Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12318100	12318100	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12318100A>G	uc001atv.2	+	10	1191	c.1050A>G	c.(1048-1050)GTA>GTG	p.V350V	VPS13D_uc001atw.2_Silent_p.V350V	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	350					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GTGATGCTGTATCTTACACTG	0.428													39	36	---	---	---	---	PASS
LAPTM5	7805	broad.mit.edu	37	1	31212756	31212756	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31212756A>G	uc001bsc.2	-	4	378	c.287T>C	c.(286-288)CTG>CCG	p.L96P		NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	96	Helical; (Potential).				transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		TTGCAGGGACAGGAAGGGCAG	0.607													8	13	---	---	---	---	PASS
ZSCAN20	7579	broad.mit.edu	37	1	33945088	33945088	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33945088G>T	uc001bxj.3	+	2	366	c.199G>T	c.(199-201)GAG>TAG	p.E67*	ZSCAN20_uc001bxk.2_Nonsense_Mutation_p.E67*|ZSCAN20_uc009vui.2_Nonsense_Mutation_p.E67*	NM_145238	NP_660281	P17040	ZSC20_HUMAN	zinc finger protein 31	67	SCAN box.				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGGACCCCACGAGGCCTTCAG	0.612													18	36	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63284828	63284828	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63284828G>T	uc001dat.2	+	5	709	c.547G>T	c.(547-549)GGG>TGG	p.G183W	ATG4C_uc001dau.2_Missense_Mutation_p.G183W	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	183					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						GGAAACAATTGGGAAATATTC	0.373													11	47	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74801765	74801765	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74801765A>G	uc001dgf.1	+	7	665	c.614A>G	c.(613-615)CAC>CGC	p.H205R	TNNI3K_uc001dgc.1_Missense_Mutation_p.H306R|TNNI3K_uc001dgd.2_Missense_Mutation_p.H306R|TNNI3K_uc001dge.1_Missense_Mutation_p.H306R	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	205	ANK 5.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						AGACCCCTCCACCTAGCATCT	0.358													17	31	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93160930	93160930	+	Silent	SNP	A	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93160930A>C	uc001dox.2	-	7	988	c.978T>G	c.(976-978)ACT>ACG	p.T326T	EVI5_uc010otf.1_Silent_p.T326T|EVI5_uc001doy.1_5'Flank	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	326	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TAAGAAAGATAGTCAGAAACC	0.373													23	66	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93730454	93730454	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93730454C>A	uc001dpq.2	+	27	4403	c.4235C>A	c.(4234-4236)ACT>AAT	p.T1412N	CCDC18_uc001dpr.1_Missense_Mutation_p.T207N|uc001dps.2_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	1293	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GCATTACTTACTAAAGTAAGT	0.303													6	32	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94473855	94473855	+	Splice_Site	SNP	T	C	C	rs61750637		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94473855T>C	uc001dqh.2	-	42	5940	c.5836_splice	c.e42-1	p.I1946_splice	ABCA4_uc001dqi.1_Splice_Site_p.I65_splice	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGGATAAATCTGCAAGATACG	0.542													9	25	---	---	---	---	PASS
PRPF38B	55119	broad.mit.edu	37	1	109242502	109242502	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109242502A>T	uc001dvv.3	+	6	1783	c.1501A>T	c.(1501-1503)AGT>TGT	p.S501C	PRPF38B_uc001dvw.3_Missense_Mutation_p.S390C|PRPF38B_uc010ouz.1_Missense_Mutation_p.S304C	NM_018061	NP_060531	Q5VTL8	PR38B_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	501					mRNA processing|RNA splicing	spliceosomal complex					0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		TAGAAAGCGTAGTAGAAGCAA	0.408													47	187	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117576499	117576499	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117576499A>G	uc010oxb.1	+	9	2900	c.2842A>G	c.(2842-2844)AGG>GGG	p.R948G	CD101_uc009whd.2_Missense_Mutation_p.R948G|CD101_uc010oxc.1_Missense_Mutation_p.R948G|CD101_uc010oxd.1_Missense_Mutation_p.R886G	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	948	Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCTTCCTTCCAGGATCTGCTC	0.478													6	50	---	---	---	---	PASS
TTF2	8458	broad.mit.edu	37	1	117631571	117631571	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117631571A>G	uc001egy.2	+	13	2329	c.2309A>G	c.(2308-2310)CAA>CGA	p.Q770R		NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	770	Helicase ATP-binding.				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ACCCCCATTCAAAACAACTTA	0.438													43	63	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145537199	145537199	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145537199C>T	uc001eoa.2	+	19	2446	c.2370C>T	c.(2368-2370)GGC>GGT	p.G790G	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.G659G|ITGA10_uc009wiw.2_Silent_p.G647G|ITGA10_uc010oyw.1_Silent_p.G735G	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	790	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGGATTGTGGCCCTGACAATG	0.493													11	87	---	---	---	---	PASS
TPM3	7170	broad.mit.edu	37	1	154145418	154145418	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154145418C>A	uc001fec.1	-	5	647	c.532G>T	c.(532-534)GAA>TAA	p.E178*	TPM3_uc001fdx.1_5'Flank|TPM3_uc010pei.1_Nonsense_Mutation_p.E51*|TPM3_uc001fdy.1_Nonsense_Mutation_p.E141*|TPM3_uc001fdz.1_Nonsense_Mutation_p.E141*|TPM3_uc001fea.1_Nonsense_Mutation_p.E141*|TPM3_uc001feb.1_Nonsense_Mutation_p.E141*|TPM3_uc010pej.1_Nonsense_Mutation_p.E74*|TPM3_uc009wor.2_Intron|TPM3_uc001fed.1_Nonsense_Mutation_p.E141*	NM_152263	NP_689476	P06753	TPM3_HUMAN	tropomyosin 3 isoform 1	177	By similarity.				cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					TCTGTGCGTTCCAAGTCTCCT	0.473			T	NTRK1|ALK	papillary thyroid|ALCL								38	131	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157805945	157805945	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157805945G>T	uc001frk.3	-	3	199	c.56C>A	c.(55-57)GCG>GAG	p.A19E		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	19					apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AGATGGAGACGCTGCAAAGAG	0.592													9	33	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158259846	158259846	+	5'UTR	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158259846G>A	uc001fru.2	+	1					CD1C_uc001frv.2_5'Flank	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor						antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					AGAAACATCTGCAAATGACAT	0.438													18	35	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158368446	158368446	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158368446C>G	uc010pih.1	-	1	811	c.811G>C	c.(811-813)GAT>CAT	p.D271H		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					ACCAACTGATCCTTGTCTGAG	0.473													15	46	---	---	---	---	PASS
DARC	2532	broad.mit.edu	37	1	159175948	159175948	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159175948G>A	uc001fto.2	+	2	959	c.719G>A	c.(718-720)GGC>GAC	p.G240D	DARC_uc001ftp.3_Missense_Mutation_p.G242D	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	240	Cytoplasmic (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					ATGGGGCCAGGCCCCTGGATG	0.537													30	104	---	---	---	---	PASS
IGSF8	93185	broad.mit.edu	37	1	160062403	160062403	+	Silent	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160062403A>T	uc001fva.2	-	5	1440	c.1395T>A	c.(1393-1395)TCT>TCA	p.S465S	IGSF8_uc001fuz.2_Silent_p.S465S|IGSF8_uc009wtf.2_Silent_p.S465S	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	465	Ig-like C2-type 4.|Extracellular (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CACCCCGCACAGAGATGTTGC	0.662													22	7	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169581631	169581631	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169581631C>T	uc001ggi.3	-	6	850	c.785G>A	c.(784-786)TGC>TAC	p.C262Y	SELP_uc001ggh.2_Missense_Mutation_p.C97Y|SELP_uc009wvr.2_Missense_Mutation_p.C262Y	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	262	Extracellular (Potential).|Sushi 2.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	CAGGGGTGGGCACTGGGCAGC	0.473													19	65	---	---	---	---	PASS
C1orf9	51430	broad.mit.edu	37	1	172520726	172520726	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172520726A>G	uc001giq.3	+	2	453	c.137A>G	c.(136-138)AAC>AGC	p.N46S	C1orf9_uc010pmm.1_Missense_Mutation_p.N46S|C1orf9_uc009wwd.2_Missense_Mutation_p.N46S|C1orf9_uc010pmn.1_Missense_Mutation_p.N46S|C1orf9_uc010pmo.1_RNA	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein	46					multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		CAAGATGACAACTGCGCACTA	0.398													6	46	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197056045	197056045	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197056045C>A	uc001gtu.2	-	27	10476	c.10219G>T	c.(10219-10221)GCT>TCT	p.A3407S	ASPM_uc001gtv.2_Missense_Mutation_p.A1822S	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3407					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TGTTTATGAGCTGTAAGTTTG	0.318													7	25	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197056046	197056046	+	Silent	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197056046T>A	uc001gtu.2	-	27	10475	c.10218A>T	c.(10216-10218)ACA>ACT	p.T3406T	ASPM_uc001gtv.2_Silent_p.T1821T	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3406					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						GTTTATGAGCTGTAAGTTTGT	0.313													7	25	---	---	---	---	PASS
C1orf106	55765	broad.mit.edu	37	1	200869268	200869268	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200869268A>G	uc001gvo.2	+	4	502	c.472A>G	c.(472-474)AAA>GAA	p.K158E	C1orf106_uc010ppm.1_Missense_Mutation_p.K73E	NM_018265	NP_060735	Q3KP66	CA106_HUMAN	hypothetical protein LOC55765 isoform 1	158										skin(2)|ovary(1)	3						GTATCCCCTCAAACCAGGGGA	0.622													4	25	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204971757	204971757	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204971757C>A	uc001hbj.2	+	27	3498	c.3170C>A	c.(3169-3171)GCC>GAC	p.A1057D	NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Intron|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_Missense_Mutation_p.A80D|NFASC_uc009xbh.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1164	Extracellular (Potential).|Fibronectin type-III 5.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCAGTTAAGGCCCAGGCTCAG	0.547													4	18	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204971758	204971758	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204971758C>A	uc001hbj.2	+	27	3499	c.3171C>A	c.(3169-3171)GCC>GCA	p.A1057A	NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Intron|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_Silent_p.A80A|NFASC_uc009xbh.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1164	Extracellular (Potential).|Fibronectin type-III 5.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAGTTAAGGCCCAGGCTCAGC	0.542													4	18	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207641891	207641891	+	Silent	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207641891A>T	uc001hfw.2	+	3	559	c.465A>T	c.(463-465)CCA>CCT	p.P155P	CR2_uc001hfv.2_Silent_p.P155P|CR2_uc009xch.2_Silent_p.P155P|CR2_uc009xci.1_5'Flank	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	155	Sushi 3.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						TCGAGTGTCCAGCACTTCCTA	0.398													10	38	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	210948803	210948803	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210948803A>G	uc001hib.2	-	10	2169	c.1999T>C	c.(1999-2001)TGT>CGT	p.C667R	KCNH1_uc001hic.2_Missense_Mutation_p.C640R	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	667	Cytoplasmic (Potential).|cNMP.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TGCAGATCACAGTAGGTCAAG	0.517													11	49	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228548045	228548045	+	Intron	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228548045C>T	uc009xez.1	+						OBSCN_uc001hsn.2_Silent_p.G6484G|OBSCN_uc001hsr.1_Intron|OBSCN_uc009xfa.2_Silent_p.G146G	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				ACTGTGGTGGCCCTGGGCCTG	0.652													10	17	---	---	---	---	PASS
GALNT2	2590	broad.mit.edu	37	1	230401027	230401027	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230401027C>G	uc010pwa.1	+	14	1426	c.1354C>G	c.(1354-1356)CAG>GAG	p.Q452E	GALNT2_uc010pvy.1_Missense_Mutation_p.Q414E|GALNT2_uc010pvz.1_RNA|GALNT2_uc001htu.2_Missense_Mutation_p.Q64E	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	452	Lumenal (Potential).|Ricin B-type lectin.				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGCCTTGCAGCAGGGAACTAA	0.517													54	135	---	---	---	---	PASS
CAPN9	10753	broad.mit.edu	37	1	230914831	230914831	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230914831G>T	uc001htz.1	+	9	1179	c.1066G>T	c.(1066-1068)GGA>TGA	p.G356*	CAPN9_uc009xfg.1_Nonsense_Mutation_p.G293*|CAPN9_uc001hua.1_Nonsense_Mutation_p.G330*	NM_006615	NP_006606	O14815	CAN9_HUMAN	calpain 9 isoform 1	356	Domain III.				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GGTCCATCAGGGAAGCTGGGT	0.592													10	24	---	---	---	---	PASS
TTC13	79573	broad.mit.edu	37	1	231042639	231042639	+	3'UTR	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231042639A>G	uc001huf.3	-	23					TTC13_uc009xfi.2_3'UTR|TTC13_uc009xfj.2_RNA|TTC13_uc001hug.3_3'UTR	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a								binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TTGTATAAATACAGCAGCAGA	0.353													20	33	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235860456	235860456	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235860456C>A	uc001hxj.2	-	46	10666	c.10491G>T	c.(10489-10491)CAG>CAT	p.Q3497H	LYST_uc001hxi.2_Missense_Mutation_p.Q721H	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3497					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGGGCAGAGCCTGGAGAGAGC	0.478									Chediak-Higashi_syndrome				21	38	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436713	248436713	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436713C>T	uc010pzi.1	-	1	404	c.404G>A	c.(403-405)AGC>AAC	p.S135N		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGCTGCCAGCTCATGAGAGT	0.592													10	76	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1168771	1168771	+	Intron	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1168771G>T	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTCTTGTTTTGCTGCAGGGTC	0.547													29	50	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1204904	1204904	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1204904C>T	uc002qwq.2	+	9	835	c.707C>T	c.(706-708)ACG>ATG	p.T236M	SNTG2_uc010ewi.2_Missense_Mutation_p.T109M	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	236					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AAAGCCGGAACGGAAAAATTA	0.542													8	122	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1652584	1652584	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652584G>T	uc002qxa.2	-	17	3032	c.2968C>A	c.(2968-2970)CTG>ATG	p.L990M		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	990					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGGAACCACAGCGTGTGCATG	0.647													3	8	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21231683	21231683	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21231683C>T	uc002red.2	-	26	8185	c.8057G>A	c.(8056-8058)TGG>TAG	p.W2686*		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2686					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGGAACGGGCCACTGCAGCTC	0.443													19	92	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29917817	29917817	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29917817C>T	uc002rmy.2	-	3	1758	c.851G>A	c.(850-852)AGG>AAG	p.R284K		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	284	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GCTCTGGTTCCTGAGGTCATG	0.572			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				13	63	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71654035	71654035	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71654035G>A	uc002shx.2	+	24	5355	c.5036G>A	c.(5035-5037)CGC>CAC	p.R1679H	ZNF638_uc002shy.2_Missense_Mutation_p.R1679H|ZNF638_uc002shz.2_Missense_Mutation_p.R1679H|ZNF638_uc002sia.2_Missense_Mutation_p.R1679H|ZNF638_uc002sib.1_3'UTR|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.R776H|ZNF638_uc002sid.2_Missense_Mutation_p.R48H	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	1679					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						AAACAGGAACGCTTGGTAACT	0.393													22	49	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74043169	74043169	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74043169C>A	uc002sjr.1	+	3	1940	c.1819C>A	c.(1819-1821)CGG>AGG	p.R607R		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	607	Lys-rich.									ovary(2)	2						CAATATGAAACGGAAGAAAAA	0.443													12	89	---	---	---	---	PASS
HK2	3099	broad.mit.edu	37	2	75101429	75101429	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75101429G>T	uc002snd.2	+	7	2654	c.728G>T	c.(727-729)CGC>CTC	p.R243L		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	243	Regulatory.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						GAAGAGATGCGCCACATCGAC	0.612													5	25	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530229	80530229	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530229C>A	uc002sok.1	-	2	986	c.716G>T	c.(715-717)TGC>TTC	p.C239F	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	239	LRR 7.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						CCTCCGCAGGCAGAGCGAGTG	0.582										HNSCC(69;0.2)			14	67	---	---	---	---	PASS
CD8A	925	broad.mit.edu	37	2	87017709	87017709	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87017709T>C	uc002srt.2	-	2	1034	c.145A>G	c.(145-147)AAC>GAC	p.N49D	RMND5A_uc002srs.3_Intron|CD8A_uc002srv.2_Missense_Mutation_p.N49D|CD8A_uc010ytn.1_Missense_Mutation_p.N90D|CD8A_uc002sru.2_Missense_Mutation_p.N49D	NM_001768	NP_001759	P01732	CD8A_HUMAN	CD8 antigen alpha polypeptide isoform 1	49	Ig-like V-type.|Extracellular (Potential).				antigen processing and presentation|regulation of immune response|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			ovary(1)	1						GACGTCGGGTTGGACAGCAGC	0.682													6	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278144	89278144	+	Intron	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278144G>C	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GAGCCTGGGCGCCTGGCCAGG	0.577													25	54	---	---	---	---	PASS
TEKT4	150483	broad.mit.edu	37	2	95542358	95542358	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95542358A>G	uc002stw.1	+	6	1245	c.1152A>G	c.(1150-1152)CTA>CTG	p.L384L	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	384	Potential.				cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						AGAAGCTTCTAGAAGCGGAGC	0.602													9	16	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125367414	125367414	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125367414A>C	uc002tno.2	+	12	2154	c.1790A>C	c.(1789-1791)CAG>CCG	p.Q597P	CNTNAP5_uc010flu.2_Missense_Mutation_p.Q598P	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	597	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TACAGGCACCAGGGGAATACA	0.532													20	46	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135744864	135744864	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135744864A>G	uc002tue.1	-	7	1609	c.1578T>C	c.(1576-1578)AAT>AAC	p.N526N	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.N413N|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.N254N|YSK4_uc002tui.3_Silent_p.N543N	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	526							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TATGCTTGTCATTTTCTTGGT	0.413													21	40	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160755282	160755282	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160755282C>A	uc002ubc.3	-	2	452	c.383G>T	c.(382-384)GGA>GTA	p.G128V	LY75_uc002ubb.3_Missense_Mutation_p.G128V|LY75_uc010fos.2_Missense_Mutation_p.G128V|LY75_uc010fot.1_Missense_Mutation_p.G128V	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	128	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TGTGCCATGTCCATCCTTCAG	0.522													6	29	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162833288	162833288	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162833288C>A	uc002ubx.3	+	25	3430	c.3246C>A	c.(3244-3246)ATC>ATA	p.I1082I	SLC4A10_uc002uby.3_Silent_p.I1052I|SLC4A10_uc010zcs.1_Silent_p.I1063I	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	1082	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						CATCTGTGATCAATATATCTG	0.363													6	15	---	---	---	---	PASS
KBTBD10	10324	broad.mit.edu	37	2	170366615	170366615	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170366615G>A	uc002ueu.1	+	1	404	c.327G>A	c.(325-327)TTG>TTA	p.L109L	KBTBD10_uc010zdh.1_Intron	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10	109					striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						TTTTTGCATTGGCCAGCCGCT	0.413													13	64	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593012	179593012	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593012C>A	uc010zfg.1	-	64	16031	c.15807G>T	c.(15805-15807)CAG>CAT	p.Q5269H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.Q1930H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6196							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTAAACCACTGAGCACTAA	0.383													13	29	---	---	---	---	PASS
MOBKL3	25843	broad.mit.edu	37	2	198380840	198380840	+	Silent	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198380840G>C	uc002uun.3	+	1	70	c.30G>C	c.(28-30)CTG>CTC	p.L10L	MOBKL3_uc002uum.3_Intron|MOBKL3_uc010fsn.2_Silent_p.L10L|MOBKL3_uc010fso.2_5'UTR|MOBKL3_uc010zgz.1_5'UTR	NM_015387	NP_056202	Q9Y3A3	MOBL3_HUMAN	Mps One Binder kinase activator-like 3 isoform	10					transport	Golgi cisterna membrane|perinuclear region of cytoplasm	metal ion binding|protein binding				0			Epithelial(96;0.225)			CGGCAGTGCTGAGGCGGAACA	0.687													3	3	---	---	---	---	PASS
SPATS2L	26010	broad.mit.edu	37	2	201337764	201337764	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201337764G>T	uc002uvn.3	+	12	1622	c.1270G>T	c.(1270-1272)GCC>TCC	p.A424S	SPATS2L_uc010fst.2_Missense_Mutation_p.A424S|SPATS2L_uc002uvo.3_Missense_Mutation_p.A364S|SPATS2L_uc002uvp.3_Missense_Mutation_p.A424S|SPATS2L_uc002uvq.3_Missense_Mutation_p.A355S|SPATS2L_uc002uvr.3_Missense_Mutation_p.A424S|SPATS2L_uc010zhc.1_Missense_Mutation_p.A454S	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	424						cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						GACCATGCCGGCCAACAAGCA	0.522													6	11	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	202005138	202005138	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202005138C>T	uc002uxb.3	+	5	1034	c.582C>T	c.(580-582)CTC>CTT	p.L194L	CFLAR_uc002uwz.2_Silent_p.L194L|CFLAR_uc002uxa.3_Silent_p.L194L|CFLAR_uc010zhk.1_Silent_p.L98L|CFLAR_uc002uxc.3_Silent_p.L194L|CFLAR_uc010zhl.1_Silent_p.L98L|CFLAR_uc010fsw.1_RNA|CFLAR_uc002uxd.3_Silent_p.L194L|CFLAR_uc002uxe.2_Silent_p.L194L|CFLAR_uc002uxf.2_Silent_p.L194L|CFLAR_uc010fsy.2_RNA|CFLAR_uc010fsx.2_Silent_p.L194L|CFLAR_uc010zhm.1_Silent_p.L98L|CFLAR_uc010fsz.2_5'UTR|CFLAR_uc002uxg.2_5'UTR|uc002uxh.1_RNA	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform	194	Interaction with caspase-8 propeptide.|Interaction with FADD.|Interaction with caspase-3.|Not proteolytically processed and involved in apoptosis inhibition.|Interaction with TRAF1 and TRAF2.|Interaction with caspase-8.				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						AAAAGAGTCTCAAGGATCCTT	0.388													9	82	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216289955	216289955	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216289955G>T	uc002vfa.2	-	7	1164	c.898C>A	c.(898-900)CCC>ACC	p.P300T	FN1_uc002vfb.2_Missense_Mutation_p.P300T|FN1_uc002vfc.2_Missense_Mutation_p.P300T|FN1_uc002vfd.2_Missense_Mutation_p.P300T|FN1_uc002vfe.2_Missense_Mutation_p.P300T|FN1_uc002vff.2_Missense_Mutation_p.P300T|FN1_uc002vfg.2_Missense_Mutation_p.P300T|FN1_uc002vfh.2_Missense_Mutation_p.P300T|FN1_uc002vfi.2_Missense_Mutation_p.P300T|FN1_uc002vfj.2_Missense_Mutation_p.P300T|FN1_uc002vfl.2_Missense_Mutation_p.P300T	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	300					acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding	p.P300S(1)		central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGAGGCTGGGGGTGAGGCTGC	0.522													12	97	---	---	---	---	PASS
TMPPE	643853	broad.mit.edu	37	3	33134425	33134425	+	Silent	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33134425T>C	uc003cfk.2	-	2	1454	c.1263A>G	c.(1261-1263)ACA>ACG	p.T421T	GLB1_uc003cfh.1_Intron|GLB1_uc003cfi.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron|TMPPE_uc011axl.1_Silent_p.T284T	NM_001039770	NP_001034859	Q6ZT21	TMPPE_HUMAN	transmembrane protein with	421						integral to membrane	metal ion binding				0						CATACACGAATGTAGCCTGGG	0.567													10	11	---	---	---	---	PASS
EXOG	9941	broad.mit.edu	37	3	38539221	38539221	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38539221C>T	uc003cih.2	+	2	361	c.265C>T	c.(265-267)CGG>TGG	p.R89W	EXOG_uc010hhg.2_Intron|EXOG_uc011ayq.1_Intron|EXOG_uc003cij.2_5'UTR|EXOG_uc010hhd.2_Intron|EXOG_uc010hhe.2_Intron|EXOG_uc003cik.2_5'UTR|EXOG_uc010hhf.2_5'UTR|EXOG_uc003cii.2_Intron	NM_005107	NP_005098	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	89						mitochondrial inner membrane	endonuclease activity|metal ion binding|nucleic acid binding				0						TCAGGCAAAGCGGGTGCCTAG	0.398													12	28	---	---	---	---	PASS
MON1A	84315	broad.mit.edu	37	3	49947570	49947570	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49947570C>T	uc003cxz.2	-	4	1778	c.1652G>A	c.(1651-1653)AGC>AAC	p.S551N	MON1A_uc003cya.2_Missense_Mutation_p.S389N|MON1A_uc003cyb.2_Missense_Mutation_p.S389N	NM_032355	NP_115731	Q86VX9	MON1A_HUMAN	MON1 homolog A isoform a	454							protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GAGTCCCGAGCTCTTTGACTT	0.612													18	57	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806723	97806723	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806723G>A	uc011bgs.1	+	1	707	c.707G>A	c.(706-708)AGA>AAA	p.R236K		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GAAAAGGGCAGAAGCAAAGCC	0.408													6	40	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111632221	111632221	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111632221A>T	uc010hqa.2	+	3	1802	c.1391A>T	c.(1390-1392)GAC>GTC	p.D464V	PHLDB2_uc003dyc.2_Missense_Mutation_p.D491V|PHLDB2_uc003dyd.2_Missense_Mutation_p.D464V|PHLDB2_uc003dyg.2_Missense_Mutation_p.D464V|PHLDB2_uc003dyh.2_Missense_Mutation_p.D464V|PHLDB2_uc003dyi.2_Missense_Mutation_p.D50V|PHLDB2_uc003dyf.3_Missense_Mutation_p.D464V	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	464						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						ACAAAGCCTGACAGTCGCTTA	0.517													66	81	---	---	---	---	PASS
CCDC14	64770	broad.mit.edu	37	3	123650002	123650002	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123650002C>A	uc011bjx.1	-	12	1960	c.1869G>T	c.(1867-1869)GGG>GGT	p.G623G	CCDC14_uc003egv.3_Silent_p.G264G|CCDC14_uc003egx.3_Silent_p.G423G|CCDC14_uc010hrt.2_Silent_p.G582G|CCDC14_uc003egy.3_Silent_p.G423G|CCDC14_uc003egz.2_Silent_p.G423G	NM_022757	NP_073594	Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	623						centrosome					0		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		GTAATGTTATCCCCAATATCT	0.368													11	39	---	---	---	---	PASS
ASTE1	28990	broad.mit.edu	37	3	130743391	130743391	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130743391G>A	uc003env.1	-	3	1202	c.760C>T	c.(760-762)CAC>TAC	p.H254Y	NEK11_uc003enx.2_5'Flank|NEK11_uc003eny.2_5'Flank|NEK11_uc003eoa.2_5'Flank|NEK11_uc003enz.2_5'Flank|NEK11_uc010htn.2_5'Flank|NEK11_uc011blk.1_5'Flank|NEK11_uc011bll.1_5'Flank|NEK11_uc003enw.1_5'Flank|NEK11_uc011blm.1_5'Flank|ASTE1_uc010htm.1_Missense_Mutation_p.H254Y|ASTE1_uc011blj.1_RNA	NM_014065	NP_054784	Q2TB18	ASTE1_HUMAN	asteroid homolog 1	254					DNA repair		nuclease activity				0						AGGATTCGGTGGTGTCTCCTC	0.438													28	25	---	---	---	---	PASS
TFDP2	7029	broad.mit.edu	37	3	141697362	141697362	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141697362C>T	uc003eun.3	-	7	898	c.519G>A	c.(517-519)TCG>TCA	p.S173S	TFDP2_uc003euk.3_Silent_p.S86S|TFDP2_uc010hur.2_Silent_p.S112S|TFDP2_uc003eul.3_Silent_p.S112S|TFDP2_uc011bnf.1_Silent_p.S76S|TFDP2_uc011bng.1_Silent_p.S37S|TFDP2_uc003eum.3_Silent_p.S112S	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	173	Potential.				cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						ATTTACATACCGAATCAGCAG	0.383													12	151	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147108988	147108988	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147108988A>C	uc003ewd.1	-	4	1007	c.734T>G	c.(733-735)TTC>TGC	p.F245C	ZIC4_uc003ewc.1_Missense_Mutation_p.F175C|ZIC4_uc011bno.1_Missense_Mutation_p.F295C	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	245	C2H2-type 4.					nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCTGTTGGCGAAGCGCCGCTC	0.617													35	19	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148917542	148917542	+	Silent	SNP	G	A	A	rs144537170	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148917542G>A	uc003ewy.3	-	8	1711	c.1458C>T	c.(1456-1458)AAC>AAT	p.N486N	CP_uc011bnr.1_RNA|CP_uc003ewx.3_Silent_p.N267N|CP_uc003ewz.2_Silent_p.N486N|CP_uc010hvf.1_Silent_p.N212N	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	486	Plastocyanin-like 3.|F5/8 type A 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ATGTGCCCTCGTTGTTCTTAT	0.443													32	218	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151148142	151148142	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151148142T>C	uc003eyp.2	+	42	6397	c.6359T>C	c.(6358-6360)GTG>GCG	p.V2120A	MED12L_uc011bnz.1_Missense_Mutation_p.V1784A	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	2120	Gln-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCCGCCTTGGTGCGGCAGCTC	0.537													7	65	---	---	---	---	PASS
MBNL1	4154	broad.mit.edu	37	3	152174130	152174130	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152174130G>T	uc003ezm.2	+	7	1879	c.1090G>T	c.(1090-1092)GCA>TCA	p.A364S	MBNL1_uc003ezh.2_Missense_Mutation_p.A358S|MBNL1_uc003ezi.2_Missense_Mutation_p.A346S|MBNL1_uc003ezj.2_Missense_Mutation_p.A319S|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Silent_p.L294L|MBNL1_uc003ezn.2_Missense_Mutation_p.A290S|MBNL1_uc003ezo.2_Missense_Mutation_p.A278S|MBNL1_uc010hvp.2_Intron	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	364					embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TCCCTTCGCTGCAACAGCCAC	0.428													17	103	---	---	---	---	PASS
LRRC31	79782	broad.mit.edu	37	3	169569470	169569470	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169569470G>T	uc003fgc.1	-	7	1173	c.1096C>A	c.(1096-1098)CCA>ACA	p.P366T	LRRC31_uc010hwp.1_Missense_Mutation_p.P310T	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	366										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TTCAATGCTGGTAAAAATCGG	0.403													28	97	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172165779	172165779	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165779T>A	uc003fib.1	-	1	425	c.425A>T	c.(424-426)TAC>TTC	p.Y142F	GHSR_uc011bpv.1_Missense_Mutation_p.Y142F	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	142	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GATGGCGAAGTAGCGCTCGAC	0.617													29	13	---	---	---	---	PASS
HTR3E	285242	broad.mit.edu	37	3	183823602	183823602	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183823602C>A	uc010hxq.2	+	7	1236	c.770C>A	c.(769-771)CCC>CAC	p.P257H	HTR3E_uc003fml.3_Missense_Mutation_p.P242H|HTR3E_uc003fmm.2_Missense_Mutation_p.P272H|HTR3E_uc010hxr.2_Missense_Mutation_p.P283H|HTR3E_uc003fmn.2_Missense_Mutation_p.P257H	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	257	Helical; Name=1; (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CTTCTCGTGCCCAGTGGCTTT	0.552													19	143	---	---	---	---	PASS
RTP2	344892	broad.mit.edu	37	3	187416621	187416621	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187416621C>A	uc003fro.1	-	2	772	c.343G>T	c.(343-345)GAG>TAG	p.E115*		NM_001004312	NP_001004312	Q5QGT7	RTP2_HUMAN	receptor transporting protein 2	115	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding				0	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		ACCAGGCCCTCGATGTTCTCC	0.677													19	22	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193061839	193061839	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193061839C>G	uc011bsq.1	-	9	820	c.820G>C	c.(820-822)GAG>CAG	p.E274Q		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	274					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TCCAGCTCCTCCAAACCTACA	0.418													17	58	---	---	---	---	PASS
ZFYVE28	57732	broad.mit.edu	37	4	2343208	2343208	+	Silent	SNP	G	A	A	rs74965159		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2343208G>A	uc003gex.1	-	3	634	c.315C>T	c.(313-315)GCC>GCT	p.A105A	ZFYVE28_uc011bvk.1_Silent_p.A35A|ZFYVE28_uc011bvl.1_Silent_p.A105A|ZFYVE28_uc003gey.3_Silent_p.A35A|ZFYVE28_uc003gez.2_Silent_p.A58A|ZFYVE28_uc003gew.1_5'Flank	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	105					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						CCGCTACCTCGGCACCGAACC	0.662													5	11	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8613866	8613866	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8613866C>A	uc003glm.2	+	8	1466	c.1340C>A	c.(1339-1341)GCG>GAG	p.A447E	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.A310E|CPZ_uc003glo.2_Missense_Mutation_p.A436E|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	447					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						ATCAACGGGGCGGACTGGTAC	0.403													11	3	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62801650	62801650	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62801650T>A	uc010ihh.2	+	12	2275	c.2102T>A	c.(2101-2103)GTT>GAT	p.V701D	LPHN3_uc003hcq.3_Missense_Mutation_p.V701D|LPHN3_uc003hct.2_Missense_Mutation_p.V94D	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	688	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						GAATTGGAAGTTGCAAGACTG	0.363													3	4	---	---	---	---	PASS
AREG	374	broad.mit.edu	37	4	75312287	75312287	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75312287A>G	uc011cbl.1	+	2	308	c.98A>G	c.(97-99)TAC>TGC	p.Y33C		NM_001657	NP_001648	P15514	AREG_HUMAN	amphiregulin preproprotein	33					cell proliferation|cell-cell signaling|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|positive regulation of DNA replication	cell surface|extracellular space|integral to membrane	cytokine activity|growth factor activity				0			Lung(101;0.196)			AATGACACCTACTCTGGGAAG	0.488													48	39	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114163341	114163341	+	Silent	SNP	C	A	A	rs113692517	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114163341C>A	uc003ibe.3	+	9	967	c.867C>A	c.(865-867)GGC>GGA	p.G289G	ANK2_uc003ibd.3_Silent_p.G268G|ANK2_uc003ibf.3_Silent_p.G289G|ANK2_uc003ibc.2_Silent_p.G265G|ANK2_uc011cgb.1_Silent_p.G304G	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	289	ANK 8.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGATCGAGGCGGTCAGATCG	0.428													26	26	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169305933	169305933	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169305933C>T	uc003irq.3	-	30	4167	c.3946G>A	c.(3946-3948)GAC>AAC	p.D1316N		NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1316	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CCAAGCAGGTCTTGACCTCTT	0.423													11	19	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183575036	183575036	+	Silent	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183575036T>C	uc003ivd.1	+	5	1138	c.1101T>C	c.(1099-1101)TCT>TCC	p.S367S		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	367	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CATTACCTTCTGGAGACAATG	0.368													12	17	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1420684	1420684	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1420684A>G	uc003jck.2	-	6	1048	c.927T>C	c.(925-927)TCT>TCC	p.S309S		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	309					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CTGTACTCACAGACGCCTCGC	0.592													29	117	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065607	35065607	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065607C>A	uc003jjm.2	-	10	1983	c.1453G>T	c.(1453-1455)GAG>TAG	p.E485*	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Nonsense_Mutation_p.E384*	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	485	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGGTCAGTCTCAGAATGGAAG	0.483													27	58	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39383066	39383066	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39383066C>A	uc003jlx.2	-	10	1526	c.995G>T	c.(994-996)AGT>ATT	p.S332I	DAB2_uc003jlw.2_Missense_Mutation_p.S311I	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	332					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			GGGCCCATTACTCAGCGGAGT	0.498													25	73	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90049535	90049535	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90049535A>G	uc003kju.2	+	54	11362	c.11266A>G	c.(11266-11268)ATT>GTT	p.I3756V	GPR98_uc003kjt.2_Missense_Mutation_p.I1462V|GPR98_uc003kjv.2_Missense_Mutation_p.I1356V	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3756	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGTGCTACTATTGATCAGGA	0.453													21	24	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127648412	127648412	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127648412C>T	uc003kuu.2	-	37	5232	c.4793G>A	c.(4792-4794)GGG>GAG	p.G1598E		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1598	TB 6.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GACGCCCACCCCGATCTCGGT	0.552													105	149	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	133984827	133984827	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133984827G>T	uc003kzs.2	+	1	349	c.61G>T	c.(61-63)GGA>TGA	p.G21*	SEC24A_uc011cxu.1_5'UTR	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	21					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGCCCAGAACGGAGCCGCCTT	0.697													3	12	---	---	---	---	PASS
KDM3B	51780	broad.mit.edu	37	5	137727932	137727932	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137727932C>A	uc003lcy.1	+	8	2811	c.2611C>A	c.(2611-2613)CGG>AGG	p.R871R	KDM3B_uc010jew.1_Silent_p.R527R|KDM3B_uc011cys.1_Intron	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	871					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11						GGGCCGGCCTCGGACTGCCCC	0.612													3	21	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209961	140209961	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209961A>T	uc003lho.2	+	1	2312	c.2285A>T	c.(2284-2286)GAG>GTG	p.E762V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.E762V	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	762	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCCGGGGAGGGCCCACCC	0.597													6	35	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736606	140736606	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736606G>T	uc003ljq.1	+	1	1839	c.1839G>T	c.(1837-1839)GAG>GAT	p.E613D	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.E613D	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	613	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCCAGCGAGCCGGGACTAT	0.622													21	26	---	---	---	---	PASS
KIAA0141	9812	broad.mit.edu	37	5	141316862	141316862	+	Missense_Mutation	SNP	G	T	T	rs137962377		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141316862G>T	uc003lls.2	+	11	1371	c.1249G>T	c.(1249-1251)GCT>TCT	p.A417S	KIAA0141_uc003llt.2_Missense_Mutation_p.A417S|KIAA0141_uc003llu.1_RNA	NM_001142603	NP_001136075	Q14154	DELE_HUMAN	hypothetical protein LOC9812 precursor	417	TPR 6.				apoptosis|regulation of caspase activity	mitochondrion	protein binding			skin(1)	1		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGTCAGCCGCTCTGGGAAA	0.567													26	51	---	---	---	---	PASS
ZNF76	7629	broad.mit.edu	37	6	35260412	35260412	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35260412T>C	uc003oki.1	+	10	1218	c.1013T>C	c.(1012-1014)GTG>GCG	p.V338A	ZNF76_uc011dsz.1_Missense_Mutation_p.V338A|ZNF76_uc003okj.1_Missense_Mutation_p.V338A	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)	338	C2H2-type 6.				regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCACGTGGTGCACACACAC	0.617													25	23	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36981871	36981871	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36981871C>G	uc010jwp.1	+	6	989	c.818C>G	c.(817-819)GCC>GGC	p.A273G	FGD2_uc003ong.2_5'UTR|FGD2_uc011dtv.1_5'UTR|FGD2_uc003oni.1_Missense_Mutation_p.A79G	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	273	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						CAGGCCGATGCCCAGAGTGAG	0.577													21	14	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51618098	51618098	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51618098C>T	uc003pah.1	-	57	9127	c.8851G>A	c.(8851-8853)GGA>AGA	p.G2951R	PKHD1_uc010jzn.1_Missense_Mutation_p.G934R|PKHD1_uc003pai.2_Missense_Mutation_p.G2951R	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2951	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GTCAACAGTCCAACCTCAGCA	0.468													15	22	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97053773	97053773	+	Intron	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97053773T>C	uc003pos.1	+						FHL5_uc003pot.1_Intron	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator							nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ACTTTTGGAGTACAGGTTCCC	0.338													16	21	---	---	---	---	PASS
KLHL32	114792	broad.mit.edu	37	6	97424046	97424046	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97424046A>G	uc010kcm.1	+	3	669	c.197A>G	c.(196-198)TAT>TGT	p.Y66C	KLHL32_uc003poy.2_Missense_Mutation_p.Y66C|KLHL32_uc011ead.1_Missense_Mutation_p.Y66C|KLHL32_uc003poz.2_5'UTR|KLHL32_uc011eae.1_Missense_Mutation_p.Y66C	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	66	BTB.									ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TGCAGTGACTATTTCCGGGTA	0.448													6	43	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110540601	110540601	+	Silent	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110540601A>T	uc003pua.2	+	11	1149	c.1125A>T	c.(1123-1125)GTA>GTT	p.V375V		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	375	WD 3.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ACCGAAAAGTACCTTATTGTG	0.323													21	17	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116747880	116747880	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116747880A>G	uc003pws.2	+	3	754	c.560A>G	c.(559-561)TAT>TGT	p.Y187C	DSE_uc011ebf.1_Missense_Mutation_p.Y187C|DSE_uc011ebg.1_Missense_Mutation_p.Y206C|DSE_uc003pwt.2_Missense_Mutation_p.Y187C	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	187					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GCCTCAGGGTATATGTATGAA	0.463													21	26	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18975451	18975451	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18975451G>T	uc003suh.2	+	22	2855	c.2814G>T	c.(2812-2814)AAG>AAT	p.K938N	HDAC9_uc003sue.2_Missense_Mutation_p.K938N|HDAC9_uc003sui.2_Missense_Mutation_p.K941N|HDAC9_uc003suj.2_Missense_Mutation_p.K897N|HDAC9_uc003suk.2_Missense_Mutation_p.K186N	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	938	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	ATTTGACGAAGCAATTGATGA	0.378													38	113	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23776540	23776540	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23776540G>A	uc003sws.3	+	8	927	c.860G>A	c.(859-861)GGT>GAT	p.G287D	STK31_uc003swt.3_Missense_Mutation_p.G264D|STK31_uc011jze.1_Missense_Mutation_p.G287D|STK31_uc010kuq.2_Missense_Mutation_p.G264D	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	287							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTGGCTGTTGGTGACTTTAAT	0.338													16	33	---	---	---	---	PASS
PLEKHA8	84725	broad.mit.edu	37	7	30102343	30102343	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30102343A>T	uc003tam.1	+	12	1376	c.1285A>T	c.(1285-1287)ATC>TTC	p.I429F	PLEKHA8_uc003tao.2_Missense_Mutation_p.I313F|PLEKHA8_uc003tap.1_Missense_Mutation_p.I429F|PLEKHA8_uc003tan.2_Missense_Mutation_p.I429F	NM_032639	NP_116028	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A	429					protein transport	cytoplasm	glycolipid binding|glycolipid transporter activity			breast(3)|ovary(1)	4						GGAGAAGGATATCCAGACAGC	0.358													19	47	---	---	---	---	PASS
ANLN	54443	broad.mit.edu	37	7	36465356	36465356	+	Intron	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36465356A>T	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						CACAGTAAGTAGAATTTTTGA	0.318													14	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38288949	38288949	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38288949T>G	uc003tfu.3	-	2	275	c.40A>C	c.(40-42)ACG>CCG	p.T14P	uc003tfv.2_Missense_Mutation_p.T14P|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																		TCTGGCACCGTTAACCAGCTA	0.393													41	79	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55259524	55259524	+	Missense_Mutation	SNP	T	A	A	rs121913444		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55259524T>A	uc003tqk.2	+	21	2828	c.2582T>A	c.(2581-2583)CTG>CAG	p.L861Q	EGFR_uc010kzg.1_Missense_Mutation_p.L816Q|EGFR_uc011kco.1_Missense_Mutation_p.L808Q|uc003tqo.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	861	Cytoplasmic (Potential).|Protein kinase.		L -> Q (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.L861Q(96)|p.L861R(10)|p.A859_L883>V(2)|p.L861F(1)|p.L861V(1)|p.L861P(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTGGCCAAACTGCTGGGTGCG	0.557		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			45	121	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122755604	122755604	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122755604C>G	uc003vkm.2	-	15	1781	c.1756G>C	c.(1756-1758)GCT>CCT	p.A586P	SLC13A1_uc010lks.2_Missense_Mutation_p.A462P	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	586						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	ATAGCAGGAGCCCACGAAGGG	0.413													14	40	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128415130	128415130	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128415130C>T	uc003vnt.3	-	2	431	c.431G>A	c.(430-432)CGC>CAC	p.R144H		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	144	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						GGAGCTGAAGCGGAAGTTGCC	0.552													15	30	---	---	---	---	PASS
CLCN1	1180	broad.mit.edu	37	7	143017891	143017891	+	Intron	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143017891A>T	uc003wcr.1	+						CLCN1_uc011ktc.1_Intron|CLCN1_uc003wcs.1_5'Flank|CLCN1_uc010lox.1_5'Flank|CLCN1_uc010loy.1_5'Flank	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle						muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					CCTTCAGGGTAGGTTTAACCT	0.512													21	50	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701479	143701479	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701479C>A	uc003wdt.1	+	1	390	c.390C>A	c.(388-390)CTC>CTA	p.L130L		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					GTCGCCCACTCCACTACCCAA	0.532													21	47	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147336265	147336265	+	Silent	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147336265A>T	uc003weu.1	+	13	2481	c.1965A>T	c.(1963-1965)CCA>CCT	p.P655P		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	655	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GCTACAACCCAGAAAAATACT	0.512										HNSCC(39;0.1)			21	71	---	---	---	---	PASS
C7orf33	202865	broad.mit.edu	37	7	148312428	148312428	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148312428C>T	uc003wew.2	+	3	830	c.469C>T	c.(469-471)CAT>TAT	p.H157Y		NM_145304	NP_660347	Q8WU49	CG033_HUMAN	hypothetical protein LOC202865	157										central_nervous_system(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGTACGTGGGCATGAAGTAAG	0.388													30	59	---	---	---	---	PASS
CLN8	2055	broad.mit.edu	37	8	1728421	1728421	+	Silent	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1728421C>G	uc003wpo.3	+	3	854	c.549C>G	c.(547-549)GGC>GGG	p.G183G		NM_018941	NP_061764	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8	183	TLC.				cell death|ceramide biosynthetic process|cholesterol metabolic process|lipid transport|negative regulation of proteolysis|phospholipid metabolic process	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TGCAGGCGGGCTGGTCCGAGT	0.453													9	25	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10470689	10470689	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10470689C>T	uc003wtc.2	-	4	1148	c.919G>A	c.(919-921)GAT>AAT	p.D307N		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	307					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		TTCATGTCATCGCCAGCCACC	0.647													14	43	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	13357058	13357058	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13357058C>T	uc003wwm.2	-	2	967	c.523G>A	c.(523-525)GTA>ATA	p.V175I	DLC1_uc003wwn.2_Missense_Mutation_p.V175I|DLC1_uc011kxy.1_Missense_Mutation_p.V175I	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	175					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						CTTTCTTTTACCAGTGCTAAT	0.408													12	82	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	13357059	13357059	+	Silent	SNP	C	A	A	rs147848228		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13357059C>A	uc003wwm.2	-	2	966	c.522G>T	c.(520-522)CTG>CTT	p.L174L	DLC1_uc003wwn.2_Silent_p.L174L|DLC1_uc011kxy.1_Silent_p.L174L	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	174					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TTTCTTTTACCAGTGCTAATT	0.408													12	81	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	29007808	29007808	+	Intron	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29007808T>C	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ATGAACAACATCATACCTGAA	0.348													11	26	---	---	---	---	PASS
SLC20A2	6575	broad.mit.edu	37	8	42294928	42294928	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42294928C>A	uc010lxl.2	-	8	1796	c.1102G>T	c.(1102-1104)GAG>TAG	p.E368*	SLC20A2_uc010lxm.2_Nonsense_Mutation_p.E368*|SLC20A2_uc003xpe.2_Nonsense_Mutation_p.E368*|SLC20A2_uc011lcu.1_Nonsense_Mutation_p.E170*	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2	368	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			GGCTTCTCCTCGGGGCCCCTG	0.597													25	63	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59728236	59728236	+	Silent	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59728236C>G	uc003xtw.1	-	7	1274	c.1053G>C	c.(1051-1053)CTG>CTC	p.L351L		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	351						nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TCGAATTGATCAGCTGAGGAG	0.512													15	34	---	---	---	---	PASS
GGH	8836	broad.mit.edu	37	8	63938734	63938734	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63938734G>A	uc003xuw.2	-	5	765	c.482C>T	c.(481-483)CCG>CTG	p.P161L		NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor	161	Gamma-glutamyl hydrolase.				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	GAAGTTCAGCGGCATTGCCAC	0.418													10	37	---	---	---	---	PASS
CYP7B1	9420	broad.mit.edu	37	8	65509278	65509278	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65509278C>A	uc003xvj.2	-	6	1646	c.1442G>T	c.(1441-1443)GGA>GTA	p.G481V		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	481					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				GTAGTTTAGTCCTATGGGCTT	0.303													10	27	---	---	---	---	PASS
CYP7B1	9420	broad.mit.edu	37	8	65509282	65509282	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65509282T>A	uc003xvj.2	-	6	1642	c.1438A>T	c.(1438-1440)ATA>TTA	p.I480L		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	480					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTTAGTCCTATGGGCTTATCA	0.318													9	27	---	---	---	---	PASS
PI15	51050	broad.mit.edu	37	8	75737654	75737654	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75737654G>C	uc003yal.2	+	2	349	c.170G>C	c.(169-171)AGG>ACG	p.R57T	uc003yak.1_Intron|PI15_uc003yam.2_Missense_Mutation_p.R57T	NM_015886	NP_056970	O43692	PI15_HUMAN	protease inhibitor 15 preproprotein	57						extracellular region	peptidase inhibitor activity			central_nervous_system(2)|ovary(1)	3	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			CCCAAAGCCAGGCGGAAGCGC	0.448													10	68	---	---	---	---	PASS
STMN2	11075	broad.mit.edu	37	8	80553671	80553671	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80553671G>C	uc003ybj.2	+	3	225	c.174G>C	c.(172-174)TTG>TTC	p.L58F	STMN2_uc010lzp.2_RNA|STMN2_uc011lfn.1_Missense_Mutation_p.L58F	NM_007029	NP_008960	Q93045	STMN2_HUMAN	superiorcervical ganglia, neural specific 10	58	Regulatory/phosphorylation domain (Potential).				intracellular signal transduction|negative regulation of microtubule depolymerization|negative regulation of microtubule polymerization|negative regulation of neuron projection development|neuron differentiation|positive regulation of microtubule depolymerization|positive regulation of neuron projection development	axon|growth cone|membrane|membrane fraction|perinuclear region of cytoplasm|soluble fraction	protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			AGCTGATCTTGAAGCCACCAT	0.458													27	34	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110476886	110476886	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110476886G>T	uc003yne.2	+	49	7929	c.7825G>T	c.(7825-7827)GGC>TGC	p.G2609C		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2609	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGTTCCCCTTGGCGAATTTTT	0.433										HNSCC(38;0.096)			25	76	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113697704	113697704	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113697704G>A	uc003ynu.2	-	15	2572	c.2413C>T	c.(2413-2415)CAC>TAC	p.H805Y	CSMD3_uc003yns.2_Missense_Mutation_p.H77Y|CSMD3_uc003ynt.2_Missense_Mutation_p.H765Y|CSMD3_uc011lhx.1_Missense_Mutation_p.H701Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	805	Extracellular (Potential).|CUB 4.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CGCAGTATGTGACTATTACTA	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			22	41	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139611003	139611003	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139611003G>C	uc003yvd.2	-	61	4771	c.4324C>G	c.(4324-4326)CCC>GCC	p.P1442A	COL22A1_uc011ljo.1_Missense_Mutation_p.P722A	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1442	Pro-rich.|Gly-rich.|Collagen-like 14.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGCCCTGGGGGTCCAACTGGT	0.622										HNSCC(7;0.00092)			19	25	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689491	109689491	+	Missense_Mutation	SNP	C	A	A	rs76712188		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689491C>A	uc004bcz.2	+	3	3587	c.3298C>A	c.(3298-3300)CCC>ACC	p.P1100T	ZNF462_uc010mto.2_Missense_Mutation_p.P948T|ZNF462_uc004bda.2_Missense_Mutation_p.P948T	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1100					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						GGGTTCCCCACCCCCCCCACA	0.527													3	12	---	---	---	---	PASS
ASB6	140459	broad.mit.edu	37	9	132400573	132400573	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132400573G>C	uc004byf.1	-	6	928	c.762C>G	c.(760-762)AGC>AGG	p.S254R	ASB6_uc004bye.1_Missense_Mutation_p.S179R|ASB6_uc004byg.1_3'UTR|ASB6_uc011mbt.1_Missense_Mutation_p.S175R|ASB6_uc010myx.1_Missense_Mutation_p.S225R	NM_017873	NP_060343	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box-containing 6 isoform	254	ANK 5.				intracellular signal transduction	cytoplasm					0		Ovarian(14;0.00556)				CTGGGCACTCGCTGGGGTCGG	0.622													11	14	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136662858	136662858	+	Missense_Mutation	SNP	G	C	C	rs150680379		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136662858G>C	uc004ces.2	-	10	956	c.910C>G	c.(910-912)CGG>GGG	p.R304G	VAV2_uc004cer.2_Missense_Mutation_p.R299G	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	304	DH.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		AAGTCCTCCCGGCTGGCCAGG	0.617													5	9	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136726513	136726513	+	Silent	SNP	C	A	A	rs145591299	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136726513C>A	uc004ces.2	-	3	409	c.363G>T	c.(361-363)GCG>GCT	p.A121A	VAV2_uc004cer.2_Silent_p.A121A	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	121					angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		CTTTGTTCTGCGCGATGCTGT	0.567													3	7	---	---	---	---	PASS
NSUN6	221078	broad.mit.edu	37	10	18835047	18835047	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18835047T>A	uc010qcp.1	-	11	1643	c.1225A>T	c.(1225-1227)AGG>TGG	p.R409W	NSUN6_uc001iqb.2_5'Flank	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6	409							methyltransferase activity|RNA binding			ovary(2)	2						CCAGCTCCCCTCATTCCTTCT	0.463													15	86	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26518595	26518595	+	Silent	SNP	C	A	A	rs149136572	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26518595C>A	uc001isp.2	+	7	1232	c.729C>A	c.(727-729)GGC>GGA	p.G243G	GAD2_uc001isq.2_Silent_p.G243G	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	243					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	CTTTAGGTGGCGCCATATCTA	0.443													12	18	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26789824	26789824	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26789824G>T	uc001iss.2	+	5	558	c.237G>T	c.(235-237)GAG>GAT	p.E79D	APBB1IP_uc001isr.2_Missense_Mutation_p.E79D|APBB1IP_uc009xks.1_Missense_Mutation_p.E79D	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	79					blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						GTGAGGCTGAGCAGAGGACAA	0.438													21	46	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29812615	29812615	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29812615G>T	uc001iut.1	-	15	3681	c.2928C>A	c.(2926-2928)TAC>TAA	p.Y976*	SVIL_uc010qdw.1_5'Flank|SVIL_uc001iuu.1_Nonsense_Mutation_p.Y550*	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	976					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TCAGGATGGGGTAGGATGCTT	0.517													6	47	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37430680	37430680	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37430680A>G	uc001iza.1	+	7	786	c.687A>G	c.(685-687)GCA>GCG	p.A229A		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	285						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ATGAGGCTGCACCCTTGGCGG	0.398													9	21	---	---	---	---	PASS
ZNF37A	7587	broad.mit.edu	37	10	38407647	38407647	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38407647A>G	uc001izk.2	+	8	2387	c.1568A>G	c.(1567-1569)TAT>TGT	p.Y523C	ZNF37A_uc001izl.2_Missense_Mutation_p.Y523C|ZNF37A_uc001izm.2_Missense_Mutation_p.Y523C	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	523	C2H2-type 12.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						GAGAAACCCTATGAATGTAAT	0.358													4	26	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48389413	48389413	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48389413C>G	uc001jez.2	-	1	1579	c.1465G>C	c.(1465-1467)GTG>CTG	p.V489L		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	489	4 X approximate tandem repeats.|2.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	AGCAGGGGCACAGCAGAGGAT	0.642													7	6	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50820165	50820165	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50820165T>A	uc001jhw.2	+	1	1819	c.1379T>A	c.(1378-1380)CTG>CAG	p.L460Q	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	460	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						CTGGCCAACCTGCTCTATGCT	0.637													3	13	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50856551	50856551	+	Splice_Site	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50856551A>G	uc001jhz.2	+	9	1435	c.1282_splice	c.e9-2	p.F428_splice	CHAT_uc001jhv.1_Splice_Site_p.F310_splice|CHAT_uc001jhx.1_Splice_Site_p.F310_splice|CHAT_uc001jhy.1_Splice_Site_p.F310_splice|CHAT_uc001jia.2_Splice_Site_p.F310_splice|CHAT_uc010qgs.1_Splice_Site_p.F310_splice	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2						neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	TTCCTGTTGCAGTTTGTGGTG	0.607													3	9	---	---	---	---	PASS
PDLIM1	9124	broad.mit.edu	37	10	97007015	97007015	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97007015C>T	uc001kkh.2	-	5	751	c.642G>A	c.(640-642)ACG>ACA	p.T214T	PDLIM1_uc001kki.2_Silent_p.T214T|PDLIM1_uc009xuv.2_Silent_p.T214T|PDLIM1_uc001kkj.1_Silent_p.T214T	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	214					response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CCAAGAAAGACGTGGACTGTT	0.468													19	95	---	---	---	---	PASS
C10orf62	414157	broad.mit.edu	37	10	99350269	99350269	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99350269C>T	uc001koa.2	+	1	786	c.615C>T	c.(613-615)CAC>CAT	p.H205H	DHDPSL_uc001knx.2_Intron|DHDPSL_uc001kny.2_Intron|DHDPSL_uc001knz.2_Intron|PI4K2A_uc010qoy.1_Intron	NM_001009997	NP_001009997	Q5T681	CJ062_HUMAN	hypothetical protein LOC414157	205	His-rich.						protein binding				0		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		ACAGTCACCACAGTCACCATG	0.532													10	38	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104176612	104176612	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104176612G>A	uc001kvg.1	-	2	711	c.184C>T	c.(184-186)CGT>TGT	p.R62C	PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Missense_Mutation_p.R62C|PSD_uc001kvi.1_Missense_Mutation_p.R62C|FBXL15_uc001kvj.1_5'Flank|FBXL15_uc001kvk.2_5'Flank	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	62	Pro-rich.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GCTGTCACACGTCCCAGTTCC	0.697													13	23	---	---	---	---	PASS
COL17A1	1308	broad.mit.edu	37	10	105814742	105814742	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105814742T>A	uc001kxr.2	-	20	1910	c.1741A>T	c.(1741-1743)AAA>TAA	p.K581*	COL17A1_uc010qqv.1_Nonsense_Mutation_p.K565*	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	581	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TAATTACCTTTAGGGCCTGGA	0.398													6	31	---	---	---	---	PASS
FAM53B	9679	broad.mit.edu	37	10	126311970	126311970	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126311970C>A	uc001lhv.1	-	5	1633	c.1110G>T	c.(1108-1110)CAG>CAT	p.Q370H	FAM53B_uc001lhu.1_Intron	NM_014661	NP_055476	Q14153	FA53B_HUMAN	hypothetical protein LOC9679	370										ovary(1)|pancreas(1)	2		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		ACAGGTCCTCCTGGCAGGCGA	0.726													8	12	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221861	5221861	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221861T>G	uc010qyz.1	-	1	70	c.70A>C	c.(70-72)ACT>CCT	p.T24P		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAAATCCAGTGAGAAGAAAG	0.438													21	37	---	---	---	---	PASS
OR51B6	390058	broad.mit.edu	37	11	5373352	5373352	+	Silent	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5373352C>G	uc010qzb.1	+	1	615	c.615C>G	c.(613-615)GTC>GTG	p.V205V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGCAATGGTCTTGTTGGACT	0.443													13	33	---	---	---	---	PASS
MYOD1	4654	broad.mit.edu	37	11	17741491	17741491	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17741491C>A	uc001mni.2	+	1	382	c.162C>A	c.(160-162)GGC>GGA	p.G54G		NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1	54					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3						TGCACGTGGGCGCGCTCCTGA	0.687													11	4	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18955986	18955986	+	Missense_Mutation	SNP	C	G	G	rs145122494		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18955986C>G	uc001mpg.2	-	1	564	c.346G>C	c.(346-348)GTG>CTG	p.V116L		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	116	Helical; Name=3; (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						TCGGTGCTCACGGCACTCAGA	0.567													25	31	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371721	55371721	+	Silent	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371721A>T	uc010rii.1	-	1	129	c.129T>A	c.(127-129)ATT>ATA	p.I43I		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGGTCACAATAATGAGCATAT	0.403													27	30	---	---	---	---	PASS
OR5M9	390162	broad.mit.edu	37	11	56230073	56230073	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56230073C>A	uc010rjj.1	-	1	805	c.805G>T	c.(805-807)GGC>TGC	p.G269C		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					ACCATTTTGCCCTGCTCTACG	0.458													19	19	---	---	---	---	PASS
NXF1	10482	broad.mit.edu	37	11	62569222	62569222	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62569222C>T	uc001nvf.1	-	6	764	c.628G>A	c.(628-630)GAA>AAA	p.E210K	NXF1_uc001nvg.1_Missense_Mutation_p.E210K|NXF1_uc009yog.1_Missense_Mutation_p.E253K|NXF1_uc010rmh.1_Missense_Mutation_p.E73K	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	210	Interaction with THOC4.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						TTTAGCTGTTCTACTTGTTCT	0.473													101	58	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74883491	74883491	+	Silent	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74883491T>A	uc001owb.2	+	7	1236	c.849T>A	c.(847-849)GCT>GCA	p.A283A	SLCO2B1_uc010rrq.1_Silent_p.A28A|SLCO2B1_uc010rrr.1_Silent_p.A139A|SLCO2B1_uc010rrs.1_Silent_p.A167A|SLCO2B1_uc001owc.2_Silent_p.A56A|SLCO2B1_uc001owd.2_Silent_p.A261A	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	283	Helical; Name=6; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	TCCTCATCGCTGCCGGTGCAG	0.562													25	25	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85435625	85435625	+	Intron	SNP	G	A	A	rs146138820		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85435625G>A	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Silent_p.H625H|SYTL2_uc001pbb.2_Silent_p.H625H|SYTL2_uc001pbc.2_Silent_p.H625H|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ACTCCTTCTCGTGAGTTTCTT	0.458													15	41	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92495111	92495111	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92495111G>A	uc001pdj.3	+	4	3776	c.3759G>A	c.(3757-3759)CAG>CAA	p.Q1253Q		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1253	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAAGCCCCAGTTCCCAGAGA	0.483										TCGA Ovarian(4;0.039)			109	91	---	---	---	---	PASS
CD3D	915	broad.mit.edu	37	11	118211200	118211200	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118211200A>T	uc001pss.1	-	2	301	c.164T>A	c.(163-165)ATT>AAT	p.I55N	CD3D_uc001pst.1_Missense_Mutation_p.I55N	NM_000732	NP_000723	P04234	CD3D_HUMAN	CD3 antigen, delta subunit isoform A precursor	55	Extracellular (Potential).				positive thymic T cell selection|T cell costimulation|T cell receptor signaling pathway	cytoplasm|integral to membrane	protein heterodimerization activity			ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		CAGTCTTGTAATGTCTGAGAG	0.448													13	25	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252427	124252427	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252427T>G	uc010sai.1	-	1	813	c.813A>C	c.(811-813)AAA>AAC	p.K271N		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	271	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CAGAAGAAACTTTTCCCTGCT	0.418													13	73	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252924	124252924	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252924A>G	uc010sai.1	-	1	316	c.316T>C	c.(316-318)TTT>CTT	p.F106L		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ATGACGAAAAAGAGAAAGAAA	0.388													61	48	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43858395	43858395	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43858395A>G	uc010skx.1	-	10	1508	c.1508T>C	c.(1507-1509)ATA>ACA	p.I503T		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	503	Disintegrin.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTTTCTTACTATATGGGGACA	0.338													16	37	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56495001	56495001	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56495001A>G	uc001sjh.2	+	27	3551	c.3358A>G	c.(3358-3360)AGG>GGG	p.R1120G	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Missense_Mutation_p.R477G|ERBB3_uc010sqc.1_Missense_Mutation_p.R1061G|ERBB3_uc009zok.2_Missense_Mutation_p.R385G|ERBB3_uc001sjk.2_Missense_Mutation_p.R361G|ERBB3_uc001sjl.2_Missense_Mutation_p.R240G	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	1120	Cytoplasmic (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GAGCCGGAGCAGGAGCCGGAG	0.612													13	17	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58006770	58006770	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58006770T>G	uc001spb.2	+	2	615	c.155T>G	c.(154-156)CTG>CGG	p.L52R	GEFT_uc009zpy.2_Missense_Mutation_p.L91R|GEFT_uc001soz.1_Intron|GEFT_uc001spa.2_Intron|uc001spc.2_RNA|GEFT_uc001spd.2_5'Flank	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	52					regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					GCCTCCGGTCTGGCTGCCCCc	0.493													14	44	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68051334	68051334	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68051334A>T	uc001str.3	+	3	1049	c.647A>T	c.(646-648)GAT>GTT	p.D216V	DYRK2_uc001sts.3_Missense_Mutation_p.D143V	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	216					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		GTGCCCCACGATCACGTGGCT	0.552													4	25	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86374058	86374058	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86374058C>T	uc001tai.3	-	8	1696	c.446G>A	c.(445-447)CGT>CAT	p.R149H	MGAT4C_uc001tal.3_Missense_Mutation_p.R149H|MGAT4C_uc001taj.3_Missense_Mutation_p.R149H|MGAT4C_uc001tak.3_Missense_Mutation_p.R149H|MGAT4C_uc010sum.1_Missense_Mutation_p.R173H|MGAT4C_uc001tah.3_Missense_Mutation_p.R149H	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	149	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						CATGGCATCACGCCAGGAAGA	0.398													5	34	---	---	---	---	PASS
POC1B	282809	broad.mit.edu	37	12	89891131	89891131	+	Intron	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89891131T>C	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron|POC1B_uc009zsp.2_5'Flank|POC1B_uc009zsq.2_5'Flank	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1						TATCAAGAAATAGAAGAACAA	0.393													19	22	---	---	---	---	PASS
IKBIP	121457	broad.mit.edu	37	12	99007962	99007962	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99007962G>C	uc001tfv.2	-	3	564	c.454C>G	c.(454-456)CAA>GAA	p.Q152E	IKBIP_uc001tfw.2_3'UTR	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2	152					induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						GTAATGTCTTGAGAAAGCGTC	0.363													6	54	---	---	---	---	PASS
SCYL2	55681	broad.mit.edu	37	12	100709335	100709335	+	Splice_Site	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100709335G>T	uc001thn.2	+	9	1146	c.1096_splice	c.e9-1	p.R366_splice	SCYL2_uc009ztw.1_Splice_Site_p.R193_splice|SCYL2_uc001thm.1_Splice_Site_p.R366_splice	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein						endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						TTGCCTTTCAGCGTGTCATTG	0.318													12	22	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100897258	100897258	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100897258T>A	uc001tht.1	+	1	121	c.93T>A	c.(91-93)AGT>AGA	p.S31R	NR1H4_uc001thp.1_Intron|NR1H4_uc001thq.1_Intron|NR1H4_uc010svj.1_Intron|NR1H4_uc001thr.1_Intron|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Missense_Mutation_p.S31R	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	31					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						AAATGATGAGTATGAAGCCCG	0.463													4	23	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104133214	104133214	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104133214A>G	uc001tjw.2	+	54	5908	c.5722A>G	c.(5722-5724)ACT>GCT	p.T1908A	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1908	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CTGTGTCAATACTCCCAGCTG	0.398													4	34	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112481660	112481660	+	Silent	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112481660T>C	uc001ttm.2	-	18	2039	c.2019A>G	c.(2017-2019)GAA>GAG	p.E673E	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.E645E|NAA25_uc009zwa.1_Silent_p.E673E	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	673						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						TCTTATGTTCTTCAGAAACGT	0.333													8	49	---	---	---	---	PASS
GPR12	2835	broad.mit.edu	37	13	27333507	27333507	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27333507G>A	uc010aal.2	-	2	680	c.458C>T	c.(457-459)ACG>ATG	p.T153M	GPR12_uc010tdl.1_Translation_Start_Site	NM_005288	NP_005279	P47775	GPR12_HUMAN	G protein-coupled receptor 12	153	Cytoplasmic (Potential).					integral to plasma membrane					0	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		AAACGTGACCGTCCTCTCCGA	0.577													8	52	---	---	---	---	PASS
NUFIP1	26747	broad.mit.edu	37	13	45517626	45517626	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45517626T>A	uc001uzp.2	-	9	1364	c.1322A>T	c.(1321-1323)TAT>TTT	p.Y441F		NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein	441					box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TAACGTTTGATAGTTGTGATA	0.323													29	33	---	---	---	---	PASS
EDNRB	1910	broad.mit.edu	37	13	78492558	78492558	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492558T>C	uc001vko.2	-	1	409	c.151A>G	c.(151-153)AAG>GAG	p.K51E	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Missense_Mutation_p.K51E|EDNRB_uc010aez.1_Missense_Mutation_p.K51E|EDNRB_uc001vkp.1_Missense_Mutation_p.K134E|EDNRB_uc010afa.1_Missense_Mutation_p.K51E	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	51	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)	CATAAGGTCTTAGTGGGTGGC	0.632													22	23	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92345764	92345764	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92345764A>T	uc010tif.1	+	3	1015	c.649A>T	c.(649-651)AGG>TGG	p.R217W		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	217						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACAGATGGGGAGGTCCCTGCT	0.522													11	13	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103705015	103705015	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103705015C>T	uc001vpy.3	-	3	1137	c.540G>A	c.(538-540)ATG>ATA	p.M180I		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	180	Extracellular (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GATTAACAAACATTCCAATGG	0.388													32	30	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20388876	20388876	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20388876C>A	uc010tkw.1	+	1	111	c.111C>A	c.(109-111)GTC>GTA	p.V37V		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTATACAGTCATTGTGCTGG	0.408													10	88	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63246548	63246548	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63246548G>T	uc001xfx.2	-	10	1968	c.1917C>A	c.(1915-1917)CAC>CAA	p.H639Q	KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Missense_Mutation_p.H581Q	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	639	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GCTTGATGATGTGTAGGTCAC	0.478													28	40	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78187074	78187074	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78187074T>C	uc001xuf.2	-	12	1255	c.1228A>G	c.(1228-1230)AGG>GGG	p.R410G	SNW1_uc010tvm.1_Missense_Mutation_p.R335G|SNW1_uc010asu.2_Missense_Mutation_p.R248G|SNW1_uc010tvn.1_Missense_Mutation_p.R410G	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	410					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTGAAGAGCCTTTGGTCATAC	0.393													29	66	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78187123	78187123	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78187123A>G	uc001xuf.2	-	12	1206	c.1179T>C	c.(1177-1179)GCT>GCC	p.A393A	SNW1_uc010tvm.1_Silent_p.A318A|SNW1_uc010asu.2_Silent_p.A231A|SNW1_uc010tvn.1_Silent_p.A393A	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	393					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GAACACCGAGAGCAATAACTT	0.388													24	55	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78187124	78187124	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78187124G>T	uc001xuf.2	-	12	1205	c.1178C>A	c.(1177-1179)GCT>GAT	p.A393D	SNW1_uc010tvm.1_Missense_Mutation_p.A318D|SNW1_uc010asu.2_Missense_Mutation_p.A231D|SNW1_uc010tvn.1_Missense_Mutation_p.A393D	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	393					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		AACACCGAGAGCAATAACTTC	0.383													24	54	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79432744	79432744	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79432744C>A	uc001xun.2	+	9	2144	c.1653C>A	c.(1651-1653)GTC>GTA	p.V551V	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Silent_p.V676V	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	924	Extracellular (Potential).|Laminin G-like 5.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCGAGCTTGTCAAGGGGTAAG	0.423													12	77	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105615534	105615534	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105615534C>T	uc001yqg.2	-	13	2130	c.1726G>A	c.(1726-1728)GAG>AAG	p.E576K	JAG2_uc010axf.2_5'Flank|JAG2_uc001yqf.2_5'UTR|JAG2_uc001yqh.2_Missense_Mutation_p.E538K	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	576	Extracellular (Potential).|EGF-like 10; atypical.				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGGCACGGCTCGCGGGGCACG	0.677													8	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22466284	22466284	+	5'Flank	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466284T>C	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		TCCAGAAGCCTTGCAGGAGAC	0.557													19	115	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27185220	27185220	+	Silent	SNP	T	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27185220T>G	uc001zbd.1	+	10	1212	c.873T>G	c.(871-873)GTT>GTG	p.V291V	GABRB3_uc001zbb.2_5'Flank	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	291	Helical; (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CCAGGACAGTTTTTGGTGAGT	0.522													3	16	---	---	---	---	PASS
CHRM5	1133	broad.mit.edu	37	15	34355670	34355670	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34355670G>A	uc001zhk.1	+	3	1422	c.752G>A	c.(751-753)AGA>AAA	p.R251K	CHRM5_uc001zhl.1_Missense_Mutation_p.R251K	NM_012125	NP_036257	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	251	Cytoplasmic (By similarity).				cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)	GCTCTGTTCAGATCCTGCTTG	0.602													14	66	---	---	---	---	PASS
SLC12A6	9990	broad.mit.edu	37	15	34553129	34553129	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34553129C>G	uc001zhw.2	-	3	573	c.409G>C	c.(409-411)GAG>CAG	p.E137Q	SLC12A6_uc001zhv.2_Missense_Mutation_p.E86Q|SLC12A6_uc001zhx.2_Missense_Mutation_p.E122Q|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.E78Q|SLC12A6_uc001zib.2_Missense_Mutation_p.E128Q|SLC12A6_uc001zic.2_Missense_Mutation_p.E137Q|SLC12A6_uc010bau.2_Missense_Mutation_p.E137Q|SLC12A6_uc001zid.2_Missense_Mutation_p.E78Q|SLC12A6_uc001zhu.2_5'UTR	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	137	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	AATATTACCTCAAAGAGTGCC	0.333													5	18	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41857334	41857334	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41857334G>C	uc001zof.1	+	6	1002	c.778G>C	c.(778-780)GTT>CTT	p.V260L		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	260	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTCCTGTACAGTTCAGGTAGG	0.587													4	29	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42720257	42720257	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42720257C>A	uc001zpw.2	-	12	5223	c.4888G>T	c.(4888-4890)GCG>TCG	p.A1630S	ZFP106_uc001zpu.2_Missense_Mutation_p.A728S|ZFP106_uc001zpv.2_Missense_Mutation_p.A815S|ZFP106_uc001zpx.2_Missense_Mutation_p.A858S	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	1630						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		GCCAGTCCCGCATAGAGGATT	0.493													10	63	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48063828	48063828	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48063828C>G	uc010bek.2	+	19	3428	c.3068C>G	c.(3067-3069)CCT>CGT	p.P1023R	SEMA6D_uc001zvw.2_Missense_Mutation_p.P961R|SEMA6D_uc001zvy.2_Missense_Mutation_p.P1023R|SEMA6D_uc001zvz.2_Missense_Mutation_p.P967R|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.P961R|SEMA6D_uc001zwc.2_Missense_Mutation_p.P948R	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	1023	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CATCTGCAGCCTTCCCTCTCC	0.542													18	111	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50534871	50534871	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50534871C>G	uc001zxz.2	-	12	1681	c.1575G>C	c.(1573-1575)CAG>CAC	p.Q525H	HDC_uc001zxy.2_Missense_Mutation_p.Q268H|HDC_uc010uff.1_Missense_Mutation_p.Q492H	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	525					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CACGCTGAGGCTGCTTGATGA	0.577													8	18	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53994323	53994323	+	Intron	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53994323C>A	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		TTTTACTCTTCGTCTTACTTT	0.269													8	38	---	---	---	---	PASS
LMAN1L	79748	broad.mit.edu	37	15	75108845	75108845	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75108845C>A	uc002ayt.1	+	3	410	c.408C>A	c.(406-408)ATC>ATA	p.I136I	LMAN1L_uc010bkd.2_Silent_p.I64I|LMAN1L_uc010ulo.1_Intron|LMAN1L_uc010bke.1_Silent_p.I136I	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor	136	Lumenal (Potential).|L-type lectin-like.					ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						GCATCGGGATCTTCTTTGACT	0.502													6	32	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79296437	79296437	+	Missense_Mutation	SNP	C	T	T	rs150222693		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79296437C>T	uc002beq.2	-	16	2579	c.2204G>A	c.(2203-2205)CGC>CAC	p.R735H	RASGRF1_uc002bep.2_Missense_Mutation_p.R719H|RASGRF1_uc010blm.1_Missense_Mutation_p.R644H|RASGRF1_uc002ber.3_Missense_Mutation_p.R719H|RASGRF1_uc010unh.1_Missense_Mutation_p.R130H|RASGRF1_uc002beo.2_5'UTR	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	735	N-terminal Ras-GEF.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GGAGAACTTGCGGGTGGCGCG	0.647													8	27	---	---	---	---	PASS
BCL2A1	597	broad.mit.edu	37	15	80253456	80253456	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80253456T>A	uc002bfc.3	-	2	663	c.481A>T	c.(481-483)ACA>TCA	p.T161S	BCL2A1_uc002bfd.3_3'UTR	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1	161					anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						ATCTTTCCTGTAACTTCTAGA	0.353													11	28	---	---	---	---	PASS
MEF2A	4205	broad.mit.edu	37	15	100211761	100211761	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100211761C>T	uc010urw.1	+	4	654	c.295C>T	c.(295-297)CCA>TCA	p.P99S	MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Missense_Mutation_p.P99S|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	99					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GTGCGACAGCCCAGACCCTGA	0.333													3	12	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	603410	603410	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:603410G>A	uc002chi.2	+	14	3518	c.3155G>A	c.(3154-3156)CGC>CAC	p.R1052H	SOLH_uc002chj.2_Missense_Mutation_p.R112H	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	1052					proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CTGGCACATCGCAAGGCAGCC	0.677													14	35	---	---	---	---	PASS
SSTR5	6755	broad.mit.edu	37	16	1129327	1129327	+	Silent	SNP	G	T	T	rs141899937		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1129327G>T	uc002ckq.2	+	1	547	c.459G>T	c.(457-459)CCG>CCT	p.P153P	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	153	Cytoplasmic (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)	GGCGCCGCCCGCGTGTGGCCA	0.687													7	5	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1798307	1798307	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1798307G>T	uc002cmk.2	+	7	1174	c.1054G>T	c.(1054-1056)GAC>TAC	p.D352Y	MAPK8IP3_uc002cml.2_Missense_Mutation_p.D352Y|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.D353Y	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	352					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						GCCAGAGCTGGACATGTGTCC	0.607													17	20	---	---	---	---	PASS
MEFV	4210	broad.mit.edu	37	16	3306572	3306572	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3306572T>C	uc002cun.1	-	1	56	c.16A>G	c.(16-18)AGT>GGT	p.S6G		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	6	DAPIN.				inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|lung(1)	6					Colchicine(DB01394)	AGATGGTCACTAGGGGTCTTA	0.552													12	41	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3823884	3823884	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3823884A>G	uc002cvv.2	-	13	2535	c.2331T>C	c.(2329-2331)GGT>GGC	p.G777G	CREBBP_uc002cvw.2_Silent_p.G739G	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	777					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGGTGTGTGCACCCATCATGT	0.587			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				24	52	---	---	---	---	PASS
PARN	5073	broad.mit.edu	37	16	14576629	14576629	+	Silent	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14576629A>G	uc010uzd.1	-	22	1678	c.1536T>C	c.(1534-1536)TAT>TAC	p.Y512Y	PARN_uc010uzc.1_Silent_p.Y451Y|PARN_uc010uze.1_Silent_p.Y466Y|PARN_uc010uzf.1_Silent_p.Y337Y	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation	512					female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						TTCTCCCCATATATTCAGCAT	0.413													8	25	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20335162	20335162	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20335162A>G	uc002dgv.2	-	3	594	c.511T>C	c.(511-513)TGG>CGG	p.W171R	GP2_uc002dgw.2_Missense_Mutation_p.W171R|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	171						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						AGATTACACCAGGGAGTGCCT	0.577													5	11	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20370844	20370844	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20370844C>G	uc002dhc.1	-	12	1775	c.1552G>C	c.(1552-1554)GCT>CCT	p.A518P		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	518					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						TTTTCCTCAGCTAGCACTTCC	0.383													25	54	---	---	---	---	PASS
LOC81691	81691	broad.mit.edu	37	16	20839834	20839834	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20839834A>G	uc002dhv.2	+	11	1396	c.1133A>G	c.(1132-1134)TAT>TGT	p.Y378C	ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Missense_Mutation_p.Y378C|LOC81691_uc002dhw.2_Missense_Mutation_p.Y121C|LOC81691_uc002dhy.3_Missense_Mutation_p.Y378C	NM_030941	NP_112203	Q96IC2	REXON_HUMAN	exonuclease NEF-sp isoform 1	378						nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2						TTGGCTCGGTATTTCCTTAAG	0.398													23	28	---	---	---	---	PASS
AQP8	343	broad.mit.edu	37	16	25238511	25238511	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25238511G>T	uc002doc.2	+	5	807	c.725G>T	c.(724-726)GGA>GTA	p.G242V		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	242	Helical; (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		CTGCTTGTTGGACTGCTCATT	0.597													5	27	---	---	---	---	PASS
MAZ	4150	broad.mit.edu	37	16	29818992	29818992	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29818992C>T	uc002dty.2	+	2	1054	c.886C>T	c.(886-888)CGA>TGA	p.R296*	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAZ_uc002dtv.1_Intron|MAZ_uc010vdx.1_Nonsense_Mutation_p.R273*|MAZ_uc002dtw.2_Intron|MAZ_uc002dtx.2_Nonsense_Mutation_p.R296*|MAZ_uc010bzg.2_Intron|MAZ_uc002dtz.1_Nonsense_Mutation_p.R14*|MAZ_uc002dua.2_5'Flank|MAZ_uc010vdy.1_5'Flank	NM_002383	NP_002374	P56270	MAZ_HUMAN	MYC-associated zinc finger protein isoform 1	296	C2H2-type 2.				regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription|transcription initiation from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1						CCACCTGAACCGACACAAGCT	0.642													5	20	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48209318	48209318	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48209318G>A	uc002eff.1	-	25	3899	c.3549C>T	c.(3547-3549)TCC>TCT	p.S1183S	ABCC11_uc002efg.1_Silent_p.S1183S|ABCC11_uc002efh.1_Silent_p.S1183S|ABCC11_uc010cbg.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	1183	ABC transporter 2.|Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CCATGCCCAAGGAGGACTTCC	0.612									Cerumen_Type				8	12	---	---	---	---	PASS
LDHD	197257	broad.mit.edu	37	16	75147555	75147555	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75147555T>C	uc002fdm.2	-	8	1080	c.1033A>G	c.(1033-1035)ATA>GTA	p.I345V	LDHD_uc002fdn.2_Missense_Mutation_p.I322V	NM_153486	NP_705690	Q86WU2	LDHD_HUMAN	D-lactate dehydrogenase isoform 1 precursor	345							D-lactate dehydrogenase (cytochrome) activity|flavin adenine dinucleotide binding|protein binding				0						TGCTGGACTATCTCCTCTGCA	0.667													4	13	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76573756	76573756	+	Intron	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76573756T>C	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						AGAGGTAATGTAGTAAATTCA	0.353													10	59	---	---	---	---	PASS
CLEC3A	10143	broad.mit.edu	37	16	78064611	78064611	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78064611G>A	uc002ffh.3	+	3	548	c.467G>A	c.(466-468)CGT>CAT	p.R156H		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	156	C-type lectin.				skeletal system development	extracellular region	sugar binding				0						AACTGGGACCGTGCACAGCCT	0.532													17	44	---	---	---	---	PASS
CTU2	348180	broad.mit.edu	37	16	88781041	88781041	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88781041G>A	uc002flm.2	+	12	1296	c.1248G>A	c.(1246-1248)CAG>CAA	p.Q416Q	CTU2_uc002fln.2_Silent_p.Q416Q|CTU2_uc010chz.2_Silent_p.Q487Q|CTU2_uc010cia.2_Silent_p.Q329Q	NM_001012759	NP_001012777	Q2VPK5	CTU2_HUMAN	cytoplasmic tRNA 2-thiolation protein 2 isoform	416					tRNA thio-modification|tRNA wobble uridine modification	cytoplasm|protein complex|soluble fraction	protein binding			skin(1)	1						GTCTCTCCCAGATGCAGTCAC	0.697													15	27	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3213890	3213890	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3213890C>T	uc002fvi.2	+	1	352	c.286C>T	c.(286-288)CCC>TCC	p.P96S		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						CAGAAGCATTCCCTATAAGGC	0.547													16	17	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7573982	7573982	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7573982C>A	uc002gim.2	-	10	1239	c.1045G>T	c.(1045-1047)GAA>TAA	p.E349*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Nonsense_Mutation_p.E217*|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Nonsense_Mutation_p.E349*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	349	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Nuclear export signal.|Interaction with HIPK2.		E -> D (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.E349*(5)|p.E349fs*21(2)|p.I332fs*5(1)|p.?(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCCTTGAGTTCCAAGGCCTCA	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	11	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7573983	7573983	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7573983C>A	uc002gim.2	-	10	1238	c.1044G>T	c.(1042-1044)TTG>TTT	p.L348F	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Missense_Mutation_p.L216F|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Missense_Mutation_p.L348F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	348	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Nuclear export signal.|Interaction with HIPK2.		L -> S (in a sporadic cancer; somatic mutation).|L -> F (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.L348F(2)|p.L348*(2)|p.L348fs*22(1)|p.L348fs*0(1)|p.?(1)|p.I332fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTTGAGTTCCAAGGCCTCAT	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	11	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10352030	10352030	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10352030C>T	uc002gmn.2	-	32	4547	c.4436G>A	c.(4435-4437)CGT>CAT	p.R1479H	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1479	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GCTGAGAGAACGCGACTCCTT	0.448													6	38	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10442558	10442558	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10442558G>C	uc010coi.2	-	14	1508	c.1380C>G	c.(1378-1380)ATC>ATG	p.I460M	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.I460M|MYH2_uc010coj.2_Missense_Mutation_p.I460M	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	460	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CCAAGACCCCGATGAAGTACT	0.478													49	71	---	---	---	---	PASS
SEZ6	124925	broad.mit.edu	37	17	27285076	27285076	+	Missense_Mutation	SNP	C	T	T	rs139179377	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27285076C>T	uc002hdp.2	-	11	2385	c.2191G>A	c.(2191-2193)GGC>AGC	p.G731S	SEZ6_uc010crx.1_5'Flank|SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.G731S|SEZ6_uc002hdq.1_Missense_Mutation_p.G606S	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	731	Extracellular (Potential).|Sushi 3.					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			ACCACGGTGCCGTGCACTAGC	0.612													11	62	---	---	---	---	PASS
ADAM11	4185	broad.mit.edu	37	17	42848951	42848951	+	Splice_Site	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42848951G>A	uc002ihh.2	+	5	382	c.382_splice	c.e5-1	p.G128_splice	ADAM11_uc010wjd.1_Splice_Site	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				TGCTCCTTCAGGGGGCTGGAG	0.647													27	61	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56355373	56355373	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56355373C>G	uc002ivu.1	-	7	1196	c.1019G>C	c.(1018-1020)AGC>ACC	p.S340T		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	340		Calcium.			anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	GTACACCATGCTGGCGTCCAC	0.647													6	80	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57158532	57158532	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57158532C>A	uc002iwy.3	-	6	862	c.418G>T	c.(418-420)GTC>TTC	p.V140F	TRIM37_uc002iwz.3_Missense_Mutation_p.V140F|TRIM37_uc002ixa.3_Missense_Mutation_p.V18F|TRIM37_uc010woc.1_Missense_Mutation_p.V106F	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	140	Potential.					perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ACTTTAGTGACGTGTTGCTCA	0.368									Mulibrey_Nanism				24	71	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76795011	76795011	+	Silent	SNP	G	A	A	rs148007252		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76795011G>A	uc002jvz.1	-	19	3544	c.3219C>T	c.(3217-3219)GAC>GAT	p.D1073D	USP36_uc002jwa.1_Silent_p.D1073D|USP36_uc002jvy.1_Silent_p.D133D	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1071					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CAAACTCTTCGTCCCAGTCAT	0.587													16	130	---	---	---	---	PASS
C17orf55	284185	broad.mit.edu	37	17	79279081	79279081	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79279081C>T	uc002kac.1	-	4	513	c.84G>A	c.(82-84)AGG>AGA	p.R28R		NM_178519	NP_848614			hypothetical protein LOC284185												0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GATGAGCTGCCCTGTACCATG	0.672													3	9	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5397253	5397253	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5397253G>T	uc002kmt.1	-	18	2731	c.2645C>A	c.(2644-2646)GCA>GAA	p.A882E	EPB41L3_uc010wzh.1_Missense_Mutation_p.A713E|EPB41L3_uc002kmu.1_Missense_Mutation_p.A660E|EPB41L3_uc010dkq.1_Missense_Mutation_p.A551E|EPB41L3_uc002kms.1_Missense_Mutation_p.A117E|EPB41L3_uc010wze.1_Missense_Mutation_p.A187E|EPB41L3_uc010wzf.1_Missense_Mutation_p.A179E|EPB41L3_uc010wzg.1_Missense_Mutation_p.A154E|EPB41L3_uc010dkr.2_Missense_Mutation_p.A274E	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	882	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGCGGGCTGTGCTGCAGCATC	0.612													20	60	---	---	---	---	PASS
NPC1	4864	broad.mit.edu	37	18	21115532	21115532	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21115532G>C	uc002kum.3	-	22	3652	c.3378C>G	c.(3376-3378)ATC>ATG	p.I1126M	NPC1_uc010dlu.1_5'Flank|NPC1_uc010xaz.1_Missense_Mutation_p.I859M	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	1126	Helical; (Potential).				autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGGCACACATGATGACTGCAG	0.537													17	20	---	---	---	---	PASS
FAM59A	64762	broad.mit.edu	37	18	29848546	29848546	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29848546C>A	uc002kxl.2	-	6	1975	c.1919G>T	c.(1918-1920)AGT>ATT	p.S640I	FAM59A_uc002kxk.1_Missense_Mutation_p.S639I	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A	640										ovary(1)|skin(1)	2						CAGGAAGTCACTCCTGGTCTG	0.502													12	23	---	---	---	---	PASS
LIPG	9388	broad.mit.edu	37	18	47107969	47107969	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47107969G>T	uc002ldv.2	+	6	1230	c.978G>T	c.(976-978)ATG>ATT	p.M326I	LIPG_uc002ldu.1_Missense_Mutation_p.M326I|LIPG_uc010xdh.1_Missense_Mutation_p.M252I	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor	326	Heparin-binding (By similarity).				cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						CCAAGAAAATGAGGAACAAGA	0.493													50	81	---	---	---	---	PASS
SKA1	220134	broad.mit.edu	37	18	47911582	47911582	+	Intron	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47911582G>A	uc002let.2	+						SKA1_uc002leu.2_Intron|SKA1_uc010xdl.1_Intron	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						TCTGTATTCTGTAGTGTTAAG	0.363													15	71	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56246130	56246130	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56246130G>A	uc002lhj.3	-	4	2092	c.1878C>T	c.(1876-1878)GGC>GGT	p.G626G		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	626							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						AATTTGTGTTGCCTTCTTTGG	0.438											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	76	---	---	---	---	PASS
SERPINB11	89778	broad.mit.edu	37	18	61377418	61377418	+	5'UTR	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61377418C>A	uc002ljk.3	+	2					SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_5'UTR|SERPINB11_uc002ljj.3_5'UTR|SERPINB11_uc010dqe.2_5'UTR|SERPINB11_uc010dqf.2_5'UTR	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11						regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				CTCAGGCAGTCGGCATAAAAA	0.368											OREG0003822	type=REGULATORY REGION|Gene=SERPINB11|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	14	---	---	---	---	PASS
CCDC102B	79839	broad.mit.edu	37	18	66504606	66504606	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66504606G>A	uc002lkk.2	+	4	829	c.606G>A	c.(604-606)AAG>AAA	p.K202K	CCDC102B_uc002lki.2_Silent_p.K202K|CCDC102B_uc002lkj.1_Silent_p.K202K	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	202										ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CAAATAATAAGGTAAGAAAAA	0.323													10	80	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72346027	72346027	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72346027A>T	uc002llw.2	+	1	3109	c.3052A>T	c.(3052-3054)AAG>TAG	p.K1018*	ZNF407_uc010xfc.1_Nonsense_Mutation_p.K1018*|ZNF407_uc010dqu.1_Nonsense_Mutation_p.K1018*|ZNF407_uc002llu.2_Nonsense_Mutation_p.K1017*	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1018	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGGTGAGAATAAGTGTTTGCA	0.448													39	74	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5776198	5776198	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5776198C>A	uc002mda.2	+	21	2029	c.1968C>A	c.(1966-1968)AAC>AAA	p.N656K		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	656	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						ACGACCCCAACAACAATGCCC	0.592													10	36	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6990801	6990801	+	5'UTR	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6990801G>T	uc010xjk.1	-	1						NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						GGAGGAACCTGCTCCCCATAG	0.498													11	61	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9046849	9046849	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9046849G>T	uc002mkp.2	-	5	34986	c.34782C>A	c.(34780-34782)AAC>AAA	p.N11594K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11596	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TATGGGAAAAGTTGGGAATTG	0.517													6	49	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9075949	9075949	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9075949C>G	uc002mkp.2	-	3	11701	c.11497G>C	c.(11497-11499)GCA>CCA	p.A3833P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3834	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGAGTTGTTGCTGCTGATCTG	0.502													15	94	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9084683	9084683	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9084683T>C	uc002mkp.2	-	1	7336	c.7132A>G	c.(7132-7134)ATA>GTA	p.I2378V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2378	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAAGAAGCTATGGAGGTGTTG	0.438													18	38	---	---	---	---	PASS
OR7D2	162998	broad.mit.edu	37	19	9297245	9297245	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9297245C>T	uc002mkz.1	+	1	976	c.788C>T	c.(787-789)GCG>GTG	p.A263V		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	263	Extracellular (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						TTCACTTCTGCGGTGACTCAC	0.507													7	67	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10071197	10071197	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10071197T>A	uc002mmq.1	-	67	5214	c.5128A>T	c.(5128-5130)AGC>TGC	p.S1710C		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1710	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CGAGAAGAGCTGAATTCGAAA	0.572													24	57	---	---	---	---	PASS
RGL3	57139	broad.mit.edu	37	19	11527293	11527293	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11527293G>A	uc002mrp.2	-	4	484	c.420C>T	c.(418-420)AAC>AAT	p.N140N	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Silent_p.N140N|RGL3_uc002mrq.2_3'UTR	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	140	N-terminal Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CCCACCTCAGGTTCTTGTTGA	0.542													24	85	---	---	---	---	PASS
SLC1A6	6511	broad.mit.edu	37	19	15061032	15061032	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15061032C>T	uc002naa.1	-	9	1678	c.1670G>A	c.(1669-1671)CGG>CAG	p.R557Q	SLC1A6_uc010dzu.1_Missense_Mutation_p.R479Q|SLC1A6_uc010xod.1_Missense_Mutation_p.R493Q	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	557					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	GTTGCCTCCCCGTCCCCGGGA	0.652													21	20	---	---	---	---	PASS
MRPL34	64981	broad.mit.edu	37	19	17417103	17417103	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17417103G>C	uc002ngc.1	+	2	419	c.194G>C	c.(193-195)GGC>GCC	p.G65A	ABHD8_uc002ngb.3_5'Flank	NM_023937	NP_076426	Q9BQ48	RM34_HUMAN	mitochondrial ribosomal protein L34 precursor	65					translation		structural constituent of ribosome				0						AACAAGCACGGCTGGGTCCGG	0.667													2	2	---	---	---	---	PASS
C19orf50	79036	broad.mit.edu	37	19	18672950	18672950	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18672950C>G	uc002njo.2	+	2	226	c.84C>G	c.(82-84)ATC>ATG	p.I28M	C19orf50_uc002njp.2_RNA|C19orf50_uc002njq.2_Missense_Mutation_p.I28M	NM_024069	NP_076974	Q9BQD3	CS050_HUMAN	hypothetical protein LOC79036	28							protein binding				0						ACGCCATCATCCTGGCCCAGA	0.617													4	19	---	---	---	---	PASS
KLHL26	55295	broad.mit.edu	37	19	18778681	18778681	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18778681G>A	uc002njz.1	+	3	501	c.474G>A	c.(472-474)GCG>GCA	p.A158A		NM_018316	NP_060786	Q53HC5	KLH26_HUMAN	kelch-like 26	158										ovary(1)	1						TCCTGAAGGCGGCCATGAGCG	0.647													7	36	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19345811	19345811	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19345811C>A	uc002nlz.2	+	10	3255	c.3156C>A	c.(3154-3156)TGC>TGA	p.C1052*	NCAN_uc010ecc.1_Nonsense_Mutation_p.C616*	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1052	EGF-like 2; calcium-binding (Potential).				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			ACTGCCTCTGCAGCCCCTGTG	0.537													8	74	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36212435	36212435	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36212435A>G	uc010eei.2	+	3	2186	c.2186A>G	c.(2185-2187)AAC>AGC	p.N729S		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	729	Pro-rich.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTCTGAGCAACGGGCCACAG	0.662													10	37	---	---	---	---	PASS
ZNF260	339324	broad.mit.edu	37	19	37005980	37005980	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37005980G>A	uc002oee.1	-	4	1005	c.161C>T	c.(160-162)TCT>TTT	p.S54F	ZNF260_uc002oed.1_Missense_Mutation_p.S51F|ZNF260_uc010eey.1_Missense_Mutation_p.S51F|ZNF260_uc002oef.1_Missense_Mutation_p.S51F	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	54					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					GCATTCATGAGATTTCTCTCC	0.363													28	61	---	---	---	---	PASS
ZFP36	7538	broad.mit.edu	37	19	39899350	39899350	+	3'UTR	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39899350G>T	uc002olh.1	+	2					ZFP36_uc010egn.1_Missense_Mutation_p.A204S	NM_003407	NP_003398	P26651	TTP_HUMAN	zinc finger protein 36, C3H type, homolog						positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding			pancreas(1)	1	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAAAGTGACTGCCCGGTCAGA	0.602													6	28	---	---	---	---	PASS
NUMBL	9253	broad.mit.edu	37	19	41186909	41186909	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41186909G>A	uc002oon.2	-	6	621	c.453C>T	c.(451-453)CGC>CGT	p.R151R	NUMBL_uc010xvq.1_Silent_p.R110R|NUMBL_uc002ooo.2_Silent_p.R151R|NUMBL_uc010xvr.1_Silent_p.R110R	NM_004756	NP_004747	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	151	PID.				cytokine-mediated signaling pathway|lateral ventricle development|neuroblast division in subventricular zone|protein metabolic process	cytoplasm	protein binding			lung(3)|ovary(1)|breast(1)	5			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			TGTCCAGGTTGCGGTCAGGAG	0.547													42	93	---	---	---	---	PASS
LYPD3	27076	broad.mit.edu	37	19	43969638	43969638	+	Intron	SNP	G	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43969638G>C	uc002owl.1	-						LYPD3_uc002owm.2_Intron	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein							anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)				CCGGGCAGCAGACCCACCTCC	0.657													13	50	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44934577	44934577	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44934577G>T	uc002oze.1	-	6	813	c.379C>A	c.(379-381)CAA>AAA	p.Q127K	ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Missense_Mutation_p.Q121K	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	127					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				TCTTTTCCTTGCAGATTTACT	0.468													18	66	---	---	---	---	PASS
VASP	7408	broad.mit.edu	37	19	46021024	46021024	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46021024C>A	uc002pcg.2	+	2	451	c.109C>A	c.(109-111)CAG>AAG	p.Q37K	VASP_uc010eki.2_Silent_p.S20S|VASP_uc002pci.2_Missense_Mutation_p.Q24K	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	37	WH1.				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		CAGCCGCGTCCAGATCTACCA	0.642													27	63	---	---	---	---	PASS
VASP	7408	broad.mit.edu	37	19	46021195	46021195	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46021195C>T	uc002pcg.2	+	3	528	c.186C>T	c.(184-186)ATC>ATT	p.I62I	VASP_uc010eki.2_Missense_Mutation_p.S46L|VASP_uc002pci.2_Silent_p.I49I	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	62	WH1.				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		AGGTGGTCATCAACTGTGCCA	0.468													9	21	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55144519	55144519	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55144519C>A	uc002qgj.2	+	8	1351	c.1011C>A	c.(1009-1011)GCC>GCA	p.A337A	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.A337A|LILRB1_uc002qgk.2_Silent_p.A337A|LILRB1_uc002qgm.2_Silent_p.A337A|LILRB1_uc010erq.2_Silent_p.A337A|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	337	Ig-like C2-type 4.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CCACGGTGGCCTCAGGAGAGA	0.597										HNSCC(37;0.09)			22	24	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55441986	55441986	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55441986C>A	uc002qih.3	-	9	2767	c.2691G>T	c.(2689-2691)GAG>GAT	p.E897D	NLRP7_uc002qig.3_Missense_Mutation_p.E869D|NLRP7_uc002qii.3_Missense_Mutation_p.E897D|NLRP7_uc010esk.2_Missense_Mutation_p.E897D|NLRP7_uc010esl.2_Missense_Mutation_p.E925D	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	897	LRR 7.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CTTGGAGCGCCTCTGAGAGAT	0.478													18	51	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9371211	9371211	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9371211C>A	uc002wnf.2	+	16	1408	c.1272C>A	c.(1270-1272)TGC>TGA	p.C424*	PLCB4_uc010gbw.1_Nonsense_Mutation_p.C424*|PLCB4_uc010gbx.2_Nonsense_Mutation_p.C424*|PLCB4_uc002wne.2_Nonsense_Mutation_p.C424*|PLCB4_uc002wnh.2_Nonsense_Mutation_p.C271*	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	424	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						CCAAATATTGCGAAGATCTAT	0.353													12	22	---	---	---	---	PASS
C20orf71	128861	broad.mit.edu	37	20	31814784	31814784	+	Silent	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31814784T>C	uc002wyr.2	+	6	878	c.670T>C	c.(670-672)TTG>CTG	p.L224L	C20orf71_uc002wys.2_Silent_p.L188L	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	224						extracellular region	lipid binding			ovary(1)|skin(1)	2						TGTGAAACTGTTGAAAAGCCT	0.552													21	75	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33875512	33875512	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33875512A>T	uc010zux.1	-	4	1188	c.1070T>A	c.(1069-1071)ATG>AAG	p.M357K	EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Intron	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	357										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GGAGCGACCCATAAGCGGTGA	0.652													14	25	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37179733	37179733	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37179733G>A	uc002xiw.2	+	21	3286	c.3029G>A	c.(3028-3030)CGC>CAC	p.R1010H	RALGAPB_uc002xix.2_Missense_Mutation_p.R1006H|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Missense_Mutation_p.R788H	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	1010					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						CCTGAACCTCGCCCAGTTCCT	0.393													27	128	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37353631	37353631	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37353631C>A	uc002xjc.2	+	1	527	c.264C>A	c.(262-264)GGC>GGA	p.G88G		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	88	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	ATCAGCGAGGCAGCGGAGCTC	0.672													24	37	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40713432	40713432	+	Silent	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40713432G>T	uc002xkg.2	-	29	4210	c.4026C>A	c.(4024-4026)GCC>GCA	p.A1342A	PTPRT_uc010ggj.2_Silent_p.A1361A|PTPRT_uc010ggi.2_Silent_p.A545A	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1342	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGTCCCGGTAGGCAGGCCAGC	0.597													5	23	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50769544	50769544	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50769544T>A	uc002xwl.2	-	6	1536	c.1187A>T	c.(1186-1188)GAC>GTC	p.D396V	ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Missense_Mutation_p.D394V|ZFP64_uc002xwn.2_Missense_Mutation_p.D342V	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	396					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CTTAACCATGTCCCCATGGAA	0.552													21	66	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10921941	10921941	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10921941G>T	uc002yip.1	-	18	1450	c.1082C>A	c.(1081-1083)ACT>AAT	p.T361N	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.T343N|TPTE_uc002yir.1_Missense_Mutation_p.T323N|TPTE_uc010gkv.1_Missense_Mutation_p.T223N	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	361	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TACCTTTGCAGTTGAACATAT	0.338													7	79	---	---	---	---	PASS
ADAMTS5	11096	broad.mit.edu	37	21	28296372	28296372	+	Silent	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28296372C>T	uc002ymg.2	-	8	3522	c.2793G>A	c.(2791-2793)TAG>TAA	p.*931*		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	931					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TAACCACAGGCTAACATTTCT	0.468													6	10	---	---	---	---	PASS
HSCB	150274	broad.mit.edu	37	22	29139937	29139937	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29139937C>G	uc003aea.2	+	2	345	c.304C>G	c.(304-306)CAC>GAC	p.H102D	CHEK2_uc003adt.1_5'Flank|CHEK2_uc003adu.1_5'Flank|CHEK2_uc003adv.1_5'Flank|CHEK2_uc003adw.1_5'Flank|CHEK2_uc003adx.1_5'Flank|CHEK2_uc003ady.1_5'Flank|CHEK2_uc003adz.1_5'Flank	NM_172002	NP_741999	Q8IWL3	HSC20_HUMAN	J-type co-chaperone HSC20 precursor	102	J.			HPD->AAA: Does not interact with HSPA9. Does not inhibit interaction with ISCU.	iron-sulfur cluster assembly|protein folding	mitochondrion	chaperone binding|heat shock protein binding|metal ion binding			kidney(1)	1						GCGTCTTGTCCACCCAGATTT	0.478													19	63	---	---	---	---	PASS
LARGE	9215	broad.mit.edu	37	22	34157438	34157438	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34157438C>T	uc003and.3	-	3	605	c.26G>A	c.(25-27)CGG>CAG	p.R9Q	LARGE_uc003ane.3_Missense_Mutation_p.R9Q|LARGE_uc010gwp.2_Missense_Mutation_p.R9Q|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Missense_Mutation_p.R9Q	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	9	Cytoplasmic (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				CAAGAATTTCCGTCTCCCCCT	0.532													9	73	---	---	---	---	PASS
PARVB	29780	broad.mit.edu	37	22	44543806	44543806	+	Intron	SNP	A	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44543806A>G	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				GAAGAAGGTGAGCTATTGGTG	0.557													8	15	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37027907	37027907	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027907G>A	uc004ddl.1	+	1	1438	c.1424G>A	c.(1423-1425)TGC>TAC	p.C475Y		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	475										ovary(3)	3						TCCCATCTCTGCCCGGAGCCT	0.627													31	32	---	---	---	---	PASS
TSPAN7	7102	broad.mit.edu	37	X	38546888	38546888	+	Silent	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38546888G>T	uc004deg.3	+	7	786	c.717G>T	c.(715-717)CGG>CGT	p.R239R	TSPAN7_uc011mkj.1_Silent_p.R265R|TSPAN7_uc011mkk.1_Silent_p.R256R|TSPAN7_uc004deh.2_Silent_p.R147R	NM_004615	NP_004606	P41732	TSN7_HUMAN	tetraspanin 7	239	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to plasma membrane				ovary(1)	1						GTCTGTCCCGGTTCATCACGG	0.473													13	7	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44941830	44941830	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44941830G>T	uc004dge.3	+	21	3529	c.3154G>T	c.(3154-3156)GAA>TAA	p.E1052*	KDM6A_uc011mkz.1_Nonsense_Mutation_p.E1104*|KDM6A_uc011mla.1_Nonsense_Mutation_p.E1007*|KDM6A_uc011mlb.1_Nonsense_Mutation_p.E1059*|KDM6A_uc011mlc.1_Nonsense_Mutation_p.E756*|KDM6A_uc011mld.1_Nonsense_Mutation_p.E691*	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	1052					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						GGAAGAAAATGAAAAAAGAAG	0.313			D|N|F|S		renal|oesophageal SCC|MM								20	10	---	---	---	---	PASS
TCEAL5	340543	broad.mit.edu	37	X	102529492	102529492	+	5'UTR	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102529492G>A	uc004ejz.1	-	3						NM_001012979	NP_001012997	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(1)|breast(1)	2						GCTTTTCCATGTTGAGATGTT	0.264													25	15	---	---	---	---	PASS
PSMD10	5716	broad.mit.edu	37	X	107334727	107334727	+	Silent	SNP	T	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107334727T>A	uc004enp.1	-	1	122	c.24A>T	c.(22-24)CTA>CTT	p.L8L	ATG4A_uc004enr.2_5'Flank|ATG4A_uc004ent.2_5'Flank|ATG4A_uc004ens.2_5'Flank|ATG4A_uc011msl.1_5'Flank|ATG4A_uc010npi.2_5'Flank|PSMD10_uc004enq.1_Silent_p.L8L|PSMD10_uc010nph.1_Silent_p.L8L	NM_002814	NP_002805	O75832	PSD10_HUMAN	proteasome 26S non-ATPase subunit 10 isoform 1	8	ANK 1.|Interaction with RB1.|Required for nuclear localization.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cytoplasmic sequestering of NF-kappaB|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of MAPKKK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of release of cytochrome c from mitochondria|negative regulation of transcription from RNA polymerase II promoter|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus|proteasome regulatory particle	transcription factor binding			ovary(1)	1						TGCAGACCATTAGGTTAGACA	0.562													45	25	---	---	---	---	PASS
DCAF12L1	139170	broad.mit.edu	37	X	125686112	125686112	+	Silent	SNP	G	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686112G>A	uc004eul.2	-	1	731	c.480C>T	c.(478-480)TCC>TCT	p.S160S		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	160	WD 1.									skin(3)|ovary(1)	4						GAAGCGTCTTGGAGGGATTCA	0.667													10	13	---	---	---	---	PASS
BRS3	680	broad.mit.edu	37	X	135570420	135570420	+	Silent	SNP	C	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135570420C>A	uc004ezv.1	+	1	296	c.147C>A	c.(145-147)GCC>GCA	p.A49A		NM_001727	NP_001718	P32247	BRS3_HUMAN	bombesin-like receptor 3	49	Helical; Name=1; (Potential).				adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CATTGTGTGCCATCTATATTA	0.398													34	25	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138692464	138692464	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138692464A>T	uc004fau.2	-	11	1691	c.1397T>A	c.(1396-1398)TTA>TAA	p.L466*	MCF2_uc004fav.2_Nonsense_Mutation_p.L482*|MCF2_uc011mwl.1_Nonsense_Mutation_p.L443*|MCF2_uc010nsh.1_Nonsense_Mutation_p.L466*|MCF2_uc011mwm.1_Nonsense_Mutation_p.L427*|MCF2_uc011mwn.1_Nonsense_Mutation_p.L611*|MCF2_uc004faw.2_Nonsense_Mutation_p.L526*|MCF2_uc011mwo.1_Nonsense_Mutation_p.L542*	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	466					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					ATTTACTTTTAAGTTGCTCTG	0.299													3	5	---	---	---	---	PASS
MAGEA8	4107	broad.mit.edu	37	X	149013145	149013145	+	Silent	SNP	T	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149013145T>C	uc004fdw.1	+	3	314	c.99T>C	c.(97-99)GCT>GCC	p.A33A		NM_005364	NP_005355	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	33											0	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCCACAGCTGAGGAGCAGA	0.567													4	12	---	---	---	---	PASS
MIB2	142678	broad.mit.edu	37	1	1564953	1564953	+	Intron	DEL	G	-	-	rs112177324		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1564953delG	uc001agg.2	+						MIB2_uc001agh.2_Intron|MIB2_uc001agi.2_Intron|MIB2_uc001agj.2_Intron|MIB2_uc001agk.2_Intron|MIB2_uc001agm.2_Intron|MIB2_uc010nyq.1_Intron|MIB2_uc009vkh.2_Intron|MIB2_uc001agn.2_Intron|MIB2_uc001ago.2_Intron|MMP23B_uc001agp.2_5'Flank|MMP23B_uc001agq.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2						Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GAGGGTGAGTGGGGGGCCCCG	0.716													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5731629	5731629	+	IGR	DEL	G	-	-	rs144318539		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5731629delG								AJAP1 (887779 upstream) : NPHP4 (191241 downstream)																							CTGCATCCCTGGCCTCATGGC	0.577													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	6457470	6457470	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6457470delA								ACOT7 (3644 upstream) : HES2 (15030 downstream)																							GAGTGAGGCCAAAAAGTGATC	0.507													4	2	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	6997450	6997452	+	Intron	DEL	ACT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6997450_6997452delACT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		acttaccaccactatcatcacca	0.000													4	3	---	---	---	---	
UTS2	10911	broad.mit.edu	37	1	7959741	7959741	+	Intron	DEL	T	-	-	rs146392627	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7959741delT	uc001aoq.2	-							NM_006786	NP_006777	O95399	UTS2_HUMAN	urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		ctTTATGATCTTTTTTAAACA	0.050													4	2	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8570383	8570384	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8570383_8570384insA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTAGCAGCAGGAAAAAAAAAGA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9194027	9194027	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9194027delA								GPR157 (4671 upstream) : MIR34A (17700 downstream)																							agctttatgtaagtggaatca	0.040													4	2	---	---	---	---	
UBE4B	10277	broad.mit.edu	37	1	10132438	10132438	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10132438delT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTGTTATCGCTTTTTTTTTTA	0.308													4	2	---	---	---	---	
CLCNKB	1188	broad.mit.edu	37	1	16363802	16363803	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16363802_16363803insC	uc001axw.3	+						FAM131C_uc010obz.1_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGAAGGCTTCTGGAAGAGGG	0.510													4	2	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16953247	16953248	+	5'Flank	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16953247_16953248delCT	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0						AGAGGATCCCCTGAGTAAGGTC	0.584													3	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17199371	17199371	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17199371delG	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GTCTCGCTCCGGTGTACACAG	0.622													4	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17231626	17231626	+	Intron	DEL	C	-	-	rs67781706		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17231626delC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGGTGGTGCTCGGGGCAAGTG	0.587													6	4	---	---	---	---	
TAS1R2	80834	broad.mit.edu	37	1	19168478	19168478	+	Intron	DEL	G	-	-	rs35542368		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19168478delG	uc001bba.1	-							NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor						detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGAAACTGTAGAAAAAAaaaa	0.294													4	2	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19476308	19476308	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19476308delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGAAGCAAAGAAAAAAAAAAA	0.438													5	4	---	---	---	---	
AKR7A3	22977	broad.mit.edu	37	1	19610327	19610328	+	Intron	INS	-	A	A	rs145556063		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19610327_19610328insA	uc001bbv.1	-							NM_012067	NP_036199	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3						cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		tctgtccccccaaaaaaaaaac	0.149													3	3	---	---	---	---	
TCEA3	6920	broad.mit.edu	37	1	23719106	23719107	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23719106_23719107insA	uc001bgx.1	-						TCEA3_uc009vqm.1_Intron	NM_003196	NP_003187	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3						regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation, DNA-dependent	nucleus	DNA binding|translation elongation factor activity|zinc ion binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		acatcatacacacacacacaca	0.020													4	2	---	---	---	---	
TMEM50A	23585	broad.mit.edu	37	1	25684019	25684020	+	Intron	INS	-	GT	GT			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25684019_25684020insGT	uc001bke.2	+						TMEM50A_uc010oeq.1_Intron|TMEM50A_uc009vrr.2_Intron|TMEM50A_uc009vrs.2_Intron	NM_014313	NP_055128	O95807	TM50A_HUMAN	small membrane protein 1							endoplasmic reticulum|integral to membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		CTGCATCAGGAgtgtgtgtgtg	0.262													6	3	---	---	---	---	
RHCE	6006	broad.mit.edu	37	1	25710884	25710884	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25710884delT	uc001bkf.2	-						RHCE_uc001bkg.2_Intron|RHCE_uc001bkh.2_Intron|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Intron	NM_020485	NP_065231	P18577	RHCE_HUMAN	Rhesus blood group, CcEe antigens isoform 1							integral to plasma membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		CTTCACTGGCTTTTTTTTTTT	0.194													4	2	---	---	---	---	
MATN1	4146	broad.mit.edu	37	1	31196841	31196841	+	5'Flank	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31196841delC	uc001brz.2	-						uc001bsb.1_Intron	NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein precursor						protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		CCACTCACAACCCCAAGTTTC	0.587													4	2	---	---	---	---	
ZNF362	149076	broad.mit.edu	37	1	33764935	33764936	+	3'UTR	INS	-	T	T	rs35161004		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33764935_33764936insT	uc001bxc.1	+	9						NM_152493	NP_689706	Q5T0B9	ZN362_HUMAN	zinc finger protein 362						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TTGCTTCACTGttttttttttt	0.351											OREG0013343	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33782169	33782170	+	Intron	INS	-	TAGGTGCC	TAGGTGCC	rs141453070	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33782169_33782170insTAGGTGCC	uc001bxd.1	-							NM_001080438	NP_001073907			RecName: Full=Alpha 1,3-galactosyltransferase 2;          Short=A3galt2;          EC=2.4.1.87; AltName: Full=Isoglobotriaosylceramide synthase; AltName: Full=iGb3 synthase;          Short=iGb3S; Flags: Precursor;																		GGAAGATGAGTTAGGTGCCAGC	0.599													4	3	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34457358	34457358	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34457358delA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ctgactcaataaaataggCCT	0.174													4	2	---	---	---	---	
EIF2C4	192670	broad.mit.edu	37	1	36316381	36316382	+	Intron	INS	-	AA	AA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36316381_36316382insAA	uc001bzj.1	+							NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				gactccatctcaaaaaaaaaaa	0.124													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37154585	37154588	+	IGR	DEL	GGAA	-	-	rs111279905		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37154585_37154588delGGAA								CSF3R (206076 upstream) : GRIK3 (106540 downstream)																							tgtgggaaggggaaggAAGGGGAA	0.113													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37916939	37916940	+	IGR	INS	-	TT	TT	rs10634271		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37916939_37916940insTT								GRIK3 (417095 upstream) : ZC3H12A (23179 downstream)																							CCTAGGGTAACttttttttttt	0.312													5	3	---	---	---	---	
KIAA0467	23334	broad.mit.edu	37	1	43861684	43861684	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43861684delA	uc009vws.1	+						C1orf84_uc001cjh.2_Intron|C1orf84_uc001cji.1_Intron			Q5T011	SZT2_HUMAN	Homo sapiens mRNA for KIAA0467 protein, partial cds.							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				gtatgtgtccaaaaaagccag	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47917440	47917440	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47917440delT								FOXD2 (11078 upstream) : SKINTL (649947 downstream)																							TCCCACAGAAttttttttttt	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	51480690	51480693	+	IGR	DEL	AGGA	-	-	rs113970426		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51480690_51480693delAGGA								CDKN2C (40383 upstream) : C1orf185 (87213 downstream)														p.0?(1)|p.?(1)									agagggagggaggaaggaaggaag	0.034													4	2	---	---	---	---	
RNF11	26994	broad.mit.edu	37	1	51700060	51700061	+	5'Flank	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51700060_51700061delTC	uc001csi.3	+							NM_014372	NP_055187	Q9Y3C5	RNF11_HUMAN	ring finger protein 11						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	DNA binding|protein binding|zinc ion binding				0						ctgcctcccttctctctctctc	0.020													5	3	---	---	---	---	
ZYG11B	79699	broad.mit.edu	37	1	53204278	53204279	+	Intron	INS	-	T	T	rs11390068		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53204278_53204279insT	uc001cuj.2	+						ZYG11B_uc009vzg.2_Intron|ZYG11B_uc010onj.1_Intron	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B								protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TTTCTAAGGACttttttttttt	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56041659	56041659	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56041659delT								USP24 (360897 upstream) : PPAP2B (918774 downstream)																							CCCATCATCCTGGCATCTGGA	0.463													4	2	---	---	---	---	
C1orf168	199920	broad.mit.edu	37	1	57188878	57188879	+	Intron	DEL	AC	-	-	rs72110893		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57188878_57188879delAC	uc001cym.3	-						C1orf168_uc001cyl.2_Intron	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920											ovary(3)|skin(2)	5						agattcacagacacacacacac	0.000													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58799210	58799211	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58799210_58799211delGT	uc001cyt.1	-							NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						GAGTGTATGGGTGCACACGCAC	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59707293	59707293	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59707293delT								LOC729467 (94814 upstream) : FGGY (55332 downstream)																							ttcctTGTCCTTTTTTTCCCC	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61445456	61445457	+	IGR	INS	-	TT	TT	rs67989554		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61445456_61445457insTT								C1orf87 (906030 upstream) : NFIA (97489 downstream)																							GCTAAACTTAAttttttttttt	0.173													3	3	---	---	---	---	
ZZZ3	26009	broad.mit.edu	37	1	78055869	78055869	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78055869delC	uc001dhq.2	-						ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Intron|ZZZ3_uc001dhp.2_Intron	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						accagcctggccaacatggtg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80035901	80035901	+	IGR	DEL	A	-	-	rs72057643		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80035901delA								ELTD1 (563406 upstream) : None (None downstream)																							tggggaagttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80047715	80047718	+	IGR	DEL	TTTA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80047715_80047718delTTTA								ELTD1 (575220 upstream) : None (None downstream)																							tttcatgccttttatttatttatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84265288	84265289	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84265288_84265289delTG	uc001diz.3	-											Homo sapiens cDNA clone IMAGE:4815396.																		CTGTACTGCCTGTGTGTGTGTT	0.460													4	2	---	---	---	---	
CTBS	1486	broad.mit.edu	37	1	85042624	85042624	+	5'Flank	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85042624delC	uc001dka.2	-						CTBS_uc001dkc.2_5'Flank|CTBS_uc001dkd.2_5'Flank|CTBS_uc001dkb.2_5'Flank	NM_004388	NP_004379	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl- precursor							lysosome	cation binding				0				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		cagttgtactcacagttaaga	0.050													4	2	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86436197	86436198	+	Intron	DEL	AT	-	-	rs145566971		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86436197_86436198delAT	uc001dlj.2	-						COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		GAAGATGAACATAGAAAAAAAT	0.317													4	2	---	---	---	---	
SEP15	9403	broad.mit.edu	37	1	87376257	87376258	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87376257_87376258insC	uc010osi.1	-						SEP15_uc010osj.1_Intron	NM_004261	NP_004252	O60613	SEP15_HUMAN	15 kDa selenoprotein isoform 1 precursor						'de novo' posttranslational protein folding	endoplasmic reticulum lumen	selenium binding				0		Lung NSC(277;0.153)		all cancers(265;0.00744)|Epithelial(280;0.0333)		cgtggtggcgtgcacctgtaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90947668	90947668	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90947668delT								ZNF326 (453574 upstream) : BARHL2 (229912 downstream)																							AAATAGTACATTTTATCAGTC	0.368													4	2	---	---	---	---	
RPAP2	79871	broad.mit.edu	37	1	92838752	92838752	+	Intron	DEL	T	-	-	rs67527768		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92838752delT	uc001dot.2	+						RPAP2_uc009wdh.2_Intron	NM_024813	NP_079089	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2							integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		tgaggatggatttttagaggg	0.000													4	2	---	---	---	---	
BCAR3	8412	broad.mit.edu	37	1	94100275	94100276	+	Intron	DEL	AC	-	-	rs111366450		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94100275_94100276delAC	uc001dpz.2	-						BCAR3_uc001dqa.2_Intron|BCAR3_uc001dqb.2_Intron	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		aacaacaacaacaaAAAAAAAA	0.000													4	2	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669592	94669593	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669592_94669593insC	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AAATCAATTTATTTTTCCCCCT	0.332													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95273545	95273545	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95273545delA	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																		cgtctctcctaaaaatacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	101497919	101497919	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101497919delA	uc001dua.2	+						uc001dub.2_Intron					Homo sapiens cDNA FLJ11489 fis, clone HEMBA1001915.																		accctgtctcaaaaaaaaaaG	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	101720544	101720545	+	IGR	INS	-	TTG	TTG			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101720544_101720545insTTG								S1PR1 (13468 upstream) : OLFM3 (547582 downstream)																							AATCATGGAGTTTTttgttgtt	0.183													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120557662	120557664	+	Intron	DEL	AAC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120557662_120557664delAAC	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCAAAAAAAAACAACAACAACA	0.340			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.663			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142685918	142685918	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142685918delC	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ctgcctcccacccccacctcc	0.005													8	4	---	---	---	---	
LOC100286793	100286793	broad.mit.edu	37	1	143670644	143670645	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143670644_143670645insC	uc001ejp.3	-											Homo sapiens cDNA FLJ39739 fis, clone SMINT2016440.												0						CATACGCCTCACCTTTACACGC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143989141	143989147	+	Intron	DEL	AAGGCTC	-	-	rs67614190		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143989141_143989147delAAGGCTC	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		gtggagccctaaggctcaagtgtgctt	0.000													3	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144864861	144864861	+	Intron	DEL	C	-	-	rs113926963		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144864861delC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001ema.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ttctcacctgctgAGGTCTGT	0.219			T	PDGFRB	MPD								4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145077808	145077809	+	Intron	INS	-	AC	AC	rs771108		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145077808_145077809insAC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'Flank|PDE4DIP_uc001emh.2_5'Flank|PDE4DIP_uc001emk.2_5'Flank			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AAAAAAAAAAAAAAAAACCTGT	0.391													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145237179	145237179	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145237179delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGCCTTTATCAAAGACAATGT	0.348													3	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148863399	148863399	+	IGR	DEL	A	-	-	rs112271271		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148863399delA								NBPF16 (105088 upstream) : LOC645166 (64887 downstream)																							GGTCCATCACAAAAAAAAAAA	0.259													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149224011	149224012	+	IGR	INS	-	T	T	rs68076478		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149224011_149224012insT								LOC645166 (270957 upstream) : LOC388692 (55464 downstream)																							CAGTAAAAAAAACAAGTAACCC	0.277													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149748414	149748414	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149748414delT								HIST2H2BF (349185 upstream) : FCGR1A (5836 downstream)																							gctcttttcatttttttttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150860355	150860355	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150860355delG								ARNT (11169 upstream) : SETDB1 (38460 downstream)																							AAAAGGTAATGGATCTTTCTG	0.363													4	2	---	---	---	---	
GABPB2	126626	broad.mit.edu	37	1	151057418	151057418	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151057418delA	uc001ewr.2	+						GABPB2_uc010pcp.1_Intron|GABPB2_uc001ews.2_Intron	NM_144618	NP_653219	Q8TAK5	GABP2_HUMAN	GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		caaaaaatttaaaaaaaaatt	0.005													4	3	---	---	---	---	
VPS72	6944	broad.mit.edu	37	1	151159040	151159041	+	Intron	INS	-	A	A	rs114347125		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151159040_151159041insA	uc001exe.1	-						VPS72_uc001exf.1_Intron	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1						chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			gtctcaaaaagaaaaaaaaaaa	0.168													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151954817	151954817	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151954817delA								THEM4 (72704 upstream) : S100A10 (570 downstream)																							TAACAGGCACAAAAAAGGGCT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152513511	152513512	+	IGR	DEL	CA	-	-	rs140438304		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152513511_152513512delCA								CRCT1 (25031 upstream) : LCE3E (24619 downstream)																							cagagcctgccacacacaggga	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152534105	152534106	+	IGR	INS	-	G	G	rs151092094	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152534105_152534106insG								CRCT1 (45625 upstream) : LCE3E (4025 downstream)																							AAAAGGGGAATGGAAGAGAGCC	0.436													4	2	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153989996	153989996	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153989996delT	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			tctttctttcttttttttttt	0.000													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154837829	154837829	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154837829delA	uc001ffp.2	-						KCNN3_uc009wox.1_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			CCTGCCTATTAAAAAAAAAAA	0.453													2	4	---	---	---	---	
EFNA1	1942	broad.mit.edu	37	1	155101990	155101991	+	Intron	DEL	CA	-	-	rs142350089		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155101990_155101991delCA	uc001fhh.2	+						EFNA1_uc001fhi.2_Intron	NM_004428	NP_004419	P20827	EFNA1_HUMAN	ephrin A1 isoform a precursor						angiogenesis|aortic valve morphogenesis|cell migration|cell-cell signaling|endocardial cushion to mesenchymal transition involved in heart valve formation|ephrin receptor signaling pathway|mitral valve morphogenesis|negative regulation of epithelial to mesenchymal transition|negative regulation of transcription from RNA polymerase II promoter|positive regulation of peptidyl-tyrosine phosphorylation|regulation of cell adhesion mediated by integrin|substrate adhesion-dependent cell spreading	extracellular region|integral to plasma membrane	ephrin receptor binding				0	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCCTCTGGCcacacacacaca	0.465													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	155619046	155619046	+	5'Flank	DEL	T	-	-	rs141640499		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155619046delT	uc001flf.2	-											Homo sapiens, clone IMAGE:5454236, mRNA.																		CTATTTACTAttttttttttt	0.010													3	4	---	---	---	---	
ARHGEF11	9826	broad.mit.edu	37	1	156999053	156999054	+	Intron	INS	-	TTGTTG	TTGTTG	rs145277113	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156999053_156999054insTTGTTG	uc001fqo.2	-						ARHGEF11_uc001fqn.2_Intron	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					tttggtggtttttgttgttgtt	0.000													4	3	---	---	---	---	
OR10K1	391109	broad.mit.edu	37	1	158435542	158435542	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158435542delC	uc010pij.1	+	1	191	c.191delC	c.(190-192)GCCfs	p.A64fs		NM_001004473	NP_001004473	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					TTCTTCCTTGCCATCCTTTCT	0.478													106	93	---	---	---	---	
CADM3	57863	broad.mit.edu	37	1	159149597	159149598	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159149597_159149598insT	uc001ftl.2	+						CADM3_uc009wsx.1_Intron|CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Intron	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					GCTCCTAATCATTTTTTTTTTG	0.366													3	3	---	---	---	---	
SLAMF8	56833	broad.mit.edu	37	1	159803597	159803598	+	Intron	INS	-	C	C	rs141014631	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159803597_159803598insC	uc001fue.3	+							NM_020125	NP_064510	Q9P0V8	SLAF8_HUMAN	SLAM family member 8 precursor							integral to membrane					0	all_hematologic(112;0.0597)					tacatttacttccccactgaat	0.000													6	10	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162184060	162184063	+	Intron	DEL	TTCA	-	-	rs10551799		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162184060_162184063delTTCA	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			cgttcgttcgttcattcattcatt	0.319													3	4	---	---	---	---	
DDR2	4921	broad.mit.edu	37	1	162659365	162659365	+	Intron	DEL	T	-	-	rs66495803		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162659365delT	uc001gcf.2	+						DDR2_uc001gcg.2_Intron	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2						cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			GTCTCACTTATTTTTTTTTTT	0.333													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	162888207	162888207	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162888207delA								C1orf110 (49602 upstream) : RGS4 (150189 downstream)																							gcatttgcctaagtctattgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164068509	164068509	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164068509delA								NUF2 (742956 upstream) : PBX1 (460293 downstream)																							gatgattagtaaggttgatca	0.000													4	2	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164742481	164742482	+	Intron	DEL	CA	-	-	rs67697962		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164742481_164742482delCA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						GTAacacgcgcacacacacaca	0.327			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	2	---	---	---	---	
CREG1	8804	broad.mit.edu	37	1	167515717	167515717	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167515717delA	uc001gel.2	-							NM_003851	NP_003842	O75629	CREG1_HUMAN	cellular repressor of E1A-stimulated genes						cell proliferation|multicellular organismal development|regulation of growth|regulation of transcription from RNA polymerase II promoter	extracellular region	FMN binding|transcription corepressor activity				0						catctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	167583435	167583436	+	IGR	INS	-	T	T	rs140805531	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167583435_167583436insT								CREG1 (60379 upstream) : RCSD1 (16038 downstream)																							ttcctttgttgttttttttttg	0.000													4	2	---	---	---	---	
RCSD1	92241	broad.mit.edu	37	1	167606968	167606969	+	Intron	DEL	CA	-	-	rs146731131		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167606968_167606969delCA	uc001gem.2	+						RCSD1_uc010pli.1_Intron	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1											ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					AGGAATAGACcacacacacaca	0.455													4	2	---	---	---	---	
RCSD1	92241	broad.mit.edu	37	1	167664501	167664501	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167664501delG	uc001gem.2	+						RCSD1_uc010pli.1_Intron	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1											ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					GGGTGAGGCAGGGAGGGAGGA	0.587													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168186470	168186471	+	IGR	INS	-	TT	TT	rs10663456		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168186470_168186471insTT								TIPRL (15121 upstream) : SFT2D2 (8784 downstream)																							TAGGGCCTTCCttttttttttt	0.193													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168953509	168953509	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168953509delT								MGC4473 (191389 upstream) : ATP1B1 (122438 downstream)																							tctaacattcttttttttttt	0.179													4	2	---	---	---	---	
KIFAP3	22920	broad.mit.edu	37	1	169967523	169967530	+	Intron	DEL	ATATATAT	-	-	rs67634163		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169967523_169967530delATATATAT	uc001ggv.2	-						KIFAP3_uc010plx.1_Intron	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3						blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCTTCACCAGATATATATATATATATAT	0.269													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171591827	171591828	+	IGR	INS	-	AG	AG	rs144497988	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171591827_171591828insAG								BAT2L2 (29178 upstream) : MYOC (12731 downstream)																							TCTAGAATGGCAGTCACCACGT	0.421													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	171768429	171768430	+	IGR	DEL	GT	-	-	rs71976221		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171768429_171768430delGT								METTL13 (1574 upstream) : DNM3 (42191 downstream)																							gcgtgtgtgcgtgtgtgtgtgt	0.109													4	2	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173478584	173478584	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173478584delA	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						cctctgtctcaaaaaaaaaaa	0.080													6	3	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173487410	173487411	+	Intron	INS	-	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173487410_173487411insG	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						caaagaaaaaaaaaaaaaaCCC	0.183													4	2	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174633789	174633789	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174633789delC	uc001gjx.2	+							NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						tctagtctttccctaccagag	0.000													4	2	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175059584	175059584	+	Intron	DEL	C	-	-	rs35831070		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175059584delC	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACAGGTCCTGCCCCCCGTGTC	0.488													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	175211573	175211574	+	IGR	INS	-	A	A	rs141025560	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175211573_175211574insA								KIAA0040 (49344 upstream) : TNR (80361 downstream)																							ataaagcaggcaaaaaaatgtg	0.000													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178682325	178682326	+	IGR	DEL	AA	-	-	rs138482742	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178682325_178682326delAA								C1orf220 (164301 upstream) : RALGPS2 (11974 downstream)																							agaaagaaagaaagagaaagag	0.000													6	3	---	---	---	---	
RALGPS2	55103	broad.mit.edu	37	1	178733834	178733834	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178733834delA	uc001glz.2	+						RALGPS2_uc001gly.1_Intron|RALGPS2_uc010pnb.1_Intron	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						aacagatattatttcttcttc	0.000													4	2	---	---	---	---	
ABL2	27	broad.mit.edu	37	1	179188537	179188538	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179188537_179188538insA	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	CAGAGAAGAAGAAAAAAAAAGG	0.248			T	ETV6	AML								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	179786754	179786755	+	IGR	DEL	TG	-	-	rs148566677		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179786754_179786755delTG								FAM163A (1428 upstream) : TOR1AIP2 (27199 downstream)																							GAACGTCTTTtgtgtgtgtgtg	0.480													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181409556	181409557	+	IGR	INS	-	G	G	rs140863012	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181409556_181409557insG								IER5 (349579 upstream) : CACNA1E (43159 downstream)																							GCTTCTGGGCAGGGTGGCCCAG	0.446													4	6	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181601874	181601874	+	Intron	DEL	T	-	-	rs5779110		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181601874delT	uc001gow.2	+						CACNA1E_uc009wxr.2_Intron|CACNA1E_uc009wxs.2_Intron	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TTGTACCCCCTGGACCCATGC	0.318													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181875779	181875779	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181875779delA								CACNA1E (105066 upstream) : ZNF648 (147928 downstream)																							aggtataattaacatactgaa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	182048291	182048291	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182048291delG								ZNF648 (17444 upstream) : GLUL (303378 downstream)																							tgcgggtcaaggacacctagg	0.000													4	2	---	---	---	---	
RGS8	85397	broad.mit.edu	37	1	182619041	182619041	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182619041delT	uc010pnw.1	-						RGS8_uc001gpn.1_Intron|RGS8_uc001gpm.1_Intron	NM_001102450	NP_001095920	P57771	RGS8_HUMAN	regulator of G-protein signalling 8 isoform 2						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)	1						TTAACAACTCttttttttttt	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	183118858	183118860	+	IGR	DEL	CTG	-	-	rs74707586		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183118858_183118860delCTG								LAMC1 (4132 upstream) : LAMC2 (36314 downstream)																							cacccctctcctgctcacacacc	0.108													6	3	---	---	---	---	
NMNAT2	23057	broad.mit.edu	37	1	183300376	183300377	+	Intron	INS	-	C	C	rs142627846	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183300376_183300377insC	uc001gqc.1	-							NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						GACATCAATCAAGCTGCTGTCA	0.559													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	185471093	185471093	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185471093delA								IVNS1ABP (184632 upstream) : HMCN1 (232590 downstream)																							aagagctcctaaaagtagaag	0.000													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185939796	185939797	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185939796_185939797insT	uc001grq.1	+						HMCN1_uc001grr.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TGCtttctttcttttttttttt	0.153													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	186620585	186620585	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186620585delT								PDC (190346 upstream) : PTGS2 (20360 downstream)																							CCAAGTGAAATCCAGCTTGGA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	191455537	191455537	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191455537delT								None (None upstream) : RGS18 (672055 downstream)																							tggattaggctttgtcttaag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	192534908	192534911	+	IGR	DEL	AGGA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192534908_192534911delAGGA								RGS21 (198496 upstream) : RGS1 (9946 downstream)																							gtggagagggaggaaggaaggaag	0.225													4	2	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197595955	197595955	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197595955delA	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron|DENND1B_uc001gug.3_Intron	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						aaatagatggaaaaaaaatga	0.000													4	2	---	---	---	---	
LEMD1	93273	broad.mit.edu	37	1	205380214	205380220	+	Intron	DEL	AAAGAAG	-	-	rs12752185		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205380214_205380220delAAAGAAG	uc001hcj.1	-						LEMD1_uc001hci.1_Intron|LEMD1_uc001hck.1_Intron|LEMD1_uc001hcl.1_Intron|LEMD1_uc001hcm.1_Intron|LEMD1_uc001hcn.1_Intron			Q68G75	LEMD1_HUMAN	RecName: Full=LEM domain-containing protein 1;          Short=LEMP-1; AltName: Full=Cancer/testis antigen 50;          Short=CT50;							integral to membrane|nuclear envelope					0	Breast(84;0.247)		BRCA - Breast invasive adenocarcinoma(75;0.0938)			aatgaaggaaaaagaagaaagaaaaaa	0.000													6	3	---	---	---	---	
CTSE	1510	broad.mit.edu	37	1	206328523	206328524	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206328523_206328524delTG	uc001hdu.2	+						CTSE_uc001hdv.2_Intron|CTSE_uc010prs.1_Intron	NM_001910	NP_001901	P14091	CATE_HUMAN	cathepsin E isoform a preproprotein						antigen processing and presentation of exogenous peptide antigen via MHC class II|digestion|proteolysis	endosome	aspartic-type endopeptidase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(75;0.0754)			ATTGCATGAatgtgtgtgtgtg	0.158													5	3	---	---	---	---	
IL10	3586	broad.mit.edu	37	1	206944846	206944846	+	Intron	DEL	T	-	-	rs76688129		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206944846delT	uc001hen.1	-							NM_000572	NP_000563	P22301	IL10_HUMAN	interleukin 10 precursor						anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			CATTTAGAGattttttttttt	0.269													4	2	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	210908764	210908773	+	Intron	DEL	GTGTGTGTGT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210908764_210908773delGTGTGTGTGT	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		gagtgagtgagtgtgtgtgtgtgtgtgtgt	0.290													4	2	---	---	---	---	
RD3	343035	broad.mit.edu	37	1	211652720	211652720	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211652720delG	uc001him.2	-						RD3_uc001hin.2_Intron|RD3_uc009xda.2_Intron	NM_183059	NP_898882	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3						response to stimulus|visual perception					ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		CAGCGGGTCTGGCACCCCGGG	0.672													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211703086	211703086	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211703086delC								RD3 (36827 upstream) : SLC30A1 (45295 downstream)																							TCCACGACGTCCCTGCTGCTC	0.527													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221175589	221175590	+	IGR	INS	-	TCTA	TCTA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221175589_221175590insTCTA								HLX (117191 upstream) : LOC400804 (327680 downstream)																							tccatttatcttctatctatct	0.000													3	3	---	---	---	---	
DEGS1	8560	broad.mit.edu	37	1	224369778	224369778	+	5'Flank	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224369778delT	uc001hoj.2	+						DEGS1_uc001hoi.2_Intron	NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid						sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		ttctattttcttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	227641557	227641558	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227641557_227641558delTG								CDC42BPA (135731 upstream) : ZNF678 (109686 downstream)																							ctccttttcctgtgtttcagga	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230107739	230107740	+	IGR	INS	-	AA	AA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230107739_230107740insAA								URB2 (311793 upstream) : GALNT2 (85796 downstream)																							caaacatacacacaccccatcc	0.030													5	3	---	---	---	---	
GALNT2	2590	broad.mit.edu	37	1	230405478	230405478	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230405478delA	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron|GALNT2_uc001htu.2_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				ccgtctttacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DISC1	27185	broad.mit.edu	37	1	232140864	232140864	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232140864delT	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				TCTTATTATATTTTCTTTCTC	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232183560	232183563	+	IGR	DEL	TTTG	-	-	rs71573156		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232183560_232183563delTTTG								DISC1 (6544 upstream) : SIPA1L2 (350151 downstream)																							ataagagttttttgtttgtttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232699703	232699704	+	IGR	DEL	GT	-	-	rs34854572		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232699703_232699704delGT								SIPA1L2 (48460 upstream) : KIAA1383 (240934 downstream)																							tttttttttcgtgtgtgtgtgt	0.025													4	2	---	---	---	---	
KIAA1804	84451	broad.mit.edu	37	1	233475232	233475233	+	Intron	INS	-	T	T	rs71808331		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233475232_233475233insT	uc001hvt.3	+						KIAA1804_uc001hvs.1_Intron	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4						activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				tcttcttcttcttttttttttt	0.000													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234122521	234122521	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234122521delT	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			tttctttcacttttttatttc	0.000													4	2	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242483137	242483137	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242483137delC	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			tgtgactattcctctaccccc	0.000													3	3	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242483197	242483197	+	Intron	DEL	G	-	-	rs143136811		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242483197delG	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			agactaaaaaggatgcaacct	0.000													4	3	---	---	---	---	
SCCPDH	51097	broad.mit.edu	37	1	246910300	246910300	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246910300delC	uc001ibr.2	+							NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	saccharopine dehydrogenase (putative)							midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		ATGCTTGggacccttggtagc	0.184													4	2	---	---	---	---	
ZNF124	7678	broad.mit.edu	37	1	247330647	247330647	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247330647delG	uc001ick.2	-						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Intron	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			GCAGGCAACAGAAAACAGCAC	0.264													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186057	186057	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186057delA								FAM110C (139672 upstream) : SH3YL1 (32081 downstream)																							cctaaagacTAAAAAAAAAAG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3872289	3872290	+	IGR	INS	-	C	C	rs138550624	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3872289_3872290insC								ALLC (122031 upstream) : None (None downstream)																							aggtttctcttccccccgaccc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6177357	6177357	+	IGR	DEL	C	-	-	rs73910920		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6177357delC								LOC400940 (48993 upstream) : CMPK2 (803146 downstream)																							CCATGGCCCACCCCCCTCTCA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8604464	8604464	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8604464delA								LOC339788 (487487 upstream) : ID2 (214876 downstream)																							tgtatgtcagaaaaaaaaaaa	0.134													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28298426	28298427	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28298426_28298427delTG	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					tctctgtgcatgtgtgtgtgtg	0.238													4	2	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33219037	33219038	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33219037_33219038delGT	uc002ros.2	+							NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AGTTAGGGGAgtgtgtgtgtgt	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34895462	34895463	+	IGR	DEL	AG	-	-	rs145273724		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34895462_34895463delAG								MYADML (942178 upstream) : None (None downstream)																							tgccgctcctagagagactcct	0.000													2	4	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	46075449	46075450	+	Intron	INS	-	T	T	rs145627400	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46075449_46075450insT	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TTAGCAATTCAttttttttttc	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	53091806	53091807	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53091806_53091807delTG								None (None upstream) : ASB3 (805311 downstream)																							ATACATATACtgtgtgtgtgtg	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	53183177	53183177	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53183177delC								None (None upstream) : ASB3 (713941 downstream)																							GGATGAAGGACCTCCAGGAGT	0.418													3	3	---	---	---	---	
CCDC85A	114800	broad.mit.edu	37	2	56500080	56500080	+	Intron	DEL	G	-	-	rs60525863		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56500080delG	uc002rzn.2	+							NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			attggaaaaagaaaaagagag	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59133548	59133549	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59133548_59133549insA	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																		GGGAAAGCAGTAAAAAAGAGAA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60300666	60300667	+	IGR	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60300666_60300667delCA								None (None upstream) : BCL11A (377636 downstream)																							AACGTacatgcacacacacaca	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65129351	65129352	+	IGR	INS	-	TCTT	TCTT	rs144530372	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65129351_65129352insTCTT								SERTAD2 (248305 upstream) : SLC1A4 (86227 downstream)																							ctccctctctctctctcttctt	0.035													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66725151	66725151	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66725151delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						AAAACAATAGAAAAAAAATGG	0.423													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67242790	67242791	+	IGR	INS	-	A	A	rs72016776		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67242790_67242791insA								MEIS1 (442900 upstream) : ETAA1 (381651 downstream)																							AAATTCTAGTGAAAAAAAAAAA	0.342													4	2	---	---	---	---	
SFXN5	94097	broad.mit.edu	37	2	73240536	73240537	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73240536_73240537delGT	uc002siq.2	-						SFXN5_uc002sio.2_Intron|SFXN5_uc010yrc.1_Intron|SFXN5_uc002sip.2_Intron|SFXN5_uc010fet.2_Intron	NM_144579	NP_653180	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity			ovary(1)	1						gggatatttcgtgtgtgtgtgt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	75050458	75050458	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75050458delC								SEMA4F (141273 upstream) : HK2 (9324 downstream)																							CAACAGATCTCCCAAACTCTG	0.313													4	2	---	---	---	---	
REG1P	5969	broad.mit.edu	37	2	79362646	79362647	+	RNA	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79362646_79362647insT	uc002soa.1	-	4		c.1667_1668insA			REG1P_uc002sob.1_RNA|REG1P_uc002soc.1_RNA					Homo sapiens mRNA for Reg-related sequence derived peptide-1, complete cds.												0						AAACATGTTTATTTTTATTGTT	0.426													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79467063	79467063	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79467063delT	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						tttttctttcttttttttttt	0.154													4	3	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80037652	80037653	+	Intron	INS	-	T	T	rs111426628		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80037652_80037653insT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CTTTTCTTTTCttttttttttt	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81086360	81086360	+	IGR	DEL	G	-	-	rs72274524		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81086360delG								CTNNA2 (210456 upstream) : None (None downstream)																							atataagggtgggggggggca	0.000													4	2	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85790916	85790916	+	5'Flank	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85790916delA	uc002sps.2	-						GGCX_uc010yst.1_5'Flank	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	actccatctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91662603	91662604	+	IGR	DEL	TC	-	-	rs140819896		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91662603_91662604delTC								None (None upstream) : LOC654342 (142588 downstream)																							atgcatttcttctctttataat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91670666	91670666	+	IGR	DEL	T	-	-	rs112647915		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91670666delT								None (None upstream) : LOC654342 (134526 downstream)																							CCGCCGCGGCTTTTTTTGCCT	0.677													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91768879	91768879	+	IGR	DEL	T	-	-	rs71250098		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91768879delT								None (None upstream) : LOC654342 (36313 downstream)																							AGTATACATATTTTTTTTCTG	0.239													2	5	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91810712	91810713	+	Intron	INS	-	T	T	rs139062859	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91810712_91810713insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						TAAATACAAAGTTTTTTTTAAC	0.252													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96625520	96625522	+	Intron	DEL	AAC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96625520_96625522delAAC	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		ACTAACTGATAACAACAAAACAT	0.335													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102177230	102177233	+	IGR	DEL	ACAT	-	-	rs10595170	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102177230_102177233delACAT								RFX8 (86065 upstream) : MAP4K4 (137255 downstream)																							acacacacacacatgcaggacact	0.000													4	2	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111657794	111657795	+	Intron	INS	-	T	T	rs148908980	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111657794_111657795insT	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						GTAGAAGAGACTTTAACCCTGA	0.322													4	2	---	---	---	---	
IL1F7	27178	broad.mit.edu	37	2	113668675	113668675	+	5'Flank	DEL	T	-	-	rs68104898		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113668675delT	uc002tij.2	+						IL1F7_uc002tik.2_5'Flank|IL1F7_uc002til.2_5'Flank|IL1F7_uc002tim.2_5'Flank	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN	interleukin 1 family, member 7 isoform 1						immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding				0						AAAGGAATACTTGTGTTGTAT	0.398													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114918640	114918641	+	IGR	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114918640_114918641delCA								ACTR3 (202473 upstream) : DPP10 (281258 downstream)																							ctctctGTGTcacacacacaca	0.188													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121085783	121085783	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121085783delT								RALB (33500 upstream) : INHBB (17936 downstream)																							AAATACATGGTTTTAACGAAA	0.418													4	2	---	---	---	---	
FAM168B	130074	broad.mit.edu	37	2	131832418	131832418	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131832418delC	uc002tsd.2	-							NM_001009993	NP_001009993	A1KXE4	F168B_HUMAN	hypothetical protein LOC130074												0						TGCTCTATTGCCCTGCATCCC	0.542													4	2	---	---	---	---	
C2orf27A	29798	broad.mit.edu	37	2	132483726	132483726	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132483726delA	uc002ttf.1	+							NM_013310	NP_037442	Q580R0	CB027_HUMAN	hypothetical protein LOC29798												0						TTGAAAAGAGAAACCAAGCTA	0.343													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132981968	132981969	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981968_132981969insA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						tttcatagagccttttgaaaca	0.000													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133011732	133011733	+	Intron	DEL	CG	-	-	rs72367582		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133011732_133011733delCG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						CACGCACACACGGTTTCATCCC	0.658													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133046453	133046454	+	IGR	INS	-	GACA	GACA	rs146739177		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133046453_133046454insGACA								NCRNA00164 (30911 upstream) : GPR39 (127693 downstream)																							CAAACCAATGTGACAGACAGAG	0.386													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133063665	133063665	+	Intron	DEL	T	-	-	rs112256640		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133063665delT	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																		GAATGCTCTCTGTATATTTGA	0.338													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134405321	134405322	+	IGR	INS	-	AGG	AGG	rs56187134		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134405321_134405322insAGG								NCKAP5 (79290 upstream) : MGAT5 (606508 downstream)																							ggaaggaaggaaagaaaagaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134746154	134746154	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134746154delT								NCKAP5 (420123 upstream) : MGAT5 (265676 downstream)																							tctctcctcctttgagtttcc	0.000													4	2	---	---	---	---	
MBD5	55777	broad.mit.edu	37	2	149028284	149028284	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149028284delT	uc002twm.3	+							NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGACTTTCAATTTTTTTTTTG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154229647	154229650	+	IGR	DEL	TGTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154229647_154229650delTGTG								ARL6IP6 (611880 upstream) : RPRM (104202 downstream)																							tctgttgCTTtgtgtgtgtgtgtg	0.132													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162323687	162323687	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162323687delT								TBR1 (42114 upstream) : SLC4A10 (157158 downstream)																							tctttctttctttttttttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164171179	164171179	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164171179delC								KCNH7 (475939 upstream) : FIGN (292939 downstream)																							ATGTTTCTCTCCATCCAAAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164319378	164319379	+	IGR	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164319378_164319379delGT								KCNH7 (624138 upstream) : FIGN (144739 downstream)																							GATTTTGTGGGTGTGTGTGTGT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	169141802	169141805	+	IGR	DEL	CAGT	-	-	rs71958689		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169141802_169141805delCAGT								STK39 (37697 upstream) : LASS6 (171030 downstream)																							tccaaaactgcagtcagtcacctg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	169907874	169907874	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169907874delC								ABCB11 (20041 upstream) : DHRS9 (13425 downstream)																							tcatggcagacctaatacact	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177057348	177057348	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177057348delA								HOXD1 (1713 upstream) : MTX2 (76775 downstream)																							CAACAACAACAAAATACCAAC	0.408													4	2	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183075626	183075626	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183075626delT	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Intron|PDE1A_uc002uou.2_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			gggtaatttatcaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	193364848	193364850	+	IGR	DEL	AAC	-	-	rs112943040	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193364848_193364850delAAC								TMEFF2 (305204 upstream) : PCGEM1 (249721 downstream)																							AGCCAAACTAaacaacaacaaca	0.222													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	225572192	225572193	+	IGR	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225572192_225572193delCT								CUL3 (122082 upstream) : DOCK10 (57614 downstream)																							tcaggactcactctctctctcc	0.000													4	2	---	---	---	---	
RHBDD1	84236	broad.mit.edu	37	2	227846285	227846286	+	Intron	INS	-	AC	AC	rs147050960	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227846285_227846286insAC	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		tgcacacacatacacacacaca	0.218													5	3	---	---	---	---	
SP110	3431	broad.mit.edu	37	2	231067720	231067720	+	Intron	DEL	C	-	-	rs2303540	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231067720delC	uc002vqh.3	-						SP110_uc002vqg.3_Intron|SP110_uc002vqi.3_Intron|SP110_uc010fxk.2_Intron|SP110_uc010fxj.2_Intron	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		GAGCTTATTTCCTGATTTTCG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232444426	232444428	+	IGR	DEL	CAT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232444426_232444428delCAT								NMUR1 (49244 upstream) : C2orf57 (13184 downstream)																							tcattatcaccatcatcatcatc	0.000													4	2	---	---	---	---	
INPP5D	3635	broad.mit.edu	37	2	233927696	233927696	+	Intron	DEL	A	-	-	rs77302582		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233927696delA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		gaagggcattaaaaaaaaaaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238855171	238855171	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238855171delA								RAMP1 (34418 upstream) : UBE2F (20529 downstream)																							atgaaagaagaaaaaaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242930542	242930542	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242930542delG								C2orf85 (115060 upstream) : LOC728323 (100302 downstream)																							CGAGGCAGGAGGGGCCTCTTG	0.592													4	2	---	---	---	---	
SUMF1	285362	broad.mit.edu	37	3	4497607	4497607	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4497607delA	uc003bpz.1	-						SUMF1_uc003bps.1_Intron|SUMF1_uc011ass.1_Intron|SUMF1_uc010hby.1_Intron|SUMF1_uc011ast.1_Intron	NM_182760	NP_877437	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		ctactagaagaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8343429	8343430	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8343429_8343430insA	uc003bqp.2	-											Homo sapiens cDNA FLJ42094 fis, clone TESOP2002489.																		ccccatctctcaaaaaaaaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24029512	24029514	+	IGR	DEL	TTC	-	-	rs34208127		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24029512_24029514delTTC								NR1D2 (7403 upstream) : LOC152024 (108266 downstream)																							cttcctttctttctccttccttc	0.054													6	4	---	---	---	---	
TRIM71	131405	broad.mit.edu	37	3	32926033	32926033	+	Intron	DEL	A	-	-	rs111787826		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32926033delA	uc003cff.2	+							NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						tctctatttgaaaaaaaaaaa	0.010													0	6	---	---	---	---	
MYRIP	25924	broad.mit.edu	37	3	40060389	40060389	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40060389delC	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		ATACCAGAAACCCCACTTCCA	0.378													4	2	---	---	---	---	
MST1R	4486	broad.mit.edu	37	3	49928163	49928163	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49928163delT	uc003cxy.3	-						MST1R_uc011bdc.1_Intron	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor						cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CCTTACAGAAttttttttttt	0.274													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	50353061	50353061	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50353061delC								HYAL1 (3249 upstream) : HYAL2 (2167 downstream)																							GGGGGACAGGCCACAGCTCCT	0.443													3	4	---	---	---	---	
FLNB	2317	broad.mit.edu	37	3	58109431	58109432	+	Intron	DEL	AA	-	-	rs11313721		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58109431_58109432delAA	uc003djj.2	+						FLNB_uc010hne.2_Intron|FLNB_uc003djk.2_Intron|FLNB_uc010hnf.2_Intron|FLNB_uc003djl.2_Intron|FLNB_uc003djm.2_Intron	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2						actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGTTTCATTTaaaaaaaaaaaa	0.490													9	4	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60675733	60675734	+	Intron	INS	-	TTG	TTG			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60675733_60675734insTTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		actgaattcttTTGTTGTTGTT	0.178			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	61066506	61066506	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61066506delA	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		CCACAGCAGGAAAAAAAAAAA	0.448			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	64707672	64707673	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64707672_64707673insA	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																		TATAGTAATGGAAAAAAAAAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	65272402	65272402	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65272402delA								ADAMTS9 (599037 upstream) : MAGI1 (67505 downstream)																							TCTCTGGAGGAAAAAAATGAC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	67247437	67247438	+	IGR	INS	-	G	G	rs138991838	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67247437_67247438insG								KBTBD8 (185807 upstream) : SUCLG2 (177707 downstream)																							ttggtatccccccccttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70446467	70446467	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70446467delT								MITF (428981 upstream) : FOXP1 (558270 downstream)																							cttctttttgtttttttggga	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87344770	87344771	+	IGR	INS	-	AC	AC	rs141573615	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87344770_87344771insAC								POU1F1 (19033 upstream) : HTR1F (686955 downstream)																							ggctctttaaaacaactcagtg	0.000													4	2	---	---	---	---	
CGGBP1	8545	broad.mit.edu	37	3	88104473	88104473	+	3'UTR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88104473delT	uc003dqs.2	-	4					CGGBP1_uc003dqt.2_3'UTR|CGGBP1_uc003dqu.2_3'UTR	NM_001008390	NP_001008391	Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		AGTGAGGTGGTTTTTTTTTTG	0.328													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	89146987	89146987	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89146987delT								C3orf38 (939874 upstream) : EPHA3 (9687 downstream)																							TTTTCTTATGTTTGGCATATT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94346645	94346646	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94346645_94346646insT								NSUN3 (501015 upstream) : LOC255025 (310461 downstream)																							ttctttctttctttttcttttc	0.054													3	4	---	---	---	---	
LOC255025	255025	broad.mit.edu	37	3	94890189	94890189	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94890189delT	uc003drn.2	+											Homo sapiens hypothetical protein LOC255025, mRNA (cDNA clone IMAGE:5267157).												0						TTCTTCCCACttttttttttt	0.234													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98065264	98065265	+	IGR	INS	-	A	A	rs141316912	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98065264_98065265insA								OR5H2 (62588 upstream) : OR5K4 (7433 downstream)																							ctatttaacatatactaagccc	0.000													1	6	---	---	---	---	
ST3GAL6	10402	broad.mit.edu	37	3	98482578	98482578	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98482578delA	uc003dsz.2	+						ST3GAL6_uc003dsy.2_Intron|ST3GAL6_uc003dta.2_Intron|ST3GAL6_uc003dtb.2_Intron|ST3GAL6_uc003dtc.2_Intron|ST3GAL6_uc010hpd.2_Intron	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI						amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						CCTAGTGACtaaaaaaaaaaa	0.443													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98863809	98863810	+	IGR	INS	-	TA	TA	rs2682408		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98863809_98863810insTA								DCBLD2 (243276 upstream) : COL8A1 (493644 downstream)																							gtgtgtgtgtgtgtgtgtgtgt	0.342													2	4	---	---	---	---	
FILIP1L	11259	broad.mit.edu	37	3	99704438	99704439	+	Intron	INS	-	T	T	rs63477861		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99704438_99704439insT	uc003dtm.2	-						C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						ATGAGAAAAGCttttttttttt	0.129													3	3	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100657144	100657145	+	Intron	INS	-	AA	AA	rs138335495		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100657144_100657145insAA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						acctaaaagttaaaaaaaaAAA	0.158													5	3	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100702325	100702325	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100702325delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						TGTTTTTCTTAACAGATTACA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105046935	105046936	+	IGR	INS	-	A	A	rs146290321	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105046935_105046936insA								None (None upstream) : ALCAM (38777 downstream)																							cactgggaaacaaaaaaaaaat	0.000													4	2	---	---	---	---	
GRAMD1C	54762	broad.mit.edu	37	3	113590603	113590604	+	Intron	INS	-	AC	AC	rs13098437		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113590603_113590604insAC	uc003eaq.3	+						GRAMD1C_uc011bil.1_Intron|GRAMD1C_uc011bim.1_Intron	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C							integral to membrane				ovary(2)|skin(1)	3						aaaaaaaaaaaaaaaaaaaaac	0.000													3	4	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119108997	119108997	+	Intron	DEL	A	-	-	rs150885613		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119108997delA	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TCCATTCTTTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	121757971	121757971	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121757971delA								ILDR1 (16941 upstream) : CD86 (16250 downstream)																							caagtgatataacatacacgt	0.000													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124134054	124134054	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124134054delT	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron|KALRN_uc003ehh.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GTctggggactttttttttaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127257617	127257618	+	5'Flank	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127257617_127257618delCA	uc003ejk.2	-											Homo sapiens cDNA FLJ25806 fis, clone TST07194.																		ggtgcaggtgcaCACACACACA	0.361													4	2	---	---	---	---	
PODXL2	50512	broad.mit.edu	37	3	127386945	127386946	+	Intron	DEL	GT	-	-	rs71615942		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127386945_127386946delGT	uc003ejq.2	+							NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor						leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						ACATGGCtgcgtgtgtgtgtgt	0.455													4	3	---	---	---	---	
EEFSEC	60678	broad.mit.edu	37	3	127948959	127948959	+	Intron	DEL	C	-	-	rs34834087		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127948959delC	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						TTCATTCATTCTTtctctccc	0.085													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128194213	128194213	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128194213delG								DNAJB8 (8122 upstream) : GATA2 (4052 downstream)																							CTGGGTCACCGGGGGGCAGGA	0.587													4	2	---	---	---	---	
TF	7018	broad.mit.edu	37	3	133466777	133466777	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133466777delA	uc003epu.1	+						TF_uc011bls.1_Intron|TF_uc011blt.1_Intron|TF_uc003epw.1_Intron|TF_uc010htv.1_Intron|TF_uc003epv.1_Intron	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	accttgggttaaaaaaaaaaa	0.045													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133507483	133507483	+	IGR	DEL	C	-	-	rs33998685		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133507483delC								TF (9848 upstream) : SRPRB (17194 downstream)																							gggaatctctccctctgtctc	0.030													2	4	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134817952	134817954	+	Intron	DEL	TTA	-	-	rs67385104		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134817952_134817954delTTA	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron|EPHB1_uc003equ.2_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						tttgttgttgttattattattat	0.167													2	4	---	---	---	---	
DZIP1L	199221	broad.mit.edu	37	3	137811006	137811007	+	Intron	INS	-	TAAC	TAAC	rs140644204	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137811006_137811007insTAAC	uc003erq.2	-						DZIP1L_uc003err.1_Intron	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						catgaggaggttaactcattca	0.089													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138645354	138645355	+	IGR	DEL	AA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138645354_138645355delAA								PIK3CB (167169 upstream) : FOXL2 (17712 downstream)																							acacacacacaaacacacgaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138719178	138719179	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138719178_138719179insT								C3orf72 (46348 upstream) : PRR23A (3626 downstream)																							cctctgggtacttttttttttt	0.000													3	4	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	139676333	139676334	+	Intron	INS	-	T	T	rs148941257		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139676333_139676334insT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GTAATCTTTACTTTTTTTTTTT	0.198										HNSCC(16;0.037)			2	4	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140235946	140235946	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140235946delT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						tttcttctacttgttccattc	0.000										HNSCC(16;0.037)			3	3	---	---	---	---	
GRK7	131890	broad.mit.edu	37	3	141509088	141509088	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141509088delC	uc011bnd.1	+							NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor						visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						gatctgcatgcctcggcctcc	0.075													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143378101	143378101	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143378101delA	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						ATGGGTCACCAAAAAAAATCA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144616839	144616839	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144616839delG								C3orf58 (905630 upstream) : None (None downstream)																							AATTTCCAATGGGAAGGGTCA	0.313													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145602960	145602961	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145602960_145602961delAG								None (None upstream) : PLOD2 (184267 downstream)																							ACTGGAGTGAAGAGGCTAACCA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146101167	146101168	+	IGR	INS	-	T	T	rs150432505	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146101167_146101168insT								PLSCR4 (132201 upstream) : PLSCR2 (49914 downstream)																							ttgatcatctatttttttttta	0.050													0	6	---	---	---	---	
PLSCR2	57047	broad.mit.edu	37	3	146178526	146178526	+	Intron	DEL	C	-	-	rs112384089		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146178526delC	uc003evv.1	-						PLSCR2_uc003evw.1_Intron	NM_020359	NP_065092	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0						taattatccaccccaaaatac	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146446477	146446477	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146446477delT								PLSCR5 (122474 upstream) : ZIC4 (657360 downstream)																							atccagtagcttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149446306	149446307	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149446306_149446307insT								WWTR1 (25191 upstream) : COMMD2 (9953 downstream)																							AGGAAGGGGACttttttttttt	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149975577	149975578	+	IGR	INS	-	A	A	rs139499070		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149975577_149975578insA								PFN2 (286836 upstream) : TSC22D2 (151210 downstream)																							atctctgtctcaaaaaaaaaaa	0.193													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151212081	151212081	+	IGR	DEL	T	-	-	rs145383616		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151212081delT								IGSF10 (35584 upstream) : AADACL2 (239623 downstream)																							GAAACAATGATTTTTCAACAT	0.303													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152638358	152638359	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152638358_152638359delAC								P2RY1 (82517 upstream) : RAP2B (241670 downstream)																							gtgtgtgtatacacacacacac	0.000													4	3	---	---	---	---	
RAP2B	5912	broad.mit.edu	37	3	152883481	152883482	+	3'UTR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152883481_152883482insT	uc003ezr.2	+	1						NM_002886	NP_002877	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family precursor						Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity			lung(2)	2			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TCCTACTGCCATTTTTTTTTTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155658529	155658530	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155658529_155658530insT								GMPS (3011 upstream) : KCNAB1 (179807 downstream)																							GCTGGATAGTGTTTTTTTTTTT	0.277													4	2	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	156128157	156128157	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156128157delA	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Intron|KCNAB1_uc010hvt.1_Intron	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ttccaaaattatttgtcaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156331639	156331639	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156331639delC								SSR3 (58704 upstream) : LOC100287227 (59325 downstream)																							TCATGTTTTTCCCAAAAAAAG	0.274													4	2	---	---	---	---	
LEKR1	389170	broad.mit.edu	37	3	156724661	156724661	+	Intron	DEL	A	-	-	rs34626361		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156724661delA	uc003fba.1	+							NM_001004316	NP_001004316	Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1												0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			aaaccaaagtattgattgcct	0.080													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157456482	157456483	+	IGR	INS	-	A	A	rs149814791		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157456482_157456483insA								C3orf55 (137463 upstream) : SHOX2 (357318 downstream)																							gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	160464059	160464060	+	IGR	DEL	AG	-	-	rs34676301		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160464059_160464060delAG								ARL14 (67826 upstream) : PPM1L (9936 downstream)																							tgccattTTCagagagagagag	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161522170	161522171	+	IGR	INS	-	A	A	rs144254568	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161522170_161522171insA								OTOL1 (300442 upstream) : None (None downstream)																							AACACAGAATTAAAAAAACAAA	0.376													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162169068	162169069	+	IGR	INS	-	AA	AA	rs67944544		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162169068_162169069insAA								OTOL1 (947340 upstream) : None (None downstream)																							cattccaaaggaaaaaaaaaaa	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163022587	163022588	+	5'Flank	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163022587_163022588delAG	uc003feh.2	-											Homo sapiens hypothetical protein LOC647107, mRNA (cDNA clone IMAGE:5103171), partial cds.																		ctcagaacaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164184526	164184527	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164184526_164184527insT								MIR720 (125288 upstream) : SI (512160 downstream)																							agctaattatgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164541224	164541225	+	IGR	DEL	GT	-	-	rs72050433		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164541224_164541225delGT								MIR720 (481986 upstream) : SI (155462 downstream)																							gtgtatgtgcgtgtgtgtgtgt	0.332													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166386389	166386390	+	IGR	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166386389_166386390delTC								BCHE (831136 upstream) : ZBBX (571691 downstream)																							CTCCTTACCATCTTCTCCTTAT	0.371													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166590482	166590483	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166590482_166590483insA								None (None upstream) : ZBBX (367598 downstream)																							ggagacctttgcagcagcattc	0.000													5	4	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170970911	170970911	+	Intron	DEL	A	-	-	rs67810495		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170970911delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			taaaggtaccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170972494	170972494	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170972494delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GCTAACATATAAGGGCTAAAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171611486	171611493	+	IGR	DEL	CTCACACA	-	-	rs71178244		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171611486_171611493delCTCACACA								TMEM212 (34378 upstream) : FNDC3B (145925 downstream)																							CTCTCTCTCTCTcacacacacacacaca	0.322													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172992494	172992494	+	IGR	DEL	C	-	-	rs79222726		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172992494delC								SPATA16 (133462 upstream) : NLGN1 (123750 downstream)																							aacaaacaaacaaaaacatgt	0.000													5	12	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	174968043	174968046	+	Intron	DEL	TGTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174968043_174968046delTGTG	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		tcactttttctgtgtgtgtgtgtg	0.000													6	3	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175277217	175277218	+	Intron	INS	-	T	T	rs140065368	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175277217_175277218insT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		gatgccctttatttttttctct	0.000													3	4	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175415188	175415189	+	Intron	INS	-	AC	AC	rs145230652	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175415188_175415189insAC	uc003fit.2	+							NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		GCTGcacacagacacacacaca	0.297													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	175535130	175535131	+	IGR	INS	-	A	A	rs79882271		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175535130_175535131insA								NAALADL2 (11704 upstream) : None (None downstream)																							gactccatctcaaaaaaaaaaa	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177360790	177360791	+	IGR	INS	-	A	A	rs147543862	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177360790_177360791insA								TBL1XR1 (445742 upstream) : KCNMB2 (893433 downstream)																							GTAAAAGCCACAAAAATAACAG	0.386													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178196249	178196249	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178196249delA								None (None upstream) : KCNMB2 (57975 downstream)																							taagtcagggaaggttttgta	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180189309	180189309	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180189309delA								PEX5L (434792 upstream) : TTC14 (130609 downstream)																							aaaagaaaacaaaaaaaaaag	0.000													4	2	---	---	---	---	
FXR1	8087	broad.mit.edu	37	3	180682810	180682810	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180682810delT	uc003fkq.2	+						FXR1_uc003fkp.2_Intron|FXR1_uc003fkr.2_Intron|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_Intron|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Intron	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1						apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GTTTTGTTACttttttttttt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181503379	181503388	+	IGR	DEL	TTTTTTTTTT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181503379_181503388delTTTTTTTTTT								SOX2OT (44376 upstream) : None (None downstream)																							TGGCATCTCCtttttttttttttttttttt	0.210													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182416651	182416651	+	IGR	DEL	A	-	-	rs113327878		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182416651delA								SOX2OT (957648 upstream) : ATP11B (94640 downstream)																							ctaaaaatacaaaaaaaaaaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183778476	183778479	+	IGR	DEL	GTTT	-	-	rs111532443		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183778476_183778479delGTTT								HTR3C (17 upstream) : HTR3E (36373 downstream)																							TGGCTCTTCAgtttgtttgtttgt	0.235													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184335365	184335367	+	IGR	DEL	AAG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184335365_184335367delAAG								EPHB3 (35170 upstream) : MAGEF1 (92789 downstream)																							tgagaaaagaaagaagaagaggg	0.005													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185589861	185589861	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185589861delA								IGF2BP2 (47034 upstream) : TRA2B (42499 downstream)																							cccagtctctaaaaaaaatac	0.000													4	2	---	---	---	---	
KNG1	3827	broad.mit.edu	37	3	186444809	186444810	+	Intron	INS	-	TG	TG	rs139519865	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186444809_186444810insTG	uc011bsa.1	+						KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	CTAGCGgtgtatgtgtgtgtgt	0.243													4	3	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186703562	186703563	+	Intron	INS	-	A	A	rs74594138		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186703562_186703563insA	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		gaccctgtctcaaaaaaaaaaa	0.198													2	4	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188250211	188250214	+	Intron	DEL	TCAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188250211_188250214delTCAA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		aaactctgtctcaatcaatcaatc	0.127			T	HMGA2|MLL|C12orf9	lipoma|leukemia								6	3	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188987807	188987818	+	Intron	DEL	TCTTCTTCTTCT	-	-	rs143941879		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188987807_188987818delTCTTCTTCTTCT	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CTTCTCTGGAtcttcttcttcttcttcttctt	0.307													4	3	---	---	---	---	
CLDN16	10686	broad.mit.edu	37	3	190108326	190108328	+	Intron	DEL	AAG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190108326_190108328delAAG	uc003fsi.2	+						CLDN16_uc010hze.2_Intron	NM_006580	NP_006571	Q9Y5I7	CLD16_HUMAN	claudin 16						calcium-independent cell-cell adhesion|cellular metal ion homeostasis|excretion	integral to membrane|tight junction	identical protein binding|magnesium ion transmembrane transporter activity|structural molecule activity			ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		catcttaaaaaagaagaagaaga	0.133													1	5	---	---	---	---	
CCDC50	152137	broad.mit.edu	37	3	191053921	191053922	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191053921_191053922insT	uc003fsw.2	+						CCDC50_uc003fsv.2_Intron	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform							cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		gtgtacaagtgttttttttttt	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193842837	193842838	+	IGR	DEL	GA	-	-	rs10567370		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193842837_193842838delGA								LOC100128023 (130810 upstream) : HES1 (11096 downstream)																							tttttttgtggagagatgggat	0.000													1	5	---	---	---	---	
TNK2	10188	broad.mit.edu	37	3	195614717	195614722	+	Intron	DEL	GTGTGC	-	-	rs61007721		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195614717_195614722delGTGTGC	uc003fvu.1	-						TNK2_uc003fvs.1_Intron|TNK2_uc003fvt.1_Intron|TNK2_uc010hzw.1_Intron|TNK2_uc003fvv.1_5'Flank|TNK2_uc010hzx.1_Intron	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1						positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	gtgtgtgtgtgtgtgcgtgtctgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195963973	195963974	+	RNA	INS	-	AG	AG	rs147293878	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195963973_195963974insAG	uc003fwf.1	-	1		c.812_813insCT								Homo sapiens full length insert cDNA clone ZD56D02.																		ACAGTCCTAGCAGAGGCAAGGA	0.480													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196072073	196072079	+	IGR	DEL	CTGGAGT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196072073_196072079delCTGGAGT								TM4SF19 (6815 upstream) : UBXN7 (8292 downstream)																							gtccctcaggctggagtctggagtcca	0.014													6	4	---	---	---	---	
SENP5	205564	broad.mit.edu	37	3	196615455	196615455	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196615455delA	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		actctctcacaaaaaaaaaag	0.119													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196722228	196722229	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196722228_196722229delAG								PIGZ (26524 upstream) : MFI2 (7928 downstream)																							acgcagacacagacacacacag	0.000													2	5	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196781300	196781301	+	Intron	INS	-	TTTCTCTG	TTTCTCTG	rs138514079	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196781300_196781301insTTTCTCTG	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ttcttcagtcatttctctgttt	0.000													4	6	---	---	---	---	
EVC	2121	broad.mit.edu	37	4	5777180	5777180	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5777180delT	uc003gil.1	+						EVC_uc003gim.1_Intron|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein						muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)				cctagtttgatttacagttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	6737562	6737563	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6737562_6737563insA								CNO (18175 upstream) : KIAA0232 (46896 downstream)																							cccagtctctgaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9240400	9240400	+	5'Flank	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9240400delG	uc011bwo.1	+											RecName: Full=Ubiquitin carboxyl-terminal hydrolase 17-like protein 2;          EC=3.1.2.15; AltName: Full=Ubiquitin thioesterase 17-like protein 2; AltName: Full=Ubiquitin-specific-processing protease 17-like protein 2; AltName: Full=Deubiquitinating enzyme 17-like protein 2; AltName: Full=Deubiquitinating protein 3;          Short=DUB-3;																		acacacacacgccccccccac	0.303													4	2	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16534976	16534976	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16534976delA	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						gcaaaaatggaaataataata	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25298293	25298294	+	IGR	DEL	TG	-	-	rs111547613		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25298293_25298294delTG								PI4K2B (17462 upstream) : ZCCHC4 (16102 downstream)																							agctcacttttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26509136	26509139	+	IGR	DEL	GGAT	-	-	rs5856947		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26509136_26509139delGGAT								CCKAR (17094 upstream) : TBC1D19 (76407 downstream)																							aaggatggagggatggatggatgg	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33251499	33251499	+	IGR	DEL	T	-	-	rs33946898		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33251499delT								None (None upstream) : None (None downstream)																							GATTATGTTATTTTTTCTCCC	0.214													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33842579	33842579	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33842579delA								None (None upstream) : None (None downstream)																							TAAAAGACATAAATAGAAGTA	0.343													4	2	---	---	---	---	
C4orf19	55286	broad.mit.edu	37	4	37544827	37544827	+	Intron	DEL	T	-	-	rs35234281		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37544827delT	uc003gsw.3	+							NM_001104629	NP_001098099	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286												0						ctttggtgggtttttttccat	0.239													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49158809	49158809	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49158809delT								CWH43 (94716 upstream) : None (None downstream)																							aatctttccattttttttgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49213584	49213585	+	IGR	INS	-	A	A	rs141768505		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49213584_49213585insA								CWH43 (149491 upstream) : None (None downstream)																							gggacttgcttaaaaaaaagtc	0.000													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49317222	49317225	+	IGR	DEL	TGTG	-	-	rs60515316		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49317222_49317225delTGTG								CWH43 (253129 upstream) : None (None downstream)																							tctgtctgtctgtgtgtctgtctC	0.319													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	63402902	63402902	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63402902delC								LPHN3 (464735 upstream) : None (None downstream)																							ACTTACCCAGCCAAGGAAAAC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70013062	70013062	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70013062delC								UGT2B7 (34358 upstream) : UGT2B11 (52991 downstream)																							TTACCTACTTCTTTTTAATGA	0.323													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84980656	84980659	+	Intron	DEL	AGTC	-	-	rs139604158		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84980656_84980659delAGTC	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		gttggggcagagtcagtcctatgt	0.000													3	3	---	---	---	---	
PKD2	5311	broad.mit.edu	37	4	88940482	88940482	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88940482delA	uc003hre.2	+							NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2							basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		AAATGTGATTAAAAAAAAAAA	0.308													4	2	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	110128418	110128419	+	Intron	DEL	TA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110128418_110128419delTA	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TCACTGTGTGTATATGTGATAC	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	110654614	110654614	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110654614delT								PLA2G12A (3372 upstream) : CFI (7236 downstream)																							AGAGAGTGGCTAGCTTGTCTA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111141108	111141108	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111141108delT								ELOVL6 (21288 upstream) : ENPEP (256121 downstream)																							TTCACATGTCttttttttttc	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	113652295	113652295	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113652295delA								LARP7 (73554 upstream) : ANK2 (86944 downstream)																							gactctgtctaaaaaaaaaag	0.000													4	2	---	---	---	---	
CAMK2D	817	broad.mit.edu	37	4	114610859	114610859	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114610859delC	uc003ibi.2	-						CAMK2D_uc003ibj.2_Intron|CAMK2D_uc003ibk.2_Intron|CAMK2D_uc003ibo.3_Intron|CAMK2D_uc003ibm.2_Intron|CAMK2D_uc003ibn.2_Intron|CAMK2D_uc003ibl.2_Intron	NM_001221	NP_001212	Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|regulation of cell growth|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		ctttctcaagcagccccacta	0.000													4	2	---	---	---	---	
CEP170L	645455	broad.mit.edu	37	4	119436576	119436577	+	5'Flank	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119436576_119436577insT	uc003icb.2	+							NR_003135				RecName: Full=Cep170-like protein;												0						TTGGGGGCTCCTTTTTTTTTTT	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	119771680	119771681	+	IGR	INS	-	AA	AA	rs140393395	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119771680_119771681insAA								SEC24D (11853 upstream) : SYNPO2 (38315 downstream)																							CGATAATATAGAAAAAAAAACA	0.411													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	172298864	172298865	+	IGR	DEL	AC	-	-	rs112676333		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172298864_172298865delAC								None (None upstream) : GALNTL6 (435710 downstream)																							AAATTTATTTacacacacacac	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181494980	181494983	+	IGR	DEL	AAAC	-	-	rs142993932		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181494980_181494983delAAAC								None (None upstream) : None (None downstream)																							CAATAAATTAaaacaaacaaacaa	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	183744297	183744297	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183744297delG								ODZ3 (20120 upstream) : DCTD (66948 downstream)																							GGTGCCTATTGCATGCTGGAC	0.109													4	2	---	---	---	---	
CYP4V2	285440	broad.mit.edu	37	4	187123974	187123975	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187123974_187123975delAC	uc003iyw.3	+						CYP4V2_uc010ism.2_5'Flank	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		acacaaatatacacacacaccc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190555360	190555378	+	IGR	DEL	CTGGGTGACCCATTTGTGG	-	-	rs140577538	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190555360_190555378delCTGGGTGACCCATTTGTGG								None (None upstream) : FRG1 (306596 downstream)																							tgtgggtagcctgggtgacccatttgtggctggcatctg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190767395	190767395	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190767395delC								None (None upstream) : FRG1 (94579 downstream)																							ATTCTCCGTGCCGTGTCCCTC	0.647													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1047962	1047965	+	IGR	DEL	TGAG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1047962_1047965delTGAG								NKD2 (9037 upstream) : SLC12A7 (2526 downstream)																							attgtgtgaatgagtgagtgggtt	0.010													2	4	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1052736	1052740	+	Intron	DEL	GAGCA	-	-	rs142533833		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1052736_1052740delGAGCA	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGGCGGGGAGGAGCAGGGCAGGGGA	0.605													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1688427	1688428	+	IGR	INS	-	GT	GT	rs139323441	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1688427_1688428insGT								LOC728613 (54307 upstream) : MRPL36 (110072 downstream)																							tgtgtgaacaagtgtgtgtgtg	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1747847	1747847	+	IGR	DEL	C	-	-	rs11349678		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1747847delC								LOC728613 (113727 upstream) : MRPL36 (50653 downstream)																							TCCGGAGGGACCCCCCCCGCC	0.597													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3672543	3672544	+	IGR	DEL	GC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3672543_3672544delGC								IRX1 (71027 upstream) : None (None downstream)																							GCTGGAGTGTGCAGGGAGCCTG	0.629													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3815244	3815244	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3815244delG								IRX1 (213728 upstream) : None (None downstream)																							gatcctccctggttcaatatt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5555548	5555548	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5555548delG								KIAA0947 (65211 upstream) : FLJ33360 (755006 downstream)																							gaaggatctaggttgcacact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5931234	5931235	+	IGR	INS	-	A	A	rs150057412	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5931234_5931235insA								KIAA0947 (440897 upstream) : FLJ33360 (379319 downstream)																							aatatatgcatacatgtgtatc	0.074													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5961919	5961928	+	IGR	DEL	GGGCAGAACC	-	-	rs67564704		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5961919_5961928delGGGCAGAACC								KIAA0947 (471582 upstream) : FLJ33360 (348626 downstream)																							ggtttcaccagggcagaaccgggcagaacc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7207149	7207157	+	IGR	DEL	TCCCTTCCT	-	-	rs111399864	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7207149_7207157delTCCCTTCCT								PAPD7 (449988 upstream) : ADCY2 (189186 downstream)																							ccttccttcctcccttccttttcttcctt	0.091													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8910486	8910486	+	IGR	DEL	T	-	-	rs75671489		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8910486delT								None (None upstream) : SEMA5A (124652 downstream)																							TATTAATTTcttttttggcac	0.279													3	4	---	---	---	---	
CMBL	134147	broad.mit.edu	37	5	10294676	10294676	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10294676delA	uc003jes.2	-							NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase							cytosol	hydrolase activity|protein binding			skin(1)	1						atcctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10875913	10875913	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10875913delG								DAP (114526 upstream) : CTNND2 (96039 downstream)																							GCACACCTGTGGATGGGACAT	0.493													3	3	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13837670	13837670	+	Intron	DEL	A	-	-	rs113448786		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13837670delA	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ctatcttctcaaaaaaaaaaa	0.005									Kartagener_syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14096692	14096692	+	IGR	DEL	A	-	-	rs113966333		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14096692delA								DNAH5 (152103 upstream) : TRIO (47137 downstream)																							acaacagcataaaaaaaaaaa	0.000													4	2	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14207371	14207372	+	Intron	INS	-	ACACACACAC	ACACACACAC			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14207371_14207372insACACACACAC	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					agatggtctctacacacacaca	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15155097	15155097	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15155097delT								ANKH (283210 upstream) : FBXL7 (345208 downstream)																							ggtctctcccttgacacatgg	0.075													4	2	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16568351	16568354	+	Intron	DEL	ACAA	-	-	rs77205582		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16568351_16568354delACAA	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						CACAGGTTTCACAAACATTCACTC	0.284													5	3	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16923773	16923776	+	Intron	DEL	ACAC	-	-	rs35709247		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16923773_16923776delACAC	uc003jft.3	-						MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						acacgcccatacacacacacacac	0.270													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18508029	18508029	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18508029delG								None (None upstream) : CDH18 (965128 downstream)																							ccaatggtatggtgtcttcaa	0.000													4	2	---	---	---	---	
CDH9	1007	broad.mit.edu	37	5	26936215	26936215	+	Intron	DEL	G	-	-	rs80016669		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26936215delG	uc003jgs.1	-						CDH9_uc010iug.2_Intron	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ggggaagagtgggggggtgag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28014682	28014682	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28014682delC								CDH9 (975993 upstream) : None (None downstream)																							gatcacactgcccccagaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29601839	29601840	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29601839_29601840delTG								None (None upstream) : None (None downstream)																							TAGGTGCTTTTGTGTGTGTGTG	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	31565086	31565087	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31565086_31565087delAC								C5orf22 (9922 upstream) : PDZD2 (74430 downstream)																							tctgtctcaaacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	31593103	31593103	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31593103delT								C5orf22 (37939 upstream) : PDZD2 (46414 downstream)																							ccccctttacttacccaattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34109932	34109934	+	IGR	DEL	TGT	-	-	rs78871010		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34109932_34109934delTGT								C1QTNF3 (66615 upstream) : RAI14 (546499 downstream)																							tgatacagactgttttctgagaa	0.128													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36341030	36341031	+	IGR	DEL	AT	-	-	rs55888104		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36341030_36341031delAT								RANBP3L (39019 upstream) : SLC1A3 (265426 downstream)																							ggaaaacctcatgtttcataag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36594928	36594928	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36594928delA								RANBP3L (292917 upstream) : SLC1A3 (11529 downstream)																							ttagccttttaaaaaaaaaaa	0.035													5	3	---	---	---	---	
SLC1A3	6507	broad.mit.edu	37	5	36652428	36652429	+	Intron	DEL	AC	-	-	rs35501123		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36652428_36652429delAC	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	acacacacatacacacacacac	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39274028	39274028	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39274028delT								FYB (3269 upstream) : C9 (10351 downstream)																							TCTATTATGCttttttttttt	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44178128	44178129	+	IGR	DEL	TG	-	-	rs139817067		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44178128_44178129delTG								NNT (472461 upstream) : FGF10 (126968 downstream)																							ttttgttttttgtttttttttt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	53702617	53702618	+	IGR	INS	-	AA	AA	rs138917461		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53702617_53702618insAA								ARL15 (96214 upstream) : HSPB3 (48827 downstream)																							TATGCATTCCTAAAAAAAAAAA	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57452453	57452453	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57452453delC								ACTBL2 (673817 upstream) : PLK2 (297359 downstream)																							GTTGACTCAGCCACGCTGGGA	0.488													4	2	---	---	---	---	
MAP1B	4131	broad.mit.edu	37	5	71501439	71501440	+	3'UTR	DEL	GA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71501439_71501440delGA	uc003kbw.3	+	7						NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B							microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		gataacgcaggagagagagaga	0.257													4	2	---	---	---	---	
MRPS27	23107	broad.mit.edu	37	5	71584038	71584038	+	Intron	DEL	T	-	-	rs67818835		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71584038delT	uc003kbz.3	-						MRPS27_uc003kca.3_Intron|MRPS27_uc011cse.1_Intron|MRPS27_uc010iza.2_Intron	NM_015084	NP_055899	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27							mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		GCAAGAAttcttttttttttt	0.214													4	2	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75507289	75507292	+	Intron	DEL	GTGT	-	-	rs34055477		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75507289_75507292delGTGT	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TTCTGGTtgcgtgtgtgtgtgtgt	0.314													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	76237541	76237541	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76237541delT								S100Z (20486 upstream) : CRHBP (11139 downstream)																							actccacccctcccttccccc	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84699685	84699686	+	IGR	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84699685_84699686delCT								None (None upstream) : NBPF22P (878576 downstream)																							cgctcatttgctctctctctct	0.000													4	2	---	---	---	---	
LNPEP	4012	broad.mit.edu	37	5	96275577	96275578	+	Intron	INS	-	A	A	rs71985131		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96275577_96275578insA	uc003kmv.1	+							NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TGAGTCTTTTTAAAAAAAAATT	0.257													4	2	---	---	---	---	
TNFAIP8	25816	broad.mit.edu	37	5	118673860	118673861	+	Intron	INS	-	ACAC	ACAC	rs5870853		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118673860_118673861insACAC	uc011cwf.1	+						TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron	NM_001077654	NP_001071122	O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		CTGGAACTTTGacacacacaca	0.406													5	4	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140039878	140039881	+	Intron	DEL	TTTT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140039878_140039881delTTTT	uc003lgq.2	+							NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTACttctttttttttttttt	0.230													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	156126705	156126705	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156126705delA	uc003lwd.3	+						SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCAGGAAACCAAAAAAGAAAT	0.363													4	2	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169371235	169371235	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169371235delC	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron|FAM196B_uc003mag.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTGGTGAGCCCCAACTCCC	0.388													4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170692966	170692967	+	Intron	DEL	AT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170692966_170692967delAT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGGtaaaaaatatatatatat	0.421			T	TRD@	ALL								6	3	---	---	---	---	
STK10	6793	broad.mit.edu	37	5	171602321	171602321	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171602321delA	uc003mbo.1	-							NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGAGAAGGGAAAAAATGCAT	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173914065	173914068	+	IGR	DEL	GAAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173914065_173914068delGAAA								HMP19 (377884 upstream) : MSX2 (237507 downstream)																							aaagaaggaggaaagaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174119133	174119134	+	IGR	DEL	CA	-	-	rs34636943	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174119133_174119134delCA								HMP19 (582952 upstream) : MSX2 (32441 downstream)																							gcacacaacgcacacacacaca	0.287													4	2	---	---	---	---	
PRR7	80758	broad.mit.edu	37	5	176878212	176878212	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176878212delG	uc003mgu.1	+						PRR7_uc003mgv.1_Intron|PRR7_uc003mgw.1_Intron	NM_030567	NP_085044	Q8TB68	PRR7_HUMAN	proline rich 7 (synaptic)							cell junction|integral to membrane|postsynaptic membrane					0	all_cancers(89;1.51e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGGCAGTGTGGGAGGTGCCC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3778778	3778778	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3778778delT								C6orf145 (26532 upstream) : FAM50B (70854 downstream)																							ATAAtttatcttttttttttt	0.159													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	4392689	4392690	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4392689_4392690delAC								PECI (256858 upstream) : CDYL (313703 downstream)																							acacactcagacacacacacac	0.000													4	2	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5524344	5524347	+	Intron	DEL	AATG	-	-	rs71780911		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5524344_5524347delAATG	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	GACAATAGATAATGAATGTACCAC	0.392													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7642356	7642357	+	IGR	INS	-	T	T	rs146022775	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7642356_7642357insT								SNRNP48 (30157 upstream) : BMP6 (84654 downstream)																							ttttgtttttgtttttttgttt	0.228													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7691637	7691638	+	IGR	INS	-	T	T	rs143257086		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7691637_7691638insT								SNRNP48 (79438 upstream) : BMP6 (35373 downstream)																							ccttctttgaattttttttttt	0.079													5	5	---	---	---	---	
TXNDC5	81567	broad.mit.edu	37	6	7961791	7961792	+	Intron	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7961791_7961792delCT	uc003mxw.2	-							NM_001145549	NP_001139021	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)					cccacaggtcctctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8783594	8783595	+	IGR	DEL	AC	-	-	rs111415080		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8783594_8783595delAC								HULC (129517 upstream) : None (None downstream)																							CACCAAAAATacacacacacac	0.257													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10468169	10468170	+	IGR	DEL	AC	-	-	rs140539231		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10468169_10468170delAC								C6orf218 (33114 upstream) : GCNT2 (24286 downstream)																							caggaagctgacacagaagtat	0.030													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11053000	11053003	+	Intron	DEL	AAAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11053000_11053003delAAAA	uc003mzq.1	+											Homo sapiens cDNA clone IMAGE:5269899.																		attccgtctcaaaaaaaaaaaaaa	0.103													4	2	---	---	---	---	
C6orf105	84830	broad.mit.edu	37	6	11716724	11716724	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11716724delA	uc003nab.2	-						C6orf105_uc003naa.2_Intron|C6orf105_uc011dip.1_Intron	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2							integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			TCCACATGCTAGAGAAGGCAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14426393	14426393	+	IGR	DEL	A	-	-	rs34092372		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14426393delA								CD83 (289247 upstream) : JARID2 (819341 downstream)																							CCTGGATAGGAACATTCCCAG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15710418	15710419	+	IGR	INS	-	TTCC	TTCC	rs148203937	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15710418_15710419insTTCC								DTNBP1 (47147 upstream) : MYLIP (418898 downstream)																							tccttccttctttccttccttc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25240712	25240713	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25240712_25240713delTG								CMAH (73919 upstream) : LRRC16A (38935 downstream)																							CTCATTGCTCtgtgtgtgtgtg	0.312													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29662549	29662549	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29662549delA								ZFP57 (13662 upstream) : HLA-F (28568 downstream)																							agcctcctgcagggccaggat	0.000													4	2	---	---	---	---	
HLA-B	3106	broad.mit.edu	37	6	31257315	31257316	+	Intron	INS	-	T	T	rs138278285	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31257315_31257316insT	uc003ntf.2	-						HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron			P01889	1B07_HUMAN	SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						ctttcattttcttttttttctg	0.000									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33567800	33567801	+	IGR	INS	-	T	T	rs138916194		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33567800_33567801insT								C6orf227 (6685 upstream) : ITPR3 (21360 downstream)																							ttctgtctaccttttttttttt	0.257													3	4	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34039803	34039804	+	Intron	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34039803_34039804delCT	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	acacacacacctatcaccacag	0.000													4	2	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39556359	39556359	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39556359delC	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						tcaacctcttccctgtgctac	0.000													4	2	---	---	---	---	
NFYA	4800	broad.mit.edu	37	6	41048796	41048796	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41048796delA	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCAGTTTCCTAATATTTCATG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43798211	43798212	+	IGR	DEL	TG	-	-	rs35074202		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43798211_43798212delTG								VEGFA (43990 upstream) : LOC100132354 (60553 downstream)																							AATATACAAATGTGTGTGTGTG	0.480													3	4	---	---	---	---	
TNFRSF21	27242	broad.mit.edu	37	6	47248350	47248350	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47248350delC	uc003oyv.2	-							NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,						cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			GTACTGCTTTCACAGACGAGT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50358284	50358285	+	IGR	INS	-	A	A	rs149617316	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50358284_50358285insA								DEFB112 (341920 upstream) : TFAP2D (322972 downstream)																							AGAAGGAAAATAAAAAAAAGGA	0.441													1	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57373241	57373241	+	Intron	DEL	A	-	-	rs67451303		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57373241delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		atattgtaatattttttccct	0.030													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57386905	57386907	+	Intron	DEL	AGA	-	-	rs139634372		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57386905_57386907delAGA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TACAAATGAGAGAAGAATGGACA	0.453													9	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57411440	57411441	+	Intron	INS	-	A	A	rs11391617		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57411440_57411441insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttattttatttaaaaaataaCC	0.282													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57438708	57438709	+	Intron	INS	-	T	T	rs150105211		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57438708_57438709insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTTTAGTGCATTTTTTTTCCC	0.386													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57487931	57487931	+	Intron	DEL	T	-	-	rs74294531		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57487931delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tttgcattaattttttttttg	0.075													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57503574	57503575	+	Intron	INS	-	A	A	rs150588289		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57503574_57503575insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AATTATCTCTGAAAAAAAGGCA	0.198													3	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57506154	57506154	+	Intron	DEL	G	-	-	rs111228083		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57506154delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aagcaagaaagatctaaagtc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57524791	57524793	+	IGR	DEL	TTT	-	-	rs35354100		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57524791_57524793delTTT								PRIM2 (11416 upstream) : GUSBL2 (721366 downstream)																							gtaatacatcttttgtttcacac	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57525749	57525750	+	IGR	INS	-	C	C	rs149294374		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57525749_57525750insC								PRIM2 (12374 upstream) : GUSBL2 (720409 downstream)																							ttgattttttttgatgggctta	0.000													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57557438	57557439	+	IGR	INS	-	C	C	rs140134047		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57557438_57557439insC								PRIM2 (44063 upstream) : GUSBL2 (688720 downstream)																							GGTATgctccacccccaggtaa	0.025													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57595085	57595086	+	IGR	INS	-	TCCTGTCTGGCT	TCCTGTCTGGCT	rs146299071	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57595085_57595086insTCCTGTCTGGCT								PRIM2 (81710 upstream) : GUSBL2 (651073 downstream)																							TATGATTTCCCTCCTGTCTGGC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57595555	57595556	+	IGR	DEL	AG	-	-	rs34203292		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57595555_57595556delAG								PRIM2 (82180 upstream) : GUSBL2 (650603 downstream)																							GGCAGGTTTTAGAGTGTAAAGA	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	62228463	62228464	+	IGR	INS	-	T	T	rs140896837	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62228463_62228464insT								None (None upstream) : KHDRBS2 (161401 downstream)																							aggataaaaacaaaaagaagct	0.000													2	4	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69785876	69785876	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69785876delT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				CTTTCTCTGCTTTTTTTTTAG	0.318													24	15	---	---	---	---	
SENP6	26054	broad.mit.edu	37	6	76391178	76391179	+	Intron	INS	-	T	T	rs71544058		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76391178_76391179insT	uc003pid.3	+						SENP6_uc003pie.3_Intron|SENP6_uc010kbf.2_Intron	NM_015571	NP_056386	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6 isoform 1						proteolysis	cytoplasm|nucleus	cysteine-type peptidase activity			breast(2)|urinary_tract(1)|ovary(1)|lung(1)|skin(1)	6		all_hematologic(105;0.189)				tcaggtatttcttttttttttt	0.000													4	2	---	---	---	---	
ANKRD6	22881	broad.mit.edu	37	6	90325468	90325469	+	Intron	INS	-	AGAA	AGAA	rs149646654	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90325468_90325469insAGAA	uc003pni.3	+						ANKRD6_uc003pne.3_Intron|ANKRD6_uc003pnf.3_Intron|ANKRD6_uc011dzy.1_Intron|ANKRD6_uc010kcd.2_Intron|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_Intron	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6								protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CACCTGATAGGAGAAAGAATGA	0.376													4	2	---	---	---	---	
PDSS2	57107	broad.mit.edu	37	6	107478883	107478883	+	Intron	DEL	T	-	-	rs78613428		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107478883delT	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		AGCGtttttgttttttttttt	0.239													4	2	---	---	---	---	
PPIL6	285755	broad.mit.edu	37	6	109740621	109740622	+	Intron	INS	-	A	A	rs79521587		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109740621_109740622insA	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		ccatctcgattaaaaaaaaaaa	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113208879	113208879	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113208879delG								RFPL4B (536381 upstream) : MARCKS (969648 downstream)																							cacattgcatggtgagaacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114344409	114344410	+	Intron	INS	-	T	T	rs148076786	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114344409_114344410insT	uc003pwf.2	+											Homo sapiens, clone IMAGE:5770470, mRNA.																		ATCAGCTCTTGTTTGGACGGGT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123246560	123246560	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123246560delT								SMPDL3A (115698 upstream) : CLVS2 (71022 downstream)																							CGCATGCACAttttttttttt	0.194													4	2	---	---	---	---	
ENPP1	5167	broad.mit.edu	37	6	132215429	132215430	+	3'UTR	INS	-	TT	TT	rs57585731		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132215429_132215430insTT	uc011ecf.1	+	25						NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CACATCAGTCCttttttttttt	0.079													4	2	---	---	---	---	
ALDH8A1	64577	broad.mit.edu	37	6	135258195	135258196	+	Intron	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135258195_135258196delCA	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TCTCCTGCTCCACACACACACC	0.416													4	2	---	---	---	---	
KIAA1244	57221	broad.mit.edu	37	6	138595933	138595933	+	Intron	DEL	A	-	-	rs67329948		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138595933delA	uc003qhu.2	+							NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		actccgtctcaaaaaaaaaaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140257803	140257804	+	IGR	INS	-	TT	TT			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140257803_140257804insTT								CITED2 (562018 upstream) : None (None downstream)																							GAGATTGTCACttttttttttt	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142065232	142065232	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142065232delG	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																		TTTGTTCTTAGGATGTCCCCT	0.393													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150645587	150645589	+	IGR	DEL	GGC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150645587_150645589delGGC								PPP1R14C (74061 upstream) : IYD (44439 downstream)																							ctacatattgggcggcacagtgt	0.123													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152537615	152537615	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152537615delA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGGACTTTACTCTTTTTAG	0.488										HNSCC(10;0.0054)			4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162697740	162697741	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162697740_162697741delTG	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		tgtgtgtgtctgtgtgtgtgtg	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166253485	166253486	+	Intron	INS	-	T	T	rs77514822		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166253485_166253486insT	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																		ctccaactccatcccatctcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169714364	169714365	+	IGR	DEL	CT	-	-	rs145501371		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169714364_169714365delCT								THBS2 (60227 upstream) : WDR27 (142942 downstream)																							cactgcctgcctctgtccacac	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	170762262	170762263	+	IGR	INS	-	GT	GT			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170762262_170762263insGT								FAM120B (48026 upstream) : PSMB1 (17844 downstream)																							gtgaggtgtgagtgtgagtgta	0.203													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	842553	842554	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:842553_842554delAG								HEATR2 (16437 upstream) : SUN1 (13698 downstream)																							aaaaaaagaaagagagagagaa	0.000													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	944997	945015	+	Intron	DEL	GAAAGGGAAAGGGAAAGGA	-	-	rs57860044	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944997_945015delGAAAGGGAAAGGGAAAGGA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						GATGGGCagggaaagggaaagggaaaggagaaaggagaa	0.297													5	3	---	---	---	---	
CARD11	84433	broad.mit.edu	37	7	3012231	3012232	+	Intron	DEL	AA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3012231_3012232delAA	uc003smv.2	-							NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AAGTCAAACCAAAAAAAAAAAA	0.312			Mis		DLBCL								3	3	---	---	---	---	
FOXK1	221937	broad.mit.edu	37	7	4720599	4720600	+	5'Flank	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4720599_4720600insA	uc003snc.1	+						FOXK1_uc003sna.1_Intron|FOXK1_uc003snb.1_5'Flank	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1						cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		aactccgtctcaaaaaaaaaaa	0.000													4	4	---	---	---	---	
RBAK	57786	broad.mit.edu	37	7	5103109	5103110	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5103109_5103110delTG	uc010kss.1	+						LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Intron	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		ATTCTTTCACtgtgtgtgtgtg	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6959030	6959032	+	IGR	DEL	TTC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6959030_6959032delTTC								C7orf28B (93169 upstream) : C1GALT1 (263214 downstream)																							gacagaacagttcttcttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10826815	10826816	+	IGR	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10826815_10826816delTC								None (None upstream) : NDUFA4 (145999 downstream)																							ccCAACGTTGTCTCTCTTAATT	0.233													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	12463863	12463864	+	IGR	INS	-	A	A	rs142617017	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12463863_12463864insA								VWDE (20011 upstream) : SCIN (132323 downstream)																							atgtagccagcaaaaagctggc	0.000													1	6	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14316962	14316963	+	Intron	INS	-	T	T	rs138811528	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14316962_14316963insT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	tgcccaggtaatttttttttct	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15840347	15840347	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15840347delA								MEOX2 (114039 upstream) : ISPD (286805 downstream)																							ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20295135	20295135	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20295135delA								MACC1 (38122 upstream) : ITGB8 (75190 downstream)																							aacagcacctaaaaaagtTTG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20492155	20492155	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20492155delA								ITGB8 (36777 upstream) : ABCB5 (163090 downstream)																							AACAGGTACCAAAAACACCCA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35398482	35398482	+	IGR	DEL	G	-	-	rs112845347	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35398482delG								TBX20 (105240 upstream) : HERPUD2 (273790 downstream)																							aggctgaggcgggcggatcac	0.000													4	2	---	---	---	---	
SEPT7	989	broad.mit.edu	37	7	35863620	35863620	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35863620delT	uc010kxc.2	+						SEPT7_uc011kat.1_Intron|SEPT7_uc011kau.1_Intron	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1						cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						accatctgccttttttttttt	0.119													4	3	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	36983578	36983578	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36983578delA	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CAGGAAACATAAAAATGATCA	0.448													4	2	---	---	---	---	
SPDYE1	285955	broad.mit.edu	37	7	44043645	44043645	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44043645delG	uc003tjf.2	+						POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron|uc003tjg.1_RNA	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN	Williams Beuren syndrome chromosome region 19											ovary(1)	1						ttttttttttgtgtgtgtgag	0.244													12	6	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44260399	44260400	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44260399_44260400insC	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron|CAMK2B_uc003tkn.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						GTCCTGCACAGCCCCCCCCCAG	0.634													6	4	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44294370	44294375	+	Intron	DEL	CCAACT	-	-	rs111901158		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44294370_44294375delCCAACT	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						atcaccaccaccaactaccaccatca	0.029													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	44969476	44969477	+	IGR	INS	-	TC	TC	rs144170109	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44969476_44969477insTC								PURB (44516 upstream) : MYO1G (32783 downstream)																							ctttctttctttttctttcttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45579399	45579400	+	IGR	INS	-	A	A	rs147935338	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45579399_45579400insA								RAMP3 (355552 upstream) : ADCY1 (34339 downstream)																							cctaacaccttaaaaagagaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47759583	47759584	+	IGR	INS	-	T	T	rs141015816	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47759583_47759584insT								C7orf65 (58337 upstream) : PKD1L1 (54706 downstream)																							attttaccacatttTTTTTTTA	0.213													4	2	---	---	---	---	
DDC	1644	broad.mit.edu	37	7	50545911	50545911	+	Intron	DEL	A	-	-	rs67325967		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50545911delA	uc003tpf.3	-						DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Intron	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid						cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	accctgtctcaaaaaaaaaaa	0.119													3	4	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51215918	51215918	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51215918delG	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpt.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					TTTGTGCACAGGGCAGGTGGG	0.333													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57609970	57609973	+	IGR	DEL	GTTA	-	-	rs150988896		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57609970_57609973delGTTA								ZNF716 (76705 upstream) : None (None downstream)																							AAAAAATATGGTTAGTGAGAAATG	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57714133	57714134	+	IGR	INS	-	G	G	rs149586851	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57714133_57714134insG								ZNF716 (180868 upstream) : None (None downstream)																							aggagcaaagagtttctgcaaa	0.050													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57997858	57997858	+	IGR	DEL	C	-	-	rs79156896		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57997858delC								ZNF716 (464593 upstream) : None (None downstream)																							atttccttttcaaccataggc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61748662	61748663	+	IGR	INS	-	T	T	rs146069928		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61748662_61748663insT								None (None upstream) : None (None downstream)																							atcgaatggagcaaatggaatc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61753069	61753071	+	IGR	DEL	ATT	-	-	rs62453305		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61753069_61753071delATT								None (None upstream) : LOC643955 (998601 downstream)																							aaatggaatcattgaatggaatc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61820663	61820663	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61820663delC								None (None upstream) : LOC643955 (931009 downstream)																							GCGTCTTTCTCCCCCCGCCGC	0.632													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61836537	61836538	+	IGR	INS	-	AA	AA	rs138914833	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61836537_61836538insAA								None (None upstream) : LOC643955 (915134 downstream)																							aactccatctcaaaaaaaatgc	0.099													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64962336	64962336	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64962336delT								ZNF92 (96339 upstream) : INTS4L2 (150441 downstream)																							GAAATTTGTGTTTTATCAAAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65189984	65189984	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65189984delC	uc003tud.1	-						uc003tuf.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		CCTCTACATTCCCCCAGGAGG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68208056	68208056	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68208056delT								None (None upstream) : AUTS2 (855849 downstream)																							tgagctatgattgcaccactg	0.040													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69737221	69737222	+	Intron	INS	-	AA	AA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69737221_69737222insAA	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GTAGTTAAATTAAAAAAAAAAA	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	70554854	70554855	+	IGR	INS	-	A	A	rs144862876		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70554854_70554855insA								AUTS2 (296970 upstream) : WBSCR17 (42934 downstream)																							cccccctctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	71928937	71928940	+	IGR	DEL	GAAG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71928937_71928940delGAAG								CALN1 (16801 upstream) : TYW1B (94789 downstream)																							caaagtgagagaaggaaggaagga	0.074													6	3	---	---	---	---	
GTF2IRD2B	389524	broad.mit.edu	37	7	74554634	74554634	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74554634delA	uc003ubt.2	+						GTF2IRD2B_uc011kfl.1_Intron|GTF2IRD2B_uc010lcd.2_Intron|GTF2IRD2B_uc003ubu.2_Intron	NM_001003795	NP_001003795	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						aacctgtctcaaaaaaaaaaa	0.134													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	85304831	85304831	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85304831delC								SEMA3D (488660 upstream) : GRM3 (968399 downstream)																							cttgaggaatcgccacactgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	89392604	89392604	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89392604delT								ZNF804B (426260 upstream) : DPY19L2P4 (356110 downstream)																							CATAGTCACCTTCTGGTTCCA	0.343													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90298784	90298785	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90298784_90298785insA	uc003uky.2	+						CDK14_uc003ukt.1_Intron|CDK14_uc003ukv.1_Intron|CDK14_uc003uku.1_Intron|CDK14_uc003ukx.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						tacacagacccaaaaagggtca	0.079													4	2	---	---	---	---	
CYP51A1	1595	broad.mit.edu	37	7	91759606	91759608	+	Intron	DEL	TAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91759606_91759608delTAA	uc003ulm.3	-						CYP51A1_uc011khn.1_Intron|CYP51A1_uc003uln.3_Intron	NM_000786	NP_000777	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A,						cholesterol biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|sterol 14-demethylase activity				0	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Fluconazole(DB00196)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Miconazole(DB01110)|Terconazole(DB00251)	tataaaatggtaataataataat	0.123													4	2	---	---	---	---	
PON1	5444	broad.mit.edu	37	7	94981867	94981867	+	Intron	DEL	T	-	-	rs150055646		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94981867delT	uc011kih.1	-									P27169	PON1_HUMAN	SubName: Full=cDNA FLJ57644, highly similar to Serum paraoxonase/arylesterase 1 (EC 3.1.1.2);						aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	gtatactttctttcctttcac	0.000													4	2	---	---	---	---	
ASB4	51666	broad.mit.edu	37	7	95137373	95137374	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95137373_95137374insT	uc011kij.1	+						ASB4_uc003unx.2_Intron	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4						intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			gtttgaacttatttttttttta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97064922	97064922	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97064922delA								ACN9 (253849 upstream) : TAC1 (296349 downstream)																							gggagagaggaaaaaaaagga	0.080													4	2	---	---	---	---	
MGC72080	389538	broad.mit.edu	37	7	97600943	97600944	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97600943_97600944delAC	uc010lfp.1	-						MGC72080_uc003upb.1_Intron|MGC72080_uc003upa.1_Intron					Homo sapiens cDNA, FLJ99734.												0						ACCTCAGAAAacacacacacac	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98108146	98108152	+	IGR	DEL	CTGTCAC	-	-	rs112906827		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98108146_98108152delCTGTCAC								BAIAP2L1 (77719 upstream) : NPTX2 (138445 downstream)																							gagtcttgctctgtcacccaggctgga	0.116													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98408891	98408893	+	IGR	DEL	TAG	-	-	rs140739561	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98408891_98408893delTAG								NPTX2 (149710 upstream) : TMEM130 (35219 downstream)																							gtggtggtgatagtggtggtggt	0.000													8	4	---	---	---	---	
TMEM130	222865	broad.mit.edu	37	7	98455989	98455989	+	Intron	DEL	C	-	-	rs147817950		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98455989delC	uc003upo.2	-						TMEM130_uc011kiq.1_Intron|TMEM130_uc011kir.1_Intron|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			catagtgagaccccatctcta	0.000													3	4	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98492246	98492247	+	Intron	INS	-	T	T	rs144512272	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98492246_98492247insT	uc003upp.2	+						TRRAP_uc011kis.1_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ttcttttgttgtttttttttag	0.000													4	3	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99782538	99782538	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99782538delT	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ttttactaggttttattgtga	0.000													3	3	---	---	---	---	
ARMC10	83787	broad.mit.edu	37	7	102734931	102734931	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102734931delA	uc003vaw.1	+						ARMC10_uc003vay.1_Intron|ARMC10_uc003vax.1_Intron|ARMC10_uc003vbb.1_Intron|ARMC10_uc011kli.1_Intron|ARMC10_uc010lis.1_Intron|ARMC10_uc003vba.1_Intron|ARMC10_uc003vaz.1_Intron	NM_031905	NP_114111	Q8N2F6	ARM10_HUMAN	SVH protein isoform a						regulation of growth	endoplasmic reticulum membrane|integral to membrane	binding			ovary(1)	1						ACAGGATACCAAATAGCTATT	0.338													4	2	---	---	---	---	
IMMP2L	83943	broad.mit.edu	37	7	111201800	111201800	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111201800delG	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		GGTAGAATCTGGGCCCAAGTT	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114936994	114936995	+	IGR	INS	-	TG	TG			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114936994_114936995insTG								MDFIC (277731 upstream) : TFEC (638207 downstream)																							TTTGCTAAAACtgtgtgtgtgt	0.248													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	115119665	115119673	+	IGR	DEL	CCTTCCTTT	-	-	rs67672148		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115119665_115119673delCCTTCCTTT								MDFIC (460402 upstream) : TFEC (455529 downstream)																							cttccttccaccttcctttccttcctttc	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	115313004	115313004	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115313004delA								MDFIC (653741 upstream) : TFEC (262198 downstream)																							AGATAAGGTGAAAAAAAACAG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	117852687	117852687	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117852687delT								NAA38 (19809 upstream) : ANKRD7 (12025 downstream)																							ggcacctcccttctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124307489	124307490	+	IGR	INS	-	A	A	rs145915050	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124307489_124307490insA								TMEM229A (633966 upstream) : GPR37 (78626 downstream)																							gtgttagtaggaaaaaaaacca	0.000													2	4	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126590975	126590975	+	Intron	DEL	T	-	-	rs35875691		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126590975delT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TGTCCAAGTCTTTTTTTTTTT	0.294										HNSCC(24;0.065)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	126914807	126914808	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126914807_126914808insA								GRM8 (21660 upstream) : ZNF800 (95546 downstream)																							CCCAGAATCACAAAAAACACAG	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131337830	131337837	+	IGR	DEL	GGAGGGGG	-	-	rs72226482		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131337830_131337837delGGAGGGGG								PODXL (96454 upstream) : PLXNA4 (470255 downstream)																							TGGGAATTGTGGAGGGGGGGAGGGGGGG	0.567													4	2	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	131838101	131838101	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131838101delA	uc003vra.3	-							NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						AGGTGTCTGGAGCTGAGCTGA	0.557													4	2	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	132248264	132248278	+	Intron	DEL	CTCCTCCTCCTGCTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132248264_132248278delCTCCTCCTCCTGCTG	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						tctcctcctcctcctcctcctgctgctcctcctcc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134061764	134061765	+	IGR	INS	-	TCTA	TCTA	rs111882190		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134061764_134061765insTCTA								SLC35B4 (59937 upstream) : AKR1B1 (65342 downstream)																							TTCTAGGGTTCTCTGTTTCCTG	0.401													4	2	---	---	---	---	
LUZP6	767558	broad.mit.edu	37	7	135614510	135614510	+	3'UTR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135614510delT	uc003vte.3	-	4					LUZP6_uc010lmv.2_RNA	NM_145808	NP_665807	Q538Z0	LUZP6_HUMAN	myotrophin												0						TCCAAAACAATTTTTTTTTTC	0.398													4	2	---	---	---	---	
ZC3HAV1	56829	broad.mit.edu	37	7	138772005	138772005	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138772005delT	uc003vun.2	-						ZC3HAV1_uc003vup.2_Intron	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1						response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						GTGTAAGGCATTTTTCCCGTG	0.448													4	2	---	---	---	---	
OR2A12	346525	broad.mit.edu	37	7	143790578	143790578	+	5'Flank	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143790578delT	uc011kty.1	+							NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					TATATTTCTCttttttttaat	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	144634534	144634545	+	IGR	DEL	CCTTCCCTTTCT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144634534_144634545delCCTTCCCTTTCT								TPK1 (101388 upstream) : None (None downstream)																							ttctccttacccttccctttctccttcccttt	0.052													3	3	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147576689	147576689	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147576689delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGTCATGTTTACCTCTCTGGA	0.408										HNSCC(39;0.1)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150589091	150589092	+	IGR	DEL	TG	-	-	rs112377041		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150589091_150589092delTG								ABP1 (30712 upstream) : KCNH2 (52958 downstream)																							tccctggggctgtgagttcatg	0.000													4	2	---	---	---	---	
ASB10	136371	broad.mit.edu	37	7	150878702	150878702	+	Intron	DEL	T	-	-	rs112543142		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150878702delT	uc003wjm.1	-						ASB10_uc003wjl.1_Intron|ASB10_uc003wjn.1_Intron	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10						intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTGCCCttcttttttttttt	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156113964	156113965	+	IGR	INS	-	T	T	rs149573814		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156113964_156113965insT								SHH (508997 upstream) : C7orf4 (219220 downstream)																							TCTTCTTCTTCTtttttttttt	0.213													1	5	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157941476	157941476	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157941476delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CTCAATGACACCCCATCTCAC	0.572													6	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157941666	157941666	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157941666delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTCAATGACACCCCATCTCAC	0.552													9	4	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158066263	158066263	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158066263delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCCGCAGGCACAGGGGGAGCC	0.716													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158234666	158234668	+	Intron	DEL	GTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158234666_158234668delGTG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ggtcatggcagtggtggtggtgg	0.000													5	3	---	---	---	---	
ARHGEF10	9639	broad.mit.edu	37	8	1842338	1842338	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1842338delA	uc003wpr.2	+						ARHGEF10_uc003wpq.1_Intron|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_Intron|ARHGEF10_uc003wpv.2_Intron|ARHGEF10_uc010lre.2_Intron	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		agactgtctcaaaaaaaaaaa	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2195494	2195495	+	IGR	INS	-	G	G	rs111274980		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2195494_2195495insG								MYOM2 (102115 upstream) : CSMD1 (597381 downstream)																							GAGGAGGAGCCGGGGAAGGTGG	0.644													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2787114	2787114	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2787114delA								MYOM2 (693735 upstream) : CSMD1 (5762 downstream)																							TGCCTCAGGCAGGAGTCTGCC	0.602													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2799865	2799865	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2799865delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		aagttgatttaaaaaaaaaaa	0.159													8	4	---	---	---	---	
AGPAT5	55326	broad.mit.edu	37	8	6564136	6564137	+	5'Flank	DEL	AA	-	-	rs111492106		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6564136_6564137delAA	uc003wqo.2	+						AGPAT5_uc011kwm.1_5'Flank	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		GGAAAAAGGGAAAAAAAAAAAA	0.480													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8632038	8632039	+	IGR	INS	-	TT	TT	rs141926908		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8632038_8632039insTT								CLDN23 (70422 upstream) : MFHAS1 (9960 downstream)																							tttctttttccttttttttttt	0.000													4	3	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17871619	17871620	+	Intron	INS	-	C	C	rs71545505	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17871619_17871620insC	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		AAAAAAAAAAAACACACACAGA	0.267			T	RET|JAK2	papillary thyroid|CML|MPD								6	3	---	---	---	---	
PDLIM2	64236	broad.mit.edu	37	8	22447648	22447649	+	Intron	DEL	TG	-	-	rs72577328		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22447648_22447649delTG	uc003xby.2	+						PDLIM2_uc003xbz.2_Intron|PDLIM2_uc003xca.2_Intron|PDLIM2_uc003xcb.2_Intron|PDLIM2_uc003xcc.1_Intron|PDLIM2_uc003xcd.1_3'UTR	NM_021630	NP_067643	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 2							actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CAGGAAGCACTGTGGAAGGTGG	0.465													4	2	---	---	---	---	
BIN3	55909	broad.mit.edu	37	8	22478792	22478794	+	3'UTR	DEL	GAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22478792_22478794delGAA	uc003xcl.2	-	9					BIN3_uc003xck.2_3'UTR|BIN3_uc010ltw.2_3'UTR	NM_018688	NP_061158	Q9NQY0	BIN3_HUMAN	bridging integrator 3						actin filament organization|barrier septum formation|cell cycle|protein localization|unidimensional cell growth	cytoplasm|cytoskeleton	cytoskeletal adaptor activity				0		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CCAGGCTCAGGAAGAGTCATTCA	0.586													2	4	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32131677	32131677	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32131677delA	uc003xip.2	+							NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTCAGTGACTAAAAAATACAT	0.408													4	2	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32436091	32436092	+	Intron	INS	-	T	T	rs138483862	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32436091_32436092insT	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTGCTGATAGATTTTTTTTTCA	0.361													5	5	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32612095	32612095	+	Intron	DEL	A	-	-	rs76017751		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32612095delA	uc003xiv.2	+						NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc011lbg.1_Intron|NRG1_uc011lbh.1_Intron|NRG1_uc003xja.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TCTTGGGGATAAAAAAAAAAG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	35009806	35009806	+	IGR	DEL	C	-	-	rs34345316		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35009806delC								None (None upstream) : UNC5D (83169 downstream)																							AGACGATGATCACCTGTCCCA	0.473													3	3	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38112713	38112713	+	Intron	DEL	A	-	-	rs150194338		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38112713delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc003xld.2_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
FGFR1	2260	broad.mit.edu	37	8	38307183	38307184	+	Intron	INS	-	CCATTCT	CCATTCT	rs138612053	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38307183_38307184insCCATTCT	uc003xlp.2	-						FGFR1_uc011lbo.1_Intron|FGFR1_uc011lbp.1_Intron|FGFR1_uc011lbq.1_Intron|FGFR1_uc010lwk.2_Intron|FGFR1_uc011lbs.1_Intron|FGFR1_uc011lbt.1_Intron|FGFR1_uc011lbu.1_Intron|FGFR1_uc011lbv.1_Intron|FGFR1_uc011lbw.1_Intron|FGFR1_uc011lbx.1_Intron|FGFR1_uc003xlv.2_Intron|FGFR1_uc003xlu.2_Intron|FGFR1_uc003xlw.1_Intron	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1						axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CCCCCACCCCACCTTTTACACA	0.584		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						3	3	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38590822	38590822	+	Intron	DEL	T	-	-	rs113616267		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38590822delT	uc011lbz.1	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc003xmb.3_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			ATTGATCCTCTTTTTTTTTTT	0.433													4	2	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38627228	38627229	+	Intron	INS	-	GT	GT	rs139874952	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38627228_38627229insGT	uc011lbz.1	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			ttgtgtgtgtggtgtgtgtgtg	0.262													4	4	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40749703	40749703	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40749703delC	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			ATGCTATGGGCCCATCTTATT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47038899	47038899	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47038899delG								None (None upstream) : BEYLA (713609 downstream)																							ctcttttggtggtcctcctcg	0.020													5	3	---	---	---	---	
EFCAB1	79645	broad.mit.edu	37	8	49631614	49631615	+	Intron	INS	-	A	A	rs150281934	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49631614_49631615insA	uc011ldj.1	-						EFCAB1_uc003xqn.3_Intron|EFCAB1_uc010lxx.2_Intron	NM_001142857	NP_001136329	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform b								calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				gtcagactaagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56009602	56009602	+	IGR	DEL	A	-	-	rs34938597		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56009602delA								RP1 (327071 upstream) : XKR4 (5415 downstream)																							aagtatcaagagagtgagaat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59633780	59633781	+	IGR	DEL	AC	-	-	rs36067763		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59633780_59633781delAC								NSMAF (61376 upstream) : TOX (84196 downstream)																							agcaaggtatacacacacacac	0.000													3	3	---	---	---	---	
ASPH	444	broad.mit.edu	37	8	62437929	62437930	+	Intron	DEL	AT	-	-	rs71992492		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62437929_62437930delAT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	acacacacacatacacacacGC	0.307													4	2	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63873470	63873470	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63873470delG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				gaaagaaagagggagaTGATC	0.308													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64346644	64346645	+	IGR	DEL	GA	-	-	rs34655542		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64346644_64346645delGA								YTHDF3 (221299 upstream) : MIR124-2 (945061 downstream)																							gaggaaaaaggagagagagaga	0.238													4	2	---	---	---	---	
TPD52	7163	broad.mit.edu	37	8	81075192	81075193	+	Intron	INS	-	A	A	rs146855626	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81075192_81075193insA	uc003ybs.1	-						TPD52_uc010lzs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025253	NP_001020424	P55327	TPD52_HUMAN	tumor protein D52 isoform 2						anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			AACAAACAAACAaaaaaaacgg	0.020													4	2	---	---	---	---	
FABP12	646486	broad.mit.edu	37	8	82438891	82438891	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82438891delT	uc011lfp.1	-						FABP12_uc003ycg.3_Intron	NM_001105281	NP_001098751	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12								lipid binding|transporter activity				0						CCTTTTCATGTTTTTGTTTGG	0.388													4	2	---	---	---	---	
WWP1	11059	broad.mit.edu	37	8	87424928	87424929	+	Intron	INS	-	T	T	rs141959898	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87424928_87424929insT	uc003ydt.2	+						WWP1_uc010mai.2_Intron	NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase						central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GTGTACGTTGGTTTTTTTTTTG	0.376													2	4	---	---	---	---	
CNBD1	168975	broad.mit.edu	37	8	88070095	88070096	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88070095_88070096delAC	uc003ydy.2	+							NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1											ovary(3)	3						ataaacaaagacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96320229	96320230	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96320229_96320230delTG								C8orf37 (38792 upstream) : GDF6 (834330 downstream)																							AGAGGAGGAATGTGTGTGTGTG	0.450													4	2	---	---	---	---	
NIPAL2	79815	broad.mit.edu	37	8	99216074	99216075	+	Intron	DEL	CT	-	-	rs143170810	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99216074_99216075delCT	uc003yil.1	-						NIPAL2_uc011lgw.1_Intron|NIPAL2_uc003yim.1_Intron	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2							integral to membrane					0						TGGGTAGAGCCtgtgtgtgtgt	0.094													4	2	---	---	---	---	
STK3	6788	broad.mit.edu	37	8	99737605	99737605	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99737605delT	uc003yip.2	-						STK3_uc003yio.2_Intron|STK3_uc010mbm.1_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TTTTGTACCCTTTTGTATTAT	0.274													4	2	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104230594	104230595	+	Intron	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104230594_104230595delCA	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|BAALC_uc003ylg.2_Intron|BAALC_uc010mcc.2_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TTACTGACTCCAGAGTGTCTGA	0.465													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105732264	105732265	+	IGR	INS	-	AG	AG	rs150850938	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105732264_105732265insAG								LRP12 (131044 upstream) : ZFPM2 (598882 downstream)																							atatggactgtagcttttattg	0.000													2	5	---	---	---	---	
COLEC10	10584	broad.mit.edu	37	8	120103625	120103625	+	Intron	DEL	A	-	-	rs33915063		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120103625delA	uc003yoo.2	+							NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			aatctctaccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	121046504	121046513	+	Intron	DEL	ACACACACAC	-	-	rs71824607		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121046504_121046513delACACACACAC	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CAAAGCATGTacacacacacacacacacac	0.362													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	121127948	121127949	+	IGR	DEL	TT	-	-	rs71571661		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121127948_121127949delTT								DEPDC6 (64792 upstream) : COL14A1 (9403 downstream)																							gcagccagactttgtccttgag	0.025													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123058957	123058958	+	Intron	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123058957_123058958delAG	uc003ypj.2	-											Homo sapiens, clone IMAGE:5466006, mRNA.																		cttactgggcagagagagagag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	124757022	124757023	+	IGR	DEL	AA	-	-	rs138410908		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124757022_124757023delAA								ANXA13 (7375 upstream) : FAM91A1 (23859 downstream)																							GAAAGGAGACAAGAGAGAGAGA	0.287													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	133941865	133941866	+	Intron	INS	-	AA	AA	rs146719721	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133941865_133941866insAA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		aagacaaaaatagttttaagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135060566	135060566	+	IGR	DEL	T	-	-	rs71952834		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135060566delT								ST3GAL1 (476383 upstream) : ZFAT (429467 downstream)																							AAATATACGCttttttttttt	0.184													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136345467	136345467	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136345467delT								LOC286094 (33508 upstream) : KHDRBS3 (124249 downstream)																							CTGATGCAACttttttttttt	0.184													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136926147	136926147	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136926147delT								KHDRBS3 (266301 upstream) : None (None downstream)																							GTTACGTTTGTTTTTGGTACC	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137462638	137462639	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137462638_137462639delAC								KHDRBS3 (802792 upstream) : None (None downstream)																							acacacacaaacacacacacac	0.248													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137702183	137702183	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137702183delT								None (None upstream) : None (None downstream)																							cagtctgcaattttttttttc	0.000													4	2	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141818115	141818116	+	Intron	DEL	GG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141818115_141818116delGG	uc003yvu.2	-						PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			aagagggagtgggaagaattaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143271715	143271716	+	IGR	DEL	CA	-	-	rs10595484		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143271715_143271716delCA								MIR1302-7 (404041 upstream) : NCRNA00051 (8001 downstream)																							ctcattcatgcacacacacacg	0.139													4	2	---	---	---	---	
HEATR7A	727957	broad.mit.edu	37	8	145218792	145218797	+	Intron	DEL	CTCTTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145218792_145218797delCTCTTG	uc003zbk.3	+						HEATR7A_uc003zbg.2_Intron|HEATR7A_uc003zbh.3_Intron|HEATR7A_uc003zbi.3_Intron|HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826	Q8NDA8	HTR7A_HUMAN	HEAT repeat containing 7A isoform 1								binding				0						TGTGAGGCCTCTCTTGCCTCTGGGTG	0.573													30	15	---	---	---	---	
CPSF1	29894	broad.mit.edu	37	8	145628160	145628160	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145628160delA	uc003zcj.2	-						CPSF1_uc003zck.1_Intron|CPSF1_uc011lle.1_Intron|MIR1234_hsa-mir-1234|MI0006324_5'Flank|CPSF1_uc011llf.1_Intron	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,						mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TGACACACTTAAAAAAAAAAC	0.522													5	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400831	400833	+	Intron	DEL	CAT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400831_400833delCAT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ccaccatcaccatcaccaccacc	0.000													4	2	---	---	---	---	
GLIS3	169792	broad.mit.edu	37	9	4017439	4017440	+	Intron	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4017439_4017440delCA	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc003zhy.1_Intron|GLIS3_uc003zhz.1_Intron	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		AGCTTGCGTGCACACACACACA	0.436													4	2	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6561653	6561654	+	Intron	INS	-	A	A	rs146288774	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6561653_6561654insA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	tctcttgggggaaaaaaaTTGT	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6700269	6700269	+	IGR	DEL	T	-	-	rs112232733		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6700269delT								GLDC (54577 upstream) : KDM4C (16226 downstream)																							tttgggtttgttttttttttt	0.000													4	2	---	---	---	---	
ACER2	340485	broad.mit.edu	37	9	19409356	19409356	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19409356delC	uc003zny.1	+						ACER2_uc003znx.1_Intron|ACER2_uc003znz.1_Intron	NM_001010887	NP_001010887	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2						ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						TTTCAGTTCTCCATCTGTCCT	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	26640413	26640413	+	IGR	DEL	T	-	-	rs68086552	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26640413delT								TUSC1 (961557 upstream) : C9orf82 (200271 downstream)																							ATTCCCCCCCTAAACTTAGGA	0.279													4	2	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													7	4	---	---	---	---	
ATP8B5P	158381	broad.mit.edu	37	9	35405975	35405975	+	5'Flank	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35405975delG	uc010mkn.1	+						ATP8B5P_uc010mko.2_5'Flank|ATP8B5P_uc010mkp.2_5'Flank|ATP8B5P_uc003zwu.2_5'Flank					Homo sapiens cDNA, FLJ17320.												0						GCACCAGACAGGGAACTAGCT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36767799	36767799	+	IGR	DEL	T	-	-	rs71945274		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36767799delT								MELK (90121 upstream) : PAX5 (70732 downstream)																							GTGGTTTTCCTTTTTCTATCA	0.517													0	6	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66495947	66495947	+	5'Flank	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66495947delT	uc004aed.1	+											Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						ttctttcttgttttttttttt	0.000													3	3	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66496197	66496197	+	5'Flank	DEL	G	-	-	rs79383207		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66496197delG	uc004aee.1	+						LOC442421_uc004aed.1_5'Flank					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						agttttgtttgtttttttttg	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68352138	68352138	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68352138delG								FAM27B (557949 upstream) : MIR1299 (650101 downstream)																							tgctatagccgcctaactggt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70839396	70839396	+	IGR	DEL	A	-	-	rs55766796		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70839396delA								CBWD3 (339333 upstream) : FOXD4L3 (78387 downstream)																							atgaattctcagattgtaaga	0.000													4	2	---	---	---	---	
GDA	9615	broad.mit.edu	37	9	74810253	74810253	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74810253delC	uc004aiq.2	+						GDA_uc011lse.1_Intron|GDA_uc011lsf.1_Intron|GDA_uc004air.2_Intron|GDA_uc010mow.1_Intron|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Intron	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		AAACACCTGTCTTTTTTTTTT	0.299													4	2	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78741530	78741530	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78741530delA	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						actccatctcaaaaaaaaaac	0.000													4	2	---	---	---	---	
TRIM14	9830	broad.mit.edu	37	9	100837622	100837623	+	Intron	INS	-	AG	AG	rs146097524	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100837622_100837623insAG	uc004ayd.2	-						NANS_uc004ayb.2_Intron|NANS_uc004ayc.2_Intron|NANS_uc004aye.1_5'Flank	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha							cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				AAAAATAAAGCAGAGGAAGAGC	0.124													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104092539	104092539	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104092539delA								LPPR1 (5123 upstream) : BAAT (30161 downstream)																							AAGAAAGCTGAAAAAAAAAAA	0.403													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106056618	106056619	+	Intron	DEL	GC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106056618_106056619delGC	uc004bbt.2	-											Homo sapiens cDNA clone IMAGE:5266449.																		ctcttacgtagcggaagcagag	0.000													4	2	---	---	---	---	
SNX30	401548	broad.mit.edu	37	9	115539331	115539331	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115539331delC	uc004bgj.3	+							NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30						cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						TATAGCAAATCCCATGTCTTC	0.284													4	2	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119707708	119707708	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119707708delA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CTTTTAACCTAAAGGCTATGA	0.413													4	2	---	---	---	---	
GOLGA1	2800	broad.mit.edu	37	9	127642033	127642034	+	3'UTR	DEL	AT	-	-	rs3832632		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127642033_127642034delAT	uc004bpc.2	-	23					GOLGA1_uc010mws.2_RNA	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97							Golgi cisterna membrane				ovary(1)	1						TACAGAAGACATGTTTATAGTA	0.337													0	7	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133360107	133360107	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133360107delT	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_Intron|ASS1_uc010mzc.2_Intron	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	TCTGTCACTGTTTTTTTTTTC	0.398													4	2	---	---	---	---	
DNLZ	728489	broad.mit.edu	37	9	139257226	139257229	+	Intron	DEL	AAAT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139257226_139257229delAAAT	uc004chf.1	-						DNLZ_uc011mdv.1_Intron	NM_001080849	NP_001074318	Q5SXM8	DNLZ_HUMAN	DNL-type zinc finger								metal ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.42e-06)|Epithelial(140;3.3e-06)		AAAATTTAACAAATAAAAACGCAC	0.358													2	5	---	---	---	---	
WDR37	22884	broad.mit.edu	37	10	1173759	1173760	+	Intron	INS	-	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1173759_1173760insG	uc001igf.1	+						WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CATGACGGCATGGGGCGTCTTC	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2588003	2588004	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2588003_2588004delAG								ADARB2 (808285 upstream) : PFKP (521748 downstream)																							agaaaaagacagagagagagag	0.371													4	2	---	---	---	---	
RBM17	84991	broad.mit.edu	37	10	6131411	6131412	+	Intron	INS	-	TCC	TCC	rs151234895	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6131411_6131412insTCC	uc001ijb.2	+						RBM17_uc010qav.1_5'UTR	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17						mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						ccctcttcccttcctcctcctc	0.559													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10293576	10293576	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10293576delA								None (None upstream) : SFTA1P (532826 downstream)																							gacagttgggaaaaaaaaaac	0.000													4	2	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11362790	11362790	+	Intron	DEL	T	-	-	rs150676695		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11362790delT	uc001iki.3	+						CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GCTACTAAGGTTTTTTTTTTT	0.433													3	3	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12399881	12399882	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12399881_12399882insT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		cttttcttttctttttttttGG	0.376													4	2	---	---	---	---	
APBB1IP	54518	broad.mit.edu	37	10	26784310	26784311	+	Intron	INS	-	CCTGTTC	CCTGTTC	rs143423534	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26784310_26784311insCCTGTTC	uc001iss.2	+						APBB1IP_uc001isr.2_Intron|APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						GTCTCTCTGTACCTCATTCCTG	0.431													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32352843	32352844	+	IGR	DEL	TG	-	-	rs146802214		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32352843_32352844delTG								KIF5B (7472 upstream) : EPC1 (205015 downstream)																							ctattgGCGAtgtgtgtgtgtg	0.069													3	3	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	35100026	35100027	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35100026_35100027insT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TCTCCTTCCCCTTTTGGTCACT	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37284983	37284989	+	IGR	DEL	CTCACGC	-	-	rs147354825		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37284983_37284989delCTCACGC								None (None upstream) : ANKRD30A (129796 downstream)																							ggcgcggtggctcacgcctgtattccc	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	39084527	39084528	+	IGR	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39084527_39084528insC								LOC399744 (343447 upstream) : None (None downstream)																							tccattcgagtaaatcctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42605816	42605816	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42605816delC								None (None upstream) : LOC441666 (221499 downstream)																							tttcttccttccttctttcca	0.129													5	4	---	---	---	---	
RASGEF1A	221002	broad.mit.edu	37	10	43713783	43713784	+	Intron	DEL	CC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43713783_43713784delCC	uc001jap.1	-						RASGEF1A_uc001jao.1_Intron	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						GAAGCTGCCTCCTGCTTCTAGG	0.594													4	2	---	---	---	---	
PTPN20B	26095	broad.mit.edu	37	10	46585058	46585058	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46585058delC	uc001jdc.1	-						PTPN20B_uc001jcz.1_Intron|PTPN20B_uc001jda.1_Intron|PTPN20B_uc001jdb.1_Intron|PTPN20B_uc001jdd.1_Intron|PTPN20B_uc001jde.1_Intron|PTPN20B_uc001jdf.1_Intron|PTPN20B_uc001jdg.1_Intron|PTPN20B_uc001jdh.1_Intron|PTPN20B_uc001jdi.1_Intron|PTPN20B_uc009xmw.1_Intron|PTPN20B_uc001jdj.1_Intron|PTPN20B_uc009xmx.1_Intron|PTPN20B_uc001jdk.1_Intron|PTPN20B_uc001jdl.1_Intron|PTPN20B_uc001jdm.1_Intron|PTPN20B_uc001jdn.1_Intron|PTPN20B_uc001jdo.1_Intron|PTPN20B_uc001jdp.1_Intron|PTPN20B_uc001jdr.1_Intron|PTPN20B_uc001jdq.1_Intron|PTPN20B_uc001jds.1_Intron|PTPN20A_uc001jdt.1_Intron|PTPN20B_uc001jdu.1_Intron	NM_001042389	NP_001035848	Q4JDL3	PTN20_HUMAN	protein tyrosine phosphatase, non-receptor type							microtubule|microtubule organizing center|nucleus	protein tyrosine phosphatase activity				0				Kidney(211;0.201)		aggtacctggccctgtttcag	0.095													4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47044403	47044404	+	Intron	INS	-	G	G	rs113776656		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47044403_47044404insG	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						AGCAATGGGAAAAACAAGGCAA	0.446													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467360	52467361	+	IGR	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467360_52467361delCA								SGMS1 (82437 upstream) : ASAH2B (32335 downstream)																							AGCTGATATCcacacacacaca	0.342													3	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	53695658	53695658	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53695658delA	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		caaatgatctaaaatgtatgg	0.000													4	2	---	---	---	---	
VPS26A	9559	broad.mit.edu	37	10	70925594	70925601	+	Intron	DEL	TGGGAGGC	-	-	rs66507021		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70925594_70925601delTGGGAGGC	uc001jpb.2	+						VPS26A_uc001jpc.2_Intron|VPS26A_uc009xqa.2_Intron|VPS26A_uc001jpd.2_Intron	NM_004896	NP_004887	O75436	VP26A_HUMAN	vacuolar protein sorting 26 A isoform 1						retrograde transport, endosome to Golgi|vacuolar transport	cytosol|endosome membrane|retromer complex|vesicle	protein binding|protein transporter activity				0						ctcagctacttgggaggctgaggcagaa	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	73645461	73645462	+	IGR	DEL	TA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73645461_73645462delTA								PSAP (34379 upstream) : CHST3 (78658 downstream)																							tacctgtgtgtatatatatata	0.064													4	2	---	---	---	---	
CHST3	9469	broad.mit.edu	37	10	73756184	73756184	+	Intron	DEL	C	-	-	rs72426005		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73756184delC	uc001jsn.2	+							NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						tctctACCAACCCCCCCCCAA	0.274													2	4	---	---	---	---	
CHST3	9469	broad.mit.edu	37	10	73765060	73765061	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73765060_73765061delTG	uc001jsn.2	+							NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						tgtgtgtgtctgtgtgtgtgtg	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	73782335	73782335	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73782335delC								CHST3 (9014 upstream) : SPOCK2 (36458 downstream)																							cgctgtgtcacccaggctgga	0.000													4	2	---	---	---	---	
PLA2G12B	84647	broad.mit.edu	37	10	74699011	74699013	+	Intron	DEL	CAA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74699011_74699013delCAA	uc001jtf.1	-						PLA2G12B_uc009xqt.1_Intron|PLA2G12B_uc010qjz.1_Intron	NM_032562	NP_115951	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB precursor						lipid catabolic process	extracellular region	calcium ion binding|phospholipase A2 activity			ovary(1)	1	Prostate(51;0.0198)					aaatctgttTCAACAACAACAAA	0.167													4	2	---	---	---	---	
FAM149B1	317662	broad.mit.edu	37	10	74948491	74948492	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74948491_74948492insA	uc009xqz.2	+						FAM149B1_uc010qkf.1_Intron|FAM149B1_uc001jtq.2_Intron	NM_173348	NP_775483	Q96BN6	F149B_HUMAN	hypothetical protein LOC317662												0						tcagaaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	76938961	76938961	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76938961delG								SAMD8 (2354 upstream) : VDAC2 (31602 downstream)																							aaaattagctgggcgtggtga	0.000													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78697686	78697687	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78697686_78697687delTG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	tgtgtgtgtttgtgtgtgtgtg	0.322													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81875581	81875581	+	IGR	DEL	T	-	-	rs111877075		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81875581delT								C10orf57 (23275 upstream) : PLAC9 (16677 downstream)																							TAAAACATACttttttttttt	0.050													4	2	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	83846967	83846983	+	Intron	DEL	ATTAAGACTTTATGGAC	-	-	rs11267507		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83846967_83846983delATTAAGACTTTATGGAC	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TGACAATTGTATTAAGACTTTATGGACATAAGACCTA	0.387													1	5	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100360886	100360888	+	Intron	DEL	TTG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100360886_100360888delTTG	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ggcagaatttttgttgttgttgt	0.000													4	2	---	---	---	---	
ENTPD7	57089	broad.mit.edu	37	10	101462505	101462505	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101462505delT	uc001kqa.3	+						ENTPD7_uc009xwl.2_Intron	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase							cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		GGTTTCTTTCTTTTTTTTTTT	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	109273503	109273503	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109273503delT								SORCS1 (349211 upstream) : None (None downstream)																							ATAAACACACTTTTTTTTTTT	0.393													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110388449	110388450	+	IGR	DEL	AC	-	-	rs113963927		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110388449_110388450delAC								None (None upstream) : None (None downstream)																							gacaattattacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110466591	110466592	+	IGR	INS	-	T	T	rs143877153	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110466591_110466592insT								None (None upstream) : None (None downstream)																							TTTTCAGCGCGTTTTTTTTTTC	0.351													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111285584	111285584	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111285584delG								None (None upstream) : XPNPEP1 (338940 downstream)																							CATAGAGTGTGGAATGGATCT	0.448													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112630639	112630640	+	5'Flank	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112630639_112630640delTG	uc001kzh.2	+						LOC282997_uc010qrd.1_RNA|PDCD4_uc001kzg.2_5'Flank|PDCD4_uc010qre.1_5'Flank	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AGTGAAGGTTtgtgtgtgtgtg	0.480													4	3	---	---	---	---	
NCRNA00081	92482	broad.mit.edu	37	10	112665334	112665334	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112665334delA	uc009xxw.2	-						NCRNA00081_uc001kzi.3_Intron|NCRNA00081_uc001kzj.3_Intron|NCRNA00081_uc001kzk.3_Intron|NCRNA00081_uc010qrf.1_Intron	NR_024143		A8MTZ0	BBIP1_HUMAN	Homo sapiens cDNA FLJ11439 fis, clone HEMBA1001299.						cilium assembly	BBSome|cilium|cytoplasm	protein binding				0						CCACCCCTCCAAAAAAAAAAA	0.244													4	2	---	---	---	---	
SFXN4	119559	broad.mit.edu	37	10	120918798	120918799	+	Intron	INS	-	A	A	rs142085154	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120918798_120918799insA	uc001leb.2	-						SFXN4_uc001ldy.2_Intron|SFXN4_uc001ldz.2_Intron|SFXN4_uc001lea.2_Intron	NM_213649	NP_998814	Q6P4A7	SFXN4_HUMAN	sideroflexin 4						iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		tctcgaaaaacaaaaaaaaccc	0.233													3	3	---	---	---	---	
PPAPDC1A	196051	broad.mit.edu	37	10	122270226	122270226	+	Intron	DEL	C	-	-	rs66518570		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122270226delC	uc001lev.1	+						PPAPDC1A_uc010qtd.1_Intron|PPAPDC1A_uc009xzl.1_Intron|PPAPDC1A_uc001lew.1_Intron|PPAPDC1A_uc001lex.1_Intron|PPAPDC1A_uc001ley.1_Intron	NM_001030059	NP_001025230	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain						phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		AAGTCGTTTTCCTAATGTGTT	0.433													2	4	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126287567	126287568	+	Intron	INS	-	CCAT	CCAT	rs142766017	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126287567_126287568insCCAT	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		tccatctctgcccatccatcca	0.158													5	3	---	---	---	---	
FAM53B	9679	broad.mit.edu	37	10	126407616	126407617	+	Intron	INS	-	A	A	rs141263082	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126407616_126407617insA	uc001lhv.1	-						FAM53B_uc001lhu.1_Intron|FAM53B_uc001lhw.2_Intron	NM_014661	NP_055476	Q14153	FA53B_HUMAN	hypothetical protein LOC9679											ovary(1)|pancreas(1)	2		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		acaaaaaaaataaaaaaaaaga	0.153													1	6	---	---	---	---	
CTBP2	1488	broad.mit.edu	37	10	126737688	126737690	+	Intron	DEL	ACA	-	-	rs141619498		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126737688_126737690delACA	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		acatacacacacaACACCCCTTT	0.335													3	3	---	---	---	---	
ADAM12	8038	broad.mit.edu	37	10	127824845	127824845	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127824845delA	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CACAGCTTACAAAAAGAAACC	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132604008	132604009	+	IGR	INS	-	AGAC	AGAC	rs141938721	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132604008_132604009insAGAC								GLRX3 (621224 upstream) : TCERG1L (286647 downstream)																							aagaagagaagagacacacaga	0.000													3	7	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133967584	133967585	+	Intron	INS	-	CAG	CAG	rs138366344	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133967584_133967585insCAG	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CCTCAGGTGCCCATGTGGGCCA	0.644													5	3	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134517010	134517011	+	Intron	DEL	CA	-	-	rs111386654		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134517010_134517011delCA	uc001llp.2	+						INPP5A_uc001llo.1_Intron|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TGTCTTcacccacacacacaca	0.450													4	4	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134581316	134581317	+	Intron	INS	-	TG	TG	rs149194617	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134581316_134581317insTG	uc001llp.2	+						INPP5A_uc001llo.1_Intron|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GGTGCCCACGCGCCCAGTGGCA	0.634													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134804277	134804278	+	IGR	INS	-	C	C	rs140343068	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134804277_134804278insC								C10orf93 (48213 upstream) : GPR123 (80155 downstream)																							CAGCCCCGAGACCCTGAGTGTG	0.693													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134824999	134825000	+	IGR	DEL	CG	-	-	rs118090500		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134824999_134825000delCG								C10orf93 (68935 upstream) : GPR123 (59433 downstream)																							gcttgtgtgACGTGTTTTAGCA	0.030													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135474674	135474675	+	IGR	DEL	AA	-	-	rs11499528		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135474674_135474675delAA								FRG2B (34375 upstream) : LOC653544 (15604 downstream)																							acacacacacaaacacacacac	0.233													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	350151	350152	+	IGR	INS	-	ACA	ACA	rs145863105		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:350151_350152insACA								IFITM3 (29237 upstream) : B4GALNT4 (19643 downstream)																							acacaacacacacacacacaca	0.010													3	3	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840578	840578	+	Intron	DEL	A	-	-	rs143525015	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840578delA	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGGCCTCACCCCCCCCGC	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	3590656	3590657	+	IGR	INS	-	C	C	rs142804195	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3590656_3590657insC								LOC650368 (160278 upstream) : TRPC2 (47805 downstream)																							GATGAGGGGGTCCCCACCCTTG	0.550													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	5114693	5114705	+	IGR	DEL	ATCGCTTTGGCCA	-	-	rs78460343	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5114693_5114705delATCGCTTTGGCCA								OR52E2 (33836 upstream) : OR52A4 (27189 downstream)																							TTTGTGACTCATCGCTTTGGCCAAAATGTGCCC	0.469													19	13	---	---	---	---	
TMEM41B	440026	broad.mit.edu	37	11	9311586	9311587	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9311586_9311587delAC	uc001mhm.2	-						TMEM41B_uc001mhn.1_Intron	NM_015012	NP_055827	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B isoform 1							integral to membrane					0				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		CAAAAACAAAacacacacacac	0.213													4	2	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17498869	17498870	+	5'Flank	INS	-	GTG	GTG	rs140985738	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17498869_17498870insGTG	uc001mnc.2	-						ABCC8_uc010rcy.1_5'Flank	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	AACGTTACCTTGTGGTGGTGGT	0.500													4	2	---	---	---	---	
USH1C	10083	broad.mit.edu	37	11	17517382	17517383	+	Intron	DEL	AT	-	-	rs138767394		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17517382_17517383delAT	uc001mnf.2	-						USH1C_uc001mne.2_Intron|USH1C_uc009yhb.2_Intron|USH1C_uc001mng.2_Intron|USH1C_uc001mnd.2_Intron	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						TCTCCAAGACATGTGTAGAGCT	0.614													1	6	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20029902	20029902	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20029902delA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						agactgtctcaaaaaaaaaaG	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24492143	24492144	+	IGR	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24492143_24492144delTC								None (None upstream) : LUZP2 (26412 downstream)																							aaaatgtgagtctgctgctgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	35044455	35044455	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35044455delA								PDHX (26781 upstream) : CD44 (115962 downstream)																							taacaaagagaaaggaatagc	0.000													1	5	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	40879564	40879565	+	Intron	INS	-	C	C	rs57379567		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40879564_40879565insC	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				agggacaaggaaaggaagggaa	0.089													4	2	---	---	---	---	
OR4C3	256144	broad.mit.edu	37	11	48345294	48345294	+	5'Flank	DEL	G	-	-	rs33989772		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48345294delG	uc010rhv.1	+							NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						gggaggaaacgttaactgtta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50473122	50473123	+	IGR	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50473122_50473123insC								LOC646813 (93319 upstream) : OR4A5 (938325 downstream)																							ccccccaaaatccagccataaa	0.000													4	4	---	---	---	---	
SLC43A3	29015	broad.mit.edu	37	11	57177844	57177844	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57177844delT	uc001nkg.2	-						PRG2_uc001nke.2_Intron|SLC43A3_uc001nkh.2_Intron|SLC43A3_uc010rjr.1_Intron|SLC43A3_uc009yme.2_Intron|SLC43A3_uc001nki.2_Intron	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3						transmembrane transport	integral to membrane				central_nervous_system(1)	1						tcatcctagctttaaactacc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61788170	61788171	+	IGR	DEL	AA	-	-	rs150834492		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61788170_61788171delAA								FTH1 (53038 upstream) : INCENP (103274 downstream)																							acaccatctcaaaaaaaaaaaa	0.183													4	2	---	---	---	---	
STX5	6811	broad.mit.edu	37	11	62590652	62590653	+	Intron	INS	-	T	T	rs71458442		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62590652_62590653insT	uc001nvh.2	-						STX5_uc010rmi.1_Intron|STX5_uc009yoh.2_Intron|STX5_uc001nvi.2_Intron|STX5_uc010rmj.1_Intron|STX5_uc001nvj.2_Intron	NM_003164	NP_003155	Q13190	STX5_HUMAN	syntaxin 5						intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2						tagtcactttcttttttttttt	0.000													3	3	---	---	---	---	
SLC3A2	6520	broad.mit.edu	37	11	62628788	62628788	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62628788delA	uc001nwd.2	+						SLC3A2_uc001nwb.2_Intron|SLC3A2_uc001nwc.2_Intron|SLC3A2_uc001nwe.2_Intron|SLC3A2_uc001nwf.2_Intron	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c						blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						gccctgtctcaaaaaaaaaaG	0.045													4	2	---	---	---	---	
CDC42BPG	55561	broad.mit.edu	37	11	64612977	64612978	+	5'Flank	INS	-	TGTCCAGCTG	TGTCCAGCTG	rs151315089	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64612977_64612978insTGTCCAGCTG	uc001obs.3	-							NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						TTTCTGATTTCTGTCCAGCTGG	0.485													3	3	---	---	---	---	
PC	5091	broad.mit.edu	37	11	66645483	66645484	+	Intron	INS	-	A	A	rs143883950		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66645483_66645484insA	uc001ojn.1	-						PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor						gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	TTTATAATTAGAAAAAAAAGAA	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69030784	69030784	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69030784delC								TPCN2 (100877 upstream) : MYEOV (30838 downstream)																							atccatccatccatccatcct	0.000													2	4	---	---	---	---	
FGF3	2248	broad.mit.edu	37	11	69628573	69628576	+	Intron	DEL	TGGG	-	-	rs149220036	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69628573_69628576delTGGG	uc001oph.2	-							NM_005247	NP_005238	P11487	FGF3_HUMAN	fibroblast growth factor 3 precursor						fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			gatggatggatgggtggatgggtg	0.000													5	8	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70608024	70608026	+	Intron	DEL	GCT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70608024_70608026delGCT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			caagttcccGgctgctgctgctg	0.320													4	2	---	---	---	---	
PAK1	5058	broad.mit.edu	37	11	77164991	77164991	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77164991delG	uc001oyh.3	-						PAK1_uc001oyg.3_Intron	NM_002576	NP_002567	Q13153	PAK1_HUMAN	p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)					aactgggtatggtggcacgtg	0.000													4	2	---	---	---	---	
KCTD21	283219	broad.mit.edu	37	11	77893687	77893687	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77893687delA	uc001ozb.2	-							NM_001029859	NP_001025030	Q4G0X4	KCD21_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			tctttgtttcaaagacaacct	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88093311	88093311	+	IGR	DEL	T	-	-	rs67536232		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88093311delT								CTSC (22370 upstream) : GRM5 (144434 downstream)																							CATCTATTGCTTTTTTTTTTT	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88869586	88869587	+	IGR	DEL	AC	-	-	rs146148746		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88869586_88869587delAC								GRM5 (70473 upstream) : TYR (41453 downstream)																							AGAGATTATTacacacacacac	0.193													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	94733394	94733395	+	IGR	INS	-	AG	AG			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94733394_94733395insAG								KDM4D (720 upstream) : KDM4DL (25027 downstream)																							gagcaggagaaagagagagggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	98001221	98001222	+	IGR	INS	-	A	A	rs140908201	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98001221_98001222insA								None (None upstream) : CNTN5 (890649 downstream)																							GGCTTTCCTACAAAAAACATAG	0.381													5	3	---	---	---	---	
CASP4	837	broad.mit.edu	37	11	104822634	104822635	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104822634_104822635delTT	uc001pid.1	-	3	433_434	c.360_361delAA	c.(358-363)GAAAGAfs	p.E120fs	CASP4_uc001pib.1_Frame_Shift_Del_p.E64fs|CASP4_uc009yxg.1_Frame_Shift_Del_p.E29fs|CASP4_uc010rux.1_Frame_Shift_Del_p.E120fs|CASP4_uc010ruy.1_Frame_Shift_Del_p.E120fs	NM_001225	NP_001216	P49662	CASP4_HUMAN	caspase 4 isoform alpha precursor	120_121					apoptosis|induction of apoptosis|proteolysis	intracellular	cysteine-type endopeptidase activity|protein binding			lung(2)|ovary(1)|skin(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TCTTCAGCTCTTTCTTTACATA	0.406													24	12	---	---	---	---	
PPP2R1B	5519	broad.mit.edu	37	11	111628913	111628914	+	Intron	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111628913_111628914insC	uc001plx.1	-						PPP2R1B_uc001plw.1_Intron|PPP2R1B_uc010rwi.1_Intron|PPP2R1B_uc010rwj.1_Intron|PPP2R1B_uc010rwk.1_Intron|PPP2R1B_uc010rwl.1_Intron	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein								protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		ttcacctatttcttttttctta	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115715384	115715384	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115715384delC								CADM1 (340143 upstream) : BUD13 (903504 downstream)																							cagtgtatttccaggatgcag	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	117707477	117707479	+	IGR	DEL	AGG	-	-	rs141717345		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117707477_117707479delAGG								FXYD2 (8670 upstream) : FXYD6 (214 downstream)																							agggctgagcaggaggagaggaa	0.291													5	4	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118385155	118385156	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118385155_118385156insT	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		ATCCATGTGTCttttttttttt	0.233			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126367006	126367007	+	Intron	DEL	TG	-	-	rs72306549		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126367006_126367007delTG	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CCTGCTTGGCtgtgtgtgtgtg	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129604016	129604017	+	IGR	INS	-	T	T	rs72514247		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129604016_129604017insT								BARX2 (281843 upstream) : TMEM45B (81724 downstream)																							TTTCCCCCCCCGCTGCCTTCAA	0.569													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	130590042	130590045	+	IGR	DEL	ACAG	-	-	rs72423917		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130590042_130590045delACAG								ADAMTS15 (246327 upstream) : SNX19 (155722 downstream)																							TACGAAGCACACAGACACACGGGG	0.510													4	4	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131292104	131292104	+	Intron	DEL	A	-	-	rs71475755		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131292104delA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ATCTGAGAACAGTCACATTTG	0.483													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	133580545	133580545	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133580545delA								OPCML (178142 upstream) : SPATA19 (129972 downstream)																							ttgtgaagctaaaaacaggag	0.000													4	2	---	---	---	---	
PRMT8	56341	broad.mit.edu	37	12	3495889	3495889	+	Intron	DEL	C	-	-	rs10774141	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3495889delC	uc009zed.2	+							NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			ttctttctttctttttttatg	0.134													4	2	---	---	---	---	
PARP11	57097	broad.mit.edu	37	12	3932678	3932679	+	Intron	INS	-	T	T	rs147303020	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3932678_3932679insT	uc001qmk.1	-						PARP11_uc001qml.2_Intron|PARP11_uc009zef.2_Intron|PARP11_uc001qmm.2_Intron|PARP11_uc001qmn.2_Intron	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11								NAD+ ADP-ribosyltransferase activity			ovary(1)|central_nervous_system(1)	2			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			tacacactcagtaagtactgga	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5291785	5291786	+	IGR	DEL	AG	-	-	rs112351399		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5291785_5291786delAG								KCNA5 (135837 upstream) : NTF3 (249494 downstream)																							TTCAAGGATTAGAGAGAGAGAG	0.495													4	2	---	---	---	---	
NTF3	4908	broad.mit.edu	37	12	5596047	5596048	+	Intron	DEL	GT	-	-	rs111941703		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5596047_5596048delGT	uc001qnk.3	+							NM_001102654	NP_001096124	P20783	NTF3_HUMAN	neurotrophin 3 isoform 1 preproprotein						signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						TAGTTACGTGgtgtgtgtgtgt	0.292													4	2	---	---	---	---	
PLEKHA5	54477	broad.mit.edu	37	12	19506396	19506397	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19506396_19506397insT	uc001reb.2	+						PLEKHA5_uc010sie.1_Intron|PLEKHA5_uc001rea.2_Intron|PLEKHA5_uc009zin.2_Intron|PLEKHA5_uc010sif.1_Intron|PLEKHA5_uc010sig.1_Intron|PLEKHA5_uc010sih.1_Intron|PLEKHA5_uc001rec.1_Intron|PLEKHA5_uc009zio.2_Intron	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A								1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					cagccTGACTCtttttttttta	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	20088934	20088934	+	IGR	DEL	A	-	-	rs35812407		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20088934delA								AEBP2 (413761 upstream) : PDE3A (433263 downstream)																							ctcagaggagatacatgtaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22740666	22740666	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22740666delT								KIAA0528 (43214 upstream) : ETNK1 (37410 downstream)																							GTATTTCTTCTTTTTTTTTTT	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	29144145	29144145	+	IGR	DEL	A	-	-	rs74431291		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29144145delA								CCDC91 (441047 upstream) : FAR2 (158087 downstream)																							CAAGCAGACCAACTCTTCCTT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38002010	38002010	+	IGR	DEL	A	-	-	rs61921089	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38002010delA								None (None upstream) : ALG10B (708547 downstream)																							tgaggccttcattggaaacgg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47755957	47755958	+	IGR	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47755957_47755958delTC								FAM113B (125516 upstream) : RPAP3 (299758 downstream)																							tggagttgcttctctctctctc	0.000													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48271994	48271995	+	Intron	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48271994_48271995delTC	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	TTCAGGCTATTCTCTCTCTCTC	0.480													3	3	---	---	---	---	
KRT8	3856	broad.mit.edu	37	12	53291008	53291009	+	3'UTR	DEL	AA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53291008_53291009delAA	uc001sbd.2	-	8					KRT8_uc009zmj.2_3'UTR|KRT8_uc009zmk.1_3'UTR|KRT8_uc009zml.1_3'UTR|KRT8_uc009zmm.1_3'UTR	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8						cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATTTTGGACCAAAAAAAAAAAG	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54081051	54081052	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54081051_54081052insT								ATP5G2 (10539 upstream) : CALCOCO1 (23851 downstream)																							AAAAAATATGATTTTTTTTTGG	0.356													4	2	---	---	---	---	
R3HDM2	22864	broad.mit.edu	37	12	57812055	57812055	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57812055delT	uc001snt.2	-						R3HDM2_uc001sns.2_Intron|R3HDM2_uc009zpo.1_Intron	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2							nucleus	nucleic acid binding			ovary(2)	2						TCATCTGCTCTTTTCAGCTCT	0.229													4	2	---	---	---	---	
RAB21	23011	broad.mit.edu	37	12	72147873	72147873	+	5'Flank	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72147873delC	uc001swt.2	+							NM_014999	NP_055814	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0						tacaaacaaacaaaaaagaaT	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72448185	72448188	+	IGR	DEL	TCCA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72448185_72448188delTCCA								TPH2 (21964 upstream) : LOC283392 (208140 downstream)																							TTATCTTTATtccatccatccatc	0.294													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	81369877	81369877	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81369877delC								LIN7A (38183 upstream) : ACSS3 (101932 downstream)																							tcataagcctccatacctact	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89320256	89320257	+	IGR	DEL	AC	-	-	rs113164631		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89320256_89320257delAC								KITLG (346018 upstream) : DUSP6 (421582 downstream)																							GTAAACTCAAacacacacacac	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93595304	93595304	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93595304delT								EEA1 (272197 upstream) : NUDT4 (176397 downstream)																							gttttttttgtttttttttgt	0.030													4	2	---	---	---	---	
CRADD	8738	broad.mit.edu	37	12	94073258	94073258	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94073258delG	uc001tda.2	+						CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with						apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						ATGTAAGGCAGGACAAGGGTC	0.338													4	2	---	---	---	---	
NDUFA12	55967	broad.mit.edu	37	12	95377671	95377672	+	Intron	INS	-	GACATCT	GACATCT	rs149656985	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95377671_95377672insGACATCT	uc001tdl.2	-							NM_018838	NP_061326	Q9UI09	NDUAC_HUMAN	13kDa differentiation-associated protein						respiratory electron transport chain|respiratory gaseous exchange|response to oxidative stress|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	CGAGGAATGTAGCACTTGGTAT	0.371													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103315974	103315974	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103315974delT								PAH (4593 upstream) : ASCL1 (35478 downstream)																							aaatcttgccttttttttttt	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108647167	108647168	+	IGR	DEL	TC	-	-	rs151129717		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108647167_108647168delTC								WSCD2 (2856 upstream) : CMKLR1 (34654 downstream)																							CTCCCCCTTTTCTCTCTCTGTT	0.510													4	3	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881161	109881166	+	Intron	DEL	ACACAC	-	-	rs10545297		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881161_109881166delACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						gtgtgtatatacacacacacacacac	0.112													4	2	---	---	---	---	
MAPKAPK5	8550	broad.mit.edu	37	12	112319603	112319603	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112319603delG	uc001tta.2	+						MAPKAPK5_uc001tsz.2_Intron|MAPKAPK5_uc001ttb.2_Intron	NM_139078	NP_620777	Q8IW41	MAPK5_HUMAN	MAP kinase-activated protein kinase 5 isoform 2						signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)	3						GATGCTACTTGGGGACTTGAG	0.438													4	2	---	---	---	---	
NAA25	80018	broad.mit.edu	37	12	112473139	112473139	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112473139delT	uc001ttm.2	-						NAA25_uc001ttn.3_Intron	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						TTTGCCCTCCTtttttttttc	0.204													4	2	---	---	---	---	
C12orf51	283450	broad.mit.edu	37	12	112685781	112685782	+	Intron	INS	-	AC	AC	rs151176253	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112685781_112685782insAC	uc009zwc.2	-							NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TTATTTTACCTacacacacaca	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114559148	114559148	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114559148delT								RBM19 (154972 upstream) : TBX5 (232588 downstream)																							CCCACGATGCTTATCAAGAGT	0.413													4	2	---	---	---	---	
C12orf49	79794	broad.mit.edu	37	12	117175346	117175350	+	Intron	DEL	GAGGA	-	-	rs78813089		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117175346_117175350delGAGGA	uc001tvz.1	-						RNFT2_uc009zwn.2_5'Flank|RNFT2_uc001twb.3_5'Flank|RNFT2_uc001twa.3_5'Flank|C12orf49_uc009zwm.1_Intron	NM_024738	NP_079014	Q9H741	CL049_HUMAN	hypothetical protein LOC79794 precursor							extracellular region				ovary(1)	1	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		ggaggaaggtgaggaaggtaaggaa	0.000													4	2	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131470564	131470564	+	Intron	DEL	T	-	-	rs139868024		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131470564delT	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		cccacagatctattcatctgt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132373775	132373775	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132373775delT								MMP17 (37459 upstream) : ULK1 (5504 downstream)																							cactccagcctgggctacaga	0.000													4	2	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133780828	133780829	+	Frame_Shift_Ins	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133780828_133780829insC	uc010tcf.1	+	6	2886_2887	c.2556_2557insC	c.(2554-2559)CTTGTAfs	p.L852fs	ZNF268_uc010tbv.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tbw.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tbx.1_Frame_Shift_Ins_p.L712fs|ZNF268_uc010tby.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tbz.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tca.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tcb.1_Frame_Shift_Ins_p.L712fs|ZNF268_uc010tcc.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tcd.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tce.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tcg.1_Frame_Shift_Ins_p.L691fs|ZNF268_uc010tch.1_Frame_Shift_Ins_p.L852fs	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a	852_853	C2H2-type 21.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TACGCCTTCTTGTACACCAGAG	0.411													4	2	---	---	---	---	
DKFZp686A1627	266695	broad.mit.edu	37	13	19649092	19649093	+	Intron	INS	-	CAC	CAC			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19649092_19649093insCAC	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0						atcatcatcctcaccatcatca	0.198													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23497336	23497336	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23497336delT								None (None upstream) : SGCG (257724 downstream)																							ctcccattactgggtatatac	0.000													4	2	---	---	---	---	
SACS	26278	broad.mit.edu	37	13	23996802	23996802	+	Intron	DEL	T	-	-	rs68157289		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23996802delT	uc001uon.2	-						uc001uor.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin						cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GTGGTGtttcttttttttttt	0.080													3	3	---	---	---	---	
FLT1	2321	broad.mit.edu	37	13	28932005	28932006	+	Intron	INS	-	TTT	TTT	rs71190777		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28932005_28932006insTTT	uc001usb.3	-							NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	cttttctttccttttttttttt	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31424435	31424436	+	IGR	DEL	AT	-	-	rs56404229		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31424435_31424436delAT								ALOX5AP (85879 upstream) : C13orf33 (55876 downstream)																							aagtgaaaacatgtggtatttg	0.000													1	7	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32753640	32753641	+	Intron	INS	-	TG	TG	rs149633784	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32753640_32753641insTG	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGTATTAAATTtgtgtgtgtgt	0.248													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	38559410	38559410	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38559410delA								TRPC4 (115471 upstream) : UFM1 (364532 downstream)																							gggaagaaggaaaggaaggaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	40384942	40384943	+	IGR	INS	-	A	A	rs149484075	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40384942_40384943insA								COG6 (19140 upstream) : LOC646982 (536330 downstream)																							CACCTCCCCCCCCAACACCAAA	0.515													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49062138	49062138	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49062138delA								RB1 (6114 upstream) : RCBTB2 (963 downstream)																							acagtttcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	50519371	50519372	+	IGR	INS	-	T	T	rs139301774	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50519371_50519372insT								C13orf1 (8746 upstream) : DLEU2 (37316 downstream)																							ttatttatctgttttttttttg	0.005													3	3	---	---	---	---	
TRIM13	10206	broad.mit.edu	37	13	50579812	50579812	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50579812delA	uc001vdq.1	+						DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|TRIM13_uc001vdp.1_Intron|TRIM13_uc001vdr.1_Intron|TRIM13_uc001vds.1_Intron	NM_052811	NP_434698	O60858	TRI13_HUMAN	ret finger protein 2 isoform 1						anatomical structure morphogenesis|ER-associated protein catabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination	cytoplasm|endoplasmic reticulum membrane|integral to membrane	protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		ctccatctctaaaaaaaaaag	0.114													4	3	---	---	---	---	
GUCY1B2	2974	broad.mit.edu	37	13	51589137	51589138	+	Intron	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51589137_51589138delCA	uc001vfc.3	-							NR_003923				Homo sapiens soluble guanylyl cyclase subunit beta 2 (GUCY1B2) mRNA, complete cds.												0						cacacacacgcacacacacaca	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	58350373	58350373	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58350373delT								PCDH17 (47308 upstream) : None (None downstream)																							atcttctctcttttttttttc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	61219165	61219165	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61219165delG								TDRD3 (71153 upstream) : PCDH20 (764656 downstream)																							gaggtcaagagggggttgaac	0.000													2	5	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74618998	74618998	+	Intron	DEL	A	-	-	rs34045412		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74618998delA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		agaaagtctcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	75133385	75133385	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75133385delA								KLF12 (424991 upstream) : LOC647288 (678505 downstream)																							cattctatttattacgcatgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80475878	80475878	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80475878delC	uc001vlh.2	+											Homo sapiens cDNA clone IMAGE:4825993.																		ttgcttctggccagacttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80759400	80759401	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80759400_80759401insA								NDFIP2 (629195 upstream) : SPRY2 (150713 downstream)																							cagtcccaacctcaagcatcgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86922266	86922267	+	IGR	INS	-	GTGA	GTGA	rs151014959	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86922266_86922267insGTGA								SLITRK6 (548783 upstream) : None (None downstream)																							TGCTTACGTGTGTATGTGTGCA	0.312													3	3	---	---	---	---	
TPP2	7174	broad.mit.edu	37	13	103269262	103269262	+	Intron	DEL	T	-	-	rs111970507		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103269262delT	uc001vpi.3	+							NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ttgttttttgttttttgtttt	0.005													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111133940	111133940	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111133940delT	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TGTCCCTCCGTTGCTGGAGAC	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19000528	19000528	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19000528delT								None (None upstream) : OR11H12 (377066 downstream)																							ttctgtctactttttatgtga	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19003502	19003502	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19003502delA								None (None upstream) : OR11H12 (374092 downstream)																							cagatcctataaagagagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19044801	19044802	+	IGR	INS	-	AA	AA	rs144525371		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19044801_19044802insAA								None (None upstream) : OR11H12 (332792 downstream)																							agagaatctacaaagagtgttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19698789	19698789	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19698789delA								POTEG (113847 upstream) : P704P (285165 downstream)																							GAACCTTGTTAAAAAAAACTC	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20158223	20158224	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20158223_20158224delAG								P704P (137951 upstream) : OR4Q3 (57363 downstream)																							AGAGAAAAACAGAGAGATGCTG	0.401													3	4	---	---	---	---	
HNRNPC	3183	broad.mit.edu	37	14	21701196	21701196	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21701196delA	uc001vzy.2	-						HNRNPC_uc001vzw.2_Intron|HNRNPC_uc001wad.2_Intron|HNRNPC_uc001vzx.2_Intron|HNRNPC_uc001vzz.2_Intron|HNRNPC_uc001waa.2_Intron|HNRNPC_uc010ail.2_Intron|HNRNPC_uc010tlq.1_Intron|HNRNPC_uc001wab.2_Intron|HNRNPC_uc001wac.2_Intron|HNRNPC_uc010tlr.1_5'Flank|HNRNPC_uc001waf.2_Intron|HNRNPC_uc001wae.2_Intron	NM_031314	NP_112604	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C							catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding				0	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		actctgtctcaaaaaaaaaaa	0.144													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28183587	28183588	+	IGR	DEL	AG	-	-	rs141653260		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28183587_28183588delAG								None (None upstream) : None (None downstream)																							TCTAGAGAATagagagagagag	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28189325	28189325	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28189325delT								None (None upstream) : None (None downstream)																							CATCCTTCTCTTTTTTTTGAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34702135	34702135	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34702135delA								EGLN3 (281848 upstream) : C14orf147 (200010 downstream)																							ataaaagcataaaaaaaAAGG	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	41640411	41640411	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41640411delC								None (None upstream) : LRFN5 (436353 downstream)																							AAGGCAGTGACTTCAATTCTG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	48218760	48218760	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48218760delA								MDGA2 (74772 upstream) : None (None downstream)																							catctcaattaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49417666	49417666	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49417666delC								None (None upstream) : SDCCAG1 (615361 downstream)																							gagagaaagacaagaaggtgt	0.000													4	2	---	---	---	---	
C14orf33	100129075	broad.mit.edu	37	14	56038970	56038971	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56038970_56038971insT	uc001xbz.2	-											Homo sapiens cDNA FLJ42937 fis, clone BRSSN2014556.												0						ttggaagtaactttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	58028438	58028438	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58028438delA								C14orf105 (67862 upstream) : SLC35F4 (2202 downstream)																							CAGTTTGGGTAGGGGGGCCAT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	63798610	63798610	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63798610delG								GPHB5 (14047 upstream) : PPP2R5E (42745 downstream)																							caggaaagctgagagaaccca	0.000													4	2	---	---	---	---	
C14orf50	145376	broad.mit.edu	37	14	65030172	65030173	+	Intron	INS	-	A	A	rs144658648		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65030172_65030173insA	uc001xhl.1	+							NM_172365	NP_758953	Q96LQ0	CN050_HUMAN	hypothetical protein LOC145376											skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)		CCAGTCATCTTAAAAAAAAAAA	0.361													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	67901688	67901688	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67901688delT								PLEK2 (22860 upstream) : TMEM229B (19109 downstream)																							tctctctctcttttttttttt	0.000													4	2	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72860421	72860421	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72860421delA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		GAATATAGGTAGTGAGACTGA	0.403													4	2	---	---	---	---	
DPF3	8110	broad.mit.edu	37	14	73223001	73223002	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73223001_73223002delAC	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ATGCACAAAGACACACACACAC	0.450													4	2	---	---	---	---	
GTF2A1	2957	broad.mit.edu	37	14	81648445	81648445	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81648445delA	uc001xvf.1	-						GTF2A1_uc010atb.1_Intron|GTF2A1_uc001xvg.1_Intron|uc001xve.1_5'Flank	NM_015859	NP_056943	P52655	TF2AA_HUMAN	TFIIA alpha, p55 isoform 1						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)		tttgagacttaaaaaaaaaaa	0.050													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84091605	84091610	+	IGR	DEL	GTGTGT	-	-	rs138724409		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84091605_84091610delGTGTGT								None (None upstream) : None (None downstream)																							TAAATCgtgcgtgtgtgtgtgtgtgt	0.311													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	85720425	85720426	+	IGR	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85720425_85720426delCA								None (None upstream) : FLRT2 (276062 downstream)																							ACAACGCGCGcacacacacaca	0.257													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	88092052	88092053	+	IGR	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88092052_88092053delTG								None (None upstream) : GALC (212111 downstream)																							TATATACATAtgtgtgtgtgtg	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	88486140	88486140	+	IGR	DEL	A	-	-	rs35649507		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88486140delA								GPR65 (7726 upstream) : KCNK10 (160314 downstream)																							CATCTACCAGAAAAAAAGGTA	0.373													4	3	---	---	---	---	
TDP1	55775	broad.mit.edu	37	14	90454415	90454415	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90454415delA	uc001xxy.2	+						TDP1_uc010atm.2_Intron|TDP1_uc001xxz.2_Intron|TDP1_uc010atn.2_Intron|TDP1_uc001xya.2_Intron|TDP1_uc001xyb.2_Intron|TDP1_uc010ato.2_Intron|TDP1_uc001xyd.1_Intron	NM_018319	NP_060789	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1						cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		gaactcagggaaacacttaac	0.000								Repair_of_DNA-protein_crosslinks					4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92413361	92413361	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92413361delC	uc001xzx.3	-						FBLN5_uc010aud.2_5'Flank|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				AATACCCACTCCCAAAAGAAC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93368729	93368730	+	IGR	DEL	CT	-	-	rs111421122	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93368729_93368730delCT								GOLGA5 (62425 upstream) : CHGA (20715 downstream)																							cctcttcctcctctcctcctcc	0.144													4	2	---	---	---	---	
IFI27L2	83982	broad.mit.edu	37	14	94595283	94595284	+	Intron	DEL	TG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94595283_94595284delTG	uc001ycq.2	-							NM_032036	NP_114425	Q9H2X8	I27L2_HUMAN	TLH29 protein precursor							integral to membrane					0						gtctcaaatttgtgtgtgtgtg	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95340402	95340402	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95340402delG								GSC (103903 upstream) : DICER1 (212163 downstream)																							CTGTGGTCCAGGCCACCTGTG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97150376	97150376	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97150376delA								PAPOLA (116930 upstream) : VRK1 (113308 downstream)																							GTGTGGGGGCAAGAGGTGGCA	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99781030	99781031	+	IGR	DEL	CT	-	-	rs61984061		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99781030_99781031delCT								BCL11B (43208 upstream) : SETD3 (83053 downstream)																							ctgtgtctccctctctctctct	0.465													6	3	---	---	---	---	
CCDC85C	317762	broad.mit.edu	37	14	100044255	100044256	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100044255_100044256delGT	uc010avr.2	-							NM_001144995	NP_001138467	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C												0						TCCCCCATCAgtgtgtgtgtgt	0.470													4	2	---	---	---	---	
RAGE	5891	broad.mit.edu	37	14	102755588	102755589	+	Intron	INS	-	A	A	rs35083800		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102755588_102755589insA	uc001ylm.2	-						RAGE_uc010txv.1_Intron|RAGE_uc001yln.2_Intron	NM_014226	NP_055041	Q9UQ07	MOK_HUMAN	MAPK/MAK/MRK overlapping kinase						signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						aataaaatcagaaaaaaaAAAC	0.158													4	2	---	---	---	---	
ZNF839	55778	broad.mit.edu	37	14	102789356	102789359	+	Intron	DEL	ACAG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102789356_102789359delACAG	uc001ylo.2	+						ZNF839_uc010awk.1_Intron|ZNF839_uc001ylp.2_Intron|ZNF839_uc001ylq.1_5'Flank|ZNF839_uc001ylr.2_5'Flank	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839							intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						TACTAGTATAACAGACAGACGAGA	0.475											OREG0022942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106087953	106087954	+	Intron	INS	-	CAC	CAC	rs66932006		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106087953_106087954insCAC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0						GGGATGCCGGTTACCTCCTTTT	0.653													6	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106784710	106784710	+	Intron	DEL	A	-	-	rs66714645		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106784710delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						actaacagagaaaaaaatcaa	0.010													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106785241	106785241	+	Intron	DEL	A	-	-	rs10715730		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106785241delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TGTGTGACAGAAGAGAGAAGG	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20001139	20001140	+	IGR	INS	-	G	G	rs149747898		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20001139_20001140insG								None (None upstream) : GOLGA6L6 (735954 downstream)																							tcaaaagaaatttcaaatcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21921189	21921192	+	IGR	DEL	TTAG	-	-	rs75537979		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21921189_21921192delTTAG								NF1P1 (786564 upstream) : LOC646214 (11322 downstream)																							TAACATAGCATTAGTTAGTTCAGT	0.377													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23728652	23728654	+	IGR	DEL	CTT	-	-	rs140580953		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23728652_23728654delCTT								GOLGA8E (280229 upstream) : MKRN3 (81800 downstream)																							tgagagactacttctctgaactc	0.000													2	6	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	27131162	27131163	+	Intron	INS	-	TGT	TGT	rs148643056	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27131162_27131163insTGT	uc001zbb.2	-						GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATGCAGTttgctgttgttgttg	0.173													3	4	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33935552	33935553	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33935552_33935553insT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGTGTTGCTGATTTGTTGGTCC	0.446													4	2	---	---	---	---	
TP53BP1	7158	broad.mit.edu	37	15	43723859	43723859	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43723859delA	uc001zrs.2	-						TP53BP1_uc010udp.1_Intron|TP53BP1_uc001zrq.3_Intron|TP53BP1_uc001zrr.3_Intron|TP53BP1_uc010udq.1_Intron	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTTCTAGTCTAGCCTCTCTTC	0.443								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
CASC4	113201	broad.mit.edu	37	15	44591496	44591497	+	Intron	INS	-	T	T	rs59859293	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44591496_44591497insT	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron|CASC4_uc010bdu.1_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		AATTGtttttgttttttttttt	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45081750	45081751	+	IGR	DEL	CT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45081750_45081751delCT								TRIM69 (21725 upstream) : C15orf43 (167152 downstream)																							acAAACTCACCTCTCTCTCTCT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53623164	53623164	+	IGR	DEL	G	-	-	rs5812677		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53623164delG								ONECUT1 (540955 upstream) : WDR72 (182774 downstream)																							AACTCGACTTGGAGGATGAAA	0.403													4	3	---	---	---	---	
CALML4	91860	broad.mit.edu	37	15	68486010	68486010	+	3'UTR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68486010delG	uc002arb.2	-	5					CALML4_uc002arc.2_3'UTR|CALML4_uc002ard.2_RNA|CALML4_uc002are.2_RNA|CALML4_uc010bhz.2_RNA	NM_033429	NP_219501	Q96GE6	CALL4_HUMAN	calmodulin-like 4 isoform 1								calcium ion binding				0						CAGCTTGTGTGGGggggcttt	0.234													4	2	---	---	---	---	
NPTN	27020	broad.mit.edu	37	15	73889753	73889753	+	Intron	DEL	A	-	-	rs77070628		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73889753delA	uc002avs.2	-						NPTN_uc010bjc.2_Intron|NPTN_uc002avt.2_Intron|NPTN_uc002avr.2_Intron|NPTN_uc010ula.1_Intron	NM_012428	NP_036560	Q9Y639	NPTN_HUMAN	neuroplastin isoform b precursor						elevation of cytosolic calcium ion concentration|homophilic cell adhesion|long-term synaptic potentiation|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of long-term neuronal synaptic plasticity|positive regulation of neuron projection development|positive regulation of protein phosphorylation	integral to membrane|plasma membrane|presynaptic membrane	cell adhesion molecule binding|type 1 fibroblast growth factor receptor binding				0						GGCCAATCAGAAAAAAAAAAA	0.393													4	2	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	76737824	76737824	+	Intron	DEL	G	-	-	rs76271791	byFrequency	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76737824delG	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ctgttctgatggggggcaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78534849	78534849	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78534849delC								ACSBG1 (7950 upstream) : DNAJA4 (21638 downstream)																							ttttttttttccctgattctt	0.010													4	2	---	---	---	---	
IQGAP1	8826	broad.mit.edu	37	15	90956763	90956763	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90956763delT	uc002bpl.1	+							NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			tgataaatgattacattttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93585587	93585588	+	IGR	INS	-	T	T	rs145812568	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93585587_93585588insT								CHD2 (14351 upstream) : RGMA (1049 downstream)																							ATACCACCCCCTCCCTCCCCAC	0.342													3	3	---	---	---	---	
MEF2A	4205	broad.mit.edu	37	15	100128149	100128150	+	Intron	INS	-	GAC	GAC	rs145402810	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100128149_100128150insGAC	uc002bve.2	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bvg.2_Intron	NM_001130926	NP_001124398	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 2						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			ccactgcttaggaccttcagta	0.000													4	3	---	---	---	---	
SRRM2	23524	broad.mit.edu	37	16	2806345	2806346	+	5'UTR	INS	-	C	C			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2806345_2806346insC	uc002crk.2	+	2					SRRM2_uc002crj.1_Intron|SRRM2_uc002crl.1_5'UTR|SRRM2_uc010bsu.1_Intron	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300							Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GAGCGGTGGTGCCCCCCCCGGG	0.708													6	3	---	---	---	---	
CREBBP	1387	broad.mit.edu	37	16	3921125	3921125	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3921125delA	uc002cvv.2	-						CREBBP_uc002cvw.2_Intron	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a						cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		gagagaagagaaagaaaagaa	0.124			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				4	2	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	8994680	8994680	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8994680delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc002czj.2_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TACAACAGGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10369557	10369558	+	IGR	INS	-	A	A	rs112846350		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10369557_10369558insA								GRIN2A (92946 upstream) : ATF7IP2 (110354 downstream)																							aactctatctcaaaaaaaaaaa	0.005													4	4	---	---	---	---	
PLA2G10	8399	broad.mit.edu	37	16	14771572	14771575	+	Intron	DEL	ATGG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14771572_14771575delATGG	uc002dcq.2	-							NM_003561	NP_003552	O15496	PA2GX_HUMAN	phospholipase A2, group X precursor						arachidonic acid metabolic process|axon guidance|cholesterol homeostasis|lipid catabolic process|lysophospholipid transport|negative regulation of cholesterol efflux|negative regulation of sequence-specific DNA binding transcription factor activity|phospholipid metabolic process|positive regulation of arachidonic acid secretion|positive regulation of cellular protein metabolic process|positive regulation of lipid storage|positive regulation of prostaglandin secretion|regulation of macrophage activation	extracellular region	calcium ion binding|phospholipase A2 activity				0						ggcactccccatggatggatggat	0.000													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15086706	15086707	+	Intron	INS	-	T	T	rs72041186		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15086706_15086707insT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'Flank	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTATGCTATACttttttttttt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	20182312	20182312	+	IGR	DEL	A	-	-	rs34427138		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20182312delA								GPR139 (97212 upstream) : GP2 (139500 downstream)																							aatacaggttaaaaaaaagaT	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22720947	22720947	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22720947delT								LOC653786 (132761 upstream) : HS3ST2 (104913 downstream)																							TTAATGCttcttttttttttt	0.040													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22979666	22979666	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22979666delT								HS3ST2 (52009 upstream) : USP31 (93063 downstream)																							TTGTCTTCCATTTTTTTTTCC	0.348													4	2	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	25889058	25889059	+	Intron	INS	-	T	T	rs146562581	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25889058_25889059insT	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		ccagtttgtggttttttgctgc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32476163	32476163	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32476163delT								HERC2P4 (312289 upstream) : TP53TG3B (208678 downstream)																							agtcctcggctttttttgttg	0.000													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32522545	32522545	+	IGR	DEL	C	-	-	rs76051919		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32522545delC								HERC2P4 (358671 upstream) : TP53TG3B (162296 downstream)																							gggatatacactttttcacct	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32525960	32525961	+	IGR	INS	-	T	T	rs139361118	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32525960_32525961insT								HERC2P4 (362086 upstream) : TP53TG3B (158880 downstream)																							gggatactcactttttgccatt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32556862	32556863	+	IGR	INS	-	T	T	rs139315292		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32556862_32556863insT								HERC2P4 (392988 upstream) : TP53TG3B (127978 downstream)																							tggaaacactgatttgtagtat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33914543	33914544	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33914543_33914544insA								None (None upstream) : MIR1826 (50964 downstream)																							tgaaacactcctttgtagaatc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	35233694	35233694	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35233694delA								LOC146481 (518727 upstream) : None (None downstream)																							gcattctcagaaacttcttca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46444016	46444017	+	IGR	INS	-	AGC	AGC	rs141018527		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46444016_46444017insAGC								None (None upstream) : ANKRD26P1 (59232 downstream)																							actcgaatggaatcatcgaatg	0.000													4	2	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47707844	47707844	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47707844delT	uc002eev.3	+						PHKB_uc002eeu.3_Intron|PHKB_uc002eew.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				agaactgggatttacacccag	0.109													4	2	---	---	---	---	
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				cctgtctcagaaaaaaaaaaa	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53084807	53084808	+	IGR	INS	-	T	T	rs147696858	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53084807_53084808insT								TOX3 (503093 upstream) : CHD9 (4137 downstream)																							TCCTCACCCTCttttttttttg	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54719884	54719886	+	IGR	DEL	CTT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54719884_54719886delCTT								IRX3 (399506 upstream) : IRX5 (245225 downstream)																							cctccctctccttctccttctac	0.000													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55478362	55478362	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55478362delT								IRX6 (113691 upstream) : MMP2 (34719 downstream)																							GTGTTGGACATTTAAACTAAA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59001710	59001711	+	IGR	DEL	GT	-	-	rs71386777		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59001710_59001711delGT								GOT2 (233464 upstream) : None (None downstream)																							gtgtgtgtgcgtgtgtgtgttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	62748707	62748707	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62748707delC								CDH8 (678671 upstream) : None (None downstream)																							ttctccttctcctcctcctcc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	63563094	63563095	+	IGR	INS	-	TT	TT			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63563094_63563095insTT								None (None upstream) : None (None downstream)																							TTGAAAATAAATTTTGCTGGAA	0.347													4	2	---	---	---	---	
CES8	283848	broad.mit.edu	37	16	67039939	67039940	+	Intron	INS	-	G	G	rs139875929	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67039939_67039940insG	uc002eqv.2	+						CES8_uc010vix.1_Intron|CES8_uc002eqw.2_Intron|CES8_uc002eqy.2_Intron|CES8_uc002eqx.2_Intron|CES8_uc010viy.1_Intron|CES8_uc010viz.1_Intron|CES8_uc002eqz.2_Intron	NM_173815	NP_776176	Q5XG92	EST4A_HUMAN	carboxylesterase 8 (putative)							extracellular region	carboxylesterase activity				0						aacaggttaaaggggggggggc	0.139													4	2	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69856436	69856437	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69856436_69856437delGT	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						cctgggtggggtgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	70271292	70271292	+	5'Flank	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70271292delA	uc010cfp.1	-											Homo sapiens cDNA, FLJ98908.																		CAAATTACTTAAAAAAAAAAC	0.184													4	2	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71032452	71032452	+	Intron	DEL	C	-	-	rs1512628		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71032452delC	uc002ezr.2	-							NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TCAGATCTTACCAGGTGGCTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73922096	73922096	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73922096delT								HTA (794426 upstream) : PSMD7 (408585 downstream)																							TGAGTAAAACTAGGTTAGAAG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75917872	75917872	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75917872delT								TERF2IP (226544 upstream) : CNTNAP4 (393304 downstream)																							aaagtgaaacttttgagaatg	0.124													3	4	---	---	---	---	
CDYL2	124359	broad.mit.edu	37	16	80748201	80748202	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80748201_80748202insA	uc002ffs.2	-							NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						AATAAATCAAGAAAAaaaaagc	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86256652	86256652	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86256652delC								IRF8 (300443 upstream) : LOC732275 (108804 downstream)																							TCTCTGTCCTCCCCACCCTGC	0.443													4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	69317	69318	+	Intron	INS	-	T	T	rs74366498		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69317_69318insT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		CTTTTTCttccttttttttttt	0.149													3	3	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	95192	95193	+	Intron	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:95192_95193delGT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		gtggatatcagtgtgtgtgtgt	0.035													2	4	---	---	---	---	
CAMKK1	84254	broad.mit.edu	37	17	3793873	3793873	+	Intron	DEL	C	-	-	rs138869863	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3793873delC	uc002fwt.2	-						CAMKK1_uc002fwu.2_Intron|CAMKK1_uc002fwv.2_Intron	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1						synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		cattgcgagacgggtaccaca	0.030													24	27	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7623385	7623385	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7623385delT	uc002giu.1	+						DNAH2_uc002git.2_Intron|DNAH2_uc010vuk.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CACTGAGTCCTTTTTTTGTAT	0.522													4	2	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	10044760	10044761	+	Intron	INS	-	A	A	rs76812901		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10044760_10044761insA	uc002gmg.1	-							NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						aagactgtgccaaaaaaaaaaa	0.252			T	MLL	AML*								4	2	---	---	---	---	
FBXW10	10517	broad.mit.edu	37	17	18673619	18673620	+	Intron	INS	-	T	T	rs111256666		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18673619_18673620insT	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10											ovary(1)	1						TTCATTTTGACttttttttttt	0.218													4	2	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19744820	19744820	+	Frame_Shift_Del	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19744820delT	uc002gwm.3	-	9	1195	c.686delA	c.(685-687)AACfs	p.N229fs	ULK2_uc002gwn.2_Frame_Shift_Del_p.N229fs	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	229	Protein kinase.				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TAAGCTCCTGTTTTTTTCATA	0.308													16	10	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20139193	20139193	+	Intron	DEL	A	-	-	rs11341321		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20139193delA	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						CCCCTCTTGGAGGTGAGCAGT	0.478													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21343818	21343819	+	IGR	INS	-	G	G	rs151017738	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21343818_21343819insG								KCNJ12 (20639 upstream) : C17orf51 (87753 downstream)																							TTGATCCTCACTGGTGTTCTTC	0.460													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25278193	25278194	+	IGR	INS	-	CC	CC			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25278193_25278194insCC								None (None upstream) : WSB1 (342912 downstream)																							CCTCCCTCATACACAGAGATCA	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25318507	25318507	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25318507delC								None (None upstream) : WSB1 (302599 downstream)																							CTCAATGAAACCCATGTAAGA	0.353													4	2	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26126816	26126817	+	Intron	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26126816_26126817insA	uc002gzu.2	-						NOS2_uc010crh.1_Intron|NOS2_uc010wab.1_Intron	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	aggctgTTTCCAAAAAAAAAAA	0.025													3	6	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26134891	26134891	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26134891delC	uc010crh.1	-							NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GGAGGCGGTGCATTTGGGGGA	0.577													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30437950	30437951	+	IGR	DEL	CG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30437950_30437951delCG								LRRC37B (57433 upstream) : RHOT1 (31522 downstream)																							AGGGCACAGACGACATTACGGG	0.574													4	2	---	---	---	---	
MYO1D	4642	broad.mit.edu	37	17	31203293	31203293	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31203293delA	uc002hho.1	-						MYO1D_uc002hhp.1_Intron|MYO1D_uc010wcb.1_Intron	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CGCCAGGaggaaaaaaaaaag	0.393													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33106721	33106722	+	IGR	INS	-	CATC	CATC	rs144710272	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33106721_33106722insCATC								TMEM132E (140385 upstream) : CCT6B (148218 downstream)																							cAGTGtccattcatccatccat	0.040													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33163301	33163301	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33163301delA								TMEM132E (196965 upstream) : CCT6B (91639 downstream)																							GTTAGGACTCAAAAAAAAAAA	0.468													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34811875	34811876	+	IGR	INS	-	GCGC	GCGC			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34811875_34811876insGCGC								TBC1D3G (3772 upstream) : ZNHIT3 (30597 downstream)																							tgtgtgtgtgtgcgtgtatgtg	0.431													6	3	---	---	---	---	
ACACA	31	broad.mit.edu	37	17	35616803	35616804	+	Intron	DEL	TT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35616803_35616804delTT	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuz.2_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGAGACTAGAtttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36381549	36381550	+	Intron	INS	-	AC	AC	rs71726940		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36381549_36381550insAC	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																		aaaaaaaaaaaaaaaaaacaac	0.025													3	3	---	---	---	---	
SRCIN1	80725	broad.mit.edu	37	17	36720591	36720591	+	Intron	DEL	C	-	-	rs34710018		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36720591delC	uc002hqd.2	-						SRCIN1_uc002hqf.1_5'Flank|SRCIN1_uc002hqe.2_Intron|SRCIN1_uc002hqh.1_Intron	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						AGGATGAGCACCCCCCCCCCC	0.647													4	2	---	---	---	---	
CWC25	54883	broad.mit.edu	37	17	36962873	36962874	+	Intron	INS	-	A	A	rs78213578		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36962873_36962874insA	uc002hqu.2	-						CWC25_uc010wdv.1_Intron|CWC25_uc010wdw.1_Intron	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49												0						CATTGAGGTGGAAAAAAAAAAT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41375888	41375888	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41375888delC	uc002ido.2	-											Homo sapiens cDNA clone IMAGE:5169062, partial cds.																		TCATGTCCCACCCTCTGATCA	0.527													4	2	---	---	---	---	
ARHGAP27	201176	broad.mit.edu	37	17	43492499	43492499	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43492499delT	uc002iix.2	-							NM_199282	NP_954976	Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27 isoform a						positive regulation of Cdc42 GTPase activity|receptor-mediated endocytosis|signal transduction	cytoplasm|membrane	Rac GTPase activator activity|SH3 domain binding				0	Renal(3;0.0405)					AACTAATTCCTTTTTCCCTTC	0.338													4	2	---	---	---	---	
GOSR2	9570	broad.mit.edu	37	17	45091759	45091759	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45091759delA	uc010wkh.1	+							NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			ccatctcgagaaaaaaaaaaa	0.139													4	3	---	---	---	---	
CDC27	996	broad.mit.edu	37	17	45256176	45256177	+	Intron	INS	-	T	T	rs148216483		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45256176_45256177insT	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						tcctttttccgttttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47957365	47957370	+	IGR	DEL	TTGTTG	-	-	rs112511567		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47957365_47957370delTTGTTG								TAC4 (31986 upstream) : DLX4 (89192 downstream)																							gtttttctttttgttgttgttgttgt	0.204													4	2	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57748458	57748458	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57748458delA	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TAAGCCTTGGAAAAAGGTGGA	0.303			T	ALK|TFE3	ALCL|renal 								4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59380897	59380897	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59380897delC	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTTCATTGGACTTTGGCACTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	59629143	59629144	+	IGR	INS	-	T	T	rs146644265	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59629143_59629144insT								TBX4 (66674 upstream) : NACA2 (38650 downstream)																							GTCtttctttctttttttttct	0.079													3	7	---	---	---	---	
GNA13	10672	broad.mit.edu	37	17	63016773	63016773	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63016773delT	uc002jfc.2	-						GNA13_uc010wqh.1_Intron	NM_006572	NP_006563	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0						CTGAAGGGAAttttttttttt	0.174													4	2	---	---	---	---	
LOC651250	651250	broad.mit.edu	37	17	66139054	66139055	+	Intron	INS	-	CCTTCCTT	CCTTCCTT	rs139365001	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66139054_66139055insCCTTCCTT	uc002jgo.1	+											full-length cDNA clone CS0DD005YM11 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).												0						ctcccttcctcccttcctTCTT	0.059													3	3	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67529877	67529878	+	Intron	DEL	TT	-	-	rs145730614		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67529877_67529878delTT	uc002jij.2	+							NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					AGCCTGTTTGTTTTTTTTTTTT	0.386													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70192483	70192483	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70192483delT								SOX9 (69931 upstream) : SLC39A11 (449603 downstream)																							TAAAGAGGTATTAAAGTTTTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70435293	70435293	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70435293delC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		AGTTTTAACACCCCCCCCAGG	0.597													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70864483	70864484	+	Intron	INS	-	A	A	rs146378535	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70864483_70864484insA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						TATTCAGAGGGAAAAAATAATA	0.317													2	4	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71605640	71605640	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71605640delA	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						aagggaagacaggaattagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72574326	72574326	+	IGR	DEL	G	-	-	rs75514254		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72574326delG								CD300C (32044 upstream) : CD300LD (1785 downstream)																							GGCTGGGGGTGGGGGAGTCTG	0.542													5	6	---	---	---	---	
TMEM104	54868	broad.mit.edu	37	17	72815007	72815007	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72815007delG	uc002jls.3	+						TMEM104_uc010wrf.1_Intron|TMEM104_uc010wrg.1_Intron|TMEM104_uc010dfx.2_Intron	NM_017728	NP_060198	Q8NE00	TM104_HUMAN	transmembrane protein 104							integral to membrane					0	all_lung(278;0.23)					AATTTGGCATGGAAATCCTAA	0.468													4	2	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73218137	73218140	+	Intron	DEL	TTTG	-	-	rs5822073		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73218137_73218140delTTTG	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			tgtgttttgttttgtttgtttgtt	0.000													3	3	---	---	---	---	
MFSD11	79157	broad.mit.edu	37	17	74744768	74744768	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74744768delA	uc002jta.2	+						MFSD11_uc002jtb.2_Intron|MFSD11_uc010dha.2_Intron|MFSD11_uc002jtc.2_Intron|MFSD11_uc002jtd.3_Intron|MFSD11_uc010dhb.2_Intron|MFSD11_uc002jte.2_Intron	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing							integral to membrane				ovary(1)	1						accctgtcttaaaaaaaaaaa	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74776600	74776600	+	IGR	DEL	T	-	-	rs111368705		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74776600delT								MFSD11 (1264 upstream) : MGAT5B (88198 downstream)																							TGTGTATGTGttttttttttt	0.095													3	3	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75481237	75481240	+	Intron	DEL	GTGA	-	-	rs139893181		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75481237_75481240delGTGA	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			tgtgatgggggtgatgatggtaat	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	76486622	76486623	+	IGR	INS	-	GTCT	GTCT	rs148797625	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76486622_76486623insGTCT								DNAH17 (17766 upstream) : CYTH1 (183508 downstream)																							tttattcccaggtctctcaccc	0.050													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77108548	77108548	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77108548delA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			CAGAAATTCCAGGAAGGCCTT	0.622													4	2	---	---	---	---	
BAIAP2	10458	broad.mit.edu	37	17	79036944	79036945	+	Intron	DEL	CC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79036944_79036945delCC	uc002jzg.2	+						BAIAP2_uc002jyz.3_Intron|BAIAP2_uc002jza.2_Intron|BAIAP2_uc002jzc.2_Intron|BAIAP2_uc002jzb.2_Intron|BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AAGGGTGTGTCCAAAGGTGTGA	0.604													4	2	---	---	---	---	
C17orf56	146705	broad.mit.edu	37	17	79204128	79204134	+	Intron	DEL	TGAGTGC	-	-	rs150422103		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79204128_79204134delTGAGTGC	uc002jzu.1	-						C17orf56_uc002jzr.1_Intron|C17orf56_uc002jzs.1_Intron|C17orf56_uc002jzt.1_Intron|C17orf56_uc002jzv.1_Intron|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705							integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			cagtgtaCTGTGAGTGCTGCAGAGTTT	0.338											OREG0024811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
NPLOC4	55666	broad.mit.edu	37	17	79531406	79531406	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79531406delG	uc002kat.3	-						NPLOC4_uc002kau.3_3'UTR|NPLOC4_uc010wur.1_3'UTR|NPLOC4_uc002kar.2_5'Flank|NPLOC4_uc010dic.2_Intron|NPLOC4_uc002kas.2_Intron	NM_017921	NP_060391	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			aagatcacttgagcctggagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79833181	79833181	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79833181delC								ARHGDIA (3943 upstream) : THOC4 (12530 downstream)																							cacctgtagtcccagctactc	0.040													4	2	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80092984	80092984	+	Intron	DEL	T	-	-	rs79085323		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80092984delT	uc002kdx.1	-						CCDC57_uc002kdy.2_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GAAACAGACAttttttttttt	0.169													4	3	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80760219	80760219	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80760219delG	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			CCTGGATGATGGCAAATTCCA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	81194999	81195000	+	IGR	INS	-	T	T	rs146891032	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81194999_81195000insT								METRNL (142410 upstream) : None (None downstream)																							agggtttagggttagggttagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	939965	939967	+	IGR	DEL	ACA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:939965_939967delACA								ADCYAP1 (27794 upstream) : C18orf2 (314423 downstream)																							CAAAACGACGACAACAACAACAA	0.374													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3583341	3583342	+	Intron	DEL	TC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3583341_3583342delTC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				tccttttccttctctctctctc	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	4216291	4216292	+	Intron	INS	-	C	C	rs141354536	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4216291_4216292insC	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				tgattaaattacccccccccca	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4577763	4577763	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4577763delG								DLGAP1 (122497 upstream) : LOC642597 (565909 downstream)																							atgttgagttgggccatttgg	0.000													4	2	---	---	---	---	
EPB41L3	23136	broad.mit.edu	37	18	5529928	5529929	+	Intron	DEL	TG	-	-	rs72089625		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5529928_5529929delTG	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc010dks.1_Intron|EPB41L3_uc002kmv.1_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AACTCATATAtgtgtgtgtgtg	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10708411	10708411	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10708411delA								FAM38B (6432 upstream) : GNAL (980725 downstream)																							CTGCCTTGAGAACAGCATGGT	0.463													4	2	---	---	---	---	
IMPA2	3613	broad.mit.edu	37	18	11996855	11996856	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11996855_11996856delAC	uc002kqp.1	+						IMPA2_uc002kqo.1_Intron|IMPA2_uc010dlb.1_Intron|IMPA2_uc002kqq.1_Intron	NM_014214	NP_055029	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2						inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)	caccacaccaacacacacacac	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20666510	20666511	+	IGR	DEL	AA	-	-	rs35766878		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20666510_20666511delAA								RBBP8 (60065 upstream) : CABLES1 (48017 downstream)																							tgtctcctggaaaaaaaaaaaa	0.173													3	4	---	---	---	---	
KCTD1	284252	broad.mit.edu	37	18	24173511	24173512	+	Intron	INS	-	ACA	ACA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24173511_24173512insACA	uc010xbk.1	-							NM_198991	NP_945342	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ggaggaagaagacgaggaggag	0.000													2	4	---	---	---	---	
MEP1B	4225	broad.mit.edu	37	18	29781263	29781264	+	Intron	DEL	AC	-	-	rs72381086		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29781263_29781264delAC	uc002kxj.3	+							NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor						digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						ATATGTAGATacacacacacac	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	30410965	30410966	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30410965_30410966delAG								KLHL14 (57991 upstream) : C18orf34 (106400 downstream)																							ACCAAGGGGTAGAGAGAGAGAT	0.530													4	2	---	---	---	---	
MAPRE2	10982	broad.mit.edu	37	18	32636906	32636906	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32636906delA	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1						ACTGCAGTTCAAAAAGCTTCC	0.358													4	2	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42616298	42616299	+	Intron	DEL	AA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42616298_42616299delAA	uc010dni.2	+							NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		actctgtctcaaaaaaaaaaaa	0.183									Schinzel-Giedion_syndrome				2	4	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46267649	46267651	+	Intron	DEL	CCG	-	-	rs146844162	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46267649_46267651delCCG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						tactctgcccccgccccccctcC	0.256													4	2	---	---	---	---	
DYM	54808	broad.mit.edu	37	18	46785351	46785352	+	Intron	INS	-	A	A	rs138806656		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46785351_46785352insA	uc002ldi.1	-						DYM_uc010xdf.1_Intron|DYM_uc002ldj.3_Intron|DYM_uc010dov.1_5'Flank	NM_017653	NP_060123	Q7RTS9	DYM_HUMAN	dymeclin							Golgi apparatus					0						GGGGAAAAAACAAAAAAAAAAA	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51654395	51654396	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51654395_51654396insA								DCC (596613 upstream) : MBD2 (26179 downstream)																							TGGCCCAGGGGAAAAAAATAAA	0.436											OREG0024986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	52674044	52674044	+	IGR	DEL	A	-	-	rs113918483		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52674044delA								CCDC68 (47305 upstream) : TCF4 (215518 downstream)																							ATCATTGGGGAAAAAAATTAA	0.229													3	3	---	---	---	---	
WDR7	23335	broad.mit.edu	37	18	54633531	54633531	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54633531delC	uc002lgk.1	+						WDR7_uc002lgl.1_Intron	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		gcctctcctgccccctcttac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	54992419	54992420	+	IGR	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54992419_54992420delCA								WDR7 (295383 upstream) : ST8SIA3 (27301 downstream)																							ctGTGTGTGTcacacacacaca	0.094													6	3	---	---	---	---	
BCL2	596	broad.mit.edu	37	18	60812089	60812089	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60812089delA	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CACCAGTCACAGGACCTTCCC	0.617			T	IGH@	NHL|CLL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65584635	65584635	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65584635delA								DSEL (400668 upstream) : TMX3 (756292 downstream)																							CTGTCTAAGTAAAAGGCCATG	0.249													4	2	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67563417	67563418	+	Intron	INS	-	T	T	rs33943534		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563417_67563418insT	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CTTTATACTACttttttttttt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77344953	77344955	+	IGR	DEL	CTT	-	-	rs72183142		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77344953_77344955delCTT								NFATC1 (55631 upstream) : CTDP1 (94846 downstream)																							CTTGTTCCTCCTTTCCACTAAAG	0.626													3	4	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1039147	1039147	+	5'Flank	DEL	G	-	-	rs71335334		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1039147delG	uc002lqw.3	+						ABCA7_uc010dsa.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGGGGGATGGGGGGATCAA	0.547													4	4	---	---	---	---	
MIDN	90007	broad.mit.edu	37	19	1257901	1257902	+	3'UTR	INS	-	T	T	rs150550919	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1257901_1257902insT	uc002lrp.2	+	8						NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin							nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTTCTTGATCTTTTTTTTGCA	0.525													4	2	---	---	---	---	
FAM108A1	81926	broad.mit.edu	37	19	1881526	1881528	+	In_Frame_Del	DEL	AGA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1881526_1881528delAGA	uc002lug.2	-	2	444_446	c.38_40delTCT	c.(37-42)TTCTGC>TGC	p.F13del	FAM108A1_uc002lud.2_In_Frame_Del_p.F13del|FAM108A1_uc002lue.2_In_Frame_Del_p.F13del|FAM108A1_uc002luf.2_In_Frame_Del_p.F13del	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2	13						extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGGGCAGCAGAAGAGGCAGCA	0.567													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	2382679	2382682	+	IGR	DEL	ACAC	-	-	rs148093377		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2382679_2382682delACAC								SPPL2B (27580 upstream) : TMPRSS9 (7102 downstream)																							gtgcacacatacacacatgcacac	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	4745941	4745941	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4745941delT								DPP9 (22086 upstream) : C19orf30 (23176 downstream)																							gtttggtttcttttttttttt	0.000													4	2	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5254707	5254707	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5254707delG	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		CTGTGTTGCTGGACAAAAGAC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5534535	5534536	+	IGR	INS	-	TTG	TTG	rs146307665	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5534535_5534536insTTG								ZNRF4 (77669 upstream) : PLAC2 (23644 downstream)																							TTTCAGAGtttttgttgttgtt	0.104													3	4	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6792383	6792383	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6792383delA	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						GGCAAGAATTAAAAAAAAAAA	0.254													4	3	---	---	---	---	
PKN1	5585	broad.mit.edu	37	19	14549670	14549671	+	Intron	INS	-	T	T	rs111545201		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14549670_14549671insT	uc002myp.2	+						PKN1_uc002myq.2_5'Flank	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2						activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						ctaattttgtattttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15677905	15677906	+	IGR	INS	-	TC	TC	rs56411108		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15677905_15677906insTC								CYP4F22 (14778 upstream) : CYP4F8 (48123 downstream)																							ccttccttcctctttctttctt	0.183													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17750845	17750846	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750845_17750846insT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ATTCTATGGCAttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17924404	17924404	+	IGR	DEL	T	-	-	rs78212267		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17924404delT								B3GNT3 (19 upstream) : INSL3 (2918 downstream)																							AGACAGAttcttttttttttt	0.254													3	3	---	---	---	---	
LOC284440	284440	broad.mit.edu	37	19	19869710	19869711	+	Intron	INS	-	TT	TT	rs147224045	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19869710_19869711insTT	uc010ech.2	-						LOC284440_uc002nof.3_Intron	NR_026956				Homo sapiens cDNA FLJ12356 fis, clone MAMMA1002339.												0						tttgatgtgtctttttttttga	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20242475	20242475	+	IGR	DEL	A	-	-	rs34968733		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20242475delA								ZNF90 (4590 upstream) : ZNF486 (35608 downstream)																							ttctgggttcaaagcgattct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28722737	28722745	+	IGR	DEL	GCATCTGAT	-	-	rs149101225		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28722737_28722745delGCATCTGAT								LOC148189 (437889 upstream) : LOC148145 (733295 downstream)																							TGGTTAATGAGCATCTGATGCTCCATTTT	0.273													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30405802	30405802	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30405802delC								CCNE1 (90584 upstream) : C19orf2 (8749 downstream)																							tcatagacctccagtttatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31390411	31390411	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31390411delT								ZNF536 (341446 upstream) : DKFZp566F0947 (250372 downstream)																							ACTCCTATGATTTTTTTTTTG	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32235945	32235945	+	IGR	DEL	A	-	-	rs71936808		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32235945delA								TSHZ3 (395755 upstream) : ZNF507 (600569 downstream)																							actctgtgtcaaaaaaaaaaa	0.045													4	2	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33579019	33579019	+	Intron	DEL	T	-	-	rs74174635		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33579019delT	uc002nug.1	+							NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					tttaaaaaacttttttttttt	0.294													6	3	---	---	---	---	
PEPD	5184	broad.mit.edu	37	19	33945516	33945516	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33945516delA	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					tccaaaaaagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35208059	35208059	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35208059delA								ZNF302 (30757 upstream) : ZNF181 (17092 downstream)																							tgcaggatggaaaaaaaaata	0.000													4	2	---	---	---	---	
ZNF565	147929	broad.mit.edu	37	19	36693309	36693309	+	Intron	DEL	A	-	-	rs66471721		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36693309delA	uc002odn.2	-						ZNF565_uc010ees.2_Intron|ZNF565_uc002odo.2_Intron|ZNF565_uc002odp.1_Intron	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			caacaacaacaaAAAAAAACT	0.209													4	3	---	---	---	---	
ZNF565	147929	broad.mit.edu	37	19	36701528	36701529	+	Intron	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36701528_36701529insT	uc002odn.2	-						ZNF565_uc010ees.2_Intron|ZNF565_uc002odo.2_Intron|ZNF565_uc002odp.1_Intron	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			tcaaaaaatcattttttttttt	0.000													4	2	---	---	---	---	
CYP2F1	1572	broad.mit.edu	37	19	41861337	41861338	+	Intron	INS	-	CCT	CCT	rs146657462	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41861337_41861338insCCT	uc010xvw.1	+						TGFB1_uc002oqh.1_5'Flank|TMEM91_uc002oqi.2_Intron|B9D2_uc002oqj.2_Intron			P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CTCCTGCCTTCCCTCATGTCCC	0.530													3	3	---	---	---	---	
GSK3A	2931	broad.mit.edu	37	19	42743282	42743282	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42743282delT	uc002otb.1	-						GSK3A_uc002ota.1_Intron|GSK3A_uc002otc.2_Intron	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha						insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				GGCATTGGACTTTTCCCAGAA	0.537													4	2	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43587032	43587033	+	Intron	INS	-	AC	AC	rs148556389	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43587032_43587033insAC	uc010xwk.1	-						PSG6_uc002ovi.2_5'Flank|PSG2_uc002ovr.2_5'Flank|PSG2_uc002ovq.3_5'Flank|PSG2_uc010eiq.1_5'Flank|PSG2_uc002ovs.3_5'Flank|PSG2_uc002ovt.3_5'Flank			Q00889	PSG6_HUMAN	SubName: Full=Pregnancy-specific beta-1 glycoprotein; Flags: Fragment;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				ACTTTGTGCAGacacacacaca	0.431													3	3	---	---	---	---	
ZNF221	7638	broad.mit.edu	37	19	44464129	44464130	+	Intron	INS	-	T	T	rs112862175		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44464129_44464130insT	uc002oxx.2	+						ZNF221_uc010ejb.1_Intron|ZNF221_uc010xws.1_5'Flank	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Prostate(69;0.0352)				aaacttggaacttttttttttt	0.000													1	5	---	---	---	---	
ZNF226	7769	broad.mit.edu	37	19	44677476	44677479	+	Intron	DEL	CCTC	-	-	rs72010186		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44677476_44677479delCCTC	uc002oyp.2	+						ZNF226_uc002oyn.2_Intron|ZNF226_uc002oyo.2_Intron|ZNF226_uc002oyq.2_5'UTR|ZNF226_uc002oyr.2_5'UTR|ZNF226_uc010ejg.2_Intron|ZNF226_uc002oys.2_Intron|ZNF226_uc002oyt.2_Intron	NM_001032373	NP_001027545	Q9NYT6	ZN226_HUMAN	zinc finger protein 226 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				gccacattgtcctccctcttgctt	0.000													5	3	---	---	---	---	
PPP5C	5536	broad.mit.edu	37	19	46873999	46874002	+	Intron	DEL	TCTC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46873999_46874002delTCTC	uc002pem.2	+						PPP5C_uc010xya.1_Intron|PPP5C_uc002pen.2_Intron	NM_006247	NP_006238	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit						mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		tgTGTGTATGtctctctctttttt	0.015													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46895486	46895487	+	IGR	INS	-	C	C	rs140781442	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46895486_46895487insC								PPP5C (1383 upstream) : CCDC8 (18100 downstream)																							AAACACCCTAACCCCCCCCACC	0.455													4	4	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48538542	48538543	+	Intron	DEL	AT	-	-	rs79334647		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48538542_48538543delAT	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		gttgtaaatgatagagtttcct	0.000													2	5	---	---	---	---	
CABP5	56344	broad.mit.edu	37	19	48546789	48546790	+	Intron	INS	-	TC	TC	rs139672144	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48546789_48546790insTC	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		catcaccaccaccaccatcatc	0.149													5	3	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50288568	50288568	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50288568delG	uc002ppn.2	+						AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		gcttggaccagggctgtggcg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50997653	50997654	+	IGR	INS	-	GAG	GAG	rs57239148		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50997653_50997654insGAG								C19orf63 (11046 upstream) : JOSD2 (11605 downstream)																							gaggaggaagagaggaggagga	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54949742	54949743	+	IGR	INS	-	A	A	rs11296289		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54949742_54949743insA								TTYH1 (1690 upstream) : LENG8 (10322 downstream)																							accatcccttgaaaaaaaaaaa	0.015													4	2	---	---	---	---	
LILRA2	11027	broad.mit.edu	37	19	55086095	55086095	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086095delA	uc002qgg.3	+						LILRA2_uc010ern.2_Intron|LILRA2_uc002qgf.2_Intron|LILRA2_uc010yfe.1_Intron|LILRA2_uc010yff.1_Intron|LILRA2_uc010ero.2_Intron|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,						defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		TGCCCTCAGGAAGGGGGTCGG	0.602													43	21	---	---	---	---	
HSPA12B	116835	broad.mit.edu	37	20	3727769	3727770	+	Intron	INS	-	G	G			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3727769_3727770insG	uc002wjd.2	+						HSPA12B_uc010zqi.1_Intron|HSPA12B_uc002wje.2_Intron|HSPA12B_uc010zqj.1_Intron	NM_052970	NP_443202	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding				0						AGCAAGGAGTTGGGGGGGGCTC	0.520													4	2	---	---	---	---	
RNF24	11237	broad.mit.edu	37	20	3915479	3915480	+	Intron	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3915479_3915480delCA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150	Q9Y225	RNF24_HUMAN	ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0						TAATGTCACGCACACACACACA	0.505													4	2	---	---	---	---	
PRNP	5621	broad.mit.edu	37	20	4668191	4668191	+	Intron	DEL	A	-	-	rs140899288		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4668191delA	uc002wku.2	+						PRNP_uc002wkv.2_Intron|PRNP_uc002wkw.2_Intron|PRNP_uc002wkx.2_Intron|PRNP_uc002wkt.1_Intron|PRNP_uc002wky.2_Intron	NM_001080122	NP_001073591	P04156	PRIO_HUMAN	prion protein preproprotein						axon guidance|cell cycle arrest|cellular copper ion homeostasis|metabolic process|negative regulation of activated T cell proliferation|negative regulation of calcineurin-NFAT signaling pathway|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-2 production|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell receptor signaling pathway|protein homooligomerization|response to oxidative stress	anchored to membrane|endoplasmic reticulum|extrinsic to membrane|Golgi apparatus|membrane raft|nucleus|plasma membrane	copper ion binding|identical protein binding|microtubule binding			central_nervous_system(1)	1					Tetracycline(DB00759)	TGTCCTTTTTAAGGAATTTTT	0.463													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6283527	6283527	+	IGR	DEL	T	-	-	rs145796049		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6283527delT								FERMT1 (179336 upstream) : BMP2 (465218 downstream)																							TTTCAGATTCTTTTttttttt	0.184													2	5	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9289503	9289503	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9289503delA	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TGTTTGAATTAAAATATTGAA	0.279													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15008203	15008203	+	Intron	DEL	T	-	-	rs71190167		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15008203delT	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				gtggtggtggtggggggaaat	0.030													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16786181	16786181	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16786181delC								OTOR (53373 upstream) : PCSK2 (420571 downstream)																							TGCCTTCCCTCCCTGCTTCTC	0.373													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17004390	17004391	+	IGR	DEL	CA	-	-	rs5840745		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17004390_17004391delCA								OTOR (271582 upstream) : PCSK2 (202361 downstream)																							GTAGGATCAGcacacacacaca	0.272													4	2	---	---	---	---	
ZNF133	7692	broad.mit.edu	37	20	18266256	18266257	+	5'Flank	DEL	CA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18266256_18266257delCA	uc010gcq.2	+						ZNF133_uc010zrv.1_5'Flank|ZNF133_uc010zrw.1_5'Flank|ZNF133_uc010gcr.2_5'Flank|ZNF133_uc010zrx.1_5'Flank|ZNF133_uc002wql.3_5'Flank|ZNF133_uc010gcs.2_5'Flank|ZNF133_uc010zry.1_5'Flank	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2						TGTGTGCGTGCACACACACACA	0.208													4	2	---	---	---	---	
NAPB	63908	broad.mit.edu	37	20	23403410	23403412	+	5'Flank	DEL	GTT	-	-	rs139689345		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23403410_23403412delGTT	uc002wta.2	-						NAPB_uc002wtc.2_5'Flank|NAPB_uc002wtb.2_5'Flank|NAPB_uc002wtd.3_5'Flank|NAPB_uc010zst.1_5'Flank	NM_022080	NP_071363	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment						intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					GATTAAATCAGTTGTTCCCTAAC	0.241													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23747553	23747554	+	IGR	DEL	GT	-	-	rs6138063		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23747553_23747554delGT								CST1 (15979 upstream) : CST2 (56850 downstream)																							TGgagagtgagtgagagagaga	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25628987	25628987	+	Intron	DEL	T	-	-	rs112546855		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25628987delT	uc002wuz.2	+											Homo sapiens zinc finger protein 337, mRNA (cDNA clone IMAGE:4826085).																		ATGTGTCTCCttttttttttt	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26117648	26117649	+	IGR	INS	-	A	A	rs149172160		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117648_26117649insA								C20orf191 (22971 upstream) : MIR663 (71173 downstream)																							gaggaacgggggaaagactatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26207115	26207115	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26207115delA								MIR663 (18201 upstream) : None (None downstream)																							CTGGATGTGTAACAATGAAAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29597565	29597566	+	IGR	DEL	TT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29597565_29597566delTT								None (None upstream) : FRG1B (14313 downstream)																							ttttataaacttgttctaaaaa	0.129													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29647610	29647612	+	Intron	DEL	AGT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29647610_29647612delAGT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						gaaggaaggaagtagggagggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	30080418	30080418	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30080418delA								NCRNA00028 (5041 upstream) : HM13 (21823 downstream)																							aaaaaaaaacaaaaaaaaaac	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	30543505	30543505	+	IGR	DEL	T	-	-	rs35653964		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30543505delT								PDRG1 (3622 upstream) : XKR7 (12300 downstream)																							atctaccagcttttttttttt	0.000													6	3	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	33078555	33078555	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33078555delC	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						gtgtgaaataccacaccactg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	35584711	35584711	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35584711delA								SAMHD1 (4535 upstream) : RBL1 (40361 downstream)																							tacctcaaagaaaaaaaaaag	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36039803	36039804	+	IGR	DEL	GT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36039803_36039804delGT								SRC (5984 upstream) : BLCAP (106016 downstream)																							ctgtgtatgagtgtgtgtgtgC	0.441													4	2	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40187787	40187792	+	Intron	DEL	ACACAC	-	-	rs111288742		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40187787_40187792delACACAC	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CCTGTTCCTGacacacacacacacac	0.097													1	5	---	---	---	---	
HNF4A	3172	broad.mit.edu	37	20	43050809	43050810	+	Intron	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43050809_43050810delAC	uc002xma.2	+						HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|HNF4A_uc002xly.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Intron	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ccacATTCTTACCTACCACCTG	0.272													4	2	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45844798	45844798	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45844798delC	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xsr.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TGAGAAATAGCCATCATGGAC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48994977	48994978	+	IGR	INS	-	CATT	CATT	rs142607424	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48994977_48994978insCATT								CEBPB (185765 upstream) : PTPN1 (131913 downstream)																							ACAATGGCAAAcattcattcat	0.208													4	2	---	---	---	---	
BCAS4	55653	broad.mit.edu	37	20	49468579	49468579	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49468579delA	uc002xvq.2	+						BCAS4_uc002xvr.2_Intron|BCAS4_uc002xvs.2_Intron	NM_017843	NP_060313	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4 isoform a							cytoplasm					0						GGGCCACCACAAGCagcactt	0.179													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51828049	51828050	+	Intron	DEL	AA	-	-	rs68137435		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51828049_51828050delAA	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TGCCTGAAATAAAAAAAAAAAA	0.144													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57752070	57752071	+	IGR	INS	-	CA	CA	rs150049374	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57752070_57752071insCA								SLMO2 (134169 upstream) : ZNF831 (14004 downstream)																							TCTGCCCTTGGCACACAACAGC	0.500													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58620570	58620571	+	IGR	INS	-	CA	CA			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58620570_58620571insCA								CDH26 (11741 upstream) : C20orf197 (10409 downstream)																							acacacacatgcacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59610841	59610842	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59610841_59610842insT								MIR646 (727216 upstream) : CDH4 (216717 downstream)																							atccctgataattttccttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59777229	59777230	+	IGR	INS	-	A	A	rs56219348		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59777229_59777230insA								MIR646 (893604 upstream) : CDH4 (50329 downstream)																							GACCCTCCATGGTGTCACCTCC	0.584													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59894842	59894844	+	Intron	DEL	AAA	-	-	rs146745520		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59894842_59894844delAAA	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			catctcaattaaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TAF4	6874	broad.mit.edu	37	20	60573123	60573123	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60573123delC	uc002ybs.2	-							NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GTTTCCTTAGCCCCCCTCCCG	0.483													17	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60957581	60957581	+	IGR	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60957581delG								LAMA5 (15213 upstream) : RPS21 (4540 downstream)																							gcacaaacctggggtgacact	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61327183	61327184	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61327183_61327184delAC								SLCO4A1 (10057 upstream) : NTSR1 (13005 downstream)																							ACACGCAGCAACACACACACAC	0.525													4	2	---	---	---	---	
RTEL1	51750	broad.mit.edu	37	20	62319207	62319208	+	Intron	INS	-	GGG	GGG	rs143664886	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62319207_62319208insGGG	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron|RTEL1_uc002yfx.1_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CCCCATGAGCCGGGTGCTGGGG	0.668													6	3	---	---	---	---	
ZNF512B	57473	broad.mit.edu	37	20	62602059	62602062	+	5'Flank	DEL	CCTT	-	-	rs113164162	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62602059_62602062delCCTT	uc002yhl.1	-							NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					tgcctgcctgccttccttccttcc	0.230													7	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9417563	9417564	+	IGR	INS	-	T	T			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9417563_9417564insT								None (None upstream) : None (None downstream)																							aattggtggagtttttttttct	0.074													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9432854	9432854	+	IGR	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9432854delT								None (None upstream) : None (None downstream)																							tgtttttttattttttgtaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9573204	9573205	+	IGR	INS	-	GT	GT	rs138924544	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9573204_9573205insGT								None (None upstream) : None (None downstream)																							tgcgtgtgtgcgtgtgtgtgtg	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9834644	9834645	+	IGR	INS	-	T	T	rs149588575	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9834644_9834645insT								None (None upstream) : None (None downstream)																							ATGGATATGGATTTTTTTGAGA	0.238													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10603456	10603457	+	IGR	INS	-	A	A			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10603456_10603457insA								None (None upstream) : TPTE (303286 downstream)																							tggcataaaagaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10774245	10774246	+	IGR	INS	-	CGAAT	CGAAT	rs28857019		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10774245_10774246insCGAAT								None (None upstream) : TPTE (132497 downstream)																							tggaatagtagtgaatggaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10799958	10799962	+	IGR	DEL	ACTCA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10799958_10799962delACTCA								None (None upstream) : TPTE (106781 downstream)																							aattgaatggactcaaatggaatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10852579	10852583	+	IGR	DEL	AATGG	-	-	rs149883331		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10852579_10852583delAATGG								None (None upstream) : TPTE (54160 downstream)																							aatggaatgaaatggaatggaatgg	0.000													4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11035575	11035575	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11035575delA	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTAATAGGCAAAAAAAACAA	0.299													5	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11050147	11050147	+	Intron	DEL	G	-	-	rs113743562		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11050147delG	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCTTTTTTTTGATTACTGGAA	0.274													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085696	11085698	+	Intron	DEL	ACT	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085696_11085698delACT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		caccaccaccactaccaccacta	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11087075	11087076	+	Intron	INS	-	T	T	rs141194247		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11087075_11087076insT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		caccactgcacccagcccgggc	0.000													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11089271	11089273	+	Intron	DEL	CAC	-	-	rs150553952		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11089271_11089273delCAC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gtaatcccaacactttggaaggc	0.089													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14366863	14366864	+	IGR	INS	-	TC	TC	rs113519777		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14366863_14366864insTC								None (None upstream) : C21orf99 (43623 downstream)																							gaatgcttctgtggttttcatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14383027	14383028	+	IGR	INS	-	G	G	rs3865590	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14383027_14383028insG								None (None upstream) : C21orf99 (27459 downstream)																							GGTGTTAAttttttgttgttgt	0.129													5	3	---	---	---	---	
C21orf99	149992	broad.mit.edu	37	21	14439999	14439999	+	Intron	DEL	T	-	-	rs142238235		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14439999delT	uc002yja.3	+							NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						ttgcattttcttgatggcttg	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20655888	20655891	+	IGR	DEL	ACAC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20655888_20655891delACAC								TMPRSS15 (879918 upstream) : None (None downstream)																							gtacacacatacacacacacacac	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23585990	23585990	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23585990delA								NCAM2 (674776 upstream) : None (None downstream)																							TGGAGAGAGGAAAAAAAAAAA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28542409	28542410	+	IGR	DEL	GT	-	-	rs68099307		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28542409_28542410delGT								ADAMTS5 (202970 upstream) : NCRNA00113 (552288 downstream)																							ATTCAACATGgtgtgtgtgtgt	0.198													4	2	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32713185	32713185	+	Intron	DEL	A	-	-	rs112495646		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32713185delA	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						AACTGAGAGGAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33156696	33156698	+	IGR	DEL	CAC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33156696_33156698delCAC								SFRS15 (52265 upstream) : HUNK (88930 downstream)																							gctatttaatcaccaccaccacc	0.000													4	2	---	---	---	---	
PTTG1IP	754	broad.mit.edu	37	21	46280391	46280392	+	Intron	INS	-	TG	TG	rs141176110	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46280391_46280392insTG	uc002zgb.1	-						PTTG1IP_uc011afj.1_Intron|PTTG1IP_uc011afk.1_Intron	NM_004339	NP_004330	P53801	PTTG_HUMAN	pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)		AAAAAGAGGGCTGTCTACGCAA	0.396													0	6	---	---	---	---	
MCM3AP	8888	broad.mit.edu	37	21	47678652	47678653	+	Intron	DEL	TG	-	-	rs67042936		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47678652_47678653delTG	uc002zir.1	-						MCM3AP_uc002zip.1_Intron|MCM3AP_uc002ziq.1_Intron	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3						DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					TTATATtgtatgtgtgtgtgtg	0.233													2	5	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16264718	16264718	+	Intron	DEL	A	-	-	rs141034850		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16264718delA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						agaaaaaagtagtgataacct	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16854261	16854261	+	IGR	DEL	A	-	-	rs113095446		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16854261delA								OR11H1 (404457 upstream) : CCT8L2 (217387 downstream)																							actcgaatggaatcatcatcg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16855366	16855367	+	IGR	INS	-	ATC	ATC	rs113661662		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16855366_16855367insATC								OR11H1 (405562 upstream) : CCT8L2 (216281 downstream)																							actcgaatggaatcatcaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16929133	16929133	+	IGR	DEL	G	-	-	rs113117133		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16929133delG								OR11H1 (479329 upstream) : CCT8L2 (142515 downstream)																							gtaggcttcagaaggttggta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16937716	16937719	+	IGR	DEL	ATTC	-	-	rs147333975		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16937716_16937719delATTC								OR11H1 (487912 upstream) : CCT8L2 (133929 downstream)																							acaATGTAATATTCATCCCATTTG	0.137													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17237187	17237188	+	IGR	INS	-	T	T	rs143051422		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17237187_17237188insT								psiTPTE22 (57666 upstream) : XKR3 (27125 downstream)																							aaaatgctagctttttaaaaaa	0.050													4	2	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18976026	18976027	+	Intron	INS	-	A	A	rs151178184		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18976026_18976027insA	uc002zom.1	+						DGCR5_uc002zon.1_Intron	NR_002733				Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						gactctgtctcaaaaaaaaaaa	0.059													4	3	---	---	---	---	
TSSK2	23617	broad.mit.edu	37	22	19119776	19119776	+	Frame_Shift_Del	DEL	G	-	-	rs139504972		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19119776delG	uc002zow.2	+	1	1456	c.864delG	c.(862-864)GAGfs	p.E288fs	DGCR14_uc002zot.2_3'UTR|DGCR14_uc002zou.2_3'UTR|DGCR14_uc002zov.2_RNA	NM_053006	NP_443732	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	288					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1	Colorectal(54;0.0993)					TCAAGAGGGAGGGGGAGGGCA	0.637													42	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23842658	23842659	+	IGR	INS	-	GT	GT	rs149310011	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23842658_23842659insGT								ZDHHC8P1 (97859 upstream) : IGLL1 (72656 downstream)																							AGCCCTGGGTGGGGAGAGGGAA	0.347													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23875621	23875622	+	IGR	INS	-	CAGAT	CAGAT	rs138007271	by1000genomes	TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23875621_23875622insCAGAT								ZDHHC8P1 (130822 upstream) : IGLL1 (39693 downstream)																							gtgagggaggcagcggcaggaa	0.391													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	24606952	24606953	+	IGR	DEL	AG	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24606952_24606953delAG								SUSD2 (21878 upstream) : GGT5 (8670 downstream)																							gacaaagtatagagaaataagg	0.005													2	7	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24665251	24665251	+	5'Flank	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24665251delT	uc002zzw.2	+						CYTSA_uc002zzv.3_5'Flank|CYTSA_uc011ajq.1_5'Flank	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						AATTTTTTTCTTTTTTTTTTT	0.209													4	2	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24670794	24670795	+	Intron	DEL	GA	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24670794_24670795delGA	uc002zzw.2	+						CYTSA_uc002zzv.3_Intron|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						ACTGGGCTTTGACCCCTGTTCT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	37672139	37672139	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37672139delC								RAC2 (31834 upstream) : CYTH4 (6356 downstream)																							ccccaccgttccccgctgtgt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44725321	44725322	+	IGR	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44725321_44725322delAC								KIAA1644 (16590 upstream) : LDOC1L (163128 downstream)																							CGAGAATGGGacacacacacac	0.550													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44997842	44997844	+	IGR	DEL	TTT	-	-	rs113167830		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44997842_44997844delTTT								NCRNA00207 (29513 upstream) : PRR5 (66749 downstream)																							atgaaccaccttttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47786426	47786426	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47786426delA								TBC1D22A (216704 upstream) : None (None downstream)																							CAGATTCTTCAATGCCGGCTT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48150055	48150055	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48150055delA	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																		aaaaagggccaaaaattggtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48298040	48298040	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48298040delC								TBC1D22A (728318 upstream) : FAM19A5 (587248 downstream)																							GCTGGTGCCACCCCGGTGACT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49254059	49254060	+	IGR	INS	-	CT	CT	rs34459014		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49254059_49254060insCT								FAM19A5 (106317 upstream) : C22orf34 (554116 downstream)																							CAGCTCAGACCCTCTGCTCTAT	0.619													6	3	---	---	---	---	
TTLL8	164714	broad.mit.edu	37	22	50467835	50467836	+	Intron	INS	-	C	C	rs34192325		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50467835_50467836insC	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		CATCCTGAAGACCCCACACACA	0.426													2	4	---	---	---	---	
MLC1	23209	broad.mit.edu	37	22	50502312	50502313	+	Intron	DEL	CT	-	-	rs10618008		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50502312_50502313delCT	uc003bjg.1	-						MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Intron|MLC1_uc011arm.1_Intron|MLC1_uc011arn.1_Intron|MLC1_uc011aro.1_Intron	NM_139202	NP_631941	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with							basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity			pancreas(1)	1		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CCCCCTCCCCCTGCAGGCCACT	0.728													3	4	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	302265	302265	+	Intron	DEL	T	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:302265delT	uc004cpg.2	-						PPP2R3B_uc004cpf.2_5'UTR	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ctcctgcccctcctcctgcct	0.537													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3212392	3212392	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3212392delC								ARSF (181645 upstream) : MXRA5 (14219 downstream)																							ctcttcctttcctcctcttcc	0.154													4	2	---	---	---	---	
OTUD5	55593	broad.mit.edu	37	X	48791593	48791593	+	Intron	DEL	T	-	-	rs10715761		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48791593delT	uc004dlu.2	-						OTUD5_uc004dlt.3_Intron|OTUD5_uc004dlv.2_Intron|OTUD5_uc011mmp.1_Intron	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a						negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						TAACTCCCTATTTTTTTTTTT	0.443													4	2	---	---	---	---	
SSX8	280659	broad.mit.edu	37	X	52662823	52662824	+	RNA	DEL	AC	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52662823_52662824delAC	uc011mob.1	+	8		c.1272_1273delAC				NR_027250				Homo sapiens cDNA FLJ56587 complete cds, highly similar to Protein SSX8.												0						acaccacacaacacacacacac	0.391													4	2	---	---	---	---	
NCRNA00182	100302692	broad.mit.edu	37	X	73506653	73506654	+	Intron	INS	-	A	A	rs71700920		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73506653_73506654insA	uc010nlq.1	-						NCRNA00182_uc004ebr.1_Intron					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						acctgtcccttaaaaaaaaaaa	0.158													3	3	---	---	---	---	
SLC16A2	6567	broad.mit.edu	37	X	73645487	73645487	+	Intron	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73645487delC	uc004ebt.2	+							NM_006517	NP_006508	P36021	MOT8_HUMAN	solute carrier family 16, member 2							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)	TGATTGTAGGCCCCAGCTCAA	0.498													4	2	---	---	---	---	
ARHGAP36	158763	broad.mit.edu	37	X	130219333	130219333	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130219333delA	uc004evz.2	+						ARHGAP36_uc004ewa.2_Intron|ARHGAP36_uc004ewb.2_Intron|ARHGAP36_uc004ewc.2_Intron	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						CTCTCAGGTCAAAAAAAAAAA	0.393													4	2	---	---	---	---	
GABRA3	2556	broad.mit.edu	37	X	151337055	151337055	+	Intron	DEL	G	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151337055delG	uc010ntk.1	-							NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AGGAAAAAGAGGGGGGGAAAG	0.507													24	21	---	---	---	---	
RBMY3AP	64593	broad.mit.edu	37	Y	9452697	9452697	+	Intron	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9452697delA	uc004fsg.1	-						RBMY3AP_uc010nwq.1_Intron	NR_001573				Homo sapiens RNA binding motif protein, Y-linked, family 3, member A pseudogene (RBMY3AP), non-coding RNA.												0						GGTAGCATTTACCTTGGCCTC	0.363													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9956897	9956899	+	IGR	DEL	GTG	-	-	rs112328349		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9956897_9956899delGTG								TTTY22 (306043 upstream) : None (None downstream)																							cccagcagcagtgttctggaatc	0.010													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9992532	9992532	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9992532delA								TTTY22 (341678 upstream) : None (None downstream)																							tctattgatcaagttttcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9994811	9994816	+	IGR	DEL	AAATTC	-	-	rs79502907		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9994811_9994816delAAATTC								TTTY22 (343957 upstream) : None (None downstream)																							ATAATTAATAAAATTCTCTAATGGGA	0.301													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10044465	10044465	+	IGR	DEL	C	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10044465delC								TTTY22 (393611 upstream) : None (None downstream)																							gaaatatcttcccacaaaaac	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10054312	10054312	+	IGR	DEL	A	-	-			TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054312delA								TTTY22 (403458 upstream) : None (None downstream)																							cacagagtagaaagctttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59030174	59030174	+	IGR	DEL	T	-	-	rs67740623		TCGA-66-2742-01A-01D-0983-08	TCGA-66-2742-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59030174delT								None (None upstream) : None (None downstream)																							aaaaaaaaGGTGGGGGGCAGA	0.050													2	4	---	---	---	---	
