Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DFFB	1677	broad.mit.edu	37	1	3800204	3800204	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3800204T>A	uc001alc.2	+	7	1239	c.916T>A	c.(916-918)TGC>AGC	p.C306S	DFFB_uc001ale.2_RNA|DFFB_uc009vlp.2_RNA|DFFB_uc001alb.2_RNA|DFFB_uc010nzn.1_Missense_Mutation_p.C330S|DFFB_uc009vlq.2_RNA|DFFB_uc009vlr.2_Missense_Mutation_p.C257S|DFFB_uc001ald.2_Missense_Mutation_p.C242S	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta	306					apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GCACATTGTCTGCCATAAGAA	0.473													103	34	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27100389	27100389	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27100389G>A	uc001bmv.1	+	17	4474	c.4101G>A	c.(4099-4101)CAG>CAA	p.Q1367Q	ARID1A_uc001bmt.1_Silent_p.Q1366Q|ARID1A_uc001bmu.1_Silent_p.Q1367Q|ARID1A_uc001bmw.1_Silent_p.Q984Q|ARID1A_uc001bmx.1_Silent_p.Q213Q|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1367	Gln-rich.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGCAACAGCAGGTGAGGAGGG	0.483			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								98	39	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44070953	44070953	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44070953G>T	uc001cjr.2	+	18	3568	c.3228G>T	c.(3226-3228)GTG>GTT	p.V1076V	PTPRF_uc001cjs.2_Silent_p.V1067V|PTPRF_uc001cju.2_Silent_p.V454V|PTPRF_uc009vwt.2_Silent_p.V636V|PTPRF_uc001cjv.2_Silent_p.V536V|PTPRF_uc001cjw.2_Silent_p.V302V	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1076	Extracellular (Potential).|Fibronectin type-III 8.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACTCGTTTGTGCTGATGAACC	0.632													57	19	---	---	---	---	PASS
IL12RB2	3595	broad.mit.edu	37	1	67816672	67816672	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67816672C>T	uc001ddu.2	+	9	1798	c.1158C>T	c.(1156-1158)GTC>GTT	p.V386V	IL12RB2_uc010oqi.1_Silent_p.V386V|IL12RB2_uc010oqj.1_Silent_p.V386V|IL12RB2_uc010oqk.1_RNA|IL12RB2_uc010oql.1_Silent_p.V386V|IL12RB2_uc010oqm.1_Silent_p.V386V|IL12RB2_uc010oqn.1_RNA	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor	386	Fibronectin type-III 3.|Extracellular (Potential).				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						GGACCACAGTCATTCCTAGAA	0.493													86	24	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038477	75038477	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038477C>A	uc001dgg.2	-	14	3136	c.2917G>T	c.(2917-2919)GCA>TCA	p.A973S		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	973	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CCAAGAATTGCCTCTTCAGAA	0.517													48	18	---	---	---	---	PASS
CDC7	8317	broad.mit.edu	37	1	91979565	91979565	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91979565C>T	uc001doe.2	+	8	1048	c.883C>T	c.(883-885)CAC>TAC	p.H295Y	CDC7_uc001dof.2_Missense_Mutation_p.H295Y|CDC7_uc010osw.1_Missense_Mutation_p.H267Y|CDC7_uc009wdc.2_Missense_Mutation_p.H295Y|CDC7_uc009wdd.2_5'Flank	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7	295	Protein kinase.				cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		TTTCAATATACACAGCTCCAT	0.373													36	18	---	---	---	---	PASS
S1PR1	1901	broad.mit.edu	37	1	101704795	101704795	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101704795C>A	uc001dud.2	+	2	769	c.255C>A	c.(253-255)GGC>GGA	p.G85G	S1PR1_uc009weg.2_Silent_p.G85G	NM_001400	NP_001391	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	85	Helical; Name=2; (By similarity).				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)	3						ATTTTATTGGCAATCTGGCCC	0.493											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	50	27	---	---	---	---	PASS
HSD3B2	3284	broad.mit.edu	37	1	119964499	119964499	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119964499A>G	uc001ehs.2	+	3	1148	c.375A>G	c.(373-375)ATA>ATG	p.I125M	HSD3B2_uc001eht.2_Missense_Mutation_p.I125M|HSD3B2_uc001ehu.2_Intron	NM_000198	NP_000189	P26439	3BHS2_HUMAN	3 beta-hydroxysteroid dehydrogenase 2	125					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	CCAGTAGCATAGAGGTAGCCG	0.537													101	29	---	---	---	---	PASS
TDRKH	11022	broad.mit.edu	37	1	151751235	151751235	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151751235G>A	uc009wnb.1	-	6	991	c.809C>T	c.(808-810)TCC>TTC	p.S270F	TDRKH_uc001eyy.2_Missense_Mutation_p.S46F|TDRKH_uc001ezb.3_Missense_Mutation_p.S266F|TDRKH_uc001ezc.3_Missense_Mutation_p.S225F|TDRKH_uc001eza.3_Missense_Mutation_p.S270F|TDRKH_uc001ezd.3_Missense_Mutation_p.S270F|TDRKH_uc010pdn.1_Missense_Mutation_p.S46F	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	270							RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTCTCCCAGGAACCTTCCTT	0.517													39	68	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152081071	152081071	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152081071C>G	uc001ezp.2	-	2	4622	c.4622G>C	c.(4621-4623)CGC>CCC	p.R1541P	TCHH_uc009wne.1_Missense_Mutation_p.R1541P	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1541	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTGGCGGCGCAGCTGCTG	0.622													22	25	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155931629	155931629	+	Nonsense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155931629C>A	uc001fmt.2	-	11	1409	c.1291G>T	c.(1291-1293)GAG>TAG	p.E431*	ARHGEF2_uc001fmr.2_Nonsense_Mutation_p.E403*|ARHGEF2_uc001fms.2_Nonsense_Mutation_p.E430*|ARHGEF2_uc001fmu.2_Nonsense_Mutation_p.E475*|ARHGEF2_uc010pgt.1_Nonsense_Mutation_p.E404*|ARHGEF2_uc010pgu.1_Nonsense_Mutation_p.E476*	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	431	DH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TAAATACCCTCGTCCACATTG	0.632													4	162	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158631100	158631100	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158631100C>T	uc001fst.1	-	18	2763	c.2564G>A	c.(2563-2565)AGG>AAG	p.R855K		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	855	Spectrin 9.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTTGTTTCCCCTTTCTGTTAT	0.418													113	197	---	---	---	---	PASS
AIM2	9447	broad.mit.edu	37	1	159043275	159043275	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159043275G>T	uc001ftj.1	-	2	260	c.15C>A	c.(13-15)TAC>TAA	p.Y5*		NM_004833	NP_004824	O14862	AIM2_HUMAN	absent in melanoma 2	5	DAPIN.				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus				ovary(2)|pancreas(1)	3	all_hematologic(112;0.0429)					GTATCTCCTTGTATTTACTCT	0.378													99	155	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160261286	160261286	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160261286T>C	uc009wti.2	-	31	3653	c.3259A>G	c.(3259-3261)ATG>GTG	p.M1087V	COPA_uc001fvv.3_Missense_Mutation_p.M1096V	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	1087					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TAGGCTGCCATCTGGTGGACA	0.458											OREG0013929	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	44	---	---	---	---	PASS
DPT	1805	broad.mit.edu	37	1	168698149	168698149	+	Silent	SNP	C	G	G	rs79594970	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168698149C>G	uc001gfp.2	-	1	280	c.264G>C	c.(262-264)ACG>ACC	p.T88T		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	88	2 X 53-55 AA tandem repeats.|1-2.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					ACCAGCACTCCGTGGGTTCCC	0.587													47	113	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171509342	171509342	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171509342C>T	uc010pmg.1	+	16	2997	c.2731C>T	c.(2731-2733)CGG>TGG	p.R911W	BAT2L2_uc010pmh.1_5'UTR	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	911							protein C-terminus binding				0						TCAAGAGGAGCGGATTTCAGC	0.453													33	54	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196205139	196205139	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196205139G>A	uc001gtd.1	-	27	3333	c.3273C>T	c.(3271-3273)ACC>ACT	p.T1091T	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.T1024T|KCNT2_uc001gtf.1_Silent_p.T1067T|KCNT2_uc001gtg.1_RNA	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1091	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						GCTCTATTCTGGTATCTGGAG	0.313													180	293	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196953257	196953257	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196953257C>T	uc001gts.3	+	3	548	c.420C>T	c.(418-420)TGC>TGT	p.C140C		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	140	Sushi 2.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						CTCCCATATGCAGCTTCACTA	0.308													52	101	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201187690	201187690	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201187690G>A	uc001gwc.2	+	7	2054	c.1282G>A	c.(1282-1284)GGC>AGC	p.G428S	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						CGTGCGGCAGGGCTGTCAGTA	0.627													19	25	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415226	213415226	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415226G>C	uc010ptr.1	+	11	2566	c.2407G>C	c.(2407-2409)GGA>CGA	p.G803R	RPS6KC1_uc001hkd.2_Missense_Mutation_p.G791R|RPS6KC1_uc010pts.1_Missense_Mutation_p.G591R|RPS6KC1_uc010ptt.1_Missense_Mutation_p.G591R|RPS6KC1_uc010ptu.1_Missense_Mutation_p.G622R|RPS6KC1_uc010ptv.1_Missense_Mutation_p.G338R|RPS6KC1_uc001hke.2_Missense_Mutation_p.G622R	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	803	ATP (By similarity).|Protein kinase 2.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TCAAGGACTTGGAGTGGTTGA	0.418													75	123	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214830428	214830428	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214830428A>G	uc001hkm.2	+	18	8812	c.8638A>G	c.(8638-8640)ATG>GTG	p.M2880V		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	2976	Potential.|Sufficient for nuclear localization.|Sufficient for centromere localization.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGCTAAAGAGATGTTAGAGAC	0.418													90	138	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215824074	215824074	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215824074G>T	uc001hku.1	-	65	14590	c.14203C>A	c.(14203-14205)CCA>ACA	p.P4735T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4735	Fibronectin type-III 33.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGACCTTCTGGTGGGGCTGGC	0.547										HNSCC(13;0.011)			127	206	---	---	---	---	PASS
C1orf55	163859	broad.mit.edu	37	1	226176080	226176080	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226176080C>G	uc001hpu.3	-	6	704	c.651G>C	c.(649-651)ATG>ATC	p.M217I	C1orf55_uc001hpv.2_Missense_Mutation_p.M217I	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859	217										lung(1)	1	Breast(184;0.197)					CTAGTCCCTCCATGCCCAACC	0.378													30	48	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236902788	236902788	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236902788A>T	uc001hyf.2	+	10	1267	c.1063A>T	c.(1063-1065)AGC>TGC	p.S355C	ACTN2_uc001hyg.2_Missense_Mutation_p.S147C|ACTN2_uc009xgi.1_Missense_Mutation_p.S355C|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Missense_Mutation_p.S43C	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	355	Spectrin 1.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GCTGCGGATCAGCAACCGTCC	0.607													24	48	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236902789	236902789	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236902789G>T	uc001hyf.2	+	10	1268	c.1064G>T	c.(1063-1065)AGC>ATC	p.S355I	ACTN2_uc001hyg.2_Missense_Mutation_p.S147I|ACTN2_uc009xgi.1_Missense_Mutation_p.S355I|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Missense_Mutation_p.S43I	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	355	Spectrin 1.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CTGCGGATCAGCAACCGTCCT	0.602													24	46	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237995872	237995872	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237995872G>T	uc001hyl.1	+	105	14949	c.14829G>T	c.(14827-14829)ATG>ATT	p.M4943I	RYR2_uc010pyb.1_3'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4943					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTGGAAGATGTATCAAGAAA	0.378													23	40	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752419	247752419	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752419T>A	uc010pyy.1	+	1	758	c.758T>A	c.(757-759)ATC>AAC	p.I253N		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			gtggtcaccatcttttatgga	0.408													58	83	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248262842	248262842	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248262842C>A	uc001ids.2	+	3	502	c.165C>A	c.(163-165)CAC>CAA	p.H55Q		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTCGTCTCCACACACCGATGT	0.517													92	144	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436680	248436680	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436680C>A	uc010pzi.1	-	1	437	c.437G>T	c.(436-438)TGT>TTT	p.C146F		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGGAGCCAACACGACATGGT	0.577													58	229	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33623484	33623484	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33623484A>G	uc002ros.2	+	34	5041	c.5041A>G	c.(5041-5043)AAG>GAG	p.K1681E	LTBP1_uc002rot.2_Missense_Mutation_p.K1355E|LTBP1_uc002rou.2_Missense_Mutation_p.K1354E|LTBP1_uc002rov.2_Missense_Mutation_p.K1301E|LTBP1_uc010ymz.1_Missense_Mutation_p.K1312E|LTBP1_uc010yna.1_Missense_Mutation_p.K1259E|LTBP1_uc010ynb.1_Missense_Mutation_p.K578E	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1680	EGF-like 18; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CAAGAATGCCAAGTGCATTAA	0.443													32	83	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33623567	33623567	+	Silent	SNP	G	A	A	rs138835287	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33623567G>A	uc002ros.2	+	34	5124	c.5124G>A	c.(5122-5124)CCG>CCA	p.P1708P	LTBP1_uc002rot.2_Silent_p.P1382P|LTBP1_uc002rou.2_Silent_p.P1381P|LTBP1_uc002rov.2_Silent_p.P1328P|LTBP1_uc010ymz.1_Silent_p.P1339P|LTBP1_uc010yna.1_Silent_p.P1286P|LTBP1_uc010ynb.1_Silent_p.P605P	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1707					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACTGCACTCCGTTGAATACCG	0.458													35	24	---	---	---	---	PASS
VIT	5212	broad.mit.edu	37	2	37032769	37032769	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37032769G>T	uc002rpl.2	+	14	1572	c.1351G>T	c.(1351-1353)GAG>TAG	p.E451*	VIT_uc002rpm.2_Nonsense_Mutation_p.E429*|VIT_uc010ezv.2_Nonsense_Mutation_p.E407*|VIT_uc010ezw.2_Nonsense_Mutation_p.E408*	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin	436	VWFA 1.					proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				TGCTGAAAATGAGAAGCAGTA	0.478													43	26	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40405579	40405579	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40405579G>A	uc002rrx.2	-	2	1887	c.1863C>T	c.(1861-1863)ACC>ACT	p.T621T	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Silent_p.T621T|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	621	Calx-beta 2.|Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAAGGAAGAAGGTCTTGTTTT	0.483													142	159	---	---	---	---	PASS
COX7A2L	9167	broad.mit.edu	37	2	42578481	42578481	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42578481C>T	uc002rsk.2	-	3	278	c.223G>A	c.(223-225)GTC>ATC	p.V75I	COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709	O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2	75					respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0						TTCAGGTAGACGGGCACACCA	0.448													20	40	---	---	---	---	PASS
PREPL	9581	broad.mit.edu	37	2	44549036	44549036	+	Missense_Mutation	SNP	T	C	C	rs142051325		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44549036T>C	uc002ruf.2	-	13	2059	c.2024A>G	c.(2023-2025)TAT>TGT	p.Y675C	PREPL_uc002rug.2_Missense_Mutation_p.Y609C|PREPL_uc002ruh.2_Missense_Mutation_p.Y613C|PREPL_uc010fax.2_Missense_Mutation_p.Y675C|PREPL_uc002rui.3_Missense_Mutation_p.Y586C|PREPL_uc002ruj.1_Missense_Mutation_p.Y586C|PREPL_uc002ruk.1_Missense_Mutation_p.Y675C	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C	675					proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGGGGTCTGATAGCCTGGAAG	0.413													19	61	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63609192	63609192	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63609192G>T	uc002sch.2	-	11	1919	c.1473C>A	c.(1471-1473)ATC>ATA	p.I491I	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Silent_p.I332I|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Silent_p.I299I|C2orf86_uc002sci.1_Silent_p.I467I	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	491					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						ACTGGAAGATGATGTCTATCA	0.418													20	20	---	---	---	---	PASS
MEIS1	4211	broad.mit.edu	37	2	66670133	66670133	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66670133A>G	uc002sdu.2	+	6	1040	c.583A>G	c.(583-585)AAA>GAA	p.K195E	MEIS1_uc002sdt.2_Missense_Mutation_p.K195E|MEIS1_uc002sdv.2_Missense_Mutation_p.K193E|MEIS1_uc010yqh.1_RNA|MEIS1_uc010yqi.1_Missense_Mutation_p.K130E|MEIS1_uc002sdw.1_Missense_Mutation_p.K51E	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1	195	Ser/Thr-rich.						sequence-specific DNA binding transcription factor activity				0						AGGAGGATCAAAATCAGACAG	0.378													80	82	---	---	---	---	PASS
EMX1	2016	broad.mit.edu	37	2	73145400	73145400	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73145400C>T	uc002sin.1	+	1	797	c.419C>T	c.(418-420)CCG>CTG	p.P140L	EMX1_uc002sim.1_Intron	NM_004097	NP_004088	Q04741	EMX1_HUMAN	empty spiracles homolog 1	107						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGCGCCTCCCCGCTGCAGCCC	0.672													14	20	---	---	---	---	PASS
CCT7	10574	broad.mit.edu	37	2	73466917	73466917	+	Silent	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73466917T>C	uc002siz.2	+	2	255	c.153T>C	c.(151-153)GAT>GAC	p.D51D	CCT7_uc002sja.2_Intron|CCT7_uc010yrf.1_Silent_p.D7D|CCT7_uc010feu.2_Silent_p.D51D|CCT7_uc010yrg.1_Missense_Mutation_p.M1T|CCT7_uc010yrh.1_5'UTR|CCT7_uc010yri.1_Intron	NM_006429	NP_006420	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 isoform a	51					'de novo' posttranslational protein folding		ATP binding|unfolded protein binding				0						TTATTGTAGATGGCAGAGGTA	0.537													15	35	---	---	---	---	PASS
ACTG2	72	broad.mit.edu	37	2	74136206	74136206	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74136206C>G	uc002sjw.2	+	5	513	c.391C>G	c.(391-393)CCT>GCT	p.P131A	ACTG2_uc010fey.2_Missense_Mutation_p.P131A|ACTG2_uc010yrn.1_Missense_Mutation_p.P88A	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	131					muscle contraction	cytoskeleton|cytosol	ATP binding				0						CTTCAATGTCCCTGCCATGTA	0.433													31	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89265862	89265862	+	RNA	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89265862G>T	uc010ytr.1	-	95		c.7704C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGAAATCTGTGCCAGATCCAC	0.488													93	113	---	---	---	---	PASS
IL18R1	8809	broad.mit.edu	37	2	103013161	103013161	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103013161G>A	uc002tbw.3	+	11	1591	c.1441G>A	c.(1441-1443)GAC>AAC	p.D481N	IL18R1_uc010ywc.1_Missense_Mutation_p.D480N|IL18R1_uc010ywd.1_Missense_Mutation_p.D325N|IL18R1_uc010fiy.2_Missense_Mutation_p.D481N	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor	481	TIR.|Cytoplasmic (Potential).				innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						ACCTGTTACTGACTTCACATT	0.358													61	106	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128913101	128913101	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128913101T>G	uc002tps.2	+	20	2354	c.2176T>G	c.(2176-2178)TTG>GTG	p.L726V	UGGT1_uc010fme.1_Missense_Mutation_p.L601V|UGGT1_uc002tpr.2_Missense_Mutation_p.L702V	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	726					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						ATTTACTATCTTGGATTCCCA	0.328													40	79	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130872857	130872857	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130872857A>G	uc010fmh.2	-	4	966	c.566T>C	c.(565-567)GTA>GCA	p.V189A		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	189	ANK 1.					cell cortex	ATP binding			skin(3)|ovary(2)	5						CAGGAGTTTTACTACTTCTGA	0.433													22	111	---	---	---	---	PASS
ZRANB3	84083	broad.mit.edu	37	2	136107557	136107557	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136107557T>G	uc002tum.2	-	5	705	c.588A>C	c.(586-588)GAA>GAC	p.E196D	ZRANB3_uc002tuk.2_5'UTR|ZRANB3_uc002tul.2_Missense_Mutation_p.E196D|ZRANB3_uc002tun.1_Missense_Mutation_p.E136D	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	196	Helicase ATP-binding.					intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTAATACCTCTTCAGGCCTTC	0.403													23	56	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814087	137814087	+	Silent	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814087T>A	uc002tva.1	+	2	144	c.144T>A	c.(142-144)TCT>TCA	p.S48S	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTCACCTGTCTAACTGTGGTG	0.542													16	56	---	---	---	---	PASS
KYNU	8942	broad.mit.edu	37	2	143743598	143743598	+	Intron	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143743598C>A	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	TGCGTGAGTACCATCTTCAGC	0.333													20	54	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152420154	152420154	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152420154A>G	uc010fnx.2	-	91	13747	c.13556T>C	c.(13555-13557)GTT>GCT	p.V4519A	NEB_uc002txr.2_Missense_Mutation_p.V942A	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	4519					muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CAGACAGTGAACCACACCAGG	0.443													169	179	---	---	---	---	PASS
GALNT3	2591	broad.mit.edu	37	2	166606403	166606403	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166606403T>C	uc010fph.1	-	10	2015	c.1628A>G	c.(1627-1629)TAC>TGC	p.Y543C		NM_004482	NP_004473	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	543	Ricin B-type lectin.|Lumenal (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(2)|ovary(1)	3						GTATTCAAAGTACTATGGAAG	0.378													69	80	---	---	---	---	PASS
FASTKD1	79675	broad.mit.edu	37	2	170387868	170387868	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170387868G>T	uc002uev.3	-	13	2709	c.2321C>A	c.(2320-2322)GCT>GAT	p.A774D	FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.A717D	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	774					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4						TTACCTTTCAGCCCCTGGTGG	0.378													33	36	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170502594	170502594	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170502594C>T	uc002ufe.2	-	9	1510	c.1416G>A	c.(1414-1416)CAG>CAA	p.Q472Q		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	472	Potential.										0						TGGCATAGTCCTGAAATTCTT	0.388													184	180	---	---	---	---	PASS
METTL8	79828	broad.mit.edu	37	2	172216976	172216976	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172216976T>C	uc010zdo.1	-	3	332	c.191A>G	c.(190-192)AAA>AGA	p.K64R	METTL8_uc002ugu.3_Missense_Mutation_p.K64R|METTL8_uc002ugv.3_Missense_Mutation_p.K64R|METTL8_uc002ugt.3_Missense_Mutation_p.K64R|METTL8_uc002ugs.3_Missense_Mutation_p.K14R|METTL8_uc010zdp.1_Missense_Mutation_p.K19R	NM_024770	NP_079046	B3KW44	B3KW44_HUMAN	methyltransferase like 8	64							methyltransferase activity			ovary(1)	1						TTCTTTTACTTTTTTTCTGGC	0.413													24	32	---	---	---	---	PASS
HOXD13	3239	broad.mit.edu	37	2	176957927	176957927	+	Silent	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176957927A>C	uc002ukf.1	+	1	396	c.309A>C	c.(307-309)CCA>CCC	p.P103P		NM_000523	NP_000514	P35453	HXD13_HUMAN	homeobox D13	103					skeletal system development|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		AGGCTCCCCCAGCCAAAGAGT	0.687			T	NUP98	AML*								4	5	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179437986	179437986	+	Silent	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179437986A>G	uc010zfg.1	-	275	65393	c.65169T>C	c.(65167-65169)CAT>CAC	p.H21723H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.H15418H|TTN_uc010zfi.1_Silent_p.H15351H|TTN_uc010zfj.1_Silent_p.H15226H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22650							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCATATTCATGTCCTTCTG	0.408													64	48	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179451955	179451955	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179451955G>C	uc010zfg.1	-	256	56503	c.56279C>G	c.(56278-56280)ACC>AGC	p.T18760S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T12455S|TTN_uc010zfi.1_Missense_Mutation_p.T12388S|TTN_uc010zfj.1_Missense_Mutation_p.T12263S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19687							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACAAGATTGGTTACATGGAA	0.473													43	114	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179469006	179469006	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179469006C>G	uc010zfg.1	-	231	46928	c.46704G>C	c.(46702-46704)CAG>CAC	p.Q15568H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q9263H|TTN_uc010zfi.1_Missense_Mutation_p.Q9196H|TTN_uc010zfj.1_Missense_Mutation_p.Q9071H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16495							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAACTCATACTGACCATTGG	0.353													20	34	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179592314	179592314	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179592314G>T	uc010zfg.1	-	65	16483	c.16259C>A	c.(16258-16260)ACA>AAA	p.T5420K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T2081K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6347							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCACACCTGTCACAAGCAA	0.378													45	168	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209189668	209189668	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209189668G>T	uc002vcz.2	+	19	2523	c.2365G>T	c.(2365-2367)GGT>TGT	p.G789C	PIKFYVE_uc010fun.1_Missense_Mutation_p.G470C|PIKFYVE_uc002vcy.1_Missense_Mutation_p.G733C	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	789					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						AATGACCCAAGGTGATTTAGT	0.358													87	27	---	---	---	---	PASS
SP110	3431	broad.mit.edu	37	2	231035425	231035425	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231035425T>G	uc002vqh.3	-	17	2108	c.1868A>C	c.(1867-1869)AAG>ACG	p.K623T	SP110_uc002vqg.3_Missense_Mutation_p.K647T	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a	623	Bromo.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CAGCCTTTCCTTAACCAGGTC	0.473													46	17	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38639337	38639337	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38639337C>A	uc003cio.2	-	14	2339	c.2145G>T	c.(2143-2145)ATG>ATT	p.M715I	SCN5A_uc003cin.2_Missense_Mutation_p.M715I|SCN5A_uc003cil.3_Missense_Mutation_p.M715I|SCN5A_uc010hhi.2_Missense_Mutation_p.M715I|SCN5A_uc010hhk.2_Missense_Mutation_p.M715I|SCN5A_uc011ayr.1_Missense_Mutation_p.M715I|SCN5A_uc010hhj.1_Missense_Mutation_p.M326I	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	715	Helical; Name=S1 of repeat II; (Potential).				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	TAAACGGGTCCATGACCACCA	0.542													79	17	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38740054	38740054	+	Intron	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38740054C>A	uc003ciq.2	-							NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	AAAATCAGGCCTTTAAAAGAA	0.448													48	19	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39229920	39229920	+	Silent	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39229920A>G	uc003cjk.1	-	2	1238	c.1017T>C	c.(1015-1017)GGT>GGC	p.G339G	XIRP1_uc003cji.2_Silent_p.G339G|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	339							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GAACATCTGGACCAGGTGGGA	0.582													90	25	---	---	---	---	PASS
ULK4	54986	broad.mit.edu	37	3	41746590	41746590	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41746590T>C	uc003ckv.3	-	27	2941	c.2740A>G	c.(2740-2742)ATA>GTA	p.I914V		NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	914							ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TACTGTATTATTGCTTCAAAA	0.313													58	20	---	---	---	---	PASS
TGM4	7047	broad.mit.edu	37	3	44938287	44938287	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44938287G>T	uc003coc.3	+	6	709	c.636G>T	c.(634-636)GTG>GTT	p.V212V	TGM4_uc003cob.2_RNA	NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	212					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	CCGTGCTGGTGTGCAGGGCCA	0.493													4	99	---	---	---	---	PASS
PTPN23	25930	broad.mit.edu	37	3	47449059	47449059	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47449059C>A	uc003crf.1	+	12	1084	c.988C>A	c.(988-990)CTT>ATT	p.L330I	PTPN23_uc011baw.1_Missense_Mutation_p.L295I|PTPN23_uc011bax.1_RNA|PTPN23_uc011bay.1_Missense_Mutation_p.L200I	NM_015466	NP_056281	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type	330	BRO1.				cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity			breast(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ATTGGACACTCTTCAGCCTGT	0.602													4	110	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62739269	62739269	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62739269G>T	uc003dll.2	-	3	1095	c.735C>A	c.(733-735)TAC>TAA	p.Y245*	CADPS_uc003dlm.2_Nonsense_Mutation_p.Y245*|CADPS_uc003dln.2_Nonsense_Mutation_p.Y245*	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	245					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CTTCTCCACGGTAGATGGCAT	0.567													51	16	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65342327	65342327	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65342327C>T	uc003dmn.2	-	23	4641	c.4115G>A	c.(4114-4116)CGG>CAG	p.R1372Q	MAGI1_uc003dmm.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1401	Poly-Arg.				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CTCCAGAGACCGTCTCCGCCG	0.711													30	11	---	---	---	---	PASS
HTR1F	3355	broad.mit.edu	37	3	88040764	88040764	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88040764C>A	uc003dqr.2	+	2	1023	c.865C>A	c.(865-867)CGG>AGG	p.R289R		NM_000866	NP_000857	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F	289	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity			ovary(3)	3	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TACAAGAGAACGGAAAGCAGC	0.378													5	13	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188508	98188508	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188508G>A	uc003dsm.2	+	1	88	c.88G>A	c.(88-90)GTG>ATG	p.V30M		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	30	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						GCTGTTTGTGGTGTTCTTTGC	0.428													226	154	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101370029	101370029	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101370029T>C	uc003dve.3	-	11	3373	c.3143A>G	c.(3142-3144)CAT>CGT	p.H1048R		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	1048					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TCCTGAAATATGTGCTACCTC	0.353													211	170	---	---	---	---	PASS
FSTL1	11167	broad.mit.edu	37	3	120130804	120130804	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120130804C>A	uc003eds.2	-	4	370	c.195G>T	c.(193-195)GTG>GTT	p.V65V	FSTL1_uc011bjh.1_Silent_p.V30V|FSTL1_uc010hrb.2_Silent_p.V65V	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	65	Kazal-like.				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		TACTGCCACACACAGGCCTCT	0.408													31	138	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	122003495	122003495	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122003495G>T	uc003eev.3	+	7	3066	c.2694G>T	c.(2692-2694)CGG>CGT	p.R898R	CASR_uc003eew.3_Silent_p.R908R	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	898	Cytoplasmic (Potential).|Interaction with RNF19A.		R -> Q (in IGE8).		anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCCGCAAGCGGTCCAGCAGCC	0.662													28	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	126915570	126915570	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126915570C>A	uc003eji.1	+	2	282	c.42C>A	c.(40-42)GTC>GTA	p.V14V						RecName: Full=Putative uncharacterized protein C3orf56;																		AGCAGAAGGTCCGCCGTGCCT	0.597													9	35	---	---	---	---	PASS
ABTB1	80325	broad.mit.edu	37	3	127399246	127399246	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127399246C>T	uc003ejt.2	+	12	1453	c.1365C>T	c.(1363-1365)AGC>AGT	p.S455S	ABTB1_uc003ejr.2_Silent_p.S313S|ABTB1_uc003ejs.2_Silent_p.S430S|ABTB1_uc003eju.2_Silent_p.S313S|ABTB1_uc010hsm.2_Silent_p.S182S	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1	455	Potential.					cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						AGACCTACAGCGCCATAGAGG	0.682													7	21	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130174460	130174460	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130174460T>G	uc010htj.1	+	37	7234	c.6740T>G	c.(6739-6741)ATC>AGC	p.I2247S	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.I286S	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2247	Nonhelical region.				axon guidance|cell adhesion	collagen					0						AAATTAATGATCAATTATGAA	0.348													34	101	---	---	---	---	PASS
AGTR1	185	broad.mit.edu	37	3	148459669	148459669	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148459669G>A	uc003ewg.2	+	4	1293	c.847G>A	c.(847-849)GCC>ACC	p.A283T	AGTR1_uc003ewh.2_Missense_Mutation_p.A283T|AGTR1_uc003ewi.2_Missense_Mutation_p.A283T|AGTR1_uc003ewj.2_Missense_Mutation_p.A283T|AGTR1_uc003ewk.2_Missense_Mutation_p.A283T	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	283	Helical; Name=7; (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TGTGGACACGGCCATGCCTAT	0.363													5	336	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153870603	153870603	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153870603A>T	uc011bog.1	+	6	1580	c.1369A>T	c.(1369-1371)AGC>TGC	p.S457C	SGEF_uc011boh.1_Missense_Mutation_p.S457C	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	457	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ATATTTACTCAGCTTGGAGAT	0.299													7	13	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154855886	154855886	+	Intron	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154855886T>G	uc010hvr.1	+						MME_uc003fab.1_Intron|MME_uc003fac.1_Intron|MME_uc003fad.1_Intron|MME_uc003fae.1_Intron	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	ATTTTTTTCTTGCAGGCTTGT	0.333													231	191	---	---	---	---	PASS
C3orf33	285315	broad.mit.edu	37	3	155485402	155485402	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155485402C>G	uc003fal.1	-	5	520	c.250G>C	c.(250-252)GGG>CGG	p.G84R	C3orf33_uc003fam.1_Missense_Mutation_p.G127R	NM_173657	NP_775928	Q96NB5	Q96NB5_HUMAN	hypothetical protein LOC285315	84							hydrolase activity, acting on ester bonds|nucleic acid binding				0			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CATGCCTTCCCAGTTTCAGCG	0.418													18	31	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164785163	164785163	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164785163G>T	uc003fei.2	-	6	662	c.600C>A	c.(598-600)AGC>AGA	p.S200R		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	200	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TAACTTGGATGCTAAATGGGT	0.303										HNSCC(35;0.089)			138	98	---	---	---	---	PASS
LRRC31	79782	broad.mit.edu	37	3	169558000	169558000	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169558000C>A	uc003fgc.1	-	9	1506	c.1429G>T	c.(1429-1431)GTG>TTG	p.V477L	LRRC31_uc010hwp.1_Missense_Mutation_p.V421L	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	477										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			AGGAACCGCACGTTTTGGCAG	0.473													111	109	---	---	---	---	PASS
ADIPOQ	9370	broad.mit.edu	37	3	186572425	186572425	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186572425G>T	uc003fra.2	+	3	751	c.667G>T	c.(667-669)GGA>TGA	p.G223*	ADIPOQ_uc010hyy.2_Nonsense_Mutation_p.G223*	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor	223	C1q.				brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		AGAGCGTAATGGACTCTATGC	0.532													82	180	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186959278	186959278	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186959278A>C	uc003frh.1	-	10	1626	c.1294T>G	c.(1294-1296)TGC>GGC	p.C432G	MASP1_uc003fri.2_Missense_Mutation_p.C432G|MASP1_uc003frj.2_Missense_Mutation_p.C401G	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	432	Sushi 2.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CCTGGAAGGCAGGTGGGTAGG	0.507													81	237	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195453329	195453329	+	Nonsense_Mutation	SNP	C	T	T	rs73203946	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195453329C>T	uc010hzo.2	+	3	1468	c.1342C>T	c.(1342-1344)CGA>TGA	p.R448*	MUC20_uc010hzp.2_Nonsense_Mutation_p.R413*|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	619	Involved in oligomerization.|Thr-rich.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CAACAGCAGCCGAGGGACGAA	0.622													6	251	---	---	---	---	PASS
PAK2	5062	broad.mit.edu	37	3	196547330	196547330	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196547330G>T	uc003fwy.3	+	13	1564	c.1242G>T	c.(1240-1242)GTG>GTT	p.V414V		NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2	414	Protein kinase.				axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CACCAGAGGTGGTTACACGGA	0.488													65	200	---	---	---	---	PASS
LMLN	89782	broad.mit.edu	37	3	197707242	197707242	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197707242G>T	uc011buo.1	+	6	617	c.595G>T	c.(595-597)GGT>TGT	p.G199C	LMLN_uc003fyt.2_Missense_Mutation_p.G147C|LMLN_uc010iar.2_Missense_Mutation_p.G199C|LMLN_uc010ias.2_Missense_Mutation_p.G147C|LMLN_uc003fyu.2_5'UTR	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	199					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		TGGAGCAGTGGGTGTGCCAGA	0.527													47	298	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2695363	2695363	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2695363G>C	uc010icl.2	+	14	2332	c.1981G>C	c.(1981-1983)GCC>CCC	p.A661P	FAM193A_uc010ick.2_Missense_Mutation_p.A861P|FAM193A_uc003gfd.2_Missense_Mutation_p.A661P|FAM193A_uc011bvm.1_Missense_Mutation_p.A683P|FAM193A_uc011bvn.1_Missense_Mutation_p.A661P|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.A515P	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	661										ovary(3)	3						CTCGGCCCCAGCCGCCCCGAG	0.587													63	39	---	---	---	---	PASS
PROM1	8842	broad.mit.edu	37	4	16077305	16077305	+	Intron	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16077305C>A	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron|PROM1_uc010iec.1_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						GCCATCAGCACTTACCTTCTG	0.393													8	2	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22820373	22820373	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22820373G>A	uc003gqp.3	+	5	1328	c.1237G>A	c.(1237-1239)GTA>ATA	p.V413I	GBA3_uc010iep.2_Missense_Mutation_p.V106I|GBA3_uc011bxo.1_Missense_Mutation_p.V414I	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a	413					glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						CAATCTTCAAGTATATTGTGC	0.393													20	8	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44449871	44449871	+	Nonsense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44449871G>A	uc003gwu.2	-	1	954	c.670C>T	c.(670-672)CAG>TAG	p.Q224*		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	224						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						GCGTCGGCCTGGTTGTCGCGC	0.577										HNSCC(17;0.042)			4	13	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55961023	55961023	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55961023C>A	uc003has.2	-	21	3219	c.2917G>T	c.(2917-2919)GCC>TCC	p.A973S	KDR_uc003hat.1_Missense_Mutation_p.A973S	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	973	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	p.A973S(1)		lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGAGCTGGCTGAGCTCTGG	0.532			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			95	38	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55971008	55971008	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55971008C>G	uc003has.2	-	13	2091	c.1789G>C	c.(1789-1791)GAG>CAG	p.E597Q	KDR_uc003hat.1_Missense_Mutation_p.E597Q|KDR_uc011bzx.1_Missense_Mutation_p.E597Q	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	597	Ig-like C2-type 6.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	GTGGGCAACTCTCCCACATGG	0.468			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			44	21	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71472248	71472248	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71472248C>A	uc003hfl.2	+	13	1220	c.1145C>A	c.(1144-1146)GCT>GAT	p.A382D		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	382					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			ACCCCAGCAGCTGCTGACCCA	0.562													3	60	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90856890	90856890	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90856890A>G	uc003hst.2	+	6	2130	c.2059A>G	c.(2059-2061)AGT>GGT	p.S687G	MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Missense_Mutation_p.S429G	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	687	Potential.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TGCTGTCAATAGTCTAAATTT	0.348													37	16	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104095953	104095953	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104095953T>A	uc003hxb.1	-	16	1677	c.1587A>T	c.(1585-1587)AAA>AAT	p.K529N	CENPE_uc003hxc.1_Missense_Mutation_p.K529N	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	529	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CATTCTTTTCTTTTAATTTCA	0.308													27	5	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114251625	114251625	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114251625G>C	uc003ibe.3	+	27	3224	c.3124G>C	c.(3124-3126)GGT>CGT	p.G1042R	ANK2_uc003ibd.3_Missense_Mutation_p.G1033R|ANK2_uc003ibf.3_Missense_Mutation_p.G1042R|ANK2_uc011cgc.1_Missense_Mutation_p.G251R|ANK2_uc003ibg.3_Missense_Mutation_p.G70R|ANK2_uc003ibc.2_Missense_Mutation_p.G1018R|ANK2_uc011cgb.1_Missense_Mutation_p.G1057R	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCAGTTCCTTGGGTAAGGGTT	0.498													28	15	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121742365	121742365	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121742365C>T	uc003idn.2	-	4	686	c.436G>A	c.(436-438)GTT>ATT	p.V146I	PRDM5_uc003ido.2_Missense_Mutation_p.V146I|PRDM5_uc010ine.2_Missense_Mutation_p.V146I|PRDM5_uc010inf.2_Missense_Mutation_p.V146I	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	146					histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						GAATTTTCAACTTCCCCTTCT	0.398													148	56	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072775	134072775	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072775G>T	uc003iha.2	+	1	2306	c.1480G>T	c.(1480-1482)GCC>TCC	p.A494S	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.A494S	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	494	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GGATGAGGGCGCCAACGCCCA	0.587													58	15	---	---	---	---	PASS
POU4F2	5458	broad.mit.edu	37	4	147561309	147561309	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147561309G>T	uc003ikv.2	+	2	827	c.579G>T	c.(577-579)CTG>CTT	p.L193L		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	193					estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					GCGAGCTGCTGGAGCACCTGA	0.597													3	3	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	143338	143338	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143338G>C	uc003jak.2	+	2	636	c.586G>C	c.(586-588)GAG>CAG	p.E196Q		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	196					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CGTCAGTCAGGAGCTGCTGCA	0.657													35	51	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	483533	483533	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:483533T>A	uc003jbe.2	-	6	1109	c.997A>T	c.(997-999)ACC>TCC	p.T333S	SLC9A3_uc011clx.1_Missense_Mutation_p.T333S	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	333	Extracellular (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGCACGGTGGTGGCCGACTGC	0.592													8	8	---	---	---	---	PASS
IRX2	153572	broad.mit.edu	37	5	2749065	2749065	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2749065C>A	uc003jda.2	-	3	999	c.757G>T	c.(757-759)GGC>TGC	p.G253C	IRX2_uc003jdb.2_Missense_Mutation_p.G253C	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	253						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		CACTCCGAGCCCGATTCGCAC	0.692													41	57	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065413	35065413	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065413C>A	uc003jjm.2	-	10	2177	c.1647G>T	c.(1645-1647)GTG>GTT	p.V549V	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Silent_p.V448V	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	549	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGACCCCGGACACCTTGGCAT	0.498													46	78	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40934464	40934464	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40934464G>A	uc003jmh.2	+	4	290	c.176G>A	c.(175-177)GGA>GAA	p.G59E	C7_uc011cpn.1_RNA	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	59	TSP type-1 1.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				GGGCAGTATGGAGGCCAGCCT	0.428													49	60	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45267199	45267199	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45267199T>C	uc003jok.2	-	7	1800	c.1775A>G	c.(1774-1776)GAT>GGT	p.D592G		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	592	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACCTATTCGATCTAGTCGGTC	0.383													56	118	---	---	---	---	PASS
MAP3K1	4214	broad.mit.edu	37	5	56177701	56177701	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56177701A>T	uc003jqw.3	+	14	3175	c.2674A>T	c.(2674-2676)AAC>TAC	p.N892Y		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	892				DGQQDSFLQASVPNNYLETTENSSP -> QRQQHNSFCRHL FPTTIWKPQRTVPL (in Ref. 2; AAC97073).	cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGTTCCCAACAACTATCTGGA	0.458													34	15	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74135988	74135988	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74135988C>A	uc003kdm.2	-	3	186	c.143G>T	c.(142-144)AGC>ATC	p.S48I	FAM169A_uc010izm.2_Missense_Mutation_p.S48I|FAM169A_uc003kdl.2_5'UTR	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	48											0						ATTTGACAGGCTAATAGGAAT	0.323													39	13	---	---	---	---	PASS
F2RL1	2150	broad.mit.edu	37	5	76129066	76129066	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76129066G>T	uc003keo.2	+	2	809	c.634G>T	c.(634-636)GTG>TTG	p.V212L		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	212	Extracellular (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		TTTGTATGTCGTGAAGCAGAC	0.502													52	17	---	---	---	---	PASS
ACOT12	134526	broad.mit.edu	37	5	80626672	80626672	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80626672G>A	uc003khl.3	-	14	1534	c.1479C>T	c.(1477-1479)GCC>GCT	p.A493A	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	493	START.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TGAGAAATCCGGCACATATGA	0.423													3	79	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82817619	82817619	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82817619T>A	uc003kii.3	+	7	3850	c.3494T>A	c.(3493-3495)ATG>AAG	p.M1165K	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.M1165K|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1165	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACCCAGCTTATGGAAGAAACC	0.378													94	45	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115336855	115336855	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115336855C>T	uc003kro.2	+	10	1903	c.1739C>T	c.(1738-1740)ACT>ATT	p.T580I	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	580	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						CCAGTGATCACTTTAAATGTG	0.393													98	41	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131953812	131953812	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131953812A>G	uc003kxi.2	+	21	3602	c.3215A>G	c.(3214-3216)AAT>AGT	p.N1072S	RAD50_uc003kxh.2_Missense_Mutation_p.N933S	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	1072	Potential.				DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAAATCATAATTTGGCATTA	0.313								Homologous_recombination					152	54	---	---	---	---	PASS
MYOT	9499	broad.mit.edu	37	5	137206683	137206683	+	Missense_Mutation	SNP	G	T	T	rs114194130	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137206683G>T	uc011cye.1	+	2	360	c.343G>T	c.(343-345)GCT>TCT	p.A115S	MYOT_uc003lbv.2_Missense_Mutation_p.A115S|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_5'UTR	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	115	Necessary for interaction with ACTN1.				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AATCCCTTCCGCTATGGATTC	0.458													30	5	---	---	---	---	PASS
FAM53C	51307	broad.mit.edu	37	5	137680742	137680742	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137680742C>T	uc003lcv.2	+	4	835	c.365C>T	c.(364-366)TCA>TTA	p.S122L	FAM53C_uc003lcw.2_Missense_Mutation_p.S122L|FAM53C_uc011cyq.1_Intron|FAM53C_uc011cyr.1_Intron	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	122										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CGCTCACTCTCAGTGCCCGTG	0.667													43	12	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24576630	24576630	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24576630C>G	uc011djo.1	-	10	1937	c.1700G>C	c.(1699-1701)GGT>GCT	p.G567A	KIAA0319_uc011djp.1_Missense_Mutation_p.G522A|KIAA0319_uc003neh.1_Missense_Mutation_p.G567A|KIAA0319_uc011djq.1_Missense_Mutation_p.G558A|KIAA0319_uc011djr.1_Missense_Mutation_p.G567A|KIAA0319_uc010jpt.1_5'UTR	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	567	PKD 3.|Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						ACTCCCAGGACCCAGGGACCA	0.443													70	202	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26468571	26468571	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26468571G>A	uc003nib.1	+	8	1590	c.1378G>A	c.(1378-1380)GAT>AAT	p.D460N	BTN2A1_uc003nic.1_3'UTR|BTN2A1_uc003nid.1_Missense_Mutation_p.D308N|BTN2A1_uc011dko.1_Missense_Mutation_p.D399N|BTN2A1_uc010jqk.1_Missense_Mutation_p.D220N	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	460	Cytoplasmic (Potential).|B30.2/SPRY.				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						TGAAGCTGGAGATGTCTCCTT	0.552													51	83	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31914294	31914294	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31914294C>G	uc003nyj.3	+	2	487	c.209C>G	c.(208-210)CCT>CGT	p.P70R	CFB_uc011dor.1_Missense_Mutation_p.P572R|CFB_uc011dos.1_Missense_Mutation_p.P70R|CFB_uc003nyi.2_Missense_Mutation_p.P70R	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	70	Sushi 1.				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						TACCCGTACCCTGTGCAGACA	0.572													41	51	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32039771	32039771	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32039771C>G	uc003nzl.2	-	13	5188	c.4986G>C	c.(4984-4986)AAG>AAC	p.K1662N		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1744					actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						TCTCACCCGTCTTTGCCTCCA	0.582													10	21	---	---	---	---	PASS
C6orf10	10665	broad.mit.edu	37	6	32261409	32261409	+	Silent	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32261409T>C	uc011dpy.1	-	12	1214	c.1041A>G	c.(1039-1041)AAA>AAG	p.K347K	C6orf10_uc011dpx.1_Silent_p.K129K	NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	347						integral to membrane				skin(1)	1						CTTCTTGTCCTTTTGGGACAC	0.478													3	178	---	---	---	---	PASS
HLA-DQA2	3118	broad.mit.edu	37	6	32713677	32713677	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32713677G>C	uc003obx.2	+	3	499	c.441G>C	c.(439-441)TGG>TGC	p.W147C		NM_020056	NP_064440	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ	147	Alpha-2.|Extracellular (Potential).|Ig-like C1-type.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ACATCACCTGGCTGAGCAATG	0.502													75	185	---	---	---	---	PASS
TAP1	6890	broad.mit.edu	37	6	32820923	32820923	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32820923C>G	uc003ocg.2	-	1	826	c.671G>C	c.(670-672)GGC>GCC	p.G224A	TAP1_uc011dqi.1_5'Flank|PSMB9_uc011dqj.1_5'Flank|PSMB9_uc003sga.2_5'Flank	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	224	Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						GCCCTGACCGCCGGGCACCCA	0.672													11	18	---	---	---	---	PASS
ZBTB9	221504	broad.mit.edu	37	6	33424010	33424010	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33424010C>T	uc003oeq.2	+	2	1401	c.1133C>T	c.(1132-1134)CCT>CTT	p.P378L		NM_152735	NP_689948	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	378	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGACACCCCCTGCAGATGGA	0.592													21	45	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34004042	34004042	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34004042C>A	uc003oir.3	-	8	2015	c.1845G>T	c.(1843-1845)ACG>ACT	p.T615T	GRM4_uc011dsn.1_Silent_p.T568T|GRM4_uc010jvh.2_Silent_p.T615T|GRM4_uc010jvi.2_Silent_p.T307T|GRM4_uc003oio.2_Silent_p.T307T|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.T475T|GRM4_uc003oiq.2_Silent_p.T482T|GRM4_uc011dsm.1_Silent_p.T446T	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	615	Cytoplasmic (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	TGACGATGGGCGTGTCGTTGT	0.637													13	34	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34949507	34949507	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34949507A>G	uc003ojx.3	+	4	618	c.476A>G	c.(475-477)TAT>TGT	p.Y159C	ANKS1A_uc011dss.1_Missense_Mutation_p.Y159C|ANKS1A_uc011dst.1_5'UTR|ANKS1A_uc010jvp.1_5'UTR|ANKS1A_uc010jvr.1_RNA	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	159	ANK 3.					cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						GCAGCGCAGTATGGCCACACA	0.537													23	47	---	---	---	---	PASS
CCND3	896	broad.mit.edu	37	6	41908689	41908689	+	Intron	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41908689C>T	uc003orn.2	-						CCND3_uc003orp.2_Intron|CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron|CCND3_uc003orm.2_Intron|CCND3_uc003oro.2_Intron|CCND3_uc011dul.1_Intron	NM_001760	NP_001751	P30281	CCND3_HUMAN	cyclin D3 isoform 2						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACTGCACACACCCGAGGGGAA	0.682			T	IGH@	MM								29	42	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42196313	42196313	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42196313C>T	uc003osd.2	-	18	3936	c.3373G>A	c.(3373-3375)GCA>ACA	p.A1125T	TRERF1_uc011duq.1_Missense_Mutation_p.A1042T|TRERF1_uc003osb.2_Missense_Mutation_p.A893T|TRERF1_uc003osc.2_Missense_Mutation_p.A881T|TRERF1_uc003ose.2_Missense_Mutation_p.A1145T	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1125	Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATCTCAGCTGCAAAAGCCGCC	0.552													154	300	---	---	---	---	PASS
MAD2L1BP	9587	broad.mit.edu	37	6	43604388	43604388	+	Intron	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43604388G>C	uc003ovv.2	+						MAD2L1BP_uc003ovu.2_Intron	NM_014628	NP_055443	Q15013	MD2BP_HUMAN	MAD2L1 binding protein isoform 2						mitotic cell cycle checkpoint|regulation of exit from mitosis	cytoplasm|nucleus|spindle	protein binding				0	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CCCCAGGTAGGCACAGGCTTT	0.473													19	77	---	---	---	---	PASS
GPR111	222611	broad.mit.edu	37	6	47649007	47649007	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47649007A>G	uc010jzj.1	+	6	713	c.712A>G	c.(712-714)AGC>GGC	p.S238G	GPR111_uc010jzk.1_Missense_Mutation_p.S170G|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	238	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GCAGAGTTACAGCACCATAGC	0.393													26	73	---	---	---	---	PASS
MCM3	4172	broad.mit.edu	37	6	52143602	52143602	+	Nonsense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52143602G>A	uc003pan.1	-	6	927	c.817C>T	c.(817-819)CAG>TAG	p.Q273*	MCM3_uc011dwu.1_Nonsense_Mutation_p.Q227*	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	273					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					AAAGAGGGCTGAGCATCCTTG	0.438													29	47	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55216071	55216071	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55216071T>A	uc003pcm.1	+	5	477	c.391T>A	c.(391-393)TGT>AGT	p.C131S		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	131	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GATGTGGTCCTGTTTGGAAGT	0.443													117	101	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84913806	84913806	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84913806T>C	uc010kbp.2	-	7	677	c.580A>G	c.(580-582)AGT>GGT	p.S194G	KIAA1009_uc003pkj.3_Missense_Mutation_p.S118G|KIAA1009_uc003pkk.2_Missense_Mutation_p.S194G	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	194					cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		AAATCATCACTGTAATTTTCT	0.338													28	86	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90411637	90411637	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90411637C>T	uc003pnn.1	-	54	8408	c.8292G>A	c.(8290-8292)ATG>ATA	p.M2764I		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	2764					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTTCATAATTCATCAGAAGTC	0.413													27	50	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101054691	101054691	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101054691C>A	uc003pqk.2	-	32	5298	c.4969G>T	c.(4969-4971)GCT>TCT	p.A1657S		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1657	Helicase C-terminal 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ACTAAATGAGCTGGAAAGTTT	0.289													29	59	---	---	---	---	PASS
C6orf186	728464	broad.mit.edu	37	6	110620282	110620282	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110620282G>A	uc010kdu.1	-	4	629	c.629C>T	c.(628-630)CCT>CTT	p.P210L	C6orf186_uc003pub.2_Missense_Mutation_p.P13L	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	210						extracellular region					0						CTTGACACTAGGATCAAAACG	0.473													36	95	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112462046	112462046	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112462046C>A	uc003pvu.2	-	22	3201	c.2892G>T	c.(2890-2892)GGG>GGT	p.G964G	LAMA4_uc003pvv.2_Silent_p.G957G|LAMA4_uc003pvt.2_Silent_p.G957G	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	964	Laminin G-like 1.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	p.S964S(1)		ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCGAAAATTCCCCCTTTTTAA	0.438													40	66	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129635857	129635857	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129635857G>T	uc003qbn.2	+	24	3574	c.3469G>T	c.(3469-3471)GCC>TCC	p.A1157S	LAMA2_uc003qbo.2_Missense_Mutation_p.A1157S	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1157	Laminin EGF-like 13.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CGGACTCGATGCCAAGAATCC	0.522													29	44	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131216113	131216113	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131216113C>T	uc003qch.2	-	9	1565	c.1383G>A	c.(1381-1383)CCG>CCA	p.P461P	EPB41L2_uc003qcg.1_Silent_p.P461P|EPB41L2_uc011eby.1_Silent_p.P461P|EPB41L2_uc003qci.2_Silent_p.P461P|EPB41L2_uc010kfk.2_Silent_p.P461P|EPB41L2_uc010kfl.1_Silent_p.P461P	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	461	FERM.				cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TTACCTCTGCCGGTCTGACTT	0.313													16	52	---	---	---	---	PASS
VNN3	55350	broad.mit.edu	37	6	133045946	133045946	+	3'UTR	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133045946T>C	uc003qdp.2	-	6					VNN3_uc010kfs.2_Silent_p.E42E|VNN3_uc011ecl.1_RNA|VNN3_uc011ecm.1_Silent_p.E76E|VNN3_uc011ecn.1_Silent_p.E76E|VNN3_uc010kfu.2_Silent_p.E76E|VNN3_uc010kfv.2_RNA|VNN3_uc010kfw.2_Silent_p.E76E|VNN3_uc010kfx.2_Silent_p.E42E|VNN3_uc010kfy.2_Silent_p.E42E|VNN3_uc010kfz.2_Silent_p.E42E	NM_078625	NP_523239			SubName: Full=PAGEL-beta;												0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		AATCTGACTGTTCAGAGGAAA	0.468													32	60	---	---	---	---	PASS
PPIL4	85313	broad.mit.edu	37	6	149854712	149854712	+	Splice_Site	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149854712T>A	uc003qmo.1	-	7	592	c.562_splice	c.e7-1	p.S188_splice	PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Splice_Site_p.S188_splice	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		TCGACCACTCTGTTAAGACAG	0.313													13	31	---	---	---	---	PASS
IYD	389434	broad.mit.edu	37	6	150715308	150715308	+	Missense_Mutation	SNP	G	T	T	rs146905706	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150715308G>T	uc003qnu.1	+	4	744	c.604G>T	c.(604-606)GCC>TCC	p.A202S	IYD_uc003qnv.1_Missense_Mutation_p.A202S|IYD_uc003qnw.1_RNA|IYD_uc003qnx.1_Missense_Mutation_p.A202S|IYD_uc010kik.1_Missense_Mutation_p.A120S	NM_203395	NP_981932	Q6PHW0	IYD1_HUMAN	iodotyrosine dehalogenase 1 isoform 2	202	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	integral to membrane|plasma membrane				ovary(2)	2		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		ACATGGTTTCGCCGCAAATGG	0.418													49	65	---	---	---	---	PASS
ZNF12	7559	broad.mit.edu	37	7	6737029	6737029	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6737029A>C	uc003sqt.1	-	4	733	c.179T>G	c.(178-180)TTG>TGG	p.L60W	ZNF12_uc011jxa.1_5'UTR|ZNF12_uc003sqs.1_Missense_Mutation_p.L60W	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a	60	KRAB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TCCTTGCTCCAACTTGCTGAT	0.473													7	8	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13950914	13950914	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13950914G>A	uc011jxq.1	-	10	1560	c.821C>T	c.(820-822)TCC>TTC	p.S274F	ETV1_uc011jxn.1_Missense_Mutation_p.S234F|ETV1_uc011jxo.1_Missense_Mutation_p.S171F|ETV1_uc011jxp.1_Missense_Mutation_p.S216F|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.S256F|ETV1_uc011jxs.1_Missense_Mutation_p.S256F|ETV1_uc010ktv.2_Missense_Mutation_p.S143F	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	274				Missing (in Ref. 5; AAC62435).	transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						CATATAAATGGAGTGGCAGCT	0.448			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								15	41	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21932154	21932154	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21932154T>A	uc003svc.2	+	78	12671	c.12640T>A	c.(12640-12642)TAT>AAT	p.Y4214N		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4214					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CCCGGCACTGTATGGCCTCCA	0.517									Kartagener_syndrome				65	175	---	---	---	---	PASS
C7orf10	79783	broad.mit.edu	37	7	40488957	40488957	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40488957G>T	uc003thn.1	+	10	933	c.888G>T	c.(886-888)AAG>AAT	p.K296N	C7orf10_uc003thm.1_Missense_Mutation_p.K266N|C7orf10_uc003tho.1_Missense_Mutation_p.K248N	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	303							transferase activity	p.Q296H(1)		ovary(2)	2						CCGTCTGCAAGGTAATCTATA	0.403													8	70	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48315262	48315262	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48315262C>T	uc003toq.2	+	17	6024	c.5999C>T	c.(5998-6000)TCA>TTA	p.S2000L	ABCA13_uc010kyr.2_Missense_Mutation_p.S1503L	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2000					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ATTATTTCCTCAAATTTGGAA	0.323													4	30	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64439246	64439246	+	Nonsense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64439246T>A	uc003ttr.2	-	4	1988	c.703A>T	c.(703-705)AAG>TAG	p.K235*		NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117	235	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TCAGTAAGCTTTGAGGCTTGG	0.363													74	120	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83036558	83036558	+	Intron	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83036558A>G	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTTTGGTTCTATAGGAGCAAA	0.308													40	62	---	---	---	---	PASS
EPO	2056	broad.mit.edu	37	7	100320735	100320735	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100320735C>A	uc003uwi.2	+	5	742	c.561C>A	c.(559-561)GCC>GCA	p.A187A	EPO_uc011kkc.1_Silent_p.A186A	NM_000799	NP_000790	P01588	EPO_HUMAN	erythropoietin precursor	187					blood circulation|cellular hyperosmotic response|erythrocyte maturation|negative regulation of apoptosis|negative regulation of ion transmembrane transporter activity|negative regulation of sodium ion transport|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat5 protein|signal transduction	extracellular space	erythropoietin receptor binding|eukaryotic cell surface binding|hormone activity			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)	CAGGGGAGGCCTGCAGGACAG	0.577													94	132	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677408	100677408	+	Nonsense_Mutation	SNP	C	A	A	rs139093882		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677408C>A	uc003uxp.1	+	3	2764	c.2711C>A	c.(2710-2712)TCG>TAG	p.S904*	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	904	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|13.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGCCCGTTCGTCTCCTACA	0.532													209	321	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103159907	103159907	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103159907G>A	uc003vca.2	-	49	7885	c.7725C>T	c.(7723-7725)ATC>ATT	p.I2575I	RELN_uc010liz.2_Silent_p.I2575I	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2575					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGTAAAATTGGATGAACTCAG	0.383													56	92	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103293015	103293015	+	Silent	SNP	C	A	A	rs138532222		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103293015C>A	uc003vca.2	-	14	1906	c.1746G>T	c.(1744-1746)ACG>ACT	p.T582T	RELN_uc010liz.2_Silent_p.T582T	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	582					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGGCTGATGCGTTCCACATC	0.403													49	87	---	---	---	---	PASS
TAS2R16	50833	broad.mit.edu	37	7	122635423	122635423	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122635423T>C	uc003vkl.1	-	1	332	c.266A>G	c.(265-267)AAT>AGT	p.N89S		NM_016945	NP_058641	Q9NYV7	T2R16_HUMAN	taste receptor T2R16	89	Helical; Name=3; (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding			ovary(1)|skin(1)	2						TGTAAGGATATTAAAAAATTC	0.383													48	51	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123136930	123136930	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123136930A>G	uc003vkn.2	-	7	1631	c.1054T>C	c.(1054-1056)TGG>CGG	p.W352R	IQUB_uc003vko.2_Missense_Mutation_p.W352R|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.W352R	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	352	IQ.									ovary(3)|large_intestine(1)	4						TTAGCATGCCATTGCCTGTAG	0.338													62	80	---	---	---	---	PASS
HYAL4	23553	broad.mit.edu	37	7	123517097	123517097	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123517097A>C	uc003vlc.2	+	5	1972	c.1334A>C	c.(1333-1335)GAT>GCT	p.D445A	HYAL4_uc011knz.1_3'UTR	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	445	Extracellular (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						GAAGGAGCTGATTGCAGAGAA	0.453													80	124	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127338939	127338939	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127338939G>T	uc003vmi.2	+	4	586	c.360G>T	c.(358-360)GGG>GGT	p.G120G		NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	120	TNase-like 1.				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						ATACCAATGGGGAAAACATTG	0.468													31	48	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137082134	137082134	+	Silent	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137082134T>A	uc003vtt.2	-	32	2971	c.2970A>T	c.(2968-2970)GCA>GCT	p.A990A	DGKI_uc003vtu.2_Silent_p.A659A	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	990	ANK 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						TTTCACTGTCTGCCATATCCA	0.343													72	104	---	---	---	---	PASS
ADCK2	90956	broad.mit.edu	37	7	140373228	140373228	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140373228G>A	uc003vvy.1	+	1	276	c.98G>A	c.(97-99)TGC>TAC	p.C33Y	ADCK2_uc003vvz.2_Missense_Mutation_p.C33Y	NM_052853	NP_443085	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	33						integral to membrane	ATP binding|protein serine/threonine kinase activity				0	Melanoma(164;0.00956)					CCCTCCGAGTGCCCTCGCGAT	0.667													16	18	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140449164	140449164	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140449164C>T	uc003vwc.3	-	16	1976	c.1915G>A	c.(1915-1917)GTA>ATA	p.V639I		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	639	Protein kinase.				activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	AATGCATATACATCTGACTGA	0.343		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				61	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142161955	142161955	+	Intron	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142161955A>C	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_RNA|uc011krw.1_Missense_Mutation_p.V107G					SubName: Full=V_segment translation product; Flags: Fragment;																		ACAGAAGTACACAGATGTCTG	0.547													149	227	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142180545	142180545	+	Intron	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142180545G>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_RNA|uc011krz.1_Missense_Mutation_p.T105I					SubName: Full=V_segment translation product; Flags: Fragment;																		GTACACAGATGTCTGGGAGGG	0.567													131	225	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962224	151962224	+	Silent	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962224A>T	uc003wla.2	-	8	1302	c.1083T>A	c.(1081-1083)ACT>ACA	p.T361T		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	361	PHD-type 1.|RING-type.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCTGACCACAAGTAGTACAAA	0.448			N		medulloblastoma								33	533	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16026001	16026001	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16026001C>T	uc003wwz.2	-	4	794	c.596G>A	c.(595-597)GGC>GAC	p.G199D	MSR1_uc010lsu.2_Missense_Mutation_p.G217D|MSR1_uc003wxa.2_Missense_Mutation_p.G199D|MSR1_uc003wxb.2_Missense_Mutation_p.G199D|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	199	Potential.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTGGATTTTGCCATTCAGATT	0.413													32	48	---	---	---	---	PASS
EFHA2	286097	broad.mit.edu	37	8	16942784	16942784	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16942784A>T	uc003wxd.2	+	6	776	c.734A>T	c.(733-735)GAC>GTC	p.D245V		NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2	245	EF-hand 1.|1 (Potential).					integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		AACATGTTTGACACTGATGGC	0.318													91	80	---	---	---	---	PASS
TNFRSF10D	8793	broad.mit.edu	37	8	23002047	23002047	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23002047G>A	uc003xcz.1	-	7	962	c.870C>T	c.(868-870)GTC>GTT	p.V290V		NM_003840	NP_003831	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily,	290	Cytoplasmic (Potential).				anti-apoptosis|apoptosis	integral to membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		CCTGCTCAGAGACCTGGGTGG	0.577													60	54	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25745433	25745433	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25745433G>A	uc003xes.1	-	9	824	c.807C>T	c.(805-807)GCC>GCT	p.A269A	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	269	IPT/TIG.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TGATGACCATGGCTCCTCCTG	0.478													30	90	---	---	---	---	PASS
C8orf22	492307	broad.mit.edu	37	8	49986841	49986841	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49986841A>T	uc003xqq.3	+	4	365	c.182A>T	c.(181-183)CAT>CTT	p.H61L		NM_001007176	NP_001007177	Q8WWR9	PDPFL_HUMAN	hypothetical protein LOC492307	61											0		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TCGTTTTTCCATTCTGAACCT	0.368													29	69	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53568566	53568566	+	Splice_Site	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53568566A>T	uc003xre.3	-	15	4379	c.3821_splice	c.e15+1	p.S1274_splice	RB1CC1_uc003xrf.3_Splice_Site_p.S1274_splice	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1						autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CTTAATTCTTACCTTTTTGCT	0.284													30	29	---	---	---	---	PASS
C8orf34	116328	broad.mit.edu	37	8	69728119	69728119	+	Splice_Site	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69728119A>G	uc010lyz.2	+	13	1341	c.1292_splice	c.e13-2	p.R431_splice	C8orf34_uc003xyb.2_Splice_Site_p.R406_splice	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TTTGTTGTGCAGGTTCCGCTG	0.423													39	180	---	---	---	---	PASS
CNBD1	168975	broad.mit.edu	37	8	88365891	88365891	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88365891G>A	uc003ydy.2	+	10	1228	c.1180G>A	c.(1180-1182)GGG>AGG	p.G394R		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	394	cNMP.									ovary(3)	3						TGTTTATATGGGGAAACTTAA	0.323													35	69	---	---	---	---	PASS
PDP1	54704	broad.mit.edu	37	8	94935592	94935592	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94935592G>T	uc003yge.2	+	2	1574	c.1305G>T	c.(1303-1305)GAG>GAT	p.E435D	PDP1_uc003ygf.2_Missense_Mutation_p.E460D|PDP1_uc010max.2_Missense_Mutation_p.E460D|PDP1_uc011lgm.1_Missense_Mutation_p.E435D|PDP1_uc011lgn.1_Missense_Mutation_p.E494D	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic	435					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TTGTGGGTGAGTACCTAACTG	0.483													43	68	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110980823	110980823	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110980823G>T	uc003ynr.3	-	3	1339	c.997C>A	c.(997-999)CGC>AGC	p.R333S	KCNV1_uc010mcw.2_Missense_Mutation_p.R333S	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	333	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CCAAGGGAGCGTAATCCTGCA	0.318													43	62	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	132051619	132051619	+	Intron	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132051619C>A	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCAGGAGTTACCTGGTTGATG	0.572										HNSCC(32;0.087)			48	112	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140631212	140631212	+	Nonsense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140631212G>C	uc003yvf.1	-	2	478	c.414C>G	c.(412-414)TAC>TAG	p.Y138*	KCNK9_uc003yvg.1_Nonsense_Mutation_p.Y138*|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	138	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			GCTTCAGCAGGTAGCGCACGA	0.582													17	23	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145755869	145755869	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145755869C>G	uc003zdt.1	-	12	3744	c.3189G>C	c.(3187-3189)GAG>GAC	p.E1063D	LRRC24_uc003zdn.2_5'Flank|MGC70857_uc003zdp.1_5'Flank|MGC70857_uc003zdq.1_5'Flank|MGC70857_uc003zdr.1_5'Flank|ARHGAP39_uc011llk.1_Missense_Mutation_p.E1063D|ARHGAP39_uc003zds.1_Missense_Mutation_p.E1094D	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	1063	Rho-GAP.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						GGAAGGACATCTCCTTGCGGG	0.647													19	23	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7013902	7013902	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7013902G>T	uc003zkh.2	+	14	2663	c.2083G>T	c.(2083-2085)GAA>TAA	p.E695*	KDM4C_uc010mhu.2_Nonsense_Mutation_p.E717*|KDM4C_uc011lmi.1_Nonsense_Mutation_p.E695*|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Nonsense_Mutation_p.E695*|KDM4C_uc011lmk.1_Nonsense_Mutation_p.E440*|KDM4C_uc011lml.1_Nonsense_Mutation_p.E382*	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	695	PHD-type 1.				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						TATTTATAGTGAAGAAAATAT	0.408													53	24	---	---	---	---	PASS
CER1	9350	broad.mit.edu	37	9	14722619	14722619	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14722619T>A	uc003zlj.2	-	1	97	c.52A>T	c.(52-54)ACA>TCA	p.T18S		NM_005454	NP_005445	O95813	CER1_HUMAN	cerberus 1 precursor	18					BMP signaling pathway	extracellular space	cytokine activity				0				GBM - Glioblastoma multiforme(50;3.16e-06)		TGGTGCCGTGTGGTCTTTCCT	0.527													50	29	---	---	---	---	PASS
UBAP2	55833	broad.mit.edu	37	9	33927889	33927889	+	Silent	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33927889G>C	uc003ztq.1	-	20	2390	c.2277C>G	c.(2275-2277)TCC>TCG	p.S759S	UBAP2_uc011loc.1_Silent_p.S668S|UBAP2_uc011lod.1_Silent_p.S492S|UBAP2_uc011loe.1_Silent_p.S514S|UBAP2_uc011lof.1_Silent_p.S684S|UBAP2_uc011log.1_Missense_Mutation_p.P683R|UBAP2_uc003ztn.1_5'UTR|UBAP2_uc003zto.1_5'UTR|UBAP2_uc003ztp.1_5'UTR	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2	759										ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TCATGCTACTGGACAGGCTGG	0.632													48	34	---	---	---	---	PASS
GKAP1	80318	broad.mit.edu	37	9	86421392	86421392	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86421392G>A	uc004amy.2	-	3	537	c.41C>T	c.(40-42)TCT>TTT	p.S14F	GKAP1_uc004amz.2_Missense_Mutation_p.S14F|GKAP1_uc011lsu.1_RNA	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a	14					signal transduction	Golgi apparatus					0						GGCAAAACGAGAAGCGGTGGT	0.428													27	11	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95048047	95048047	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95048047C>A	uc004art.1	-	6	811	c.554G>T	c.(553-555)TGT>TTT	p.C185F	IARS_uc004ars.1_Missense_Mutation_p.C30F|IARS_uc004aru.3_Missense_Mutation_p.C185F|IARS_uc010mqr.2_Missense_Mutation_p.C75F|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	185					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	TGGAGTGTTACATGCCGTAGA	0.408													3	82	---	---	---	---	PASS
ZNF169	169841	broad.mit.edu	37	9	97063103	97063103	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97063103G>T	uc004aum.1	+	5	1368	c.1263G>T	c.(1261-1263)CAG>CAT	p.Q421H		NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169	421	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				TCAGGCACCAGAGGACACACA	0.567													19	10	---	---	---	---	PASS
OR13C2	392376	broad.mit.edu	37	9	107367215	107367215	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107367215C>T	uc011lvq.1	-	1	694	c.694G>A	c.(694-696)GAG>AAG	p.E232K		NM_001004481	NP_001004481	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTCTCCCCTCGGAAGAGCTA	0.413													66	22	---	---	---	---	PASS
MRRF	92399	broad.mit.edu	37	9	125033303	125033303	+	Missense_Mutation	SNP	A	G	G	rs149753530	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125033303A>G	uc004bmb.2	+	2	248	c.133A>G	c.(133-135)ATG>GTG	p.M45V	MRRF_uc004bmc.2_Missense_Mutation_p.M45V|MRRF_uc011lyq.1_Missense_Mutation_p.M66V|MRRF_uc010mvz.1_RNA|MRRF_uc010mwa.2_Missense_Mutation_p.M45V|MRRF_uc011lyr.1_Missense_Mutation_p.M45V|MRRF_uc004bmd.2_Missense_Mutation_p.M45V|MRRF_uc004bme.2_RNA	NM_138777	NP_620132	Q96E11	RRFM_HUMAN	mitochondrial ribosome recycling factor isoform	45					ribosome disassembly|translation	mitochondrion	sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						TAGGCAATACATGGCCTATTC	0.463													111	34	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137710517	137710517	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137710517G>A	uc004cfe.2	+	55	4628	c.4246G>A	c.(4246-4248)GAA>AAA	p.E1416K		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1416	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGCCGGCTTGGAAGGCCCTCC	0.697													9	3	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7326102	7326102	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7326102C>A	uc009xio.1	-	6	627	c.536G>T	c.(535-537)GGG>GTG	p.G179V	SFMBT2_uc001ijn.1_Missense_Mutation_p.G179V|SFMBT2_uc010qay.1_Missense_Mutation_p.G179V	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	179	MBT 2.				regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						AGGGCCTTTCCCTCGCAGAGG	0.363													33	25	---	---	---	---	PASS
OPTN	10133	broad.mit.edu	37	10	13168002	13168002	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13168002A>C	uc001ilu.1	+	12	1643	c.1205A>C	c.(1204-1206)AAT>ACT	p.N402T	OPTN_uc001ilv.1_Missense_Mutation_p.N402T|OPTN_uc001ilw.1_Missense_Mutation_p.N402T|OPTN_uc001ilx.1_Missense_Mutation_p.N402T|OPTN_uc001ily.1_Missense_Mutation_p.N396T|OPTN_uc010qbr.1_Missense_Mutation_p.N345T|OPTN_uc001ilz.1_Missense_Mutation_p.N396T	NM_001008213	NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	402	Potential.				cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding			ovary(2)	2						GAACATAATAATGCATTGAAA	0.313													20	42	---	---	---	---	PASS
SUV39H2	79723	broad.mit.edu	37	10	14939359	14939359	+	Nonsense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14939359C>G	uc001inh.2	+	2	568	c.512C>G	c.(511-513)TCA>TGA	p.S171*	SUV39H2_uc001ing.2_Intron|SUV39H2_uc001ini.2_Nonsense_Mutation_p.S171*|SUV39H2_uc001inj.2_Nonsense_Mutation_p.S171*	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2	231	Pre-SET.				cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding			breast(2)|ovary(1)	3						GAATGCAACTCAAGGTGTCAG	0.418													34	98	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17432598	17432598	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17432598C>A	uc001ipd.2	-	3	222	c.222G>T	c.(220-222)TCG>TCT	p.S74S	ST8SIA6_uc010qce.1_RNA|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	74	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						TCAGTTGGAGCGACTTCTCAT	0.308													55	43	---	---	---	---	PASS
STAM	8027	broad.mit.edu	37	10	17737147	17737147	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17737147G>T	uc001ipj.1	+	7	851	c.635G>T	c.(634-636)GGC>GTC	p.G212V	STAM_uc010qcf.1_Missense_Mutation_p.G101V|STAM_uc009xjw.1_5'UTR	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	212	SH3.		G -> D (in a colorectal cancer sample; somatic mutation).		cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity	p.G212D(1)		large_intestine(1)|ovary(1)	2						CAACATGAAGGCCGAAAAGTT	0.408													36	70	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24908835	24908835	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24908835C>A	uc001isb.2	-	9	2476	c.1989G>T	c.(1987-1989)CAG>CAT	p.Q663H	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.Q663H|ARHGAP21_uc010qdc.1_Missense_Mutation_p.Q498H|ARHGAP21_uc001isc.1_Missense_Mutation_p.Q653H	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	662					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CCCATGTCTGCTGATTCAACA	0.483													34	24	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28233794	28233794	+	Missense_Mutation	SNP	C	A	A	rs138924660		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28233794C>A	uc009xky.2	-	11	1582	c.1484G>T	c.(1483-1485)GGC>GTC	p.G495V	ARMC4_uc010qds.1_Missense_Mutation_p.G20V|ARMC4_uc010qdt.1_Missense_Mutation_p.G187V|ARMC4_uc001itz.2_Missense_Mutation_p.G495V|ARMC4_uc010qdu.1_Missense_Mutation_p.G187V	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	495	ARM 1.						binding			ovary(4)|skin(2)	6						CACTTCCAGGCCTCCAACATC	0.478													66	34	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582571	55582571	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582571T>C	uc001jju.1	-	33	5310	c.4915A>G	c.(4915-4917)ATA>GTA	p.I1639V	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.I1636V|PCDH15_uc010qhw.1_Missense_Mutation_p.I1599V|PCDH15_uc010qhx.1_Missense_Mutation_p.I1570V|PCDH15_uc010qhy.1_Missense_Mutation_p.I1646V|PCDH15_uc010qhz.1_Missense_Mutation_p.I1641V|PCDH15_uc010qia.1_Missense_Mutation_p.I1619V|PCDH15_uc010qib.1_Missense_Mutation_p.I1616V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1639	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CCTTGCCTTATTTCCTCTTTC	0.398										HNSCC(58;0.16)			63	99	---	---	---	---	PASS
KIAA0913	23053	broad.mit.edu	37	10	75558775	75558775	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75558775G>T	uc009xrl.2	+	21	4209	c.4177G>T	c.(4177-4179)GAG>TAG	p.E1393*	KIAA0913_uc001jve.2_Nonsense_Mutation_p.E1398*|KIAA0913_uc001jvf.2_Nonsense_Mutation_p.E1393*|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Nonsense_Mutation_p.E828*|KIAA0913_uc010qkr.1_Nonsense_Mutation_p.E816*|KIAA0913_uc001jvj.2_Nonsense_Mutation_p.E816*|KIAA0913_uc009xrn.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	1393							zinc ion binding			breast(1)	1	Prostate(51;0.0112)					CCTGATGTTGGAGAAGGCCTG	0.532													3	38	---	---	---	---	PASS
FAM190B	54462	broad.mit.edu	37	10	86131058	86131058	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86131058A>G	uc001kdh.1	+	2	444	c.250A>G	c.(250-252)AAT>GAT	p.N84D	FAM190B_uc001kdg.1_Missense_Mutation_p.N84D|FAM190B_uc010qmd.1_Missense_Mutation_p.N84D	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14	84										ovary(3)|skin(1)	4						AGAGCCTAACAATACTCAAAA	0.338													39	13	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	96066240	96066240	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96066240A>T	uc001kjk.2	+	26	6313	c.5679A>T	c.(5677-5679)GAA>GAT	p.E1893D	PLCE1_uc010qnx.1_Missense_Mutation_p.E1877D|PLCE1_uc001kjm.2_Missense_Mutation_p.E1585D|PLCE1_uc001kjp.2_Missense_Mutation_p.E251D	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1893	C2.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				CGTGCATTGAAGTCGACGTCC	0.527													97	45	---	---	---	---	PASS
FRAT2	23401	broad.mit.edu	37	10	99093814	99093814	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99093814G>A	uc001knd.1	-	1	645	c.516C>T	c.(514-516)GAC>GAT	p.D172D		NM_012083	NP_036215	O75474	FRAT2_HUMAN	GSK-3 binding protein FRAT2	172					cell proliferation|multicellular organismal development|Wnt receptor signaling pathway						0		Colorectal(252;0.0846)		Epithelial(162;1.34e-09)|all cancers(201;8.42e-08)		GCGGGTCGTCGTCGCCGGCGC	0.721													7	4	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99677372	99677372	+	Nonsense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99677372G>C	uc001kou.1	-	5	956	c.600C>G	c.(598-600)TAC>TAG	p.Y200*	CRTAC1_uc001kov.2_Nonsense_Mutation_p.Y189*|CRTAC1_uc001kot.1_5'UTR	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	200						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CCACATTACCGTAGGCGTAAT	0.592													30	10	---	---	---	---	PASS
SH3PXD2A	9644	broad.mit.edu	37	10	105362464	105362464	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105362464T>G	uc001kxj.1	-	14	2567	c.2427A>C	c.(2425-2427)GAA>GAC	p.E809D	SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Missense_Mutation_p.E644D|SH3PXD2A_uc010qqt.1_Missense_Mutation_p.E686D|SH3PXD2A_uc009xxn.1_Missense_Mutation_p.E644D|SH3PXD2A_uc010qqu.1_Missense_Mutation_p.E752D	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	837					cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GCCCTTCCCATTCCTTCTTGG	0.642													53	21	---	---	---	---	PASS
SH3PXD2A	9644	broad.mit.edu	37	10	105362496	105362496	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105362496C>T	uc001kxj.1	-	14	2535	c.2395G>A	c.(2395-2397)GCC>ACC	p.A799T	SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Missense_Mutation_p.A634T|SH3PXD2A_uc010qqt.1_Missense_Mutation_p.A676T|SH3PXD2A_uc009xxn.1_Missense_Mutation_p.A634T|SH3PXD2A_uc010qqu.1_Missense_Mutation_p.A742T	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1	827					cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GGAGTGGTGGCTGGGAGGGTG	0.627													60	33	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801779	120801779	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801779C>A	uc001ldu.2	-	19	3399	c.3253G>T	c.(3253-3255)GAT>TAT	p.D1085Y	EIF3A_uc010qsu.1_Missense_Mutation_p.D1051Y|EIF3A_uc009xzg.1_Missense_Mutation_p.D124Y	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1085	17.|Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCCCGGTCATCATCCATGCCT	0.627													109	53	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120832423	120832423	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120832423A>G	uc001ldu.2	-	4	666	c.520T>C	c.(520-522)TAC>CAC	p.Y174H	EIF3A_uc010qsu.1_Missense_Mutation_p.Y140H	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	174					formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATATCATGGTACAGGCGCTCT	0.383													78	25	---	---	---	---	PASS
OR51B4	79339	broad.mit.edu	37	11	5322673	5322673	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5322673G>T	uc010qza.1	-	1	504	c.504C>A	c.(502-504)TCC>TCA	p.S168S	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGGGCACGGGAACCACAAT	0.418													44	58	---	---	---	---	PASS
UBQLNL	143630	broad.mit.edu	37	11	5537191	5537191	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5537191T>A	uc001maz.3	-	1	766	c.481A>T	c.(481-483)ACC>TCC	p.T161S	HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	161										large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		AAGTTTTGGGTATGCACTTTG	0.517													80	58	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969309	5969309	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969309T>C	uc010qzt.1	+	1	733	c.733T>C	c.(733-735)TGT>CGT	p.C245R		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTAAGCACATGTGGCTCCCA	0.517													55	218	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6191170	6191170	+	Silent	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6191170A>G	uc010qzy.1	-	1	387	c.387T>C	c.(385-387)TGT>TGC	p.C129C		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAGTGGGGCACAAATGGCCA	0.502													18	62	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17124270	17124270	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17124270T>A	uc001mmq.3	-	23	3856	c.3790A>T	c.(3790-3792)ATG>TTG	p.M1264L	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Missense_Mutation_p.M884L|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	1264	PI3K/PI4K.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	ATGTGAAACATGTGTCCCGTG	0.408													43	87	---	---	---	---	PASS
LDLRAD3	143458	broad.mit.edu	37	11	36057729	36057729	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36057729G>A	uc001mwk.1	+	2	160	c.123G>A	c.(121-123)CGG>CGA	p.R41R	LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain	41	LDL-receptor class A 1.|Extracellular (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				GCAATGGACGGTGCATCCCGG	0.602													24	89	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40137227	40137227	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137227T>A	uc001mxa.1	-	2	2580	c.616A>T	c.(616-618)ATG>TTG	p.M206L	LRRC4C_uc001mxc.1_Missense_Mutation_p.M202L|LRRC4C_uc001mxd.1_Missense_Mutation_p.M202L|LRRC4C_uc001mxb.1_Missense_Mutation_p.M202L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	206	LRR 6.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				AGGTTGCACATGGCAAGGTTC	0.453													29	106	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003789	50003789	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003789G>T	uc010ria.1	-	1	249	c.249C>A	c.(247-249)TCC>TCA	p.S83S		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	83	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TCTCTTGAAAGGAATCCACAA	0.443													81	64	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579306	55579306	+	Missense_Mutation	SNP	C	G	G	rs149851583	byFrequency	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579306C>G	uc001nhw.1	+	1	364	c.364C>G	c.(364-366)CGC>GGC	p.R122G		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				GGCCTATGACCGCTTTGTGGC	0.527													70	90	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55655497	55655497	+	Intron	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55655497T>C	uc010rip.1	+						SPRYD5_uc010riq.1_Intron	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5							intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TTTGACTAATTGTCACTGCAG	0.353													5	36	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55655742	55655742	+	Intron	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55655742T>C	uc010rip.1	+						SPRYD5_uc010riq.1_Intron	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5							intracellular	zinc ion binding				0		all_epithelial(135;0.226)				ACTCCAGGTATGGACTGACCA	0.443													3	47	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872567	55872567	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872567G>A	uc010riy.1	+	1	49	c.49G>A	c.(49-51)GGA>AGA	p.G17R		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					CATCCTTATGGGACTGACACT	0.408										HNSCC(53;0.14)			64	211	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872568	55872568	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872568G>T	uc010riy.1	+	1	50	c.50G>T	c.(49-51)GGA>GTA	p.G17V		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					ATCCTTATGGGACTGACACTT	0.413										HNSCC(53;0.14)			65	211	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043328	56043328	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043328T>A	uc001nio.1	+	1	214	c.214T>A	c.(214-216)TAC>AAC	p.Y72N		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					CAGCCCAATGTACTATTTTCT	0.348													52	47	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043399	56043399	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043399C>A	uc001nio.1	+	1	285	c.285C>A	c.(283-285)GTC>GTA	p.V95V		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					AAATGTTGGTCAATTTCCTGG	0.378													95	77	---	---	---	---	PASS
OR5M9	390162	broad.mit.edu	37	11	56230873	56230873	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56230873G>T	uc010rjj.1	-	1	5	c.5C>A	c.(4-6)CCT>CAT	p.P2H		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					CGTGAAATTAGGCATTGCCTT	0.408													5	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	57983204	57983204	+	IGR	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57983204C>G								OR1S1 (11 upstream) : OR10Q1 (12185 downstream)																							ATGCCCTGGACCTCTACATTC	0.408													61	181	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58190174	58190174	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190174G>A	uc010rkg.1	-	1	561	c.561C>T	c.(559-561)TGC>TGT	p.C187C		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTTTATCAGAGCAAGACAGAG	0.373													30	34	---	---	---	---	PASS
OR5A2	219981	broad.mit.edu	37	11	59189883	59189883	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59189883G>T	uc010rkt.1	-	1	544	c.544C>A	c.(544-546)CTC>ATC	p.L182I		NM_001001954	NP_001001954	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACTGGAGGGAGGTCACAGAAA	0.478													25	75	---	---	---	---	PASS
OR4D10	390197	broad.mit.edu	37	11	59245475	59245475	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245475C>T	uc001nnz.1	+	1	573	c.573C>T	c.(571-573)GAC>GAT	p.D191D		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	191	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						CCCATACAGACATTTTCATAC	0.453													55	40	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61511438	61511438	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61511438G>C	uc001nsa.2	+	20	2717	c.2606G>C	c.(2605-2607)CGG>CCG	p.R869P		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	869	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		ACTCCTGAGCGGCCCCCCAGT	0.731													24	57	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62749403	62749403	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62749403G>A	uc001nwk.2	-	4	1015	c.708C>T	c.(706-708)CTC>CTT	p.L236L	SLC22A6_uc001nwl.2_Silent_p.L236L|SLC22A6_uc001nwj.2_Silent_p.L236L|SLC22A6_uc001nwm.2_Silent_p.L236L	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	236	Helical; (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						CACCAGCCAGGAGGAACTGGC	0.592													25	18	---	---	---	---	PASS
LTBP3	4054	broad.mit.edu	37	11	65320915	65320915	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65320915G>T	uc001oej.2	-	4	1220	c.951C>A	c.(949-951)CAC>CAA	p.H317Q	LTBP3_uc010roi.1_Missense_Mutation_p.H200Q|LTBP3_uc001oei.2_Missense_Mutation_p.H317Q|LTBP3_uc010roj.1_Intron|LTBP3_uc010rok.1_Missense_Mutation_p.H228Q	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding	317	TB 1.					extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						GGGGACACTTGTGGCACTTGC	0.667													3	54	---	---	---	---	PASS
PELI3	246330	broad.mit.edu	37	11	66239871	66239871	+	Nonsense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66239871C>A	uc001oic.3	+	5	550	c.386C>A	c.(385-387)TCG>TAG	p.S129*	PELI3_uc001oib.2_Nonsense_Mutation_p.S129*|PELI3_uc001oid.3_Nonsense_Mutation_p.S105*|PELI3_uc001oie.3_5'UTR|PELI3_uc010rpd.1_5'Flank	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1	129						cytosol	protein binding			ovary(1)	1						CACAGCATCTCGTATACACTG	0.532													4	148	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66472375	66472375	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66472375G>A	uc001ojd.2	-	14	2444	c.2372C>T	c.(2371-2373)GCC>GTC	p.A791V		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	791	Spectrin 5.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CTCCTCCAGGGCCCGATGCTG	0.682													24	87	---	---	---	---	PASS
FOLR3	2352	broad.mit.edu	37	11	71850388	71850388	+	Intron	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71850388C>G	uc001ory.1	+						FOLR3_uc001orx.1_Intron			P41439	FOLR3_HUMAN	SubName: Full=FOLR3 protein; Flags: Fragment;						folic acid transport	extracellular region|extrinsic to membrane|membrane fraction	folic acid binding|receptor activity				0					Folic Acid(DB00158)	CCTCCCCACTCAGGTCAACCA	0.607													12	4	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78412887	78412887	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78412887T>A	uc001ozl.3	-	28	5234	c.4771A>T	c.(4771-4773)ACC>TCC	p.T1591S	ODZ4_uc009yvb.1_Missense_Mutation_p.T175S	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1591	Extracellular (Potential).|YD 1.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TTGCCGGTGGTATCAAACAGA	0.502													82	72	---	---	---	---	PASS
CCDC81	60494	broad.mit.edu	37	11	86111844	86111844	+	Splice_Site	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86111844G>T	uc001pbx.1	+	7	1309	c.881_splice	c.e7+1	p.S294_splice	CCDC81_uc001pbw.1_Splice_Site_p.S204_splice|CCDC81_uc010rtq.1_Splice_Site_p.S77_splice|CCDC81_uc001pby.1_Splice_Site_p.S77_splice	NM_001156474	NP_001149946	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81 isoform 1											skin(1)	1		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				CCCCTGAAAGGTAATGCATTG	0.358													72	66	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88242498	88242498	+	Silent	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88242498T>C	uc001pcq.2	-	9	3101	c.2901A>G	c.(2899-2901)GCA>GCG	p.A967A	GRM5_uc009yvm.2_Silent_p.A935A	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	967	Cytoplasmic (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	CGCTCCCGCCTGCGCCAGCGC	0.726													23	8	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92526090	92526090	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92526090C>A	uc001pdj.3	+	8	4786	c.4769C>A	c.(4768-4770)GCT>GAT	p.A1590D		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1590	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAAGTGACGGCTCTGGACAAA	0.448										TCGA Ovarian(4;0.039)			48	37	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731217	94731217	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731217C>A	uc001pfe.2	+	3	1513	c.681C>A	c.(679-681)GCC>GCA	p.A227A		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	227	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AACGCCTGGCCAGGGAGCTCT	0.592													25	81	---	---	---	---	PASS
JRKL	8690	broad.mit.edu	37	11	96123813	96123813	+	5'UTR	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96123813T>A	uc009ywu.2	+	2					CCDC82_uc001pfx.3_5'Flank|CCDC82_uc009ywr.2_5'Flank|CCDC82_uc009ywt.1_5'Flank|JRKL_uc001pfy.2_5'UTR	NM_003772	NP_003763	Q9Y4A0	JERKL_HUMAN	jerky homolog-like						central nervous system development|regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		AGAACCTCGCTATGTCAGGGA	0.438													14	47	---	---	---	---	PASS
PDGFD	80310	broad.mit.edu	37	11	103780489	103780489	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103780489A>G	uc001phq.2	-	7	1418	c.1046T>C	c.(1045-1047)CTA>CCA	p.L349P	PDGFD_uc001php.2_Missense_Mutation_p.L343P	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1	349					positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GATGTCAACTAGAGCCATGGT	0.458													48	121	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106681206	106681206	+	Splice_Site	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106681206T>C	uc001pjg.1	-	5	1597	c.1207_splice	c.e5-1	p.V403_splice	GUCY1A2_uc010rvo.1_Splice_Site_p.V424_splice|GUCY1A2_uc009yxn.1_Splice_Site_p.V403_splice	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		TTCCATCACCTGTGAAATTAA	0.333													50	55	---	---	---	---	PASS
DIXDC1	85458	broad.mit.edu	37	11	111844922	111844922	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111844922C>T	uc001pml.2	+	4	789	c.492C>T	c.(490-492)GCC>GCT	p.A164A	DIXDC1_uc001pmj.2_Silent_p.A157A|DIXDC1_uc001pmk.2_Silent_p.A164A	NM_001037954	NP_001033043	Q155Q3	DIXC1_HUMAN	DIX domain containing 1 isoform a	164	Actin-binding.				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity			ovary(1)	1		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		CTGCTCTGGCCGATGTGTGTC	0.572													23	10	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119027673	119027673	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119027673G>A	uc001pvs.2	+	9	1353	c.1017G>A	c.(1015-1017)AAG>AAA	p.K339K	ABCG4_uc009zar.2_Silent_p.K339K	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	339	Cytoplasmic (Potential).				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CTGAGAAGAAGAGCAGCCCTG	0.607													52	164	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120996008	120996008	+	Intron	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120996008C>T	uc010rzo.1	+							NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CTGTTGTTGGCAGGTTAATGA	0.488													44	100	---	---	---	---	PASS
CRTAM	56253	broad.mit.edu	37	11	122738174	122738174	+	Missense_Mutation	SNP	C	G	G	rs141494048		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122738174C>G	uc001pyj.2	+	8	875	c.875C>G	c.(874-876)ACG>AGG	p.T292R	CRTAM_uc001pyk.2_Missense_Mutation_p.T93R	NM_019604	NP_062550	O95727	CRTAM_HUMAN	class-I MHC-restricted T cell associated	292	Helical; (Potential).				cell recognition|detection of tumor cell|positive regulation of cytokine secretion|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	integral to membrane|plasma membrane	receptor binding			ovary(1)	1		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		CTGCTGCTCACGCTGGTGTCC	0.413													13	49	---	---	---	---	PASS
PRDM10	56980	broad.mit.edu	37	11	129812419	129812419	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129812419C>A	uc001qfm.2	-	7	1100	c.868G>T	c.(868-870)GCC>TCC	p.A290S	PRDM10_uc001qfj.2_Missense_Mutation_p.A204S|PRDM10_uc001qfk.2_Missense_Mutation_p.A204S|PRDM10_uc001qfl.2_Missense_Mutation_p.A204S|PRDM10_uc010sbx.1_Missense_Mutation_p.A204S|PRDM10_uc001qfn.2_Missense_Mutation_p.A290S|PRDM10_uc009zct.1_Missense_Mutation_p.A322S	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1	290	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TGATTCTGGGCTGGCCGTACA	0.453													73	68	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1969325	1969325	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1969325G>T	uc001qjp.2	-	19	2157	c.1926C>A	c.(1924-1926)AGC>AGA	p.S642R	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.S506R	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	642	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		AAGGGGTGTCGCTGATGTCCG	0.483													11	51	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2676768	2676768	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2676768C>T	uc009zdu.1	+	13	2016	c.1703C>T	c.(1702-1704)ACG>ATG	p.T568M	CACNA1C_uc009zdv.1_Missense_Mutation_p.T565M|CACNA1C_uc001qkb.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkc.2_Missense_Mutation_p.T568M|CACNA1C_uc001qke.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkf.2_Missense_Mutation_p.T568M|CACNA1C_uc001qjz.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkd.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkg.2_Missense_Mutation_p.T568M|CACNA1C_uc009zdw.1_Missense_Mutation_p.T568M|CACNA1C_uc001qkh.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkl.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkn.2_Missense_Mutation_p.T568M|CACNA1C_uc001qko.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkp.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkr.2_Missense_Mutation_p.T568M|CACNA1C_uc001qku.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkq.2_Missense_Mutation_p.T568M|CACNA1C_uc001qks.2_Missense_Mutation_p.T568M|CACNA1C_uc001qkt.2_Missense_Mutation_p.T568M|CACNA1C_uc001qka.1_Missense_Mutation_p.T103M|CACNA1C_uc001qki.1_Missense_Mutation_p.T304M|CACNA1C_uc001qkj.1_Missense_Mutation_p.T304M|CACNA1C_uc001qkk.1_Missense_Mutation_p.T304M|CACNA1C_uc001qkm.1_Missense_Mutation_p.T304M	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	568	Helical; Name=S2 of repeat II; (Potential).|II.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	GCCCTGTTCACGGCAGAGATG	0.617													21	9	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21445117	21445117	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21445117C>T	uc001rer.2	-	11	1842	c.1591G>A	c.(1591-1593)GGA>AGA	p.G531R	SLCO1A2_uc001res.2_Missense_Mutation_p.G531R|SLCO1A2_uc010siq.1_Missense_Mutation_p.G399R|SLCO1A2_uc010sio.1_Missense_Mutation_p.G399R|SLCO1A2_uc010sip.1_Missense_Mutation_p.G399R|SLCO1A2_uc001ret.2_Missense_Mutation_p.G529R	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	531	Helical; Name=10; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ACCATATATCCAGGTATGGCA	0.383													10	8	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26217730	26217730	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217730G>A	uc001rgx.2	+	3	624	c.403G>A	c.(403-405)GGT>AGT	p.G135S	RASSF8_uc001rgy.2_Missense_Mutation_p.G135S|RASSF8_uc001rgz.2_Missense_Mutation_p.G135S|RASSF8_uc009zjd.1_Missense_Mutation_p.G135S|RASSF8_uc009zje.1_Missense_Mutation_p.G135S	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	135					signal transduction						0	Colorectal(261;0.0847)					ATTTACAGGAGGTGCCAAAGG	0.408													69	212	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26217731	26217731	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217731G>C	uc001rgx.2	+	3	625	c.404G>C	c.(403-405)GGT>GCT	p.G135A	RASSF8_uc001rgy.2_Missense_Mutation_p.G135A|RASSF8_uc001rgz.2_Missense_Mutation_p.G135A|RASSF8_uc009zjd.1_Missense_Mutation_p.G135A|RASSF8_uc009zje.1_Missense_Mutation_p.G135A	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	135					signal transduction						0	Colorectal(261;0.0847)					TTTACAGGAGGTGCCAAAGGA	0.413													70	213	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29911675	29911675	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29911675C>T	uc001rjb.2	-	3	666	c.192G>A	c.(190-192)GCG>GCA	p.A64A	TMTC1_uc001rjc.1_Silent_p.A64A	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	172	Helical; (Potential).					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					ACAGCAGACACGCTAACACGT	0.428													56	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31279291	31279291	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31279291G>T	uc010sjy.1	-	26	3462	c.3462C>A	c.(3460-3462)GCC>GCA	p.A1154A						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		TTAGTTTTGTGGCAGATTGAT	0.423													168	83	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	33031203	33031203	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33031203C>A	uc001rlj.3	-	3	726	c.611G>T	c.(610-612)CGT>CTT	p.R204L	PKP2_uc001rlk.3_Missense_Mutation_p.R204L|PKP2_uc010skj.1_Missense_Mutation_p.R204L	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	204					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GGTGCCAGCACGGCTGACCCC	0.602													93	70	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41333217	41333217	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41333217A>G	uc001rmm.1	+	12	1422	c.1309A>G	c.(1309-1311)AAA>GAA	p.K437E	CNTN1_uc009zjy.1_Missense_Mutation_p.K437E|CNTN1_uc001rmn.1_Missense_Mutation_p.K426E|CNTN1_uc001rmo.2_Missense_Mutation_p.K437E	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	437	Ig-like C2-type 5.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATTGAATGCAAACCTAAAGC	0.403													24	47	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41900384	41900384	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41900384G>T	uc010skn.1	+	4	441	c.373G>T	c.(373-375)GCT>TCT	p.A125S	PDZRN4_uc001rmq.3_Missense_Mutation_p.A66S|PDZRN4_uc009zjz.2_Missense_Mutation_p.A64S|PDZRN4_uc001rmr.2_5'Flank	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	324							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CTATGGGATGGCTTCAGAAGT	0.537													23	85	---	---	---	---	PASS
GXYLT1	283464	broad.mit.edu	37	12	42491380	42491380	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42491380C>A	uc001rms.3	-	7	1250	c.1025G>T	c.(1024-1026)CGA>CTA	p.R342L	GXYLT1_uc001rmt.3_Missense_Mutation_p.R311L	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3	342	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						ATGATCTGGTCGATAATTCCA	0.368													83	76	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46245335	46245335	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46245335G>A	uc001ros.1	+	15	3429	c.3429G>A	c.(3427-3429)GTG>GTA	p.V1143V	ARID2_uc001ror.2_Silent_p.V1143V|ARID2_uc009zkg.1_Silent_p.V599V|ARID2_uc009zkh.1_Silent_p.V770V|ARID2_uc001rou.1_Silent_p.V477V	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1143					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TACAAACTGTGCCCATTTCGA	0.498													48	120	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49050461	49050461	+	Intron	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49050461G>A	uc001rrx.2	-						C12orf41_uc001rrw.2_Intron|C12orf41_uc001rrz.2_Intron|C12orf41_uc001rry.2_Intron|C12orf41_uc001rru.2_Intron|C12orf41_uc001rrv.2_Intron|SNORA34_uc001rsa.1_5'Flank|MIR1291_hsa-mir-1291|MI0006353_5'Flank|SNORA2A_uc001rsb.1_RNA	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934											ovary(2)	2						TTGGCAATTCGCACTGGAATA	0.373													12	32	---	---	---	---	PASS
PCBP2	5094	broad.mit.edu	37	12	53853162	53853162	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53853162G>T	uc001sdl.3	+	6	700	c.350G>T	c.(349-351)GGA>GTA	p.G117V	PCBP2_uc001sdc.3_Missense_Mutation_p.G117V|PCBP2_uc001sdb.3_Missense_Mutation_p.G117V|PCBP2_uc001sde.3_Missense_Mutation_p.G117V|PCBP2_uc001sdi.3_Missense_Mutation_p.G117V|PCBP2_uc001sdd.3_Missense_Mutation_p.G117V|PCBP2_uc001sdf.3_Missense_Mutation_p.G117V|PCBP2_uc009zna.2_Missense_Mutation_p.G78V|PCBP2_uc010soh.1_Missense_Mutation_p.G117V|PCBP2_uc009zmz.1_Missense_Mutation_p.G59V|PCBP2_uc001sdg.1_RNA	NM_001128911	NP_001122383	Q15366	PCBP2_HUMAN	poly(rC) binding protein 2 isoform d	117	KH 2.				innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0						GGAAAAGGTGGATGCAAGATC	0.468													56	66	---	---	---	---	PASS
HOXC8	3224	broad.mit.edu	37	12	54403503	54403503	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54403503C>A	uc001ser.2	+	1	614	c.435C>A	c.(433-435)CAC>CAA	p.H145Q		NM_022658	NP_073149	P31273	HXC8_HUMAN	homeobox C8	145						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGAGACCCCACGGTGAGAAGC	0.552													64	78	---	---	---	---	PASS
FAM19A2	338811	broad.mit.edu	37	12	62147453	62147453	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62147453C>A	uc001sqw.2	-	4	1847	c.334G>T	c.(334-336)GAT>TAT	p.D112Y	FAM19A2_uc001sqv.2_RNA|FAM19A2_uc001sqx.2_Missense_Mutation_p.D112Y|FAM19A2_uc001sqy.2_RNA	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine	112						cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		CCTTTCCGATCCGGAAGAACT	0.413													35	102	---	---	---	---	PASS
OSBPL8	114882	broad.mit.edu	37	12	76767136	76767136	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76767136C>A	uc001sye.1	-	18	2385	c.1905G>T	c.(1903-1905)TTG>TTT	p.L635F	OSBPL8_uc001syf.1_Missense_Mutation_p.L593F|OSBPL8_uc001syg.1_Missense_Mutation_p.L593F|OSBPL8_uc001syh.1_Missense_Mutation_p.L610F	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform	635					lipid transport		lipid binding			ovary(1)	1						AATGACCTTCCAAAGTAGCTA	0.303													25	88	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78444708	78444708	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78444708G>T	uc001syp.2	+	11	2470	c.2297G>T	c.(2296-2298)AGT>ATT	p.S766I	NAV3_uc001syo.2_Missense_Mutation_p.S766I|NAV3_uc010sub.1_Missense_Mutation_p.S266I	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	766						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TATCCTCGCAGTGGTACCAGT	0.587										HNSCC(70;0.22)			10	38	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85517965	85517965	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85517965A>T	uc001tac.2	+	17	3786	c.3675A>T	c.(3673-3675)AAA>AAT	p.K1225N	LRRIQ1_uc001tab.1_Missense_Mutation_p.K1225N	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1225										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TCACCAAGAAAGATGAATCAG	0.413													21	75	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104056721	104056721	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104056721C>T	uc001tjw.2	+	18	2153	c.1967C>T	c.(1966-1968)TCC>TTC	p.S656F		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	656	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATTCCTCCCTCCATTGTCCCG	0.453													72	60	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104129294	104129294	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104129294C>G	uc001tjw.2	+	52	5672	c.5486C>G	c.(5485-5487)TCC>TGC	p.S1829C	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1829	Extracellular (Potential).|FAS1 6.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CTTCCCACATCCACTGCCTGG	0.552													7	19	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105445870	105445870	+	Silent	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105445870A>G	uc001tlc.2	-	12	1660	c.1533T>C	c.(1531-1533)TAT>TAC	p.Y511Y	ALDH1L2_uc009zuo.2_5'UTR|ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	511	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						aGAAATACCTATACATCAATC	0.244													17	61	---	---	---	---	PASS
CKAP4	10970	broad.mit.edu	37	12	106633568	106633568	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106633568G>A	uc001tlk.2	-	2	1127	c.1043C>T	c.(1042-1044)GCC>GTC	p.A348V		NM_006825	NP_006816	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	348	Potential.					ER-Golgi intermediate compartment membrane|integral to membrane|membrane fraction					0						GGCCTGCAGGGCGAGCCGCTC	0.642													15	15	---	---	---	---	PASS
ASCL4	121549	broad.mit.edu	37	12	108169080	108169080	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108169080G>A	uc001tmr.2	+	1	919	c.88G>A	c.(88-90)GGA>AGA	p.G30R		NM_203436	NP_982260	Q6XD76	ASCL4_HUMAN	achaete-scute complex-like 4	29					regulation of transcription from RNA polymerase II promoter|skin development|transcription, DNA-dependent	nucleus	DNA binding			central_nervous_system(1)	1						GACCCTGCCCGGACTCCCGCG	0.716													31	87	---	---	---	---	PASS
DDX54	79039	broad.mit.edu	37	12	113612523	113612523	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113612523C>A	uc001tup.2	-	10	1018	c.990G>T	c.(988-990)CTG>CTT	p.L330L	DDX54_uc001tuq.3_Silent_p.L330L	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	330	Helicase C-terminal.				estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						CGTTGTGCAGCAGGTGGAGCA	0.647											OREG0022139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	56	---	---	---	---	PASS
VPS33A	65082	broad.mit.edu	37	12	122745859	122745859	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122745859G>A	uc001ucd.2	-	4	545	c.432C>T	c.(430-432)CTC>CTT	p.L144L	VPS33A_uc001ucc.2_RNA|VPS33A_uc001uce.2_Silent_p.L144L	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A	144					lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CGAATGGAATGAGATCTAAGC	0.453													44	84	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20987499	20987499	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20987499C>A	uc001une.2	-	6	740	c.661G>T	c.(661-663)GAC>TAC	p.D221Y	CRYL1_uc001unf.2_Missense_Mutation_p.D199Y|CRYL1_uc001ung.2_Missense_Mutation_p.D199Y	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin	221					fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		ATGACAAGGTCCAGGTCACTA	0.483													30	10	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42871185	42871185	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42871185A>G	uc001uys.1	+	6	393	c.218A>G	c.(217-219)GAT>GGT	p.D73G		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	73					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTAAATCAGGATTTAGCTGCA	0.303													88	40	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77644818	77644818	+	Missense_Mutation	SNP	T	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77644818T>G	uc001vkf.2	-	70	11829	c.11738A>C	c.(11737-11739)CAT>CCT	p.H3913P	MYCBP2_uc010aev.2_Missense_Mutation_p.H3317P|MYCBP2_uc001vke.2_Missense_Mutation_p.H530P	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	3913					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCCAACCATATGTTCTTTCAG	0.289													95	37	---	---	---	---	PASS
HS6ST3	266722	broad.mit.edu	37	13	97484966	97484966	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97484966G>C	uc001vmw.2	+	2	954	c.930G>C	c.(928-930)CAG>CAC	p.Q310H		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	310	Lumenal (Potential).					integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					ACAATCGCCAGGTGCGCATGC	0.537													52	14	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20345187	20345187	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20345187G>T	uc001vwh.1	+	1	761	c.761G>T	c.(760-762)TGC>TTC	p.C254F		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	254	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTGGGCCATGCATCTTCATC	0.418													112	170	---	---	---	---	PASS
JPH4	84502	broad.mit.edu	37	14	24045142	24045142	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24045142G>T	uc001wkq.2	-	4	1821	c.903C>A	c.(901-903)AAC>AAA	p.N301K	JPH4_uc010tnr.1_5'Flank|JPH4_uc001wkr.2_Missense_Mutation_p.N301K|JPH4_uc001wks.2_Missense_Mutation_p.N301K	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	301	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		AGCGCAGCCCGTTGGAGCGCT	0.677													7	1	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53619450	53619450	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53619450G>A	uc001xai.2	-	1	597	c.367C>T	c.(367-369)CCT>TCT	p.P123S	DDHD1_uc001xaj.2_Missense_Mutation_p.P123S|DDHD1_uc001xah.2_Missense_Mutation_p.P123S	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	123					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					ACCAGCGGAGGCTGCTGCGGC	0.746													9	1	---	---	---	---	PASS
ZBTB1	22890	broad.mit.edu	37	14	64988813	64988813	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64988813C>T	uc001xhh.3	+	4	1022	c.591C>T	c.(589-591)TCC>TCT	p.S197S	ZBTB1_uc010aqg.2_Silent_p.S197S|ZBTB1_uc001xhi.2_Silent_p.S197S	NM_001123329	NP_001116801	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1 isoform	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AAAAAAGTTCCGTGTCCAAAT	0.378													72	29	---	---	---	---	PASS
DPF3	8110	broad.mit.edu	37	14	73140939	73140939	+	Intron	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73140939C>G	uc001xnc.2	-						DPF3_uc001xnd.1_Intron|DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GGGAAGGGGCCACACTCACCA	0.592													11	4	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94004430	94004430	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94004430G>T	uc001ybv.1	+	9	770	c.687G>T	c.(685-687)AGG>AGT	p.R229S	KIAA1409_uc001ybs.1_Missense_Mutation_p.R229S|KIAA1409_uc001ybu.1_Missense_Mutation_p.R167S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	406						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ACTGCAAGAGGTGCCACTCAA	0.567													72	18	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95033468	95033468	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95033468A>C	uc001ydk.2	+	3	877	c.811A>C	c.(811-813)AAA>CAA	p.K271Q	SERPINA4_uc010avd.2_Missense_Mutation_p.K308Q|SERPINA4_uc001ydl.2_Missense_Mutation_p.K271Q	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	271					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		GATGGATTACAAAGGAGACGC	0.493													69	11	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106173880	106173880	+	RNA	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106173880C>A	uc010tyt.1	-	3633		c.60018G>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysc.2_5'Flank					Parts of antibodies, mostly variable regions.												0						GCAGGTGGACCTCGGGCCGGA	0.677													23	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25423950	25423950	+	Intron	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25423950G>T	uc001yys.1	+						SNORD115-5_uc001yyv.1_RNA|SNORD115-7_uc001yyw.1_5'Flank|SNORD115-6_uc001yyx.1_5'Flank					Homo sapiens clone Rt-5 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		ATGCTCAATAGGATTACGCTG	0.507													142	239	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25429537	25429537	+	Intron	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25429537C>A	uc001yyy.1	+						uc001yza.1_Intron|SNORD115-9_uc001yzc.1_5'Flank					Homo sapiens clone Rt-7 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		TGAGGCCCAGCCTAGGTGAGA	0.507													99	186	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34105704	34105704	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34105704C>T	uc001zhi.2	+	74	10496	c.10426C>T	c.(10426-10428)CAC>TAC	p.H3476Y	RYR3_uc010bar.2_Missense_Mutation_p.H3471Y	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3476					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGCCGTCTGGCACAAACTGTT	0.512													100	164	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43044805	43044805	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43044805T>A	uc001zqo.2	-	14	3078	c.2639A>T	c.(2638-2640)AAG>ATG	p.K880M	TTBK2_uc010bcy.2_Missense_Mutation_p.K811M	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	880					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GTCATCATCCTTAGATATCTT	0.418													56	98	---	---	---	---	PASS
GLDN	342035	broad.mit.edu	37	15	51689784	51689784	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51689784G>T	uc002aba.2	+	6	975	c.806G>T	c.(805-807)GGC>GTC	p.G269V	GLDN_uc002abb.2_Missense_Mutation_p.G145V	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin	269	Extracellular (Potential).				cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		ATGTTCAACGGCCAGTGCCCA	0.632													27	45	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52098653	52098653	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52098653A>G	uc002abk.2	+	9	1177	c.956A>G	c.(955-957)TAC>TGC	p.Y319C	TMOD2_uc002abl.3_Missense_Mutation_p.Y283C|TMOD2_uc010bfb.2_Missense_Mutation_p.Y275C	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	319					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		AAGTTTGGATACCAGTTTACC	0.468													72	76	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52538196	52538196	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52538196C>G	uc010bff.2	-	17	2160	c.2023G>C	c.(2023-2025)GTT>CTT	p.V675L	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	675	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		GTTTCTAAAACGCCGCAGGCT	0.443													46	65	---	---	---	---	PASS
RAB27A	5873	broad.mit.edu	37	15	55520835	55520835	+	Silent	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55520835T>C	uc002aco.2	-	5	548	c.315A>G	c.(313-315)CAA>CAG	p.Q105Q	RAB27A_uc002acr.2_Silent_p.Q105Q|RAB27A_uc002acp.2_Silent_p.Q105Q|RAB27A_uc002acq.2_Silent_p.Q105Q	NM_183234	NP_899057	P51159	RB27A_HUMAN	Ras-related protein Rab-27A	105					small GTPase mediated signal transduction	dendrite|exocytic vesicle|late endosome|lysosome|melanosome	GTP binding|GTPase activity			ovary(1)	1				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		TGAGGAAACTTTGCTCATTTG	0.403													76	111	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56152937	56152937	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56152937C>A	uc002adj.2	-	6	2271	c.1971G>T	c.(1969-1971)CTG>CTT	p.L657L	NEDD4_uc002adl.2_Silent_p.L238L|NEDD4_uc002adi.2_Silent_p.L585L|NEDD4_uc010ugj.1_Silent_p.L641L|NEDD4_uc010bfm.2_Silent_p.L640L|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	657	Mediates interaction with TNIK (By similarity).				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GTTGTGCTTGCAGTTGAATGT	0.413													86	98	---	---	---	---	PASS
MAP2K5	5607	broad.mit.edu	37	15	67950889	67950889	+	Splice_Site	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67950889A>T	uc002aqu.2	+	12	1390	c.737_splice	c.e12-2	p.G246_splice	MAP2K5_uc002aqt.1_Splice_Site_p.G246_splice|MAP2K5_uc002aqv.2_Splice_Site_p.G246_splice|MAP2K5_uc002aqw.2_Splice_Site_p.G86_splice|MAP2K5_uc002aqx.2_Splice_Site_p.G56_splice	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						TTATCTCTACAGGGGGATCTT	0.388													66	100	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68479904	68479904	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68479904G>T	uc002aqz.2	+	14	1783	c.1687G>T	c.(1687-1689)GCT>TCT	p.A563S	PIAS1_uc002ara.2_Missense_Mutation_p.A171S	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	563	4 X 4 AA repeats of N-T-S-L.				androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						CTTGCTTGCCGCTGCAGCAGC	0.438													3	126	---	---	---	---	PASS
SPESP1	246777	broad.mit.edu	37	15	69238414	69238414	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69238414G>T	uc002arn.1	+	2	669	c.541G>T	c.(541-543)GTC>TTC	p.V181F	NOX5_uc002arp.1_Intron|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_145658	NP_663633	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1 precursor	181					multicellular organismal development	acrosomal vesicle					0						CAAGTCACCTGTCACCACTTT	0.448													106	184	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	71633672	71633672	+	Intron	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633672C>T	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						GTAGGTCCGGCGGTGCATCTT	0.443													28	129	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79291169	79291169	+	Splice_Site	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79291169T>A	uc002beq.2	-	19	3170	c.2795_splice	c.e19-1	p.G932_splice	RASGRF1_uc002bep.2_Splice_Site_p.G916_splice|RASGRF1_uc010blm.1_Splice_Site_p.G841_splice|RASGRF1_uc002ber.3_Splice_Site_p.G916_splice|RASGRF1_uc010unh.1_Splice_Site_p.G327_splice|RASGRF1_uc002beo.2_Splice_Site_p.G148_splice	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GGGGAAACCCTGGCAGCATGC	0.577													49	59	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81595882	81595882	+	Intron	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81595882C>T	uc002bgh.3	+						IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron|IL16_uc002bgi.1_Intron|IL16_uc002bgj.2_Intron|IL16_uc002bgk.2_Intron|IL16_uc002bgl.1_Intron|IL16_uc010unq.1_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TATGTATTTCCTCTGCAGCAA	0.323													27	40	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	87097716	87097716	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87097716G>C	uc002blz.1	+	20	2884	c.2804G>C	c.(2803-2805)AGA>ACA	p.R935T		NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	935					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						GGGGTGTCCAGAAGCTACACC	0.547													7	10	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3139746	3139746	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3139746C>T	uc002ctv.1	-	5	1612	c.1524G>A	c.(1522-1524)TCG>TCA	p.S508S	ZSCAN10_uc002cty.1_Silent_p.S169S|ZSCAN10_uc002ctw.1_Silent_p.S426S|ZSCAN10_uc002ctx.1_Silent_p.S436S	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	508	C2H2-type 7.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						TGACCAGCTGCGAGCTCTGCG	0.721													10	3	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27357843	27357843	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27357843G>T	uc002don.2	+	6	659	c.417G>T	c.(415-417)CTG>CTT	p.L139L	IL4R_uc002dom.2_Silent_p.L139L|IL4R_uc002dop.3_Silent_p.L124L|IL4R_uc010bxy.2_Silent_p.L139L|IL4R_uc002doo.2_5'UTR	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	139	Extracellular (Potential).|Fibronectin type-III.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CCGACACTCTGCTGCTGACCT	0.527													47	18	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31341848	31341848	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31341848C>A	uc002ebq.2	+	28	3296	c.3198C>A	c.(3196-3198)ATC>ATA	p.I1066I	ITGAM_uc002ebr.2_Silent_p.I1067I|ITGAM_uc010can.2_Silent_p.I472I	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	1066	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						ACCTCCTGATCGTGAGCACAG	0.627													20	5	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31926523	31926523	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31926523A>T	uc002ecs.3	+	4	1162	c.953A>T	c.(952-954)GAA>GTA	p.E318V		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	318					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						ATCCATAATGAAGAGAAACCA	0.343													68	21	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57095391	57095391	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57095391G>A	uc002ekk.1	+	31	4243	c.4018G>A	c.(4018-4020)GTG>ATG	p.V1340M	NLRC5_uc002ekn.2_Missense_Mutation_p.V1001M|NLRC5_uc002ekl.2_Missense_Mutation_p.V1144M|NLRC5_uc002ekm.2_Missense_Mutation_p.V1114M|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekp.1_Missense_Mutation_p.V255M|NLRC5_uc002ekq.1_Translation_Start_Site|NLRC5_uc002ekr.1_Missense_Mutation_p.V227M	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1340					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				GCCAGAGCACGTGTCCAGGCT	0.657													30	24	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81965179	81965179	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81965179G>T	uc002fgt.2	+	25	2811	c.2659G>T	c.(2659-2661)GAG>TAG	p.E887*		NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	887					intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCCTCCGGTGGAGTTTGCCAC	0.532													84	28	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7752382	7752382	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7752382G>A	uc002giw.1	+	11	3152	c.2776G>A	c.(2776-2778)GAG>AAG	p.E926K	KDM6B_uc002gix.2_Missense_Mutation_p.E228K	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	926					inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						GACCCTTGTGGAGCGGGTGGG	0.672													10	54	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10428555	10428555	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10428555A>T	uc010coi.2	-	33	4776	c.4648T>A	c.(4648-4650)TTA>ATA	p.L1550I	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.L1550I|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1550	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GCTTCTTCTAAAGCAGCCTGA	0.363													90	143	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10443325	10443325	+	Missense_Mutation	SNP	G	T	T	rs144860788		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10443325G>T	uc010coi.2	-	12	1195	c.1067C>A	c.(1066-1068)ACG>AAG	p.T356K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.T356K|MYH2_uc010coj.2_Missense_Mutation_p.T356K	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	356	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CACAGCCCCCGTGAGCTTGTA	0.428													123	190	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18205961	18205961	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18205961G>C	uc002gsx.1	-	6	805	c.576C>G	c.(574-576)AAC>AAG	p.N192K	TOP3A_uc002gsw.1_5'UTR|TOP3A_uc010vxs.1_Missense_Mutation_p.N90K|TOP3A_uc010cqa.1_RNA	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	192					DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						GCTCGGTCAGGTTTTCACAAG	0.562													19	62	---	---	---	---	PASS
FBXL20	84961	broad.mit.edu	37	17	37455251	37455251	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37455251A>T	uc010wed.1	-	5	542	c.321T>A	c.(319-321)AAT>AAA	p.N107K	FBXL20_uc002hrt.2_Missense_Mutation_p.N107K|FBXL20_uc010cvu.2_Missense_Mutation_p.N107K	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	107	LRR 2.					cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			ACCTTAATGCATTGTCTCCCA	0.393													19	89	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44770377	44770377	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44770377A>T	uc002iku.2	+	10	1158	c.1054A>T	c.(1054-1056)AAC>TAC	p.N352Y	NSF_uc010wke.1_Missense_Mutation_p.N258Y|NSF_uc010wkf.1_Missense_Mutation_p.N258Y|NSF_uc010wkg.1_Missense_Mutation_p.N347Y	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	352					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		CACTGTTGTCAACCAGTTGCT	0.408													30	61	---	---	---	---	PASS
COIL	8161	broad.mit.edu	37	17	55027261	55027261	+	Missense_Mutation	SNP	T	C	C	rs147998048		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55027261T>C	uc002iuu.2	-	2	1373	c.1342A>G	c.(1342-1344)ACT>GCT	p.T448A		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	448	2 X 4 AA repeats of S-L-P-A.					Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)					TGGATAATAGTAGATGAATTT	0.403													88	73	---	---	---	---	PASS
CD300A	11314	broad.mit.edu	37	17	72469855	72469855	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72469855G>A	uc002jkv.2	+	2	542	c.221G>A	c.(220-222)CGA>CAA	p.R74Q	CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen	74	Extracellular (Potential).|Ig-like V-type.				cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGGAACGGCCGAGTGTCCATC	0.522													60	58	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6873397	6873397	+	Intron	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6873397G>C	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TACCTTCACTGTGTGTTTTAG	0.378													41	106	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22805045	22805045	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22805045C>G	uc002kvk.2	-	4	3084	c.2837G>C	c.(2836-2838)CGG>CCG	p.R946P	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.R946P|ZNF521_uc002kvl.2_Missense_Mutation_p.R726P	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	946	C2H2-type 22.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CATATGTTCCCGGAGGCCATT	0.483			T	PAX5	ALL								89	95	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22805047	22805047	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22805047G>A	uc002kvk.2	-	4	3082	c.2835C>T	c.(2833-2835)CTC>CTT	p.L945L	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.L945L|ZNF521_uc002kvl.2_Silent_p.L725L	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	945	C2H2-type 22.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TATGTTCCCGGAGGCCATTTT	0.483			T	PAX5	ALL								89	93	---	---	---	---	PASS
SMAD2	4087	broad.mit.edu	37	18	45374941	45374941	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45374941C>A	uc002lcy.2	-	8	1150	c.902G>T	c.(901-903)GGC>GTC	p.G301V	SMAD2_uc002lcz.2_Missense_Mutation_p.G301V|SMAD2_uc010xdc.1_Missense_Mutation_p.G271V|SMAD2_uc010xdd.1_Missense_Mutation_p.G271V	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	301	MH2.				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						GTCTGTAAAGCCATCTACAGT	0.418													50	99	---	---	---	---	PASS
C18orf22	79863	broad.mit.edu	37	18	77798604	77798604	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77798604G>A	uc002lns.2	+	4	616	c.478G>A	c.(478-480)GCC>ACC	p.A160T	C18orf22_uc010drh.2_Missense_Mutation_p.A160T|C18orf22_uc010dri.1_Intron|C18orf22_uc002lnt.2_5'Flank	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	160					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		GCAGAGAAGTGCCGCGCACAT	0.502													58	22	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1081695	1081695	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1081695G>C	uc002lqz.1	+	18	2568	c.2337G>C	c.(2335-2337)AAG>AAC	p.K779N	HMHA1_uc010xgd.1_Missense_Mutation_p.K795N|HMHA1_uc010xge.1_Missense_Mutation_p.K647N|HMHA1_uc002lra.1_Missense_Mutation_p.K619N|HMHA1_uc002lrb.1_Missense_Mutation_p.K662N|HMHA1_uc002lrc.1_Missense_Mutation_p.K414N|HMHA1_uc002lrd.1_5'Flank|HMHA1_uc010dsd.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	779	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATCGTCAAGAAGTGCGTCT	0.701													4	9	---	---	---	---	PASS
SLC25A41	284427	broad.mit.edu	37	19	6429775	6429775	+	Missense_Mutation	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6429775A>T	uc010dus.2	-	4	670	c.584T>A	c.(583-585)CTG>CAG	p.L195Q	SLC25A41_uc010dut.2_Missense_Mutation_p.L57Q	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN	solute carrier family 25, member 41	195	Solcar 2.|Helical; Name=3; (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						GGCCACAGCCAGGGAGCCAGC	0.577													25	10	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8174596	8174596	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8174596C>T	uc002mjf.2	-	34	4396	c.4375G>A	c.(4375-4377)GTG>ATG	p.V1459M		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1459	EGF-like 23; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TTAATGCACACGCCGTTGATG	0.622													116	39	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12976218	12976218	+	Missense_Mutation	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12976218T>C	uc002mvm.2	+	15	1855	c.1727T>C	c.(1726-1728)ATC>ACC	p.I576T		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	576	Protein kinase.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						ATGGGGATCATCCTCTACGAG	0.602													163	101	---	---	---	---	PASS
NOTCH3	4854	broad.mit.edu	37	19	15273333	15273333	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15273333C>T	uc002nan.2	-	32	5932	c.5856G>A	c.(5854-5856)GTG>GTA	p.V1952V		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1952	Cytoplasmic (Potential).|ANK 4.				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AAGTGGCTTCCACGTTGTTCA	0.587													24	21	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17013536	17013536	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17013536C>A	uc002nfb.2	-	35	4781	c.4749G>T	c.(4747-4749)TGG>TGT	p.W1583C	CPAMD8_uc002nfd.1_Missense_Mutation_p.W48C	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1536						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CAGCTGGGGGCCAGTCTCCTC	0.657													29	49	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17369130	17369130	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17369130C>T	uc002nfs.1	-	8	1224	c.1111G>A	c.(1111-1113)GAC>AAC	p.D371N	USHBP1_uc002nfr.1_5'UTR|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.D307N	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	371							PDZ domain binding			ovary(1)	1						GGGGCTTCGTCTCCTGCTCCT	0.577													55	86	---	---	---	---	PASS
LRRC25	126364	broad.mit.edu	37	19	18507223	18507223	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18507223G>C	uc002niw.2	-	1	1193	c.551C>G	c.(550-552)CCT>CGT	p.P184R	LRRC25_uc002nix.2_Missense_Mutation_p.P184R	NM_145256	NP_660299	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25 precursor	184	Helical; (Potential).					integral to membrane					0						GGCCAGCACAGGGCCAGCGAT	0.657													23	29	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21240178	21240178	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21240178A>G	uc002npj.2	+	5	1174	c.1064A>G	c.(1063-1065)AAC>AGC	p.N355S	ZNF430_uc002npk.2_Missense_Mutation_p.N354S	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	355	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						AAAGCTTTTAACCAATCCTCA	0.388													4	106	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21240182	21240182	+	Silent	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21240182A>G	uc002npj.2	+	5	1178	c.1068A>G	c.(1066-1068)CAA>CAG	p.Q356Q	ZNF430_uc002npk.2_Silent_p.Q355Q	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	356	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						CTTTTAACCAATCCTCAACCC	0.383													4	107	---	---	---	---	PASS
ZNF429	353088	broad.mit.edu	37	19	21719898	21719898	+	Missense_Mutation	SNP	A	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21719898A>C	uc002nqd.1	+	4	1180	c.1043A>C	c.(1042-1044)AAA>ACA	p.K348T	ZNF429_uc010ecu.1_Intron	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN	zinc finger protein 429	348	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GAATGTGGCAAAGCCTTTAAC	0.398													23	77	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36220127	36220127	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36220127C>A	uc010eei.2	+	23	4847	c.4847C>A	c.(4846-4848)GCG>GAG	p.A1616E		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1616					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ATCTGGTCGGCGGAAGTCTTC	0.632													3	25	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36223655	36223655	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36223655G>C	uc010eei.2	+	29	6205	c.6205G>C	c.(6205-6207)GAC>CAC	p.D2069H		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2069					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGACGGCACTGACAGTGAGGC	0.706													9	12	---	---	---	---	PASS
TMEM145	284339	broad.mit.edu	37	19	42819206	42819206	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42819206G>T	uc002otk.1	+	6	534	c.482G>T	c.(481-483)CGA>CTA	p.R161L		NM_173633	NP_775904	Q8NBT3	TM145_HUMAN	transmembrane protein 145	161						integral to membrane					0		Prostate(69;0.00682)				TTCTGGACACGACACTTCTCC	0.597													44	94	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44341242	44341242	+	Missense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44341242C>A	uc002oxr.3	+	6	516	c.248C>A	c.(247-249)TCT>TAT	p.S83Y	ZNF283_uc002oxp.3_Intron	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	83	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				ATCGACTTCTCTCAGGAGGAG	0.443													4	182	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46351143	46351143	+	Silent	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46351143G>A	uc002pdn.2	-	7	788	c.543C>T	c.(541-543)ACC>ACT	p.T181T	SYMPK_uc002pdo.1_Silent_p.T181T|SYMPK_uc002pdp.1_Silent_p.T181T|SYMPK_uc002pdq.1_Silent_p.T181T	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	181					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TGATGGCGTGGGTGCGGATGC	0.587													30	50	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53668521	53668521	+	Missense_Mutation	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53668521C>T	uc010eqm.1	-	4	1322	c.1222G>A	c.(1222-1224)GTC>ATC	p.V408I		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	343	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		AAAACCTTGACGCATTCATTA	0.398													21	100	---	---	---	---	PASS
LAIR2	3904	broad.mit.edu	37	19	55019392	55019392	+	Silent	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55019392G>C	uc002qgc.2	+	3	479	c.357G>C	c.(355-357)CTG>CTC	p.L119L	LAIR2_uc002qga.1_RNA|LAIR2_uc002qgb.1_RNA|LAIR2_uc002qgd.2_Silent_p.L119L|LAIR2_uc010erl.2_Intron	NM_002288	NP_002279	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like	119						extracellular region	receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		TGGAGCTGCTGGTGAAAGGTA	0.577													59	104	---	---	---	---	PASS
ZNF329	79673	broad.mit.edu	37	19	58639614	58639614	+	Silent	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58639614C>T	uc002qrn.2	-	4	1494	c.1257G>A	c.(1255-1257)AGG>AGA	p.R419R	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	419	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		CAGTATGAATCCTCTGATGCC	0.468													20	76	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2384444	2384444	+	Silent	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2384444C>A	uc002wfy.1	+	9	1372	c.1311C>A	c.(1309-1311)ATC>ATA	p.I437I	TGM6_uc010gal.1_Silent_p.I437I	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	437					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	GCGTGGACATCACTGACCTCT	0.592													88	132	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36975018	36975018	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36975018G>T	uc002xic.1	+	1	134	c.99G>T	c.(97-99)AGG>AGT	p.R33S		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	33					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				TGGTCGCCAGGATCACCGACA	0.627													36	10	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36989421	36989421	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36989421G>T	uc002xic.1	+	6	687	c.652G>T	c.(652-654)GTT>TTT	p.V218F		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	218					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				AACTCTGCCAGGTAGGACACC	0.388													84	30	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22712342	22712342	+	RNA	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22712342G>A	uc011aim.1	+	41		c.4130G>A								Parts of antibodies, mostly variable regions.												0						GCCACCCTCAGCGTCTGGGAC	0.547													53	80	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735700	22735700	+	RNA	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735700G>A	uc011aim.1	+	46		c.5496G>A								Parts of antibodies, mostly variable regions.												0						AGCATGGGATGACAGCCTGAA	0.582													63	103	---	---	---	---	PASS
GGTLC2	91227	broad.mit.edu	37	22	22989255	22989255	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22989255G>T	uc010gtt.2	+	2	242	c.208G>T	c.(208-210)GAG>TAG	p.E70*	LOC96610_uc011aim.1_Intron|POM121L1P_uc011ait.1_5'Flank|GGTLC2_uc010gts.2_Nonsense_Mutation_p.E70*	NM_199127	NP_954578	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase-like 4 isoform 1	70					glutathione biosynthetic process		gamma-glutamyltransferase activity			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		CCCGGTCAGCGAGATCCTGTT	0.582													73	112	---	---	---	---	PASS
ZNRF3	84133	broad.mit.edu	37	22	29445173	29445173	+	Intron	SNP	A	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29445173A>T	uc003aeg.2	+						ZNRF3_uc003aeh.1_Intron	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1						TGTTTCCTCCACTTGTCTCCA	0.557													90	109	---	---	---	---	PASS
IFT27	11020	broad.mit.edu	37	22	37163876	37163876	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37163876G>C	uc003apv.1	-	2	428	c.65C>G	c.(64-66)GCA>GGA	p.A22G	IFT27_uc003apu.1_Missense_Mutation_p.A21G|IFT27_uc003apw.1_Missense_Mutation_p.A22G|IFT27_uc010gwy.1_Missense_Mutation_p.A22G	NM_006860	NP_006851	Q9BW83	IFT27_HUMAN	RAB, member of RAS oncogene family-like 4	22					small GTPase mediated signal transduction	intraflagellar transport particle B|microtubule-based flagellum	GTP binding				0						GAAGATCTGTGCCAGGGCGGT	0.522													168	334	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38109217	38109217	+	Missense_Mutation	SNP	G	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38109217G>C	uc003atr.2	+	5	526	c.255G>C	c.(253-255)AGG>AGC	p.R85S	TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atq.1_Missense_Mutation_p.R85S|TRIOBP_uc003ats.1_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	85					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CCTCTCCCAGGGGCCCATCCC	0.642													23	25	---	---	---	---	PASS
APOBEC3H	164668	broad.mit.edu	37	22	39496312	39496312	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39496312G>T	uc011aoh.1	+	2	95	c.29G>T	c.(28-30)CGC>CTC	p.R10L	APOBEC3H_uc011aoi.1_5'Flank|APOBEC3H_uc003axa.3_5'Flank	NM_181773	NP_861438	Q6NTF7	ABC3H_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	10					DNA cytosine deamination|negative regulation of retroviral genome replication|negative regulation of transposition	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Melanoma(58;0.04)					GAAACATTCCGCTTACAGTTT	0.542													60	104	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41751873	41751873	+	Intron	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41751873G>T	uc003azw.2	+						ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B						interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						CGATGTGAGCGCTGGGATGGG	0.622													24	32	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43687048	43687048	+	Intron	SNP	T	C	C			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43687048T>C	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				TAGGCTGTACTCACCATTGGA	0.582													12	12	---	---	---	---	PASS
TTLL8	164714	broad.mit.edu	37	22	50483723	50483723	+	Missense_Mutation	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50483723T>A	uc011ark.1	-	6	604	c.604A>T	c.(604-606)AGG>TGG	p.R202W		NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		GCCTCCTCCCTCTGGTCCCTG	0.682													11	15	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21549999	21549999	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21549999G>T	uc004czx.1	+	11	1153	c.1117G>T	c.(1117-1119)GAA>TAA	p.E373*	CNKSR2_uc004czw.2_Nonsense_Mutation_p.E373*|CNKSR2_uc011mjn.1_Nonsense_Mutation_p.E324*|CNKSR2_uc011mjo.1_Nonsense_Mutation_p.E373*|CNKSR2_uc004czy.2_5'UTR	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	373	DUF1170.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						CCTTCCTTGTGAAGACCTCAG	0.393													60	11	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30236958	30236958	+	Missense_Mutation	SNP	C	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30236958C>G	uc004dbz.2	+	2	364	c.261C>G	c.(259-261)AGC>AGG	p.S87R		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	87							protein binding			ovary(1)	1						GTGCCAAGAGCCACCAAGGTG	0.552													9	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	48163038	48163038	+	Splice_Site	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48163038C>A	uc010nib.1	-	4	367	c.280_splice	c.e4+1	p.V94_splice		NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		CATCTACTCACCCTGATTCCT	0.473													83	23	---	---	---	---	PASS
ZC4H2	55906	broad.mit.edu	37	X	64137656	64137656	+	3'UTR	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64137656C>T	uc004dvu.2	-	5					ZC4H2_uc004dvv.2_3'UTR|ZC4H2_uc011mov.1_3'UTR|ZC4H2_uc011mow.1_Silent_p.R173R|ZC4H2_uc004dvw.1_3'UTR	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing								metal ion binding|protein binding			ovary(1)	1						ATGTGCTCTCCCTTTCTTTAT	0.493													19	1	---	---	---	---	PASS
ZC4H2	55906	broad.mit.edu	37	X	64141803	64141803	+	Nonsense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64141803G>T	uc004dvu.2	-	2	207	c.119C>A	c.(118-120)TCA>TAA	p.S40*	ZC4H2_uc004dvv.2_Nonsense_Mutation_p.S17*|ZC4H2_uc011mov.1_Nonsense_Mutation_p.S17*|ZC4H2_uc011mow.1_Nonsense_Mutation_p.S40*|ZC4H2_uc004dvw.1_Nonsense_Mutation_p.S40*	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	40	Potential.						metal ion binding|protein binding	p.S40L(1)		ovary(1)	1						CCTTTCCTCTGACTCAAGTGC	0.507													29	4	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65427994	65427994	+	Silent	SNP	T	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65427994T>A	uc011moz.1	+	15	2538	c.2478T>A	c.(2476-2478)ACT>ACA	p.T826T	HEPH_uc004dwn.2_Silent_p.T826T|HEPH_uc004dwo.2_Silent_p.T556T|HEPH_uc010nkr.2_Silent_p.T634T|HEPH_uc011mpa.1_Silent_p.T826T|HEPH_uc010nks.2_Silent_p.T115T	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	823	Extracellular (Potential).|Plastocyanin-like 5.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						ATATCCTGACTGTGGTATTCA	0.428													20	4	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78427296	78427296	+	Nonsense_Mutation	SNP	C	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78427296C>A	uc004edg.1	+	1	828	c.792C>A	c.(790-792)TGC>TGA	p.C264*		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	264	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TTAAAAGCTGCCTAGCCAGAA	0.383										HNSCC(63;0.18)			34	58	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86890576	86890576	+	Missense_Mutation	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86890576G>T	uc004efb.2	+	9	1908	c.1726G>T	c.(1726-1728)GGT>TGT	p.G576C	KLHL4_uc004efa.2_Missense_Mutation_p.G576C	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	576	Kelch 4.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						ATATGCTATTGGTGGACGTGA	0.388													31	8	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105451000	105451000	+	Silent	SNP	G	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105451000G>T	uc004emf.1	+	4	2224	c.1575G>T	c.(1573-1575)CCG>CCT	p.P525P	MUM1L1_uc004emg.1_Silent_p.P525P	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	525										ovary(2)|pancreas(1)|skin(1)	4						CCAGGGAACCGATGGCTGTAA	0.448													30	6	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117777531	117777531	+	Missense_Mutation	SNP	G	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117777531G>A	uc004eqp.2	+	40	4435	c.4372G>A	c.(4372-4374)GCC>ACC	p.A1458T	DOCK11_uc004eqq.2_Missense_Mutation_p.A1237T	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1458					blood coagulation	cytosol	GTP binding			ovary(3)	3						ACATGTATTTGCCTCACTGAG	0.408													213	32	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123034381	123034381	+	Missense_Mutation	SNP	A	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123034381A>G	uc010nqu.2	+	6	1264	c.1138A>G	c.(1138-1140)ATA>GTA	p.I380V	XIAP_uc004etx.2_Missense_Mutation_p.I380V|XIAP_uc010nqv.2_Missense_Mutation_p.I6V	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	380					anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						ACAAGAAGCTATACGAATGGG	0.323									X-linked_Lymphoproliferative_syndrome				54	4	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153039176	153039176	+	Intron	SNP	C	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153039176C>T	uc004fii.2	+						PLXNB3_uc010nuk.2_Intron|PLXNB3_uc011mzd.1_Intron|PLXNB3_uc004fij.1_5'Flank|SRPK3_uc004fik.2_5'Flank	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1						axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGTGAGCCCCTCACCAGCA	0.701													9	3	---	---	---	---	PASS
C1orf187	374946	broad.mit.edu	37	1	11766322	11766322	+	Frame_Shift_Del	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11766322delG	uc001asr.1	+	2	147	c.7delG	c.(7-9)GGGfs	p.G3fs		NM_198545	NP_940947	Q8NBI3	DRAXI_HUMAN	chromosome 1 open reading frame 187 precursor	3					axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region					0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)		GCCAATGGCTGGGCCTGCCAT	0.607													15	7	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109888137	109888137	+	Intron	DEL	A	-	-	rs112644374		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109888137delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		actttgtttcaaaaaaaaaaa	0.174													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149060241	149060241	+	IGR	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149060241delG								LOC645166 (107187 upstream) : LOC388692 (219235 downstream)																							CTCAGCCAGTGGGGAGATCAC	0.473													12	14	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180805493	180805493	+	Intron	DEL	A	-	-	rs72155316		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180805493delA	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						actcagtctcaaaaaaaaaaa	0.124													6	4	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216500999	216500999	+	Intron	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216500999delG	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCTAAACCTGCAAATACACA	0.358										HNSCC(13;0.011)			103	61	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241901461	241901463	+	Intron	DEL	CTG	-	-	rs35933135		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241901461_241901463delCTG	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			AAAGTAATCACTGCTGCTATTTT	0.305													5	4	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73678938	73678938	+	Frame_Shift_Del	DEL	A	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73678938delA	uc002sje.1	+	10	5398	c.5287delA	c.(5287-5289)ACAfs	p.T1763fs	ALMS1_uc002sjf.1_Frame_Shift_Del_p.T1719fs|ALMS1_uc002sjg.2_Frame_Shift_Del_p.T1149fs|ALMS1_uc002sjh.1_Frame_Shift_Del_p.T1149fs	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1761	34 X 47 AA approximate tandem repeat.|26.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CTATTCACATACAGAGAAGCC	0.428													83	98	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125281944	125281944	+	Frame_Shift_Del	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125281944delG	uc002tno.2	+	9	1753	c.1389delG	c.(1387-1389)ACGfs	p.T463fs	CNTNAP5_uc010flu.2_Frame_Shift_Del_p.T464fs	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	463	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACCGCATCACGCTCACTCTGG	0.493													71	50	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128874108	128874108	+	Intron	DEL	T	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128874108delT	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						CACATTAttcttttttttttg	0.169													4	2	---	---	---	---	
WDR12	55759	broad.mit.edu	37	2	203748476	203748476	+	Intron	DEL	A	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203748476delA	uc002uzl.2	-						WDR12_uc010ftt.2_Intron	NM_018256	NP_060726	Q9GZL7	WDR12_HUMAN	WD repeat domain 12 protein						cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						TGAACAAAGCAAAAAAGACAA	0.338													13	26	---	---	---	---	
RNPEPL1	57140	broad.mit.edu	37	2	241515987	241515989	+	In_Frame_Del	DEL	CCG	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241515987_241515989delCCG	uc002vzi.2	+	9	1446_1448	c.853_855delCCG	c.(853-855)CCGdel	p.P286del	RNPEPL1_uc010fzf.2_In_Frame_Del_p.P192del|RNPEPL1_uc002vzj.2_5'UTR	NM_018226	NP_060696	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like	286					leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		TGCCACAGGCCCGCCGCTGGCTG	0.665													6	22	---	---	---	---	
TMEM108	66000	broad.mit.edu	37	3	132991154	132991157	+	Intron	DEL	TGTT	-	-	rs3078833		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132991154_132991157delTGTT	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_Intron|TMEM108_uc003epk.2_Intron	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4						tgtgtgtgtgtgtTTCCTAAAGGA	0.319													5	3	---	---	---	---	
TM4SF18	116441	broad.mit.edu	37	3	149051255	149051256	+	Intron	INS	-	TC	TC			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149051255_149051256insTC	uc003exa.2	-							NM_138786	NP_620141	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18							integral to membrane				ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GACCttttttttctctctctct	0.376													10	5	---	---	---	---	
RSRC1	51319	broad.mit.edu	37	3	157866140	157866141	+	Intron	DEL	GT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157866140_157866141delGT	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			TTCTTAAAAGgtgtgtgtgtgt	0.267													5	4	---	---	---	---	
NDUFB5	4711	broad.mit.edu	37	3	179336126	179336127	+	Intron	INS	-	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179336126_179336127insT	uc003fkc.2	+						NDUFB5_uc003fkd.2_Intron|NDUFB5_uc003fke.2_Intron	NM_002492	NP_002483	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			skin(1)	1	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)		NADH(DB00157)	TGAAATGATCATTTTAAAGAAT	0.238													31	33	---	---	---	---	
DNAJB11	51726	broad.mit.edu	37	3	186302103	186302106	+	Intron	DEL	TTCT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186302103_186302106delTTCT	uc003fqi.2	+							NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11						protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TGCTCCTTCATTCTTTCTTTTTGC	0.377													11	9	---	---	---	---	
PLA2G12A	81579	broad.mit.edu	37	4	110635887	110635888	+	Intron	INS	-	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110635887_110635888insT	uc003hzp.2	-						PLA2G12A_uc010img.2_Intron	NM_030821	NP_110448	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA precursor						lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity				0				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		GTTTAACCCAAttttttttttt	0.153													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183713320	183713320	+	Intron	DEL	A	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183713320delA	uc003ivd.1	+							NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AATTAAAATGAAAATCATTTT	0.398													3	10	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132234183	132234183	+	Intron	DEL	T	-	-	rs67779737		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132234183delT	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tcttcttgtcttttttttttt	0.119													4	3	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7571410	7571411	+	Intron	DEL	AA	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7571410_7571411delAA	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ttctgtaggcaaaaaaaaaaAA	0.163													3	3	---	---	---	---	
FOXP4	116113	broad.mit.edu	37	6	41566687	41566688	+	3'UTR	INS	-	T	T			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41566687_41566688insT	uc003oql.2	+	17					FOXP4_uc003oqm.2_3'UTR|FOXP4_uc003oqn.2_3'UTR	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN	forkhead box P4 isoform 1						embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCCTGTAGTGACCGGCAGGGCT	0.668													4	2	---	---	---	---	
LOC100132354	100132354	broad.mit.edu	37	6	43872656	43872659	+	Intron	DEL	TTCC	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43872656_43872659delTTCC	uc011dvm.1	+							NR_024478				Homo sapiens cDNA FLJ38229 fis, clone FCBBF2004256.												0						Attccttcctttccttccttcctt	0.240													4	2	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20739336	20739337	+	Intron	INS	-	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20739336_20739337insA	uc003suw.3	+						ABCB5_uc010kuh.2_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						tctcataaaagaaaaaaaaaaa	0.114													9	5	---	---	---	---	
SBDS	51119	broad.mit.edu	37	7	66456003	66456004	+	Intron	INS	-	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66456003_66456004insA	uc003tvm.1	-							NM_016038	NP_057122	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome protein						bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1						gactccatctcaaaaaaaaaaa	0.104			Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				8	5	---	---	---	---	
SGCE	8910	broad.mit.edu	37	7	94285199	94285200	+	Intron	INS	-	G	G			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94285199_94285200insG	uc003unl.2	-						SGCE_uc003unm.2_Intron|SGCE_uc003unn.2_Intron|SGCE_uc011kic.1_Intron|SGCE_uc011kid.1_Intron|PEG10_uc011kie.1_5'Flank	NM_003919	NP_003910	O43556	SGCE_HUMAN	sarcoglycan, epsilon isoform 2						cell-matrix adhesion|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AAAGAGAGGCTGGTGCCCAAAG	0.703											OREG0018170	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128317558	128317559	+	Intron	INS	-	AAAAA	AAAAA	rs10659136		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317558_128317559insAAAAA	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						gactccgtctcaaaaaaaaaaa	0.223													4	3	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139878082	139878089	+	5'Flank	DEL	TCCCTCCC	-	-	rs142303955		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139878082_139878089delTCCCTCCC	uc003vvm.2	-						LOC100134229_uc011kqy.1_RNA	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					cttccttccttccctccctccCTTTCCT	0.106													5	3	---	---	---	---	
SGK223	157285	broad.mit.edu	37	8	8176274	8176298	+	Frame_Shift_Del	DEL	TGCTTCTCCCGGGGCCCTTCCGGGG	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8176274_8176298delTGCTTCTCCCGGGGCCCTTCCGGGG	uc003wsh.3	-	5	3587_3611	c.3587_3611delCCCCGGAAGGGCCCCGGGAGAAGCA	c.(3586-3612)TCCCCGGAAGGGCCCCGGGAGAAGCAGfs	p.S1196fs		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1196_1204	Protein kinase.						ATP binding|non-membrane spanning protein tyrosine kinase activity				0						CCGGGGCAGCTGCTTCTCCCGGGGCCCTTCCGGGGAGGCGGGGCC	0.609													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47547806	47547806	+	IGR	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47547806delG								None (None upstream) : BEYLA (204702 downstream)																							tatatatactgggacctcacc	0.114													5	3	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48647674	48647675	+	Intron	DEL	GT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48647674_48647675delGT	uc003xqd.2	+						KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				gtgtgtgtgggtgtgtgtgtgt	0.342													5	3	---	---	---	---	
CALB1	793	broad.mit.edu	37	8	91081350	91081351	+	Intron	DEL	GC	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91081350_91081351delGC	uc003yel.1	-						CALB1_uc011lge.1_Intron	NM_004929	NP_004920	P05937	CALB1_HUMAN	calbindin 1							nucleus	calcium ion binding|vitamin D binding			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CCTACTTTAAGCAGCTTTCTTA	0.391													60	33	---	---	---	---	
ZNF16	7564	broad.mit.edu	37	8	146157387	146157390	+	Frame_Shift_Del	DEL	CTCA	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146157387_146157390delCTCA	uc003zet.2	-	4	970_973	c.783_786delTGAG	c.(781-786)AGTGAGfs	p.S261fs	ZNF16_uc003zeu.2_Frame_Shift_Del_p.S261fs	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16	261_262					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GGTAAGCTTTCTCACTCATATGAG	0.466													204	120	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110220241	110220241	+	IGR	DEL	C	-	-	rs57160910		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110220241delC								RAD23B (125772 upstream) : KLF4 (26894 downstream)																							aaaaaaaaaacaaaaaaacaa	0.169													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19340851	19340852	+	IGR	DEL	AA	-	-	rs12781021		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19340851_19340852delAA								ARL5B (373911 upstream) : PLXDC2 (764520 downstream)																							actccgtctcaaaaaaaaaaaa	0.144													4	2	---	---	---	---	
PDLIM1	9124	broad.mit.edu	37	10	97031194	97031194	+	Intron	DEL	A	-	-	rs5787128		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97031194delA	uc001kkh.2	-						PDLIM1_uc001kki.2_Intron|PDLIM1_uc009xuv.2_Intron|PDLIM1_uc001kkj.1_Intron	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1						response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		actccgtctcaaaaaaaaaaa	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61711676	61711681	+	IGR	DEL	TCCTTC	-	-	rs148785004	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61711676_61711681delTCCTTC								RAB3IL1 (23935 upstream) : BEST1 (5675 downstream)																							ttccttcctttccttcccttccttcc	0.010													3	3	---	---	---	---	
LOC653113	653113	broad.mit.edu	37	12	8386701	8386702	+	Intron	INS	-	C	C	rs11612306	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8386701_8386702insC	uc010sgk.1	-							NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CTGCCGCAAGACCCCATGCCCC	0.520													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10392081	10392082	+	IGR	INS	-	TTA	TTA	rs143361134		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392081_10392082insTTA								GABARAPL1 (16359 upstream) : KLRD1 (64968 downstream)																							tccttccttccttcttccttcc	0.045													4	2	---	---	---	---	
C12orf45	121053	broad.mit.edu	37	12	105388100	105388100	+	Intron	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105388100delG	uc001tlb.2	+							NM_152318	NP_689531	Q8N5I9	CL045_HUMAN	hypothetical protein LOC121053												0						actccagtctgggcagcagag	0.095													7	5	---	---	---	---	
P2RX2	22953	broad.mit.edu	37	12	133196330	133196330	+	Frame_Shift_Del	DEL	C	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133196330delC	uc001ukj.1	+	3	375	c.375delC	c.(373-375)TGCfs	p.C125fs	P2RX2_uc001uki.1_Frame_Shift_Del_p.C125fs|P2RX2_uc001ukk.1_Frame_Shift_Del_p.C125fs|P2RX2_uc001ukl.1_Intron|P2RX2_uc001ukm.1_Intron|P2RX2_uc001ukn.1_Intron|P2RX2_uc009zyt.1_Frame_Shift_Del_p.C125fs|P2RX2_uc001uko.1_Intron	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X2 isoform A	125	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		AGGGAACCTGCCCCGAGGTGA	0.721													15	23	---	---	---	---	
MYH7	4625	broad.mit.edu	37	14	23896042	23896042	+	Frame_Shift_Del	DEL	C	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23896042delC	uc001wjx.2	-	18	2094	c.1988delG	c.(1987-1989)CGCfs	p.R663fs		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	663	Myosin head-like.|Actin-binding.		R -> C (in CMH1).|R -> H (in CMH1).|R -> S (in CMH1).		adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ATGGGTGGAGCGCAAGTTGGT	0.448													19	40	---	---	---	---	
SNX6	58533	broad.mit.edu	37	14	35037841	35037841	+	Intron	DEL	T	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35037841delT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419	Q9UNH7	SNX6_HUMAN	sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		actcagccTGTTTTTTTTTTT	0.194													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52754676	52754678	+	IGR	DEL	AAA	-	-	rs71444753		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52754676_52754678delAAA								PTGDR (11235 upstream) : PTGER2 (26338 downstream)																							ATGTTAAGCCaaaaaaaaaaaaa	0.305													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92439370	92439371	+	Intron	DEL	TT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92439370_92439371delTT	uc001xzy.2	-						TRIP11_uc010auf.1_Intron	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		ATACTGGCACtttttttttttt	0.119			T	PDGFRB	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31128274	31128275	+	IGR	INS	-	T	T	rs34976531		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31128274_31128275insT								ARHGAP11B (150465 upstream) : MTMR15 (67780 downstream)																							TTTTGATAAGCTTTTTTTTTTT	0.312													4	3	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50882045	50882046	+	Intron	INS	-	TTTTTTG	TTTTTTG	rs148695282	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50882045_50882046insTTTTTTG	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGGTTACAGttttttttgtttt	0.178													4	2	---	---	---	---	
UBE2Q2	92912	broad.mit.edu	37	15	76146955	76146958	+	Intron	DEL	GTTT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76146955_76146958delGTTT	uc002bbg.2	+						UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Intron	NM_173469	NP_775740	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2						TTAAAGACTAGTTTGTTTGTTTTT	0.250													2	4	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85443229	85443232	+	Intron	DEL	AGGC	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85443229_85443232delAGGC	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			gaaAAGAAAAaggcaggcaggcag	0.025													5	4	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	86791071	86791071	+	Frame_Shift_Del	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86791071delG	uc002blz.1	+	6	638	c.558delG	c.(556-558)CTGfs	p.L186fs		NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	186					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						AGGCCTTCCTGGCAGCACAGG	0.627													90	62	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70604236	70604237	+	Intron	INS	-	TTT	TTT	rs71387530		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70604236_70604237insTTT	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				AGGCCATTTGGttttttttttt	0.213													4	2	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7576878	7576887	+	Frame_Shift_Del	DEL	AGTGGTTTCT	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7576878_7576887delAGTGGTTTCT	uc002gim.2	-	9	1153_1162	c.959_968delAGAAACCACT	c.(958-969)AAGAAACCACTGfs	p.K320fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.K320fs|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_Frame_Shift_Del_p.K188fs|TP53_uc010cng.1_Frame_Shift_Del_p.K188fs|TP53_uc002gii.1_Frame_Shift_Del_p.K188fs|TP53_uc010cnh.1_Frame_Shift_Del_p.K320fs|TP53_uc010cni.1_Frame_Shift_Del_p.K320fs|TP53_uc002gij.2_Frame_Shift_Del_p.K320fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	320_323	Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Interaction with HIPK2.		L -> P (in a sporadic cancer; somatic mutation).|L -> R (in a sporadic cancer; somatic mutation).|L -> M (in a sporadic cancer; somatic mutation).|L -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|L -> V (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.K321fs*24(4)|p.K320N(3)|p.K320fs*26(2)|p.K320*(2)|p.P322L(2)|p.P322R(2)|p.K321*(2)|p.S315fs*22(1)|p.L323fs*22(1)|p.K321K(1)|p.P318fs*21(1)|p.K320fs*25(1)|p.P322fs*23(1)|p.L323V(1)|p.L323R(1)|p.?(1)|p.L323P(1)|p.L308fs*15(1)|p.L323G(1)|p.L323M(1)|p.K320K(1)|p.K320fs*18(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCTCCATCCAGTGGTTTCTTCTTTGGCTG	0.457		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			37	45	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597927	11597930	+	Intron	DEL	CTTT	-	-	rs12946303		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597927_11597930delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGctttcttgctttcttgctttct	0.245													4	3	---	---	---	---	
FLJ40504	284085	broad.mit.edu	37	17	26629459	26629460	+	Intron	DEL	AC	-	-	rs34529329		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26629459_26629460delAC	uc002has.3	-							NM_173624	NP_775895			SubName: Full=Putative uncharacterized protein FLJ40504; SubName: Full=cDNA FLJ40504 fis, clone TESTI2045509, highly similar to KERATIN, TYPE I CYTOSKELETAL 18;												0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		ctcTCAAAAGacacacacacac	0.104													3	3	---	---	---	---	
CWC25	54883	broad.mit.edu	37	17	36962874	36962874	+	Intron	DEL	A	-	-	rs78213578		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36962874delA	uc002hqu.2	-						CWC25_uc010wdv.1_Intron|CWC25_uc010wdw.1_Intron	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49												0						ATTGAGGTGGAAAAAAAAAAT	0.428													4	2	---	---	---	---	
CACNB1	782	broad.mit.edu	37	17	37347528	37347529	+	Intron	INS	-	ACTTATTAT	ACTTATTAT	rs138131266	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37347528_37347529insACTTATTAT	uc002hrm.1	-						CACNB1_uc002hrl.1_Intron|CACNB1_uc002hrn.2_Intron|CACNB1_uc002hro.2_Intron|CACNB1_uc002hrp.1_Intron|CACNB1_uc010web.1_Intron	NM_000723	NP_000714	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1						axon guidance	voltage-gated calcium channel complex				large_intestine(1)|ovary(1)	2					Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)	taataacacgcacttattatac	0.000													4	3	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47118650	47118650	+	Intron	DEL	C	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47118650delC	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						CTTGGAAATGCCAAGTCTGGG	0.279													27	24	---	---	---	---	
EPB41L3	23136	broad.mit.edu	37	18	5395272	5395272	+	Intron	DEL	G	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5395272delG	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AGAGTTCTATGGCACTTATTT	0.453													5	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22328645	22328646	+	IGR	INS	-	T	T	rs146299092	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22328645_22328646insT								HRH4 (268725 upstream) : ZNF521 (313242 downstream)																							tccttccttcctccttccctcc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41055172	41055173	+	IGR	DEL	CA	-	-	rs142909777		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41055172_41055173delCA								SYT4 (197557 upstream) : None (None downstream)																							CTAAAGAAACcacacacacaca	0.292													2	4	---	---	---	---	
NFIX	4784	broad.mit.edu	37	19	13105126	13105127	+	5'Flank	INS	-	GT	GT	rs139318180	by1000genomes	TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13105126_13105127insGT	uc002mwd.2	+							NM_002501	NP_002492	Q14938	NFIX_HUMAN	nuclear factor I/X (CCAAT-binding transcription						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			TGGGCAACCCAgtgtgtgtgtg	0.436													4	3	---	---	---	---	
IL27RA	9466	broad.mit.edu	37	19	14157483	14157495	+	Intron	DEL	GGGTGGACTTGTA	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14157483_14157495delGGGTGGACTTGTA	uc002mxx.2	+							NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN	class I cytokine receptor precursor						cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0						GCAGACGGATGGGTGGACTTGTAAGAGGGAGTG	0.385													39	26	---	---	---	---	
ZNF790	388536	broad.mit.edu	37	19	37309182	37309184	+	3'UTR	DEL	CTG	-	-	rs142103405		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37309182_37309184delCTG	uc002oew.2	-	5					uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GATGAATTCTctgctgctgctgc	0.261													4	3	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47886767	47886775	+	In_Frame_Del	DEL	CCTCCTGGA	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47886767_47886775delCCTCCTGGA	uc002xui.2	-	3	1821_1829	c.1574_1582delTCCAGGAGG	c.(1573-1584)GTCCAGGAGGAA>GAA	p.VQE525del		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	525_527							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGAACATCTTCCTCCTGGACCTCCTGGAG	0.522													50	61	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47510883	47510884	+	IGR	INS	-	TGA	TGA			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47510883_47510884insTGA								COL6A1 (85920 upstream) : COL6A2 (7149 downstream)																							ggtgatggtggtggtgatggtg	0.000													4	2	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31985765	31985768	+	Intron	DEL	TTTA	-	-			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31985765_31985768delTTTA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TTTGTCCATCTTTATTTATTTATT	0.333													4	3	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36691448	36691449	+	Intron	DEL	GT	-	-	rs111330544		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36691448_36691449delGT	uc003apg.2	-							NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAGGGCCACGgtgtgtgtgtgt	0.550			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	2	---	---	---	---	
ATP11C	286410	broad.mit.edu	37	X	138871361	138871362	+	Intron	INS	-	A	A			TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138871361_138871362insA	uc004faz.2	-						ATP11C_uc004fay.2_Intron|ATP11C_uc004fba.2_Intron	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a						ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					gactccatctcaaaaaaaaaaa	0.119													6	3	---	---	---	---	
GABRE	2564	broad.mit.edu	37	X	151123842	151123843	+	Frame_Shift_Ins	INS	-	C	C	rs141069947		TCGA-63-5128-01A-01D-1441-08	TCGA-63-5128-10A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151123842_151123843insC	uc004ffi.2	-	8	1188_1189	c.1134_1135insG	c.(1132-1137)CGCCATfs	p.R378fs	GABRE_uc011myd.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	378_379	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GCTCATACATGGCGGAGTTTAG	0.520													11	46	---	---	---	---	
