Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RSC1A1	6248	broad.mit.edu	37	1	15986589	15986589	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15986589G>T	uc010obn.1	+	1	226	c.226G>T	c.(226-228)GAT>TAT	p.D76Y	DDI2_uc001awx.1_3'UTR|DDI2_uc009voj.1_3'UTR	NM_006511	NP_006502	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1,	76					negative regulation of transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	cell junction|Golgi apparatus|nucleus	ion channel inhibitor activity			ovary(1)	1		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTTTACAAGATCTTTCTGA	0.428													58	143	---	---	---	---	PASS
ALDH4A1	8659	broad.mit.edu	37	1	19209686	19209686	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19209686C>T	uc001bbb.2	-	7	886	c.610G>A	c.(610-612)GTG>ATG	p.V204M	ALDH4A1_uc010ocu.1_Missense_Mutation_p.V144M|ALDH4A1_uc001bbc.2_Missense_Mutation_p.V204M	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	204					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	ATGGCCGCCACGAAGCCCTGG	0.677													30	22	---	---	---	---	PASS
BEST4	266675	broad.mit.edu	37	1	45253092	45253092	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45253092G>A	uc001cmm.2	-	2	248	c.199C>T	c.(199-201)CGG>TGG	p.R67W		NM_153274	NP_695006	Q8NFU0	BEST4_HUMAN	bestrophin 4	67	Extracellular (Potential).					chloride channel complex|plasma membrane	chloride channel activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TTGCAGTACCGGGCCACCTGA	0.587													174	88	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93651976	93651976	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93651976G>A	uc001dpq.2	+	4	900	c.732G>A	c.(730-732)CAG>CAA	p.Q244Q		NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	126	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TTAGGCAACAGAATGCTTGTT	0.328													94	38	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99772055	99772055	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99772055A>G	uc001dse.2	+	7	1887	c.1781A>G	c.(1780-1782)AAG>AGG	p.K594R	LPPR4_uc010oue.1_Missense_Mutation_p.K536R	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	594							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AGCAGCCCCAAGAACACTGAA	0.552													15	58	---	---	---	---	PASS
IGSF3	3321	broad.mit.edu	37	1	117150836	117150836	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117150836G>A	uc001egr.1	-	5	1655	c.950C>T	c.(949-951)TCC>TTC	p.S317F	IGSF3_uc001egq.1_Missense_Mutation_p.S317F|IGSF3_uc001egs.1_5'UTR	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	317	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GAAGGCCCAGGAGACAGCAAA	0.597													21	23	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118623790	118623790	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118623790G>C	uc001ehk.2	-	15	2211	c.2143C>G	c.(2143-2145)CCT>GCT	p.P715A		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	715						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTATTATCAGGGACTGAGAGT	0.373													49	302	---	---	---	---	PASS
C1orf51	148523	broad.mit.edu	37	1	150256018	150256018	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150256018A>T	uc001euh.2	+	2	477	c.341A>T	c.(340-342)GAG>GTG	p.E114V	C1orf51_uc001eui.2_Missense_Mutation_p.E26V|C1orf51_uc001euj.2_Missense_Mutation_p.E114V	NM_144697	NP_653298	Q8N365	CA051_HUMAN	hypothetical protein LOC148523	114											0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTACCACAGAGGGAGACCTG	0.527													38	283	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165370528	165370528	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165370528A>G	uc001gda.2	-	10	1664	c.1364T>C	c.(1363-1365)ATG>ACG	p.M455T		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	455	Ligand-binding (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	GGTCTCCAACATCTCCATGAG	0.612													27	77	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167095879	167095879	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095879C>T	uc001geb.1	+	5	1511	c.1511C>T	c.(1510-1512)GCG>GTG	p.A504V		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	504					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						AGAGAGGAGGCGGCAGACAGG	0.602													11	41	---	---	---	---	PASS
TGFB2	7042	broad.mit.edu	37	1	218520394	218520394	+	Intron	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218520394G>T	uc001hlm.2	+						TGFB2_uc001hll.2_Intron|TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		CCGAAAGTAAGTACTTATTTT	0.587													3	9	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27591333	27591333	+	Intron	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27591333T>C	uc002rkb.2	-						EIF2B4_uc002rjz.2_Intron|EIF2B4_uc002rka.2_Intron|EIF2B4_uc002rkc.2_Intron|EIF2B4_uc002rkd.2_Intron|EIF2B4_uc002rke.2_Intron|EIF2B4_uc002rkf.1_3'UTR|SNX17_uc010ylj.1_5'Flank|SNX17_uc002rkg.1_5'Flank|SNX17_uc010ylk.1_5'Flank|SNX17_uc010eza.1_5'Flank|SNX17_uc002rki.1_5'Flank|SNX17_uc002rkh.1_5'Flank|SNX17_uc010yll.1_5'Flank|SNX17_uc010ylm.1_5'Flank|SNX17_uc010yln.1_5'Flank|SNX17_uc010ylo.1_5'Flank|SNX17_uc010ylp.1_5'Flank|SNX17_uc010ylq.1_5'Flank	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,						myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTAGGAACCTTGACAAAACAA	0.453													5	224	---	---	---	---	PASS
CNGA3	1261	broad.mit.edu	37	2	99013208	99013208	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99013208C>A	uc002syt.2	+	8	1992	c.1575C>A	c.(1573-1575)GGC>GGA	p.G525G	CNGA3_uc002syu.2_Silent_p.G507G|CNGA3_uc010fij.2_Silent_p.G529G	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	525	cGMP.		G -> D (in ACHM2).		signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)|upper_aerodigestive_tract(1)	6						TCAACGAGGGCAAGCTGGCCG	0.552													77	118	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136547235	136547235	+	Silent	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136547235G>T	uc002tuu.1	-	16	5480	c.5469C>A	c.(5467-5469)ATC>ATA	p.I1823I		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1823	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		ATGCTTTGGGGATCCTTGGCA	0.537													24	143	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163360948	163360948	+	Intron	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163360948C>T	uc002uch.1	-						KCNH7_uc002uci.2_Intron	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	AAAATTGTGTCCTACCTGGGT	0.358													57	278	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179633590	179633590	+	Silent	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179633590T>A	uc010zfg.1	-	38	9197	c.8973A>T	c.(8971-8973)ACA>ACT	p.T2991T	TTN_uc010zfh.1_Silent_p.T2945T|TTN_uc010zfi.1_Silent_p.T2945T|TTN_uc010zfj.1_Silent_p.T2945T|TTN_uc002unb.2_Silent_p.T2991T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2991							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATAGTTCACTGTCACCTCAA	0.388													20	97	---	---	---	---	PASS
BOLL	66037	broad.mit.edu	37	2	198650699	198650699	+	5'Flank	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198650699G>C	uc002uus.2	-						BOLL_uc002uur.2_5'Flank|BOLL_uc002uut.2_Intron|BOLL_uc010zha.1_Intron|BOLL_uc002uuu.1_5'Flank	NM_033030	NP_149019	Q8N9W6	BOLL_HUMAN	boule isoform 2						cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity			ovary(2)	2						CCTGATCGCCGTACTCACCGG	0.627													7	20	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237240050	237240050	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237240050C>T	uc002vvz.1	-	18	2507	c.2325G>A	c.(2323-2325)GCG>GCA	p.A775A	IQCA1_uc002vwb.2_Silent_p.A783A|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Silent_p.A734A	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	775							ATP binding			ovary(1)	1						TGCTGGTTATCGCCGTAATAA	0.463													57	142	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25674273	25674273	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25674273C>G	uc011awn.1	-	9	1082	c.1039G>C	c.(1039-1041)GTG>CTG	p.V347L	TOP2B_uc003cdj.2_Missense_Mutation_p.V342L	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	347					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						ACATAATCCACGTGCCGTCCA	0.318													40	81	---	---	---	---	PASS
CCBP2	1238	broad.mit.edu	37	3	42906815	42906815	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42906815C>T	uc003cme.2	+	3	1000	c.821C>T	c.(820-822)ACG>ATG	p.T274M	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmf.2_Missense_Mutation_p.T274M|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	274	Extracellular (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TTTCTGCATACGCTGTTGGAC	0.537													64	198	---	---	---	---	PASS
MON1A	84315	broad.mit.edu	37	3	49949259	49949259	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49949259C>T	uc003cxz.2	-	3	730	c.604G>A	c.(604-606)GCC>ACC	p.A202T	MON1A_uc003cya.2_Intron|MON1A_uc003cyb.2_Intron	NM_032355	NP_115731	Q86VX9	MON1A_HUMAN	MON1 homolog A isoform a	105							protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGGTCCCGGGCCACACCCGTC	0.667													44	29	---	---	---	---	PASS
ATXN7	6314	broad.mit.edu	37	3	63967989	63967989	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63967989T>C	uc003dlw.3	+	7	1433	c.880T>C	c.(880-882)TCA>CCA	p.S294P	ATXN7_uc003dlv.2_Missense_Mutation_p.S294P|ATXN7_uc010hnv.2_Missense_Mutation_p.S294P|ATXN7_uc011bfn.1_Missense_Mutation_p.S149P	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	294					cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		TAACTGCCCCTCAATACCAAA	0.507													3	48	---	---	---	---	PASS
C3orf38	285237	broad.mit.edu	37	3	88205613	88205613	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88205613T>C	uc003dqw.2	+	4	1129	c.818T>C	c.(817-819)CTG>CCG	p.L273P		NM_173824	NP_776185	Q5JPI3	CC038_HUMAN	hypothetical protein LOC285237	273					apoptosis						0		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		TTTATCAACCTGAAAATTATG	0.378													3	64	---	---	---	---	PASS
H1FOO	132243	broad.mit.edu	37	3	129270138	129270138	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129270138C>G	uc003emu.2	+	5	1001	c.996C>G	c.(994-996)ATC>ATG	p.I332M	H1FOO_uc003emv.2_Missense_Mutation_p.I193M	NM_153833	NP_722575	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	332					meiosis|nucleosome assembly	cytoplasm|nucleosome	DNA binding			skin(1)	1						GGCTGCCCATCAAGGCCTCAT	0.587													14	57	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290178	130290178	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290178G>T	uc010htl.2	+	6	2949	c.2918G>T	c.(2917-2919)GGA>GTA	p.G973V		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	973	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GAGACTTTTGGAGGTCTGAAG	0.458													41	45	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145809643	145809643	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145809643G>C	uc003evs.1	-	8	1329	c.823C>G	c.(823-825)CAG>GAG	p.Q275E	PLOD2_uc011bnm.1_Missense_Mutation_p.Q220E|PLOD2_uc003evr.1_Missense_Mutation_p.Q275E	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	275					protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	CCATTATCCTGTGTCCATGAA	0.373													7	156	---	---	---	---	PASS
ARL14	80117	broad.mit.edu	37	3	160395683	160395683	+	Silent	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160395683A>G	uc003fdq.2	+	1	736	c.549A>G	c.(547-549)GGA>GGG	p.G183G		NM_025047	NP_079323	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	183					small GTPase mediated signal transduction	intracellular	GTP binding				0			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			AATCAAGAGGAGACACTTTGG	0.483													7	381	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167254726	167254726	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167254726T>A	uc003fev.1	-	7	1136	c.830A>T	c.(829-831)AAA>ATA	p.K277I	WDR49_uc003feu.1_Missense_Mutation_p.K102I|WDR49_uc011bpd.1_Missense_Mutation_p.K341I|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	277										large_intestine(1)|ovary(1)|skin(1)	3						TATACCTCCTTTCCATTCTTC	0.388													7	219	---	---	---	---	PASS
ECT2	1894	broad.mit.edu	37	3	172491779	172491779	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172491779C>A	uc003fii.2	+	13	1560	c.1422C>A	c.(1420-1422)ATC>ATA	p.I474I	ECT2_uc010hwv.1_Silent_p.I505I|ECT2_uc003fih.2_Silent_p.I473I|ECT2_uc003fij.1_Silent_p.I474I|ECT2_uc003fik.1_Silent_p.I474I|ECT2_uc003fil.1_Silent_p.I505I	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene	474	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TTGGTAGCATCCCAGATATCT	0.323													9	365	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192517235	192517235	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192517235C>G	uc011bsp.1	-	2	737	c.416G>C	c.(415-417)CGC>CCC	p.R139P		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	139											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		GGCTGAGTGGCGCATGTCGAG	0.507													9	446	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195492215	195492215	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195492215C>T	uc011bto.1	-	10	13800	c.13340G>A	c.(13339-13341)GGC>GAC	p.G4447D	MUC4_uc003fuz.2_Missense_Mutation_p.G173D|MUC4_uc003fva.2_Missense_Mutation_p.G55D|MUC4_uc003fvb.2_Missense_Mutation_p.G91D|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.G91D|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.G55D|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.G139D|MUC4_uc011bti.1_Missense_Mutation_p.G139D|MUC4_uc011btj.1_Missense_Mutation_p.G316D|MUC4_uc011btk.1_Missense_Mutation_p.G55D|MUC4_uc011btl.1_Missense_Mutation_p.G84D|MUC4_uc011btm.1_Missense_Mutation_p.G264D|MUC4_uc011btn.1_Missense_Mutation_p.G55D|MUC4_uc003fvo.2_Missense_Mutation_p.G339D|MUC4_uc003fvp.2_Missense_Mutation_p.G288D|MUC4_uc010hzu.1_Missense_Mutation_p.G1187D	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1332	AMOP.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGGTTCCAGCCCCAGCTGGG	0.627													6	72	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42580397	42580397	+	Silent	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42580397G>T	uc003gwr.2	-	12	1240	c.1008C>A	c.(1006-1008)GGC>GGA	p.G336G	ATP8A1_uc003gws.2_Silent_p.G336G|ATP8A1_uc011byz.1_Silent_p.G336G	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	336	Extracellular (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	AATTACTAGCGCCACCATCTG	0.363													39	173	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49005780	49005780	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49005780C>A	uc003gyv.2	+	7	1013	c.831C>A	c.(829-831)TAC>TAA	p.Y277*	CWH43_uc011bzl.1_Nonsense_Mutation_p.Y250*	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	277	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						GGCTCCTTTACCTGCACACAT	0.488													34	127	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57190272	57190272	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57190272C>A	uc003hbk.2	+	10	3772	c.3381C>A	c.(3379-3381)GTC>GTA	p.V1127V	KIAA1211_uc010iha.2_Silent_p.V1120V	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1127										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CCACGCAGGTCAGTGTCAGCG	0.587													38	62	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71508698	71508698	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71508698G>A	uc011caw.1	+	9	1836	c.1555G>A	c.(1555-1557)GGG>AGG	p.G519R		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	519					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			TTTGCCCAAAGGGATTGTTTT	0.398													59	157	---	---	---	---	PASS
ARHGAP24	83478	broad.mit.edu	37	4	86852093	86852093	+	Intron	SNP	G	A	A	rs140557900	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86852093G>A	uc003hpk.2	+						ARHGAP24_uc003hpj.2_Intron|ARHGAP24_uc003hpl.2_Intron|ARHGAP24_uc010ikf.2_Intron|ARHGAP24_uc003hpm.2_Missense_Mutation_p.D4N	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GATGCCTGAAGACCGGAATTC	0.493													28	125	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170453	90170453	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170453A>T	uc003hsm.1	-	2	1328	c.809T>A	c.(808-810)CTC>CAC	p.L270H		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	270										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TTCGCTAGTGAGGGGGGTTGG	0.562													61	165	---	---	---	---	PASS
CFI	3426	broad.mit.edu	37	4	110685823	110685823	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110685823G>T	uc003hzr.3	-	3	560	c.352C>A	c.(352-354)CAT>AAT	p.H118N	CFI_uc003hzq.2_5'Flank|CFI_uc011cft.1_Missense_Mutation_p.H118N|CFI_uc003hzs.3_Missense_Mutation_p.H118N	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein	118	SRCR.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		GTATTTCCATGCTTCAAGGAA	0.318													21	68	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129964586	129964586	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129964586G>C	uc003igp.2	-	4	704	c.198C>G	c.(196-198)CAC>CAG	p.H66Q	SCLT1_uc003igq.2_Missense_Mutation_p.H66Q|SCLT1_uc010iob.1_Missense_Mutation_p.H66Q|SCLT1_uc003igr.2_Missense_Mutation_p.H66Q|SCLT1_uc003igs.2_RNA|SCLT1_uc003igt.3_Missense_Mutation_p.H66Q	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	66						centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						GTTCTCCTAGGTGTTTATCAT	0.269													9	33	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507372	155507372	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507372C>T	uc003iod.1	-	5	1267	c.1209G>A	c.(1207-1209)GCG>GCA	p.A403A	FGA_uc003ioe.1_Silent_p.A403A|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	403	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TGTTAGGCCTCGCGTTCCCAG	0.512													71	167	---	---	---	---	PASS
VEGFC	7424	broad.mit.edu	37	4	177650829	177650829	+	Silent	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177650829G>C	uc003ius.1	-	2	649	c.219C>G	c.(217-219)CTC>CTG	p.L73L		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	73					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		ATTCTGGGTAGAGTACAGTCA	0.438													26	87	---	---	---	---	PASS
SLC12A7	10723	broad.mit.edu	37	5	1073810	1073810	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1073810C>A	uc003jbu.2	-	17	2245	c.2179G>T	c.(2179-2181)GTG>TTG	p.V727L		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	727					potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	ACCGAGCCCACGATGGTCAGG	0.697													31	141	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6611197	6611197	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6611197A>T	uc003jdu.2	-	11	1162	c.1097T>A	c.(1096-1098)GTA>GAA	p.V366E	NSUN2_uc003jdt.2_Missense_Mutation_p.V130E|NSUN2_uc011cmk.1_Missense_Mutation_p.V331E|NSUN2_uc003jdv.2_Missense_Mutation_p.V130E	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	366						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TTTCGTCATTACCTGCAGAAC	0.488													132	227	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11199629	11199629	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11199629C>T	uc003jfa.1	-	11	2051	c.1906G>A	c.(1906-1908)GGT>AGT	p.G636S	CTNND2_uc010itt.2_Missense_Mutation_p.G545S|CTNND2_uc011cmy.1_Missense_Mutation_p.G299S|CTNND2_uc011cmz.1_Missense_Mutation_p.G203S|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.G203S	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	636	ARM 4.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GGGATGCCACCACAGTTTTTC	0.473													47	286	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065617	35065617	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065617G>A	uc003jjm.2	-	10	1973	c.1443C>T	c.(1441-1443)AGC>AGT	p.S481S	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Silent_p.S380S	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	481	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CAGAATGGAAGCTTTCTACCT	0.493													152	177	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39377138	39377138	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39377138C>A	uc003jlx.2	-	12	2282	c.1751G>T	c.(1750-1752)TGG>TTG	p.W584L	DAB2_uc003jlw.2_Missense_Mutation_p.W563L	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	584					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			TGTTGTTGACCAAGCATTGGG	0.552											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	74	172	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39382758	39382758	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39382758G>C	uc003jlx.2	-	10	1834	c.1303C>G	c.(1303-1305)CAA>GAA	p.Q435E	DAB2_uc003jlw.2_Missense_Mutation_p.Q414E	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	435					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			TTGGTACTTTGTGGAGGTGGG	0.498													35	264	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45462055	45462055	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45462055T>A	uc003jok.2	-	3	929	c.904A>T	c.(904-906)ATC>TTC	p.I302F		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	302	Helical; Name=Segment S5; (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ATCATGCCGATGAGATTAAAA	0.398													17	92	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140250178	140250178	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250178G>A	uc003lia.2	+	1	2348	c.1490G>A	c.(1489-1491)CGG>CAG	p.R497Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.R497Q	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	497	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGAGCGGCGGTTGGGCGAC	0.672													21	95	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147029988	147029988	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147029988C>A	uc003loq.1	-	4	1132	c.750G>T	c.(748-750)CTG>CTT	p.L250L	JAKMIP2_uc011dbx.1_Silent_p.L208L|JAKMIP2_uc003lor.1_Silent_p.L250L|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Silent_p.L250L	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	250						Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCCTTGACCAGAAAGAGTT	0.493													14	112	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176931494	176931494	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176931494C>A	uc003mhk.2	-	6	986	c.981G>T	c.(979-981)CGG>CGT	p.R327R	DOK3_uc003mhh.3_Intron|DOK3_uc003mhi.3_Intron|DOK3_uc003mhj.3_Intron|DOK3_uc003mhl.2_Silent_p.R271R	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	327	Pro-rich.					cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GAGAGGTGGCCCGTGGCAGGG	0.726													4	3	---	---	---	---	PASS
CNOT6	57472	broad.mit.edu	37	5	179996224	179996224	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179996224C>G	uc003mlx.2	+	10	1491	c.1142C>G	c.(1141-1143)TCA>TGA	p.S381*	CNOT6_uc010jld.2_Nonsense_Mutation_p.S381*|CNOT6_uc010jle.2_Nonsense_Mutation_p.S376*	NM_015455	NP_056270	Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	381					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		ATGTTCCTCTCAGAAGTGAAG	0.398													59	152	---	---	---	---	PASS
BPHL	670	broad.mit.edu	37	6	3152808	3152808	+	Nonstop_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3152808G>C	uc003mva.2	+	7	924	c.875G>C	c.(874-876)TGA>TCA	p.*292S	BPHL_uc003muz.2_RNA|BPHL_uc011dht.1_RNA|BPHL_uc003muy.2_Nonstop_Mutation_p.*275S	NM_004332	NP_004323	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like precursor	292					cellular amino acid metabolic process|response to toxin	mitochondrion	hydrolase activity				0	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TTCCTACAATGAGAATGCACA	0.438													30	131	---	---	---	---	PASS
PGK2	5232	broad.mit.edu	37	6	49753637	49753637	+	3'UTR	SNP	A	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49753637A>C	uc003ozu.2	-	1						NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2						glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					AGGAAGTAACACTATATTAAC	0.438													30	65	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56471708	56471708	+	Intron	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56471708G>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.S2036C	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACAAGTAAGAGACACAATGGC	0.438													22	124	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75831144	75831144	+	Silent	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75831144G>T	uc003phs.2	-	44	7126	c.6960C>A	c.(6958-6960)GCC>GCA	p.A2320A	COL12A1_uc003pht.2_Silent_p.A1156A	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2320					cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TATCTGCCTTGGCCCCTTTGC	0.368													17	209	---	---	---	---	PASS
PRSS35	167681	broad.mit.edu	37	6	84234198	84234198	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84234198C>T	uc003pjz.2	+	2	1201	c.1038C>T	c.(1036-1038)ACC>ACT	p.T346T	PRSS35_uc010kbm.2_Silent_p.T346T	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	346	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CGGGCTCCACCGGTTCGGGGG	0.507													37	113	---	---	---	---	PASS
ZUFSP	221302	broad.mit.edu	37	6	116966902	116966902	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116966902C>G	uc003pxf.1	-	9	1910	c.1664G>C	c.(1663-1665)GGT>GCT	p.G555A	ZUFSP_uc010kef.1_Missense_Mutation_p.G359A	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	555						intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		AGAAAGAGCACCCTCTACTGC	0.308													26	161	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127797341	127797341	+	Silent	SNP	C	A	A	rs3734449	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127797341C>A	uc003qbd.2	-	6	2695	c.1830G>T	c.(1828-1830)GTG>GTT	p.V610V	C6orf174_uc003qbc.2_5'Flank	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	610	Potential.					integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CTCTGTTCTCCACCTCCAGTT	0.612													35	182	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7476074	7476074	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7476074C>T	uc003src.1	-	23	1929	c.1812G>A	c.(1810-1812)GGG>GGA	p.G604G	COL28A1_uc011jxe.1_Silent_p.G287G|COL28A1_uc003srd.2_Silent_p.G159G|COL28A1_uc003sre.1_Silent_p.G25G	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	604					cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ATCCAGGTATCCCAGGTCCTC	0.393													55	132	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184757	19184757	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184757C>T	uc003suo.1	-	1	288	c.229G>A	c.(229-231)GAG>AAG	p.E77K	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	77	Poly-Glu.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						tcttcctcctcctcttctccg	0.373													11	36	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93055693	93055693	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93055693A>G	uc003umv.1	-	15	1763	c.1502T>C	c.(1501-1503)ATC>ACC	p.I501T	CALCR_uc011kia.1_Missense_Mutation_p.I281T|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.I467T|CALCR_uc003umw.2_Missense_Mutation_p.I467T	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	483	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	TTGCTCTATGATATTCAAAGG	0.463													11	315	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94898729	94898729	+	Intron	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94898729T>A	uc003unp.2	+						PPP1R9A_uc010lfj.2_Missense_Mutation_p.S1012T|PPP1R9A_uc011kif.1_Missense_Mutation_p.S972T|PPP1R9A_uc003unq.2_Missense_Mutation_p.S990T|PPP1R9A_uc011kig.1_Intron|PPP1R9A_uc003unr.2_Missense_Mutation_p.S63T	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)							cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GGGAGACACTTCACTGTTTTC	0.433										HNSCC(28;0.073)			79	129	---	---	---	---	PASS
SH2B2	10603	broad.mit.edu	37	7	101960886	101960886	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101960886A>T	uc011kko.1	+	6	1658	c.1613A>T	c.(1612-1614)CAC>CTC	p.H538L		NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2	495	SH2.				blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0						CGCCACTTCCACACACACCCC	0.637													8	67	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508490	106508490	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508490G>A	uc003vdv.3	+	2	569	c.484G>A	c.(484-486)GTC>ATC	p.V162I	PIK3CG_uc003vdu.2_Missense_Mutation_p.V162I|PIK3CG_uc003vdw.2_Missense_Mutation_p.V162I	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	162					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TGGCTATGACGTCACTGACGT	0.687													10	24	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143043685	143043685	+	Silent	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143043685C>G	uc003wcr.1	+	19	2385	c.2298C>G	c.(2296-2298)TCC>TCG	p.S766S	CLCN1_uc011ktc.1_Silent_p.S378S	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	766	Cytoplasmic (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					AAAGACCCTCCATCTTCCAGT	0.547													9	163	---	---	---	---	PASS
OR2A5	393046	broad.mit.edu	37	7	143747957	143747957	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143747957C>G	uc011ktw.1	+	1	463	c.463C>G	c.(463-465)CTG>GTG	p.L155V		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	155	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					TGGTTCCCTTCTGGCCCTGGT	0.532													162	338	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148815409	148815409	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148815409T>C	uc003wfj.2	-	2	123	c.50A>G	c.(49-51)TAT>TGT	p.Y17C		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	17	KRAB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TTCCGAAAAATATAAGGCCAC	0.388													81	326	---	---	---	---	PASS
KBTBD11	9920	broad.mit.edu	37	8	1950735	1950735	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1950735C>A	uc003wpw.3	+	2	2343	c.1377C>A	c.(1375-1377)ATC>ATA	p.I459I		NM_014867	NP_055682	O94819	KBTBB_HUMAN	kelch repeat and BTB (POZ) domain containing 11	459	Kelch 4.									pancreas(1)	1		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.72e-05)|READ - Rectum adenocarcinoma(644;0.0929)|COAD - Colon adenocarcinoma(149;0.134)		ACGGCGAGATCTACGTGTCCG	0.517													3	9	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	13357323	13357323	+	Silent	SNP	G	A	A	rs146650078		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13357323G>A	uc003wwm.2	-	2	702	c.258C>T	c.(256-258)GAC>GAT	p.D86D	DLC1_uc003wwn.2_Silent_p.D86D|DLC1_uc011kxy.1_Silent_p.D86D	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	86					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TGTCATTTTCGTCCACATCCT	0.443													6	406	---	---	---	---	PASS
SLC7A2	6542	broad.mit.edu	37	8	17412160	17412160	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17412160A>G	uc011kyc.1	+	7	1316	c.1147A>G	c.(1147-1149)AAA>GAA	p.K383E	SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Missense_Mutation_p.K423E|SLC7A2_uc011kyf.1_Missense_Mutation_p.K383E	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	383	Cytoplasmic (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	AATCAATTCCAAAACGAAGAC	0.418													88	141	---	---	---	---	PASS
PCM1	5108	broad.mit.edu	37	8	17851086	17851086	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17851086G>A	uc003wyi.3	+	29	5207	c.4785G>A	c.(4783-4785)CGG>CGA	p.R1595R	PCM1_uc011kyh.1_Silent_p.R1587R|PCM1_uc003wyj.3_Silent_p.R1541R|PCM1_uc011kyi.1_Silent_p.R394R|PCM1_uc011kyj.1_Silent_p.R351R|PCM1_uc003wyk.3_Silent_p.R277R|PCM1_uc011kyk.1_Silent_p.R211R	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	1595	Interaction with HAP1.				centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		AGCTGGACCGGCAAATTAAAG	0.318			T	RET|JAK2	papillary thyroid|CML|MPD								3	16	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110439365	110439365	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110439365G>A	uc003yne.2	+	25	3084	c.2980G>A	c.(2980-2982)GGA>AGA	p.G994R		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	994	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAGCACCTGCGGAAAGCAGAA	0.403										HNSCC(38;0.096)			17	59	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113303772	113303772	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113303772C>A	uc003ynu.2	-	56	9100	c.8941G>T	c.(8941-8943)GGA>TGA	p.G2981*	CSMD3_uc003yns.2_Nonsense_Mutation_p.G2183*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.G2941*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.G2812*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2981	Extracellular (Potential).|Sushi 20.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCCCATTGTCCATTTGGTTGA	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	100	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113564904	113564904	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113564904A>T	uc003ynu.2	-	26	4439	c.4280T>A	c.(4279-4281)TTA>TAA	p.L1427*	CSMD3_uc003yns.2_Nonsense_Mutation_p.L699*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.L1387*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.L1323*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1427	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCCAGGAGATAAGATTCTTCC	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			27	95	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134145775	134145775	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134145775G>C	uc003ytw.2	+	47	8100	c.8059G>C	c.(8059-8061)GAC>CAC	p.D2687H	TG_uc010mdw.2_Missense_Mutation_p.D1446H|TG_uc011ljb.1_Missense_Mutation_p.D1056H|TG_uc011ljc.1_Missense_Mutation_p.D820H	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2687					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCCTGGCCTGACTTTGTACC	0.502													29	99	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141889697	141889697	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141889697G>A	uc003yvu.2	-	4	465	c.235C>T	c.(235-237)CAT>TAT	p.H79Y	PTK2_uc003yvr.2_5'UTR|PTK2_uc003yvs.2_Missense_Mutation_p.H79Y|PTK2_uc003yvt.2_Missense_Mutation_p.H101Y|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Missense_Mutation_p.H79Y	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	79	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CAGGCCACATGCTTTACTTTG	0.438													82	400	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141889698	141889698	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141889698C>T	uc003yvu.2	-	4	464	c.234G>A	c.(232-234)AAG>AAA	p.K78K	PTK2_uc003yvr.2_5'UTR|PTK2_uc003yvs.2_Silent_p.K78K|PTK2_uc003yvt.2_Silent_p.K100K|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Silent_p.K78K	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	78	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			AGGCCACATGCTTTACTTTGT	0.438													83	396	---	---	---	---	PASS
ZNF251	90987	broad.mit.edu	37	8	145947101	145947101	+	Silent	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145947101T>C	uc003zdv.3	-	5	2200	c.1944A>G	c.(1942-1944)AAA>AAG	p.K648K		NM_138367	NP_612376	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	648					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TTAAAGCAGGTTTCTCTCCAA	0.403													24	65	---	---	---	---	PASS
IFNE	338376	broad.mit.edu	37	9	21481486	21481486	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21481486G>A	uc003zpg.2	-	1	827	c.208C>T	c.(208-210)CAG>TAG	p.Q70*	LOC554202_uc003zpe.2_Intron|LOC554202_uc003zpf.2_Intron	NM_176891	NP_795372	Q86WN2	IFNE_HUMAN	interferon, epsilon precursor	70					defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0						TGGTACTGCTGAGGACTCAAA	0.433													72	44	---	---	---	---	PASS
PGM5	5239	broad.mit.edu	37	9	71094458	71094458	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71094458C>A	uc004agr.2	+	8	1513	c.1284C>A	c.(1282-1284)CAC>CAA	p.H428Q		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	428					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						TTGGCCGCCACTACTATTGCA	0.502													22	57	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79985424	79985424	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79985424G>A	uc004akr.2	+	65	9097	c.8837G>A	c.(8836-8838)AGA>AAA	p.R2946K	VPS13A_uc004akp.3_Missense_Mutation_p.R2946K|VPS13A_uc004akq.3_Missense_Mutation_p.R2946K|VPS13A_uc004aks.2_Missense_Mutation_p.R2907K	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	2946					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CAGAAGAGAAGAGAAGCCATG	0.468													25	57	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103066024	103066024	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103066024C>A	uc004bas.2	-	14	2781	c.2566G>T	c.(2566-2568)GAG>TAG	p.E856*	TEX10_uc011lvf.1_Nonsense_Mutation_p.E695*|TEX10_uc011lvg.1_Nonsense_Mutation_p.E840*	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1	856						integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		ACAGGCAGCTCCTCAGGCCCA	0.577													58	177	---	---	---	---	PASS
LMX1B	4010	broad.mit.edu	37	9	129455586	129455586	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129455586C>G	uc004bqj.2	+	4	706	c.656C>G	c.(655-657)TCG>TGG	p.S219W	LMX1B_uc004bqi.2_Missense_Mutation_p.S219W|LMX1B_uc011maa.1_Missense_Mutation_p.S219W	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	219	Homeobox.				dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GAGGTCTCGTCGAAGCCTTGC	0.587									Nail-Patella_Syndrome				8	4	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50966569	50966569	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50966569C>A	uc001jie.2	-	2	212	c.70G>T	c.(70-72)GTC>TTC	p.V24F	OGDHL_uc009xog.2_Missense_Mutation_p.V51F|OGDHL_uc010qgt.1_Missense_Mutation_p.V24F|OGDHL_uc010qgu.1_Intron|OGDHL_uc009xoh.2_Intron	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	24					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						AACACCGGGACGTCATGTGCA	0.612													7	52	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99667794	99667794	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99667794A>T	uc001kou.1	-	6	1182	c.826T>A	c.(826-828)TTT>ATT	p.F276I	CRTAC1_uc001kov.2_Missense_Mutation_p.F265I|CRTAC1_uc001kot.1_Missense_Mutation_p.F66I	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	276						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GCGTCCACAAAGGTGCCATCG	0.627													8	46	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103901185	103901185	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103901185A>G	uc001kum.2	+	5	2959	c.2920A>G	c.(2920-2922)AGT>GGT	p.S974G	PPRC1_uc001kun.2_Missense_Mutation_p.S854G|PPRC1_uc010qqj.1_Missense_Mutation_p.S974G|PPRC1_uc009xxa.2_RNA	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	974	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTCACCTTACAGTTCCACATG	0.607													24	80	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104809514	104809514	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104809514G>A	uc001kwm.2	+	2	1796	c.1672G>A	c.(1672-1674)GAT>AAT	p.D558N	CNNM2_uc001kwn.2_Missense_Mutation_p.D558N	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	558	CBS 2.				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGGAGAAGGGGATCCATTTTA	0.368													36	149	---	---	---	---	PASS
LOC653544	653544	broad.mit.edu	37	10	135491085	135491085	+	Silent	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135491085T>A	uc010qvi.1	+	1	807	c.696T>A	c.(694-696)GGT>GGA	p.G232G		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	232						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCGGCGGGGGTCACCCTGCTC	0.741													5	31	---	---	---	---	PASS
OR51F2	119694	broad.mit.edu	37	11	4842815	4842815	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4842815G>C	uc010qyn.1	+	1	200	c.200G>C	c.(199-201)CGG>CCG	p.R67P		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	67	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTCTGTGAACGGAGCCTCCAT	0.478													55	277	---	---	---	---	PASS
OR2AG2	338755	broad.mit.edu	37	11	6789764	6789764	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6789764C>A	uc001meq.1	-	1	425	c.425G>T	c.(424-426)TGG>TTG	p.W142L		NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CACCATGATCCAGCAGACTCT	0.517													21	73	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55321900	55321900	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55321900C>G	uc010rig.1	+	1	118	c.118C>G	c.(118-120)CTA>GTA	p.L40V		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	Error:Variant_position_missing_in_Q8NGM1_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TAATTGCAGACTATACATGAT	0.383										HNSCC(20;0.049)			64	269	---	---	---	---	PASS
FAM111A	63901	broad.mit.edu	37	11	58920509	58920509	+	Silent	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58920509A>T	uc010rkp.1	+	5	1595	c.1368A>T	c.(1366-1368)CTA>CTT	p.L456L	FAM111A_uc010rkq.1_Silent_p.L456L|FAM111A_uc010rkr.1_Silent_p.L456L|FAM111A_uc001nno.2_Silent_p.L456L|FAM111A_uc001nnp.2_Silent_p.L456L|FAM111A_uc001nnq.2_Silent_p.L456L	NM_001142521	NP_001135993	Q96PZ2	F111A_HUMAN	hypothetical protein LOC63901	456					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_epithelial(135;0.139)				CTATGGAACTATATAATGGAA	0.383													50	134	---	---	---	---	PASS
RASGRP2	10235	broad.mit.edu	37	11	64507609	64507609	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64507609A>T	uc009ypu.2	-	6	625	c.398T>A	c.(397-399)GTG>GAG	p.V133E	RASGRP2_uc001oat.2_Missense_Mutation_p.V35E|RASGRP2_uc001oau.2_5'UTR|RASGRP2_uc009ypv.2_Missense_Mutation_p.V133E|RASGRP2_uc009ypw.2_Missense_Mutation_p.V133E	NM_001098671	NP_001092141	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2	133					platelet activation|Ras protein signal transduction|regulation of cell growth|regulation of small GTPase mediated signal transduction	cell junction|cytosol|ruffle membrane|synapse|synaptosome	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity				0						CCGCTGAGTCACCTGCCGCTT	0.602													24	72	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67174428	67174428	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67174428T>G	uc001ola.2	+	8	808	c.779T>G	c.(778-780)TTC>TGC	p.F260C	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_Intron|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	260	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CTGTGCCTCTTCGCCCGCTCC	0.682													123	150	---	---	---	---	PASS
ARHGEF17	9828	broad.mit.edu	37	11	73021927	73021927	+	Silent	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73021927A>G	uc001otu.2	+	1	2265	c.2244A>G	c.(2242-2244)GAA>GAG	p.E748E		NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	748					actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						CCACCTCTGAAGAGCCTACTG	0.622													17	69	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89431699	89431699	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89431699A>G	uc001pda.2	+	14	1787	c.1261A>G	c.(1261-1263)AAG>GAG	p.K421E		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	421					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GGGAGATGTGAAGAGACAGAT	0.458													102	99	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92715352	92715352	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92715352G>T	uc001pdk.1	+	2	1066	c.963G>T	c.(961-963)AGG>AGT	p.R321S		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	321	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	AATACAAGAGGATCCTCTTGG	0.532													80	319	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731718	94731718	+	Silent	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731718G>C	uc001pfe.2	+	3	2014	c.1182G>C	c.(1180-1182)GGG>GGC	p.G394G		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	394					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CCCGCAGTGGGACACGGTGCC	0.627													18	46	---	---	---	---	PASS
B3GAT1	27087	broad.mit.edu	37	11	134253790	134253790	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134253790G>A	uc001qhq.2	-	4	666	c.405C>T	c.(403-405)CGC>CGT	p.R135R	B3GAT1_uc001qhr.2_Silent_p.R135R|B3GAT1_uc010scv.1_Silent_p.R148R	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	135	Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GGCCGGTGTCGCGCAGCAGGC	0.716													3	6	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546585	11546585	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546585G>T	uc010shk.1	-	3	462	c.427C>A	c.(427-429)CCC>ACC	p.P143T		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTTGTGGGGGTGGTCCTTGT	0.592													98	470	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39763666	39763666	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39763666G>A	uc001rly.2	-	3	461	c.315C>T	c.(313-315)AAC>AAT	p.N105N	KIF21A_uc001rlx.2_Silent_p.N105N|KIF21A_uc001rlz.2_Silent_p.N105N|KIF21A_uc010skl.1_Silent_p.N105N|KIF21A_uc001rma.1_Silent_p.N105N	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	105	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CCTCAACAATGTTAACATCAA	0.338													24	88	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	45173490	45173490	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45173490T>A	uc001rog.2	-	5	1157	c.562A>T	c.(562-564)ACA>TCA	p.T188S	NELL2_uc001rof.3_Missense_Mutation_p.T187S|NELL2_uc001roh.2_Missense_Mutation_p.T188S|NELL2_uc009zkd.2_Missense_Mutation_p.T187S|NELL2_uc010skz.1_Missense_Mutation_p.T238S|NELL2_uc010sla.1_Missense_Mutation_p.T211S|NELL2_uc001roi.1_Missense_Mutation_p.T188S|NELL2_uc010slb.1_Missense_Mutation_p.T187S|NELL2_uc001roj.2_Missense_Mutation_p.T188S	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	188	TSP N-terminal.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		AGCCAAAATGTTGTGCCTAGA	0.368													25	107	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56233275	56233275	+	Intron	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56233275C>A	uc001sib.2	-						MMP19_uc001sia.2_Intron|MMP19_uc001sid.2_Intron|MMP19_uc010spw.1_Intron	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1						angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						GGGGGAGGGACTGACCATAGA	0.567													6	67	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112478342	112478342	+	Silent	SNP	T	C	C	rs112342385		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112478342T>C	uc001ttm.2	-	21	2501	c.2481A>G	c.(2479-2481)AAA>AAG	p.K827K	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.K799K|NAA25_uc009zwa.1_Silent_p.K805K	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	827						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						AGTTACCATCTTTAACTTCTA	0.289													24	100	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133215752	133215752	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133215752C>A	uc001uks.1	-	40	5555	c.5511G>T	c.(5509-5511)CTG>CTT	p.L1837L	POLE_uc001ukq.1_Silent_p.L47L|POLE_uc001ukr.1_Silent_p.L641L|POLE_uc010tbq.1_RNA	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1837					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GTGTGCGGTGCAGGGCAGGGT	0.577								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage			OREG0022269	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	88	---	---	---	---	PASS
PROZ	8858	broad.mit.edu	37	13	113819369	113819369	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113819369C>A	uc001vta.1	+	6	515	c.508C>A	c.(508-510)CAG>AAG	p.Q170K	PROZ_uc010agr.1_Missense_Mutation_p.Q192K	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	170					blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	AAATGCAGACCAGTGTGCCTG	0.522													32	26	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65253722	65253722	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65253722C>T	uc001xht.2	-	15	3015	c.2961G>A	c.(2959-2961)CTG>CTA	p.L987L	SPTB_uc001xhr.2_Silent_p.L987L|SPTB_uc001xhs.2_Silent_p.L987L|SPTB_uc001xhu.2_Silent_p.L987L	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	987	Spectrin 7.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGATACCTGCCAGGTCCCGCC	0.602													32	41	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25453266	25453266	+	Intron	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25453266G>T	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_Intron|SNORD115-22_uc001yzr.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCTGAAGAGAGGTGATGACTT	0.532													114	319	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25615718	25615718	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25615718C>A	uc001zaq.2	-	4	1612	c.1612G>T	c.(1612-1614)GTC>TTC	p.V538F	uc001zae.2_Intron|UBE3A_uc001zar.2_Missense_Mutation_p.V515F|UBE3A_uc001zas.2_Missense_Mutation_p.V535F|UBE3A_uc001zat.2_Missense_Mutation_p.V515F	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	538					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CTTACCCGGACAAGTGCATCA	0.368													47	311	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28421627	28421627	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28421627C>A	uc001zbj.2	-	63	9739	c.9633G>T	c.(9631-9633)GAG>GAT	p.E3211D		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3211	RCC1 10.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAGCTCCACACTCAATCTGGC	0.542													20	156	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294195	31294195	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294195G>C	uc001zfm.2	-	27	4770	c.4642C>G	c.(4642-4644)CTC>GTC	p.L1548V	TRPM1_uc010azy.2_Missense_Mutation_p.L1455V|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1548	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTTGACCTGAGAGATGGGAAT	0.423													193	254	---	---	---	---	PASS
MEIS2	4212	broad.mit.edu	37	15	37184663	37184663	+	Intron	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37184663G>C	uc001zjr.2	-						MEIS2_uc001zjl.2_Intron|MEIS2_uc010ucj.1_Intron|MEIS2_uc001zjm.2_Intron|MEIS2_uc001zjn.2_Intron|MEIS2_uc001zjo.2_Intron|MEIS2_uc001zjp.2_Intron|MEIS2_uc001zjs.2_Intron|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron|MEIS2_uc001zjj.2_Intron|MEIS2_uc001zjk.2_Intron	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		CTGCAAACCTGAAAATAGAGA	0.418													216	246	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42150811	42150811	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42150811C>T	uc001zos.2	-	49	8443	c.8110G>A	c.(8110-8112)GAG>AAG	p.E2704K		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2739	Spectrin 24.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGCTGCAGCTCCTGCTGTTGG	0.612													19	12	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91293049	91293049	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91293049A>T	uc002bpr.2	+	3	648	c.551A>T	c.(550-552)CAG>CTG	p.Q184L	BLM_uc010uqh.1_Missense_Mutation_p.Q184L|BLM_uc010uqi.1_5'UTR|BLM_uc010bnx.2_Missense_Mutation_p.Q184L	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	184					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AGCACTGCTCAGAAATCAAAA	0.378			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				54	75	---	---	---	---	PASS
CASKIN1	57524	broad.mit.edu	37	16	2234823	2234823	+	Nonsense_Mutation	SNP	A	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2234823A>C	uc010bsg.1	-	14	1403	c.1371T>G	c.(1369-1371)TAT>TAG	p.Y457*		NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	457	CASK-binding (By similarity).				signal transduction	cytoplasm				skin(2)	2						GCTGCTCCCCATAGACCTGCC	0.682													10	15	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20944647	20944647	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20944647C>T	uc010vbe.1	-	62	12180	c.12180G>A	c.(12178-12180)CTG>CTA	p.L4060L	DNAH3_uc010vbd.1_Silent_p.L1495L	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4060					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TGTCCTGATGCAGAAACATTG	0.517													33	206	---	---	---	---	PASS
USP31	57478	broad.mit.edu	37	16	23079455	23079455	+	Missense_Mutation	SNP	G	A	A	rs150676134		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23079455G>A	uc002dll.2	-	16	3971	c.3971C>T	c.(3970-3972)CCG>CTG	p.P1324L	USP31_uc002dlk.2_Missense_Mutation_p.P596L|USP31_uc010vca.1_Missense_Mutation_p.P627L|USP31_uc010bxm.2_Missense_Mutation_p.P612L	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	1324					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		CCTGCCACCCGGAGACGAGGG	0.502													32	156	---	---	---	---	PASS
USP31	57478	broad.mit.edu	37	16	23079989	23079989	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23079989T>C	uc002dll.2	-	16	3437	c.3437A>G	c.(3436-3438)AAG>AGG	p.K1146R	USP31_uc002dlk.2_Missense_Mutation_p.K418R|USP31_uc010vca.1_Missense_Mutation_p.K449R|USP31_uc010bxm.2_Missense_Mutation_p.K434R	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	1146	Ser-rich.				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		AGTCCTGCTCTTCCCAGGTGG	0.587													36	56	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57957294	57957294	+	Intron	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57957294C>T	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CCTGCAAAGACACAGATGTGG	0.542													19	39	---	---	---	---	PASS
ALOX15	246	broad.mit.edu	37	17	4542424	4542424	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4542424C>T	uc002fyh.2	-	3	355	c.341G>A	c.(340-342)CGC>CAC	p.R114H	ALOX15_uc010vsd.1_Missense_Mutation_p.R75H|ALOX15_uc010vse.1_Missense_Mutation_p.R136H	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	114	PLAT.				inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	GCCCACAGTGCGGCCTAGAAG	0.607													5	250	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8732154	8732154	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8732154G>A	uc002glq.1	-	11	1283	c.1043C>T	c.(1042-1044)ACG>ATG	p.T348M	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	348					platelet activation	cytosol					0						ATCAGCCCCCGTGGGAAGGTC	0.667													10	15	---	---	---	---	PASS
CDRT15	146822	broad.mit.edu	37	17	14139248	14139248	+	Silent	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14139248G>C	uc010vvu.1	-	3	492	c.492C>G	c.(490-492)CTC>CTG	p.L164L	CDRT15_uc010coq.2_RNA	NM_001007530	NP_001007531	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	164											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		TCCATGCCTGGAGGAGGAGGT	0.612													3	21	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59147363	59147363	+	Intron	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59147363C>T	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GCACGTCACCCACCTTCCGGC	0.532													26	105	---	---	---	---	PASS
CSH1	1442	broad.mit.edu	37	17	61972738	61972738	+	Intron	SNP	G	T	T	rs148091382		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61972738G>T	uc002jcs.1	-						CSH2_uc002jck.2_Intron|CSH1_uc002jcp.1_Intron|CSH1_uc002jcq.1_Intron|CSH1_uc002jcr.1_3'UTR|CSH1_uc002jct.1_Intron|CSH1_uc002jcu.1_Missense_Mutation_p.A184E|CSH1_uc002jcv.1_Intron|CSH1_uc002jcw.2_Intron|CSH1_uc002jcy.2_3'UTR	NM_001317	NP_001308	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 1 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding			skin(1)	1						TTGGGTCAGCGCCTTACTGCT	0.547									Russell-Silver_syndrome				8	245	---	---	---	---	PASS
PRKCA	5578	broad.mit.edu	37	17	64738758	64738758	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64738758C>G	uc002jfp.1	+	13	1448	c.1404C>G	c.(1402-1404)AAC>AAG	p.N468K	PRKCA_uc002jfo.1_Missense_Mutation_p.N339K	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	468	Protein kinase.				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	AGTTAGATAACGTCATGTTGG	0.448													44	268	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65908159	65908159	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65908159A>G	uc002jgf.2	+	11	4220	c.4159A>G	c.(4159-4161)AAA>GAA	p.K1387E	BPTF_uc002jge.2_Missense_Mutation_p.K1513E	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1513					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TACCACTGACAAAAAGAATAA	0.303													43	78	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67039676	67039676	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67039676T>C	uc002jhu.2	-	6	897	c.754A>G	c.(754-756)ATT>GTT	p.I252V	ABCA9_uc010dez.2_Missense_Mutation_p.I252V|ABCA9_uc002jhv.2_Missense_Mutation_p.I252V	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	252					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					AATGACGTAATGTATTGTCTT	0.328													5	237	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78363638	78363638	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78363638G>C	uc002jyh.1	+	41	9648	c.9425G>C	c.(9424-9426)AGA>ACA	p.R3142T	uc002jyi.1_Intron|RNF213_uc010dhx.1_Missense_Mutation_p.R86T	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCCTTAAACAGATGCCAGTTA	0.532													128	42	---	---	---	---	PASS
CSNK1D	1453	broad.mit.edu	37	17	80211076	80211076	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80211076C>A	uc002kej.2	-	4	697	c.381G>T	c.(379-381)CGG>CGT	p.R127R	SLC16A3_uc002kee.2_Intron|CSNK1D_uc002kef.2_Silent_p.R127R|CSNK1D_uc002kei.2_Silent_p.R127R|CSNK1D_uc010wvj.1_Intron|CSNK1D_uc010dil.2_5'Flank|CSNK1D_uc002keh.2_5'UTR|CSNK1D_uc010dim.1_5'Flank	NM_001893	NP_001884	P48730	KC1D_HUMAN	casein kinase 1, delta isoform 1	127	Protein kinase.				circadian regulation of gene expression|DNA repair|G2/M transition of mitotic cell cycle|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|regulation of circadian rhythm|Wnt receptor signaling pathway	centrosome|cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			breast(2)	2	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GCTTCACATCCCGGTGGATGA	0.567													73	398	---	---	---	---	PASS
CD226	10666	broad.mit.edu	37	18	67563247	67563247	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563247G>A	uc010dqo.2	-	3	864	c.417C>T	c.(415-417)CAC>CAT	p.H139H	CD226_uc002lkm.3_Silent_p.H139H	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor	139	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CCGAAACAATGTGGCTATTTG	0.468													13	86	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6718267	6718267	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6718267C>G	uc002mfm.2	-	3	486	c.424G>C	c.(424-426)GGC>CGC	p.G142R		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	142					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CCTGTGGAGCCAGGGGTGTAG	0.647													20	14	---	---	---	---	PASS
RLN3	117579	broad.mit.edu	37	19	14139151	14139151	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14139151C>T	uc002mxw.1	+	1	135	c.135C>T	c.(133-135)TTC>TTT	p.F45F	RLN3_uc010dzj.1_Silent_p.F45F	NM_080864	NP_543140	Q8WXF3	REL3_HUMAN	relaxin 3 preproprotein	45						extracellular region	hormone activity				0						CAGTCATCTTCACCTGCGGGG	0.647													76	39	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15132725	15132725	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15132725C>A	uc002nae.2	+	6	1344	c.1245C>A	c.(1243-1245)CTC>CTA	p.L415L		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	415					microtubule cytoskeleton organization	microtubule				ovary(1)	1						CTGCGCGCCTCGCACAGGTAA	0.617													3	38	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21909693	21909693	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21909693G>A	uc002nqi.2	-	5	1620	c.1421C>T	c.(1420-1422)GCA>GTA	p.A474V	ZNF100_uc002nqh.2_Missense_Mutation_p.A410V	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	474	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CATCTTATGTGCAGTTAGTTG	0.403													33	117	---	---	---	---	PASS
SLC7A9	11136	broad.mit.edu	37	19	33355535	33355535	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33355535C>T	uc002ntv.3	-	3	352	c.235G>A	c.(235-237)GGT>AGT	p.G79S	SLC7A9_uc002ntt.3_Intron|SLC7A9_uc002ntu.3_Missense_Mutation_p.G79S|SLC7A9_uc002ntw.3_Intron	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9	79	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GTCTCTTTACCCAGCGTCGCG	0.632													9	51	---	---	---	---	PASS
ZNF781	163115	broad.mit.edu	37	19	38160634	38160634	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38160634G>A	uc002ogy.2	-	4	1158	c.416C>T	c.(415-417)ACA>ATA	p.T139I	ZNF781_uc002ogz.2_Missense_Mutation_p.T134I	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781	139					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTCATCAGTGTGAATTTTCC	0.383													14	278	---	---	---	---	PASS
SPINT2	10653	broad.mit.edu	37	19	38778547	38778547	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38778547G>T	uc002ohr.1	+	3	640	c.309G>T	c.(307-309)AGG>AGT	p.R103S	SPINT2_uc002ohs.1_Missense_Mutation_p.R46S	NM_021102	NP_066925	O43291	SPIT2_HUMAN	serine protease inhibitor, Kunitz type, 2	103	Extracellular (Potential).				cellular component movement	cytoplasm|extracellular region|integral to membrane|soluble fraction	serine-type endopeptidase inhibitor activity				0	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCACCAGCAGGAATGCAGCGG	0.527													50	199	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41074150	41074150	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41074150C>T	uc002ony.2	+	31	7004	c.6918C>T	c.(6916-6918)AGC>AGT	p.S2306S	SPTBN4_uc002onz.2_Silent_p.S2306S|SPTBN4_uc010egx.2_Silent_p.S1049S	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2306					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGGAGTCCAGCGAACAGGAGA	0.657													4	9	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44515581	44515581	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44515581G>C	uc002oyb.1	+	5	1641	c.1390G>C	c.(1390-1392)GAT>CAT	p.D464H		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	464					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				CTTGAATCTGGATATAATTTT	0.249													13	50	---	---	---	---	PASS
ZNF224	7767	broad.mit.edu	37	19	44605048	44605048	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44605048T>C	uc002oyh.1	+	4	412	c.110T>C	c.(109-111)ATG>ACG	p.M37T		NM_013398	NP_037530	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	37	KRAB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				CGAGATGTGATGCTGGAGAAC	0.542													5	237	---	---	---	---	PASS
DMWD	1762	broad.mit.edu	37	19	46289601	46289601	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46289601C>A	uc002pdj.1	-	3	1199	c.1153G>T	c.(1153-1155)GAG>TAG	p.E385*	DMWD_uc002pdk.1_Nonsense_Mutation_p.E385*|DMWD_uc010eko.1_Nonsense_Mutation_p.E70*	NM_004943	NP_004934	Q09019	DMWD_HUMAN	dystrophia myotonica-containing WD repeat motif	385					meiosis						0		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		GTCGCCGCCTCCTCTGCCCTT	0.711													21	42	---	---	---	---	PASS
DMWD	1762	broad.mit.edu	37	19	46289602	46289602	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46289602C>A	uc002pdj.1	-	3	1198	c.1152G>T	c.(1150-1152)GAG>GAT	p.E384D	DMWD_uc002pdk.1_Missense_Mutation_p.E384D|DMWD_uc010eko.1_Missense_Mutation_p.E69D	NM_004943	NP_004934	Q09019	DMWD_HUMAN	dystrophia myotonica-containing WD repeat motif	384					meiosis						0		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		TCGCCGCCTCCTCTGCCCTTG	0.716													21	44	---	---	---	---	PASS
C19orf73	55150	broad.mit.edu	37	19	49622111	49622111	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49622111C>G	uc002pmq.3	-	1	287	c.169G>C	c.(169-171)GTG>CTG	p.V57L	PPFIA3_uc002pmr.2_5'Flank|PPFIA3_uc010yai.1_5'Flank	NM_018111	NP_060581	Q9NVV2	CS073_HUMAN	hypothetical protein LOC55150	57										large_intestine(1)	1						GCAGGCCGCACTACTGTCTGC	0.716													5	21	---	---	---	---	PASS
CST4	1472	broad.mit.edu	37	20	23666553	23666553	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23666553T>A	uc002wto.1	-	3	460	c.404A>T	c.(403-405)AAT>ATT	p.N135I		NM_001899	NP_001890	P01036	CYTS_HUMAN	cystatin S precursor	135				N -> D (in Ref. 10; AA sequence).		extracellular region	cysteine-type endopeptidase inhibitor activity			breast(1)	1	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					ACACCTGGAATTCACCAGGGA	0.567													28	70	---	---	---	---	PASS
ELMO2	63916	broad.mit.edu	37	20	44997542	44997542	+	Silent	SNP	A	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44997542A>G	uc002xrt.1	-	21	2160	c.1950T>C	c.(1948-1950)CCT>CCC	p.P650P	ELMO2_uc010zxq.1_Silent_p.P382P|ELMO2_uc002xrs.1_Silent_p.P397P|ELMO2_uc002xru.1_Silent_p.P650P|ELMO2_uc010zxr.1_Silent_p.P662P|ELMO2_uc010zxs.1_Silent_p.P467P	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	650	PH.				apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CATATTTATTAGGTGCGATGA	0.458													4	272	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45976616	45976616	+	Silent	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45976616G>A	uc002xta.1	-	2	263	c.9C>T	c.(7-9)ATC>ATT	p.I3I	ZMYND8_uc010ghr.1_Silent_p.I3I|ZMYND8_uc002xst.1_Silent_p.I3I|ZMYND8_uc002xsu.1_Silent_p.I3I|ZMYND8_uc002xsv.1_Silent_p.I3I|ZMYND8_uc002xsw.1_5'UTR|ZMYND8_uc002xsx.1_5'UTR|ZMYND8_uc002xsy.1_Silent_p.I3I|ZMYND8_uc002xsz.1_Silent_p.I3I|ZMYND8_uc010zxy.1_Silent_p.I30I|ZMYND8_uc002xtb.1_Silent_p.I23I|ZMYND8_uc002xss.2_Silent_p.I28I|ZMYND8_uc010zxz.1_Silent_p.I23I|ZMYND8_uc002xtc.1_Silent_p.I23I|ZMYND8_uc002xtd.1_Silent_p.I23I|ZMYND8_uc002xte.1_Silent_p.I3I|ZMYND8_uc010zya.1_Silent_p.I3I|ZMYND8_uc002xtf.1_Silent_p.I23I|ZMYND8_uc010ghs.1_Silent_p.I22I|ZMYND8_uc002xth.2_Silent_p.I23I	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b	3							protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			AGCGAGTAGAGATATCCATGC	0.388													35	198	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58318189	58318189	+	Missense_Mutation	SNP	G	A	A	rs143288140		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58318189G>A	uc002yau.2	+	2	613	c.146G>A	c.(145-147)CGT>CAT	p.R49H	PHACTR3_uc002yat.2_Missense_Mutation_p.R46H|PHACTR3_uc010zzw.1_Missense_Mutation_p.R8H|PHACTR3_uc002yav.2_Missense_Mutation_p.R8H|PHACTR3_uc002yaw.2_Missense_Mutation_p.R8H|PHACTR3_uc002yax.2_Missense_Mutation_p.R8H	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	49						nuclear matrix	actin binding|protein phosphatase inhibitor activity	p.R49H(1)		ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCCCCGGCGCGTCCTGAATAT	0.567													70	144	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45833791	45833791	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45833791G>T	uc002zet.1	+	21	3193	c.2980G>T	c.(2980-2982)GAG>TAG	p.E994*	TRPM2_uc002zeu.1_Nonsense_Mutation_p.E994*|TRPM2_uc002zew.1_Nonsense_Mutation_p.E994*|TRPM2_uc010gpt.1_Nonsense_Mutation_p.E994*|TRPM2_uc002zex.1_Nonsense_Mutation_p.E780*|TRPM2_uc002zey.1_Nonsense_Mutation_p.E507*	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	994	Extracellular (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CTTCAACCCGGAGCACTGCAG	0.637													146	94	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3235500	3235500	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3235500C>A	uc004crg.3	-	6	6379	c.6222G>T	c.(6220-6222)GCG>GCT	p.A2074A		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2074	Ig-like C2-type 5.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGGCAGGGGCGCAGCCTTGG	0.647													5	6	---	---	---	---	PASS
FIGF	2277	broad.mit.edu	37	X	15381379	15381379	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15381379C>T	uc004cwt.1	-	2	662	c.153G>A	c.(151-153)GAG>GAA	p.E51E		NM_004469	NP_004460	O43915	VEGFD_HUMAN	vascular endothelial growth factor D	51					angiogenesis|cell differentiation|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of mast cell chemotaxis|vascular endothelial growth factor receptor signaling pathway	extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|platelet-derived growth factor receptor binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					GAAGTAGTTCCTCCAAACTAG	0.438													28	97	---	---	---	---	PASS
PHKA2	5256	broad.mit.edu	37	X	18956828	18956828	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18956828G>A	uc004cyv.3	-	10	1388	c.958C>T	c.(958-960)CTC>TTC	p.L320F		NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	320					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					TTTTCGAAGAGCTTGAGTTCA	0.383													8	143	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19380917	19380917	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19380917C>T	uc004czk.1	-	27	3680	c.2043G>A	c.(2041-2043)CGG>CGA	p.R681R	MAP3K15_uc004czj.1_Silent_p.R641R|MAP3K15_uc004czi.1_Silent_p.R140R	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	1206	Potential.						ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					CTAGAGTTTGCCGCAGAAGAT	0.333													5	223	---	---	---	---	PASS
GLOD5	392465	broad.mit.edu	37	X	48624360	48624360	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48624360G>T	uc011mmh.1	+	2	225	c.184G>T	c.(184-186)GAG>TAG	p.E62*	GLOD5_uc004dko.1_Nonsense_Mutation_p.E62*	NM_001080489	NP_001073958			glyoxalase domain containing 5												0						CCTGGGCATGGAGGTCATGAC	0.423													3	29	---	---	---	---	PASS
SLC35A2	7355	broad.mit.edu	37	X	48761911	48761911	+	Intron	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48761911C>A	uc004dlo.1	-						SLC35A2_uc011mml.1_3'UTR|SLC35A2_uc004dlp.1_3'UTR|SLC35A2_uc011mmm.1_3'UTR|SLC35A2_uc011mmn.1_3'UTR|SLC35A2_uc004dlr.1_3'UTR|SLC35A2_uc004dlq.2_Missense_Mutation_p.G229C	NM_005660	NP_005651	P78381	S35A2_HUMAN	solute carrier family 35, member A2 isoform a						galactose metabolic process	Golgi membrane|integral to membrane|nucleus	sugar:hydrogen symporter activity|UDP-galactose transmembrane transporter activity			breast(1)	1						CCAGAGGAGCCAGGCCCCGGA	0.622													3	13	---	---	---	---	PASS
ZNF711	7552	broad.mit.edu	37	X	84502615	84502615	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84502615C>G	uc004eeo.2	+	3	384	c.37C>G	c.(37-39)CCA>GCA	p.P13A	ZNF711_uc004eep.2_Missense_Mutation_p.P13A|ZNF711_uc004eeq.2_Missense_Mutation_p.P13A	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	13					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						ATTGCACACGCCAGACTCTAG	0.328													51	228	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99551335	99551335	+	Silent	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99551335C>A	uc010nmz.2	-	6	5063	c.3387G>T	c.(3385-3387)CTG>CTT	p.L1129L	PCDH19_uc004efw.3_Silent_p.L1081L|PCDH19_uc004efx.3_Silent_p.L1082L	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	1129	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GACCTTCCTTCAGAATGGGGC	0.502													72	313	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101096499	101096499	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101096499G>T	uc011mrk.1	-	6	632	c.272C>A	c.(271-273)CCC>CAC	p.P91H	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	91	RRM.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						CACAGAGTAGGGCGCAGTAAA	0.473													34	139	---	---	---	---	PASS
IRS4	8471	broad.mit.edu	37	X	107977874	107977874	+	Silent	SNP	C	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107977874C>T	uc004eoc.2	-	1	1734	c.1701G>A	c.(1699-1701)GGG>GGA	p.G567G		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	567						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						CTGAGCCATGCCCACCTCCAG	0.637													6	386	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299305	125299305	+	Silent	SNP	G	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299305G>C	uc004euk.1	-	1	630	c.603C>G	c.(601-603)GCC>GCG	p.A201A		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	201	WD 2.									lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CACTCAGCCAGGCGACTGCGA	0.642													12	81	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337261	144337261	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337261C>A	uc004fcb.2	+	2	146	c.146C>A	c.(145-147)TCA>TAA	p.S49*		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	49											0	Acute lymphoblastic leukemia(192;6.56e-05)					TCAGAATATTCAACAGTATTA	0.428													54	168	---	---	---	---	PASS
SLC6A8	6535	broad.mit.edu	37	X	152959803	152959803	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152959803G>T	uc004fib.3	+	10	1675	c.1397G>T	c.(1396-1398)GGG>GTG	p.G466V	SLC6A8_uc004fic.3_Missense_Mutation_p.G456V|SLC6A8_uc011myx.1_Missense_Mutation_p.G351V|SLC6A8_uc010nuj.2_RNA	NM_005629	NP_005620	P48029	SC6A8_HUMAN	solute carrier family 6 member 8 isoform 1	466	Extracellular (Potential).				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CCCCAGGGCGGGATGTACGTC	0.632													44	164	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153589928	153589928	+	Silent	SNP	A	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153589928A>T	uc004fkk.2	-	21	3204	c.2955T>A	c.(2953-2955)GTT>GTA	p.V985V	FLNA_uc010nuu.1_Silent_p.V985V	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	985	Filamin 8.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTCTTTGCCAACGTCCACCT	0.562													37	128	---	---	---	---	PASS
MEAF6	64769	broad.mit.edu	37	1	37961307	37961308	+	Intron	INS	-	C	C			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37961307_37961308insC	uc001cbg.1	-						MEAF6_uc001cbd.1_Intron|MEAF6_uc001cbe.1_Intron|MEAF6_uc009vvd.1_Intron|MEAF6_uc001cbf.1_Intron	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						acaaaaaacaaaaaaaaaaaaa	0.163													10	7	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86211200	86211201	+	Intron	INS	-	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86211200_86211201insA	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGTGTAAAACAAAACCATTTG	0.347													59	92	---	---	---	---	
RGS16	6004	broad.mit.edu	37	1	182569291	182569292	+	3'UTR	INS	-	TT	TT	rs10649643		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182569291_182569292insTT	uc001gpl.3	-	5						NM_002928	NP_002919	O15492	RGS16_HUMAN	regulator of G-protein signalling 16						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(1)	1						GCTGGAGCGCAttttttttttt	0.515													3	3	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766800	206766803	+	Intron	DEL	GAGA	-	-	rs71570017		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766800_206766803delGAGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			AAACTAAATGgagagagagagaga	0.196													4	2	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236572369	236572369	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236572369delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			cctatttcttaaaaaaaaaaa	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65738847	65738847	+	Intron	DEL	T	-	-	rs111377658		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65738847delT	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		ttttTTGAAATTTTTTTTTTT	0.159													6	3	---	---	---	---	
TMPRSS7	344805	broad.mit.edu	37	3	111774313	111774314	+	Intron	INS	-	AC	AC	rs774772	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111774313_111774314insAC	uc010hqb.2	+						TMPRSS7_uc011bhr.1_Intron	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7						proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						cacacacacagacacacacaca	0.183													4	2	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113186746	113186751	+	Intron	DEL	TAATTA	-	-	rs71917202		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113186746_113186751delTAATTA	uc003eag.3	-						CCDC52_uc003eaf.3_Intron|CCDC52_uc003eah.1_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						TTTACCCTACTAATTATAATTTGCTA	0.282													2	4	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305689	21305692	+	Intron	DEL	AGAC	-	-	rs33955327	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305689_21305692delAGAC	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				agagagagagagacagagagagag	0.191													6	3	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123230649	123230662	+	Intron	DEL	TAGAACTTAAAAAA	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123230649_123230662delTAGAACTTAAAAAA	uc003ieh.2	+						KIAA1109_uc003iel.1_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ATATACAGTTTAGAACTTAAAAAATAAAACATTA	0.318													65	28	---	---	---	---	
RPS3A	6189	broad.mit.edu	37	4	152025591	152025592	+	Intron	INS	-	TTT	TTT	rs13111229		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152025591_152025592insTTT	uc003ilz.2	+							NM_001006	NP_000997	P61247	RS3A_HUMAN	ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)					CAGttttttggttttttttttt	0.401													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1192226	1192226	+	IGR	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1192226delA								SLC12A7 (80054 upstream) : SLC6A19 (9484 downstream)																							gctgaggagtagggggagatg	0.010													7	5	---	---	---	---	
DND1	373863	broad.mit.edu	37	5	140052285	140052285	+	Frame_Shift_Del	DEL	T	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140052285delT	uc003lgt.2	-	3	393	c.349delA	c.(349-351)ACGfs	p.T117fs		NM_194249	NP_919225	Q8IYX4	DND1_HUMAN	dead end homolog 1	117	RRM 1.				multicellular organismal development|negative regulation of gene silencing by miRNA	cytoplasm|nucleus	AU-rich element binding|nucleotide binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTGCAGCGTGGCGATGGCG	0.682													8	4	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154287016	154287017	+	Intron	INS	-	GAAAAAAAA	GAAAAAAAA	rs145860358	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154287016_154287017insGAAAAAAAA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAATAAAGCTTAACAAAAAAAA	0.356													3	3	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27491130	27491131	+	IGR	DEL	TC	-	-	rs71706046	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27491130_27491131delTC								ZNF184 (50233 upstream) : HIST1H2BL (284127 downstream)																							tgtgtgtgtgtctgtgtgtgtg	0.025													5	4	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70609057	70609058	+	Intron	INS	-	TT	TT	rs112888229		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70609057_70609058insTT	uc003pfc.1	+							NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						Attctttttaattttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92356678	92356678	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92356678delA	uc003pod.2	-											Homo sapiens cDNA clone IMAGE:5284581.																		aattttagccAAAAAAAAAAA	0.045													4	2	---	---	---	---	
STAG3L2	442582	broad.mit.edu	37	7	74303583	74303592	+	Intron	DEL	ACAGAAAGAG	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74303583_74303592delACAGAAAGAG	uc003ubj.3	-						STAG3L2_uc011kfj.1_Intron	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like							nucleus	binding				0						agcctgggcaacagaaagagactgtctcaa	0.119													4	3	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104681592	104681592	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104681592delA	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						TTTTTAAAGTAAAAAAAAAAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114529132	114529133	+	IGR	INS	-	TTCC	TTCC			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114529132_114529133insTTCC								FOXP2 (198040 upstream) : MDFIC (33076 downstream)																							gtggattttgattccttccttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7679341	7679342	+	IGR	INS	-	A	A			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7679341_7679342insA								FAM90A7 (262107 upstream) : SPAG11A (26060 downstream)																							gactccttctcaaaaaaaaaaa	0.074													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																							cttccttccttcctccctccct	0.124													11	5	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135602974	135602976	+	Intron	DEL	CAA	-	-	rs146800539		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135602974_135602976delCAA	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			ccaccaccaccaacaccaccacc	0.000													4	2	---	---	---	---	
FANCC	2176	broad.mit.edu	37	9	98009495	98009496	+	Intron	DEL	GT	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98009495_98009496delGT	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				gcgtgcacgcgtgtgtgtgtgt	0.287			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	3	---	---	---	---	
SEC61B	10952	broad.mit.edu	37	9	101990074	101990075	+	Intron	INS	-	T	T	rs111986989		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990074_101990075insT	uc004azh.2	+							NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGCAAAGAAAGTTTTTTTTTTT	0.302													5	3	---	---	---	---	
AKR1C2	1646	broad.mit.edu	37	10	5045396	5045397	+	Intron	INS	-	T	T	rs71929051		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5045396_5045397insT	uc010qan.1	-						AKR1E2_uc001ihl.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C2_uc009xhy.2_Intron|AKR1C2_uc001ihs.2_Intron|AKR1C2_uc001iht.2_Intron|AKR1C2_uc010qao.1_Intron	NM_205845	NP_995317	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2						digestion|prostaglandin metabolic process|steroid metabolic process	cytoplasm	androsterone dehydrogenase (A-specific) activity|bile acid binding|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0					NADH(DB00157)|Ursodeoxycholic acid(DB01586)	TTTGGTTCTAGTTTTTTTTTTT	0.287													3	3	---	---	---	---	
UCP3	7352	broad.mit.edu	37	11	73712720	73712721	+	Intron	INS	-	T	T	rs140851461	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73712720_73712721insT	uc001our.2	-							NM_003356	NP_003347	P55916	UCP3_HUMAN	uncoupling protein 3 isoform UCP3L						mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)					CTCTCTCTCTCTTTTTTTTTTC	0.356													6	3	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89868964	89868965	+	Intron	INS	-	T	T	rs34639551		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89868964_89868965insT	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Intron|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TAGTCATCAACTTTTTTTTTTT	0.307													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90671347	90671348	+	IGR	INS	-	G	G			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90671347_90671348insG								MIR1261 (68977 upstream) : None (None downstream)																							aaaggaaagaagaaagaaggaa	0.243													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2547523	2547525	+	Intron	DEL	TAA	-	-	rs61537036		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2547523_2547525delTAA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	atggtggtggtaatgatggtggt	0.059													4	2	---	---	---	---	
CHD4	1108	broad.mit.edu	37	12	6682042	6682042	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6682042delA	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						CCATCTCTTTAAAAAAAAAAA	0.244													4	2	---	---	---	---	
TROAP	10024	broad.mit.edu	37	12	49719150	49719150	+	Intron	DEL	A	-	-	rs111795391		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49719150delA	uc001rtx.3	+						TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						tctatttcttaaaaaaaaaaa	0.199													4	3	---	---	---	---	
ATP6V0A2	23545	broad.mit.edu	37	12	124205737	124205738	+	Intron	INS	-	TGTTT	TGTTT	rs142454152	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124205737_124205738insTGTTT	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		ATGAATCTAGGtgttttgtttt	0.312													7	4	---	---	---	---	
PRPF39	55015	broad.mit.edu	37	14	45565499	45565500	+	Intron	DEL	TT	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45565499_45565500delTT	uc001wvz.3	+						PRPF39_uc001wvy.3_Intron|PRPF39_uc010and.2_5'UTR	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog						mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						AAAACAAAGAtttttttttttt	0.332													7	5	---	---	---	---	
EIF2B2	8892	broad.mit.edu	37	14	75471393	75471405	+	Intron	DEL	TTTTTTTTTTTTT	-	-	rs369376		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75471393_75471405delTTTTTTTTTTTTT	uc001xrc.1	+							NM_014239	NP_055054	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B,						cellular response to stimulus|myelination|oligodendrocyte development|ovarian follicle development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	ATP binding|GTP binding|protein binding|translation initiation factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00661)		tatatatatattttttttttttttttttttttt	0.352													4	2	---	---	---	---	
PKM2	5315	broad.mit.edu	37	15	72498895	72498895	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72498895delA	uc002atx.1	-						PKM2_uc002ats.1_Intron|PKM2_uc002att.1_Intron|PKM2_uc002atu.1_Intron|PKM2_uc010bit.1_Intron|PKM2_uc010uki.1_Intron|PKM2_uc002atv.1_Intron|PKM2_uc002atw.1_Intron|PKM2_uc002aty.1_Intron|PKM2_uc010ukj.1_Intron|PKM2_uc010ukk.1_Intron|PKM2_uc010biu.1_Intron|PKM2_uc002atz.1_Intron	NM_182471	NP_872271	P14618	KPYM_HUMAN	pyruvate kinase, muscle isoform M1						glycolysis|programmed cell death	cytosol|nucleus|plasma membrane	ATP binding|magnesium ion binding|potassium ion binding|protein binding|pyruvate kinase activity			breast(1)	1					Pyruvic acid(DB00119)	AGAACAGGAGAAAAAAAAAAG	0.493													5	3	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81665211	81665212	+	Intron	INS	-	GTGTGT	GTGTGT	rs137855296	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81665211_81665212insGTGTGT	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						tgtgtttgtgcgtgtgtgtgtg	0.332													7	4	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700254	14700255	+	Intron	DEL	GA	-	-	rs113976422		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700254_14700255delGA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						gaccctgagggaaaaaaaaaaa	0.139													4	2	---	---	---	---	
VPS53	55275	broad.mit.edu	37	17	456813	456813	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:456813delA	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		aattccatacacttttttttt	0.095													4	2	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7577145	7577146	+	Frame_Shift_Ins	INS	-	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577145_7577146insT	uc002gim.2	-	8	986_987	c.792_793insA	c.(790-795)CTACTGfs	p.L264fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Ins_p.L264fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Ins_p.L132fs|TP53_uc010cng.1_Frame_Shift_Ins_p.L132fs|TP53_uc002gii.1_Frame_Shift_Ins_p.L132fs|TP53_uc010cnh.1_Frame_Shift_Ins_p.L264fs|TP53_uc010cni.1_Frame_Shift_Ins_p.L264fs|TP53_uc002gij.2_Frame_Shift_Ins_p.L264fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	264_265	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		L -> M (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.L264L(5)|p.L264fs*81(4)|p.?(4)|p.L264del(4)|p.L265M(4)|p.L265fs*80(3)|p.L264I(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.L265del(2)|p.264_265insSSGNL(1)|p.E258fs*71(1)|p.L265fs*81(1)|p.G262fs*2(1)|p.L264V(1)|p.L264P(1)|p.L264R(1)|p.S261_L264>R(1)|p.L265_R267delLGR(1)|p.L265_K305del41(1)|p.L265L(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCGTCCCAGTAGATTACCAC	0.515		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			17	15	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21312637	21312638	+	Intron	INS	-	TGT	TGT	rs143247012		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21312637_21312638insTGT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aggagACTTGGTGTGGGGCATC	0.312										Prostate(3;0.18)			10	7	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62076856	62076857	+	Intron	INS	-	CCCCAAAGGG	CCCCAAAGGG	rs138698925	by1000genomes	TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076856_62076857insCCCCAAAGGG	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GCAAGCTGACCCCCCCACCCCT	0.678													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114442	11114442	+	IGR	DEL	A	-	-	rs5842456		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114442delA								BAGE (15505 upstream) : None (None downstream)																							TGCTTAGGTTAAATTTTTTTT	0.289													5	5	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45499777	45499777	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45499777delA	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc011afa.1_5'Flank	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTAGTAACTTAAAAAAAAAAA	0.388													7	4	---	---	---	---	
GCAT	23464	broad.mit.edu	37	22	38209774	38209775	+	Intron	INS	-	T	T			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38209774_38209775insT	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	gagcattattcttttttttttt	0.000													4	2	---	---	---	---	
ACSL4	2182	broad.mit.edu	37	X	108911122	108911122	+	Intron	DEL	A	-	-			TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108911122delA	uc004eoi.2	-						ACSL4_uc004eoj.2_Intron|ACSL4_uc004eok.2_Intron|ACSL4_uc010npp.1_Intron	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4						fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	actccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122772579	122772580	+	Intron	DEL	AC	-	-	rs35181346		TCGA-60-2711-01A-01D-1522-08	TCGA-60-2711-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772579_122772580delAC	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						acacacacgtacacacacacac	0.139													5	6	---	---	---	---	
