Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLEKHN1	84069	broad.mit.edu	37	1	909828	909828	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:909828G>A	uc001ace.2	+	15	1900	c.1865G>A	c.(1864-1866)CGG>CAG	p.R622Q	PLEKHN1_uc001acd.2_Missense_Mutation_p.R570Q|PLEKHN1_uc001acf.2_Missense_Mutation_p.R535Q	NM_032129	NP_115505	Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N	622											0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CCAGATGGTCGGTCCCCCAGG	0.637													24	61	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16256434	16256434	+	Silent	SNP	C	A	A	rs111615156		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16256434C>A	uc001axk.1	+	11	3903	c.3699C>A	c.(3697-3699)GTC>GTA	p.V1233V	SPEN_uc010obp.1_Silent_p.V1192V	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1233					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGGATCATGTCGATTTTGATA	0.463													39	77	---	---	---	---	PASS
KIAA0090	23065	broad.mit.edu	37	1	19547255	19547255	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19547255C>T	uc001bbo.2	-						KIAA0090_uc001bbn.2_Intron|KIAA0090_uc001bbp.2_Intron|KIAA0090_uc001bbq.2_Intron|KIAA0090_uc001bbr.2_Intron	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor							integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		ATGAGGGTCTCACCTGCTTTG	0.488													38	23	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32196749	32196749	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32196749C>A	uc001btn.2	-	29	4386	c.4032G>T	c.(4030-4032)GAG>GAT	p.E1344D	BAI2_uc001btm.2_Missense_Mutation_p.E338D|BAI2_uc001btp.1_Missense_Mutation_p.E338D|BAI2_uc010ogn.1_Missense_Mutation_p.E314D|BAI2_uc010ogo.1_Missense_Mutation_p.E953D|BAI2_uc010ogp.1_Missense_Mutation_p.E1277D|BAI2_uc010ogq.1_Missense_Mutation_p.E1311D|BAI2_uc001bto.2_Missense_Mutation_p.E1344D	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1344	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGAGCCTGGCTCAGTGGGCC	0.701													7	6	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38197148	38197148	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38197148G>T	uc009vvi.2	-	7	1684	c.1598C>A	c.(1597-1599)TCC>TAC	p.S533Y	EPHA10_uc009vvh.1_RNA|EPHA10_uc001cbu.2_RNA|EPHA10_uc001cbv.1_RNA	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	533	Fibronectin type-III 2.|Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGCCCCGGGGAAGCGGCCCG	0.597													36	93	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39851393	39851393	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39851393C>G	uc010oiu.1	+	21	9587	c.9456C>G	c.(9454-9456)ATC>ATG	p.I3152M	MACF1_uc010ois.1_Missense_Mutation_p.I2650M|MACF1_uc001cda.1_Missense_Mutation_p.I2537M|MACF1_uc001cdc.1_Missense_Mutation_p.I1716M	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	4717					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGTCAGCTATCAGCACCCAAC	0.507													32	27	---	---	---	---	PASS
TAL1	6886	broad.mit.edu	37	1	47689737	47689737	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47689737C>G	uc001cqx.2	-	3	1057	c.480G>C	c.(478-480)ATG>ATC	p.M160I	TAL1_uc009vyq.2_5'UTR|TAL1_uc001cqy.2_Missense_Mutation_p.M160I|TAL1_uc001cra.1_RNA|TAL1_uc001cqz.1_RNA	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	160					basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						TGGTGGTGAACATAGGGAAGG	0.567			T	TRD@|SIL	lymphoblastic leukemia/biphasic								43	143	---	---	---	---	PASS
ZZZ3	26009	broad.mit.edu	37	1	78098555	78098555	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78098555C>T	uc001dhq.2	-	5	961	c.485G>A	c.(484-486)CGA>CAA	p.R162Q	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.R162Q|ZZZ3_uc001dhp.2_Missense_Mutation_p.R162Q	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5						TCGACAAGCTCGTTTAGTCCC	0.393													76	288	---	---	---	---	PASS
FUBP1	8880	broad.mit.edu	37	1	78435678	78435678	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78435678C>G	uc001dii.2	-	2	231	c.142G>C	c.(142-144)GAT>CAT	p.D48H	FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_Missense_Mutation_p.D48H	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein	48					transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						GTCCCTGCATCACCTCCAATT	0.303													41	26	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87031644	87031644	+	Silent	SNP	T	C	C	rs79822589	byFrequency	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87031644T>C	uc009wcs.2	+	6	939	c.895T>C	c.(895-897)TTG>CTG	p.L299L	CLCA4_uc009wct.2_Silent_p.L62L|CLCA4_uc009wcu.2_Silent_p.L119L	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	299						apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TGTCTTCTCATTGCTGAAGAT	0.403													82	82	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103379182	103379182	+	Intron	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103379182C>A	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TAAATTAGTGCATTTACTCAC	0.348													55	75	---	---	---	---	PASS
POLR3GL	84265	broad.mit.edu	37	1	145460115	145460115	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145460115C>T	uc001enp.1	-	2	215	c.108G>A	c.(106-108)CAG>CAA	p.Q36Q	NBPF10_uc001emp.3_Intron	NM_032305	NP_115681	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	36											0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTGGAGAAGGCTGCAGGGTGG	0.622													10	22	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145562897	145562897	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145562897C>A	uc001eob.1	+	10	2693	c.2585C>A	c.(2584-2586)ACG>AAG	p.T862K	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.T705K	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	862	Potential.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAGTATAATACGGCCTGCCGG	0.677													13	10	---	---	---	---	PASS
FMO5	2330	broad.mit.edu	37	1	146680526	146680526	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146680526G>C	uc001epi.2	-	6	1107	c.718C>G	c.(718-720)CTT>GTT	p.L240V	FMO5_uc001eph.3_Missense_Mutation_p.L240V|FMO5_uc001epj.2_Missense_Mutation_p.L240V|FMO5_uc001epk.3_Missense_Mutation_p.L240V	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1	240						integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)					AAATGTGTAAGTCGAGAAGAG	0.428													19	184	---	---	---	---	PASS
CRNN	49860	broad.mit.edu	37	1	152382780	152382780	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152382780C>T	uc001ezx.2	-	3	852	c.778G>A	c.(778-780)GCC>ACC	p.A260T		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	260	Gln-rich.				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCATTGGTGGCCTCCTGTGTC	0.597													99	759	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153303234	153303234	+	3'UTR	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153303234G>C	uc001fbo.2	-	9					PGLYRP4_uc001fbp.2_3'UTR	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta						defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAGGACCTGGGGCTTCTCTC	0.567													26	194	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153317794	153317794	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153317794G>A	uc001fbo.2	-	4	269	c.204C>T	c.(202-204)TGC>TGT	p.C68C	PGLYRP4_uc001fbp.2_Silent_p.C64C	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta	68					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGAATACTGCAGCCAACAG	0.587													115	159	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153317795	153317795	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153317795C>G	uc001fbo.2	-	4	268	c.203G>C	c.(202-204)TGC>TCC	p.C68S	PGLYRP4_uc001fbp.2_Missense_Mutation_p.C64S	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta	68					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAATACTGCAGCCAACAGC	0.582													116	161	---	---	---	---	PASS
CKS1B	1163	broad.mit.edu	37	1	154947241	154947241	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154947241A>G	uc001fgb.2	+	1	124	c.20A>G	c.(19-21)TAC>TGC	p.Y7C	SHC1_uc001ffx.2_5'Flank|SHC1_uc001ffy.2_5'Flank|CKS1B_uc001fga.2_RNA|hsa-mir-4258|MI0015857_5'Flank	NM_001826	NP_001817	P61024	CKS1_HUMAN	CDC28 protein kinase 1B	7					cell division|cell proliferation|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle	nucleoplasm	cyclin-dependent protein kinase regulator activity|protein binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AAACAAATTTACTATTCGGAC	0.572													17	30	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155823139	155823139	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155823139C>T	uc001flz.2	-	2	530	c.433G>A	c.(433-435)GAC>AAC	p.D145N	GON4L_uc001fly.1_Missense_Mutation_p.D145N|GON4L_uc009wrh.1_Missense_Mutation_p.D145N|GON4L_uc001fma.1_Missense_Mutation_p.D145N|GON4L_uc001fmc.2_Missense_Mutation_p.D145N|GON4L_uc001fmd.3_Missense_Mutation_p.D145N|GON4L_uc009wri.2_5'UTR	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	145					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCACATCTGTCTTCTTGGGTA	0.448													60	372	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158326363	158326363	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158326363C>G	uc001fse.2	+	5	1219	c.980C>G	c.(979-981)TCA>TGA	p.S327*	CD1E_uc010pid.1_3'UTR|CD1E_uc010pie.1_3'UTR|CD1E_uc010pif.1_3'UTR|CD1E_uc001fsd.2_3'UTR|CD1E_uc001fsk.2_Nonsense_Mutation_p.S237*|CD1E_uc001fsj.2_Nonsense_Mutation_p.S182*|CD1E_uc001fsc.2_Nonsense_Mutation_p.S138*|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Nonsense_Mutation_p.S83*|CD1E_uc001fsf.2_Nonsense_Mutation_p.S327*|CD1E_uc001fry.2_Nonsense_Mutation_p.S272*|CD1E_uc001fsg.2_3'UTR|CD1E_uc001fsh.2_Nonsense_Mutation_p.S138*|CD1E_uc001fsi.2_3'UTR|CD1E_uc009wsv.2_Nonsense_Mutation_p.S228*|CD1E_uc001frz.2_Nonsense_Mutation_p.S237*|CD1E_uc009wsw.2_Intron	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	327					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					GTAGTTGACTCACGGTTAAAA	0.308													38	47	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161163501	161163501	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161163501C>A	uc001fyt.3	-	6	2092	c.1664G>T	c.(1663-1665)GGT>GTT	p.G555V		NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	555	TSP type-1.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GTACTTGCCACCATTCCGGGG	0.657													53	312	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165380257	165380257	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165380257T>C	uc001gda.2	-	5	1012	c.712A>G	c.(712-714)AGG>GGG	p.R238G		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	238	Hinge.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	TCTAGAATCCTCTCCACAGGC	0.478													59	128	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167847818	167847818	+	Silent	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167847818A>T	uc001ger.2	-	12	1570	c.1272T>A	c.(1270-1272)ATT>ATA	p.I424I	ADCY10_uc009wvk.2_Silent_p.I332I|ADCY10_uc010plj.1_Silent_p.I271I|ADCY10_uc009wvl.2_Silent_p.I423I	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	424					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						CGCAGGTCACAATTCCTGGGT	0.423													47	118	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169489835	169489835	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169489835C>G	uc001ggg.1	-	22	6261	c.6116G>C	c.(6115-6117)AGA>ACA	p.R2039T		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	2039	F5/8 type C 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	CCTAATATATCTAGCCACAAT	0.373													21	47	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173478803	173478803	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173478803G>C	uc001giz.2	-	24	3366	c.2943C>G	c.(2941-2943)GGC>GGG	p.G981G	SLC9A11_uc009wwe.2_Silent_p.G539G	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	981	cNMP.				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						AGGCATCAAAGCCTTCATATA	0.393													10	57	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175299318	175299318	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175299318C>A	uc001gkp.1	-	19	3766	c.3685G>T	c.(3685-3687)GAC>TAC	p.D1229Y	TNR_uc009wwu.1_Missense_Mutation_p.D1229Y	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1229	Fibrinogen C-terminal.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TCCCGCATGTCCACGCGCAGC	0.572													47	88	---	---	---	---	PASS
TOR1AIP2	163590	broad.mit.edu	37	1	179815248	179815248	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179815248G>C	uc001gnk.2	-	6	1759	c.1371C>G	c.(1369-1371)GTC>GTG	p.V457V	TOR1AIP2_uc001gnl.2_Silent_p.V457V	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2	457						endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1						TCACTGGCTGGACTGGCAGTA	0.448													35	160	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201009468	201009468	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201009468C>G	uc001gvv.2	-	43	5488	c.5261G>C	c.(5260-5262)AGA>ACA	p.R1754T		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1754	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GGAGCTCTTTCTGTCCTCAGG	0.572													23	66	---	---	---	---	PASS
NAV1	89796	broad.mit.edu	37	1	201757714	201757714	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201757714G>A	uc001gwu.2	+	10	3461	c.3114G>A	c.(3112-3114)GAG>GAA	p.E1038E	NAV1_uc001gwv.1_Silent_p.E546E|NAV1_uc001gww.1_Silent_p.E647E|NAV1_uc001gwx.2_Silent_p.E647E|NAV1_uc001gwy.1_Silent_p.E419E	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1038					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						CCCTGGCCGAGAGACCCAAGG	0.622													65	172	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201868841	201868841	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201868841C>T	uc001gxb.2	-	2	1548	c.1300G>A	c.(1300-1302)GAG>AAG	p.E434K	LMOD1_uc010ppu.1_Missense_Mutation_p.E383K	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	434					muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						ATCTCCATCTCCGTCTTGCCT	0.582													31	50	---	---	---	---	PASS
PPP1R12B	4660	broad.mit.edu	37	1	202538294	202538294	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202538294G>A	uc001gya.1	+	23	2975	c.2831G>A	c.(2830-2832)CGC>CAC	p.R944H	PPP1R12B_uc001gxz.1_Missense_Mutation_p.R944H|PPP1R12B_uc001gyb.1_Missense_Mutation_p.R170H|PPP1R12B_uc001gyc.1_Missense_Mutation_p.R170H	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)	944					regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCCTTGGAGCGCAAAATGTCA	0.433													4	118	---	---	---	---	PASS
SLC45A3	85414	broad.mit.edu	37	1	205632421	205632421	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205632421G>A	uc001hda.1	-	3	837	c.498C>T	c.(496-498)TTC>TTT	p.F166F	SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_5'UTR|SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	166	Helical; Name=5; (Potential).				transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GACTGATCATGAAGGCATAGA	0.632			T	ETV1|ETV5|ELK4|ERG	prostate 								5	88	---	---	---	---	PASS
DYRK3	8444	broad.mit.edu	37	1	206821586	206821586	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206821586G>A	uc001hej.2	+	3	1211	c.1043G>A	c.(1042-1044)CGC>CAC	p.R348H	DYRK3_uc001hek.2_Intron|DYRK3_uc001hei.2_Missense_Mutation_p.R328H	NM_003582	NP_003573	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	348	Protein kinase.				erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|central_nervous_system(1)	3	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CACCACGGGCGCAGTTCAACC	0.458													5	292	---	---	---	---	PASS
IL19	29949	broad.mit.edu	37	1	207010317	207010317	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207010317C>T	uc001hep.2	+	4	1098	c.159C>T	c.(157-159)ACC>ACT	p.T53T	IL19_uc001heo.2_Silent_p.T91T|IL19_uc010prx.1_Silent_p.T53T	NM_013371	NP_037503	Q9UHD0	IL19_HUMAN	interleukin 19 isoform 2 precursor	53					apoptosis|immune response|signal transduction	extracellular space	cytokine activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(75;0.211)			CTAAGGACACCTTCCCAAATG	0.408													64	137	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207803911	207803911	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207803911C>G	uc001hfy.2	+	38	6192	c.6052C>G	c.(6052-6054)CAA>GAA	p.Q2018E	CR1_uc001hfx.2_Missense_Mutation_p.Q2468E	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	2018	Cytoplasmic (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TTTACATTCTCAAGGAGGCAG	0.343													9	26	---	---	---	---	PASS
CD34	947	broad.mit.edu	37	1	208073314	208073314	+	Silent	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208073314A>T	uc001hgw.1	-	2	372	c.114T>A	c.(112-114)ACT>ACA	p.T38T	CD34_uc001hgx.1_Silent_p.T38T|CD34_uc010psj.1_5'UTR	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a	38	Extracellular (Potential).				cell-cell adhesion|leukocyte migration|regulation of immune response	integral to membrane	carbohydrate binding			ovary(1)	1						CTGGGGTAGCAGTACCGTTGT	0.443													22	134	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215844357	215844357	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215844357A>G	uc001hku.1	-	64	14477	c.14090T>C	c.(14089-14091)TTT>TCT	p.F4697S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4697	Fibronectin type-III 32.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGAATCTATAAAAGATGTTGA	0.363										HNSCC(13;0.011)			132	241	---	---	---	---	PASS
C1orf131	128061	broad.mit.edu	37	1	231364912	231364912	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231364912T>C	uc001hun.1	-	3	531	c.494A>G	c.(493-495)GAA>GGA	p.E165G	C1orf131_uc001hul.2_Missense_Mutation_p.E165G|C1orf131_uc001hum.2_Missense_Mutation_p.E164G|C1orf131_uc010pwd.1_Missense_Mutation_p.E164G	NM_152379	NP_689592	Q8NDD1	CA131_HUMAN	hypothetical protein LOC128061	165										central_nervous_system(1)|skin(1)	2	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TAGGTTAAATTCTTGTGTATC	0.209													23	47	---	---	---	---	PASS
ZNF124	7678	broad.mit.edu	37	1	247322379	247322379	+	Intron	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247322379G>C	uc001ick.2	-						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Intron	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			CTAAAATGTAGACCCAGAAAT	0.259													10	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	248685906	248685906	+	IGR	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685906C>A								OR2G6 (8 upstream) : OR2T29 (35939 downstream)																							TAGGAAACACCTGGAATTCTA	0.493													28	23	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1921039	1921039	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1921039C>A	uc002qxe.2	-	11	2383	c.1556G>T	c.(1555-1557)GGG>GTG	p.G519V	MYT1L_uc002qxd.2_Missense_Mutation_p.G517V|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	519	C2HC-type 2.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TGGGTACAGCCCAGTTACGTG	0.552													107	164	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24930643	24930643	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24930643G>T	uc002rfk.2	+	11	2562	c.2304G>T	c.(2302-2304)CTG>CTT	p.L768L	NCOA1_uc010eye.2_Silent_p.L768L|NCOA1_uc002rfi.2_Silent_p.L617L|NCOA1_uc002rfj.2_Silent_p.L768L|NCOA1_uc002rfl.2_Silent_p.L768L	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	768									PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTGAGCCTGGATGATGTAA	0.388			T	PAX3	alveolar rhadomyosarcoma								35	62	---	---	---	---	PASS
DNAJC27	51277	broad.mit.edu	37	2	25170608	25170608	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25170608G>C	uc002rft.1	-	7	750	c.699C>G	c.(697-699)GTC>GTG	p.V233V	DNAJC27_uc010ykn.1_Silent_p.V162V|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_3'UTR	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	233	J.				protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						ACGCTTTATTGACTTCATCCC	0.458													24	121	---	---	---	---	PASS
SLC30A3	7781	broad.mit.edu	37	2	27480121	27480121	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27480121G>T	uc002rjk.2	-	5	864	c.678C>A	c.(676-678)CCC>CCA	p.P226P	SLC30A3_uc002rjj.2_Missense_Mutation_p.P72H|SLC30A3_uc010ylh.1_Silent_p.P221P	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),	226	Cytoplasmic (Potential).				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTTCCCCAGGGGCAGGGGCT	0.652													22	58	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32703827	32703827	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32703827C>A	uc010ezu.2	+	36	7327	c.7193C>A	c.(7192-7194)TCT>TAT	p.S2398Y		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2398					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GGAGATATATCTTGGGGTGGT	0.413													28	156	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46313509	46313509	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46313509C>G	uc002rut.2	+							NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			CAGGTAGCCTCTTCTCTCCTC	0.502													53	105	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55254534	55254534	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55254534G>C	uc002rye.2	-	3	999	c.701C>G	c.(700-702)TCT>TGT	p.S234C	RTN4_uc002ryd.2_Missense_Mutation_p.S28C|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	234	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						AGAAGGAAGAGAAGCAGCAGT	0.443													25	121	---	---	---	---	PASS
DGUOK	1716	broad.mit.edu	37	2	74154148	74154148	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74154148G>T	uc002sjx.2	+	1	196	c.111G>T	c.(109-111)GGG>GGT	p.G37G	DGUOK_uc002sjy.2_Silent_p.G37G|DGUOK_uc002sjz.2_RNA	NM_080916	NP_550438	Q16854	DGUOK_HUMAN	deoxyguanosine kinase isoform a precursor	37					guanosine metabolic process|purine base metabolic process|purine deoxyribonucleoside metabolic process|purine-containing compound salvage	mitochondrial matrix	ATP binding|deoxyguanosine kinase activity|phosphotransferase activity, alcohol group as acceptor				0						CGGGGCGCGGGCCCCGAAGGC	0.657													55	91	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74273535	74273535	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74273535G>C	uc002skb.3	+	1	86	c.86G>C	c.(85-87)GGA>GCA	p.G29A	TET3_uc010fez.1_Missense_Mutation_p.G29A	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	29							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GAGCCCGCTGGACCCAGTCTG	0.647													23	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309569	89309569	+	RNA	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309569A>T	uc010ytr.1	-	74		c.6778T>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCCCAGATCCACTGCCGCTGA	0.478													125	152	---	---	---	---	PASS
PROM2	150696	broad.mit.edu	37	2	95943153	95943153	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95943153A>G	uc002suh.1	+	7	947	c.814A>G	c.(814-816)ACA>GCA	p.T272A	PROM2_uc002sui.2_Missense_Mutation_p.T272A|PROM2_uc002suj.2_5'UTR|PROM2_uc002suk.2_Missense_Mutation_p.T272A|PROM2_uc002sul.2_5'UTR	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	272	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						CTTGAATGCTACAGTGGTAGA	0.647													26	61	---	---	---	---	PASS
SEMA4C	54910	broad.mit.edu	37	2	97527051	97527051	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97527051T>C	uc002sxh.3	-	15	1974	c.1814A>G	c.(1813-1815)TAC>TGC	p.Y605C	SEMA4C_uc002sxf.3_Missense_Mutation_p.Y105C|SEMA4C_uc002sxe.2_Missense_Mutation_p.Y146C|SEMA4C_uc002sxg.3_Missense_Mutation_p.Y658C	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor	605	Extracellular (Potential).|Ig-like C2-type.				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2						CCGGGCATCGTAGAGGAAGGA	0.697													17	32	---	---	---	---	PASS
TSGA10	80705	broad.mit.edu	37	2	99636926	99636926	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99636926G>T	uc002szg.3	-	16	2262	c.1634C>A	c.(1633-1635)TCT>TAT	p.S545Y	TSGA10_uc002szh.3_Missense_Mutation_p.S545Y|TSGA10_uc002szi.3_Missense_Mutation_p.S545Y|TSGA10_uc010fin.1_Missense_Mutation_p.S545Y	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	545					spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						AGAATGAGCAGAATCTAACTC	0.368													21	92	---	---	---	---	PASS
SEPT10	151011	broad.mit.edu	37	2	110323374	110323374	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110323374G>C	uc002tew.2	-	7	1204	c.825C>G	c.(823-825)GTC>GTG	p.V275V	SEPT10_uc010ywu.1_Silent_p.V108V|SEPT10_uc002tex.2_Silent_p.V252V|SEPT10_uc002tey.2_Silent_p.V275V|SEPT10_uc010ywv.1_Silent_p.V141V|SEPT10_uc002tev.1_Silent_p.V82V|SEPT10_uc010fjo.2_RNA|SEPT10_uc002tez.1_Silent_p.V50V	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1	275					cell cycle|cell division	septin complex	GTP binding				0						GGCGAGCTTTGACCATCTTGT	0.428													84	377	---	---	---	---	PASS
ACOXL	55289	broad.mit.edu	37	2	111806850	111806850	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111806850G>C	uc002tgr.3	+	17	1739	c.1515G>C	c.(1513-1515)CAG>CAC	p.Q505H	ACOXL_uc010fkc.2_Missense_Mutation_p.Q475H|ACOXL_uc010yxk.1_Missense_Mutation_p.Q475H	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2	505					fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						AAGAGGACCAGACTTTGTTAA	0.428													11	73	---	---	---	---	PASS
PSD4	23550	broad.mit.edu	37	2	113943490	113943490	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113943490C>T	uc002tjc.2	+	5	1469	c.1286C>T	c.(1285-1287)CCC>CTC	p.P429L	PSD4_uc002tjd.2_Missense_Mutation_p.P50L|PSD4_uc002tje.2_Intron|PSD4_uc002tjf.2_Missense_Mutation_p.P50L	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	429					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						GAATCTCTTCCCTGCACCTTG	0.647													17	35	---	---	---	---	PASS
CFC1B	653275	broad.mit.edu	37	2	131356222	131356222	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131356222G>T	uc002tro.1	-	3	631	c.240C>A	c.(238-240)TTC>TTA	p.F80L		NM_001079530	NP_001072998	P0CG36	CFC1B_HUMAN	cripto, FRL-1, cryptic family 1B	80					gastrulation	extracellular region					0	Colorectal(110;0.1)					TACCCTCTCCGAAAGCCCGGG	0.592													20	126	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141128305	141128305	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141128305C>A	uc002tvj.1	-	71	11954	c.10982G>T	c.(10981-10983)GGC>GTC	p.G3661V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3661	Extracellular (Potential).|LDL-receptor class A 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTCATCACTGCCATCCACACA	0.398										TSP Lung(27;0.18)			58	320	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141128306	141128306	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141128306C>G	uc002tvj.1	-	71	11953	c.10981G>C	c.(10981-10983)GGC>CGC	p.G3661R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3661	Extracellular (Potential).|LDL-receptor class A 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCATCACTGCCATCCACACAG	0.403										TSP Lung(27;0.18)			57	318	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141250190	141250190	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141250190G>T	uc002tvj.1	-	57	10079	c.9107C>A	c.(9106-9108)ACA>AAA	p.T3036K		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3036	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTTAAAAGTGTGTAGTTGGA	0.363										TSP Lung(27;0.18)			29	198	---	---	---	---	PASS
ARL6IP6	151188	broad.mit.edu	37	2	153575138	153575138	+	5'UTR	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153575138C>G	uc002tyn.2	+	1					ARL6IP6_uc002tym.2_Intron|ARL6IP6_uc002tyo.2_5'Flank|PRPF40A_uc002tyh.3_5'Flank|PRPF40A_uc010zcd.1_5'Flank|PRPF40A_uc002tyi.2_5'Flank|PRPF40A_uc002tyj.2_5'Flank|PRPF40A_uc002tyl.1_5'Flank	NM_152522	NP_689735	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation-like factor 6 interacting							integral to membrane					0						TGTTTCGCGCCATGTCGTTTG	0.697													23	82	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158406748	158406748	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158406748C>G	uc002tzk.3	-	4	944	c.701G>C	c.(700-702)CGT>CCT	p.R234P	ACVR1C_uc002tzl.3_Missense_Mutation_p.R154P|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.R184P	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	234	Protein kinase.|Cytoplasmic (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						TTCTGCCTCACGAAACCAAGA	0.433													21	199	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158406867	158406867	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158406867C>A	uc002tzk.3	-	4	825	c.582G>T	c.(580-582)ACG>ACT	p.T194T	ACVR1C_uc002tzl.3_Silent_p.T114T|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Silent_p.T144T	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	194	Cytoplasmic (Potential).|GS.			T->D: Pro-apoptotic.	apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						GAAGCACAATCGTCCTTGCAA	0.398													36	139	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160755237	160755237	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160755237C>T	uc002ubc.3	-	2	497	c.428G>A	c.(427-429)GGA>GAA	p.G143E	LY75_uc002ubb.3_Missense_Mutation_p.G143E|LY75_uc010fos.2_Missense_Mutation_p.G143E|LY75_uc010fot.1_Missense_Mutation_p.G143E	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	143	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		CTCTGAGCCTCCTTTCTTCCA	0.502													28	112	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160755382	160755382	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160755382G>T	uc002ubc.3	-	2	352	c.283C>A	c.(283-285)CTG>ATG	p.L95M	LY75_uc002ubb.3_Missense_Mutation_p.L95M|LY75_uc010fos.2_Missense_Mutation_p.L95M|LY75_uc010fot.1_Missense_Mutation_p.L95M	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	95	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		AACATTCTCAGCTCATTTACC	0.522													66	79	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168107682	168107682	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107682G>A	uc002udx.2	+	8	9798	c.9780G>A	c.(9778-9780)GAG>GAA	p.E3260E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.E3085E|XIRP2_uc010fpq.2_Silent_p.E3038E|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3085					actin cytoskeleton organization	cell junction	actin binding	p.E3260G(1)		skin(7)|ovary(6)|pancreas(1)	14						ACGCTCAAGAGGAAATCAGGA	0.423													25	101	---	---	---	---	PASS
G6PC2	57818	broad.mit.edu	37	2	169764111	169764111	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169764111C>G	uc002uem.2	+	5	682	c.590C>G	c.(589-591)CCA>CGA	p.P197R	G6PC2_uc002uen.2_3'UTR|G6PC2_uc010fpv.2_Missense_Mutation_p.P81R	NM_021176	NP_066999	Q9NQR9	G6PC2_HUMAN	islet-specific glucose-6-phosphatase-related	197	Cytoplasmic (Potential).				gluconeogenesis|glucose homeostasis|glucose transport|regulation of insulin secretion|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity			pancreas(1)	1						GAACACACTCCAGGCATCCAA	0.517													25	169	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179441933	179441933	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179441933G>A	uc010zfg.1	-	273	61649	c.61425C>T	c.(61423-61425)CCC>CCT	p.P20475P	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.P14170P|TTN_uc010zfi.1_Silent_p.P14103P|TTN_uc010zfj.1_Silent_p.P13978P|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21402							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGACCTGGGGGACCAGGTA	0.458													20	69	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179453427	179453427	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179453427G>A	uc010zfg.1	-	253	55545	c.55321C>T	c.(55321-55323)CGA>TGA	p.R18441*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R12136*|TTN_uc010zfi.1_Nonsense_Mutation_p.R12069*|TTN_uc010zfj.1_Nonsense_Mutation_p.R11944*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19368							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGACCCATCGTGTTGAATGC	0.423													112	142	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179613541	179613541	+	Missense_Mutation	SNP	G	A	A	rs138927584		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613541G>A	uc002unb.2	-	46	13810	c.13586C>T	c.(13585-13587)GCA>GTA	p.A4529V	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	660							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAATTTATTGCAATGTTAGA	0.318													43	138	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179613794	179613794	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613794G>A	uc002unb.2	-	46	13557	c.13333C>T	c.(13333-13335)CTT>TTT	p.L4445F	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCACCAAGGGATTCTTCA	0.348													26	128	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179631292	179631292	+	Silent	SNP	G	A	A	rs151129843	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179631292G>A	uc010zfg.1	-	41	9743	c.9519C>T	c.(9517-9519)GAC>GAT	p.D3173D	TTN_uc010zfh.1_Silent_p.D3127D|TTN_uc010zfi.1_Silent_p.D3127D|TTN_uc010zfj.1_Silent_p.D3127D|TTN_uc002umz.1_5'Flank|TTN_uc002unb.2_Silent_p.D3173D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3173							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCAACATCGTCTTCATTGA	0.368													64	87	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179649052	179649052	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179649052G>T	uc010zfg.1	-	16	2744	c.2520C>A	c.(2518-2520)GCC>GCA	p.A840A	TTN_uc010zfh.1_Silent_p.A794A|TTN_uc010zfi.1_Silent_p.A794A|TTN_uc010zfj.1_Silent_p.A794A|TTN_uc002unb.2_Silent_p.A840A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	840							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGTAATGTGGCAATAGCAC	0.468													67	79	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191827719	191827719	+	3'UTR	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191827719C>A	uc002usf.2	+	18					GLS_uc002ush.2_3'UTR|GLS_uc010zgi.1_3'UTR|GLS_uc010zgj.1_3'UTR	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GTAATGGTCTCAAATCCCAAG	0.348													12	70	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197066124	197066124	+	Intron	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197066124A>C	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						TGAAAACACAAGAAACAGCAC	0.318													22	81	---	---	---	---	PASS
OBSL1	23363	broad.mit.edu	37	2	220435043	220435043	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220435043G>C	uc010fwk.2	-	1	969	c.912C>G	c.(910-912)CTC>CTG	p.L304L	OBSL1_uc010fwl.1_5'Flank|OBSL1_uc002vmi.2_Silent_p.L304L|OBSL1_uc002vmj.2_Intron|INHA_uc002vmk.1_5'Flank	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	304	Ig-like 3.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		AAAGCACCTTGAGCACGAAGC	0.697													6	23	---	---	---	---	PASS
ACSL3	2181	broad.mit.edu	37	2	223791784	223791784	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223791784C>G	uc002vni.2	+	12	1793	c.1342C>G	c.(1342-1344)CTG>GTG	p.L448V	ACSL3_uc002vnj.2_Missense_Mutation_p.L448V	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	448	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TATTCGTCTCCTGTTGTGTGG	0.388			T	ETV1	prostate								81	59	---	---	---	---	PASS
CRTAP	10491	broad.mit.edu	37	3	33156012	33156012	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33156012A>G	uc003cfl.3	+	1	563	c.443A>G	c.(442-444)TAC>TGC	p.Y148C	CRTAP_uc010hfz.2_Missense_Mutation_p.Y148C|CRTAP_uc003cfm.2_5'UTR|CRTAP_uc003cfn.2_5'UTR	NM_006371	NP_006362	O75718	CRTAP_HUMAN	cartilage associated protein precursor	148						proteinaceous extracellular matrix	binding				0						CGCGAGCCCTACAAGTTCCTG	0.483													3	2	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33580423	33580423	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33580423T>C	uc003cfu.2	-	32	3770	c.3416A>G	c.(3415-3417)TAT>TGT	p.Y1139C	CLASP2_uc003cfs.2_Missense_Mutation_p.Y346C|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Missense_Mutation_p.Y739C	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	1148										ovary(3)|central_nervous_system(1)	4						TTCTGTGTCATAATCAAATGC	0.313													15	9	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38622756	38622756	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38622756C>T	uc003cio.2	-	17	3088	c.2894G>A	c.(2893-2895)CGC>CAC	p.R965H	SCN5A_uc003cin.2_Missense_Mutation_p.R965H|SCN5A_uc003cil.3_Missense_Mutation_p.R965H|SCN5A_uc010hhi.2_Missense_Mutation_p.R965H|SCN5A_uc010hhk.2_Missense_Mutation_p.R965H|SCN5A_uc011ayr.1_Missense_Mutation_p.R965H|SCN5A_uc010hhj.1_Missense_Mutation_p.R576H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	965			R -> C (in BRS1; steady state inactivation shifted to a more negative potential; slower recovery from inactivation).		blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CCTCTGGATGCGGGCCAGGGC	0.627													10	19	---	---	---	---	PASS
DNAH12	201625	broad.mit.edu	37	3	57493430	57493430	+	Silent	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493430A>C	uc003dit.2	-	8	1018	c.837T>G	c.(835-837)GGT>GGG	p.G279G	DNAH12_uc003diu.2_Silent_p.G279G	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1	279	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						CAGGTTTAACACCTTCTAGTG	0.299													55	152	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108812288	108812288	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108812288C>T	uc003dxl.2	-	8	771	c.684G>A	c.(682-684)CTG>CTA	p.L228L	MORC1_uc011bhn.1_Silent_p.L228L	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	228					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CATACTCCTCCAGAGCTCCAG	0.438													45	88	---	---	---	---	PASS
MIR567	693152	broad.mit.edu	37	3	111831716	111831716	+	RNA	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111831716G>T	hsa-mir-567|MI0003573	+			c.69G>T			C3orf52_uc003dyq.3_Intron|C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron																	0						GGAAGAACATGCAAAACTAAA	0.328													4	26	---	---	---	---	PASS
MIR567	693152	broad.mit.edu	37	3	111831717	111831717	+	RNA	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111831717C>G	hsa-mir-567|MI0003573	+			c.70C>G			C3orf52_uc003dyq.3_Intron|C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron																	0						GAAGAACATGCAAAACTAAAA	0.328													5	27	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122658260	122658260	+	Intron	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122658260A>C	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc003egb.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		GAAGGGAAGAAAGCAATCGTA	0.483													31	50	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123454236	123454236	+	Intron	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123454236T>C	uc003ego.2	-						MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCACAAAGCCTAGACATACCT	0.448													72	142	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127379588	127379588	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127379588G>T	uc003ejq.2	+	3	741	c.717G>T	c.(715-717)ATG>ATT	p.M239I		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	239	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						AGAGCAGCATGGGGCCCAGCT	0.632													56	103	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132221231	132221231	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132221231G>T	uc003eor.2	+	40	4700	c.4635G>T	c.(4633-4635)TGG>TGT	p.W1545C		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1545							heat shock protein binding			ovary(1)|breast(1)	2						GAATTTTGTGGTATCTCCTTG	0.413													38	241	---	---	---	---	PASS
ACPL2	92370	broad.mit.edu	37	3	141006283	141006283	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141006283C>G	uc003etu.2	+	7	792	c.493C>G	c.(493-495)CTC>GTC	p.L165V	ACPL2_uc003etv.2_Missense_Mutation_p.L165V|ACPL2_uc011bna.1_Missense_Mutation_p.L127V|ACPL2_uc011bnb.1_Missense_Mutation_p.L148V	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor	165						extracellular region	acid phosphatase activity			skin(1)	1						GATGGGAGAGCTCACACAGAC	0.547													81	397	---	---	---	---	PASS
SLC9A9	285195	broad.mit.edu	37	3	142985589	142985589	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142985589A>T	uc003evn.2	-	16	2075	c.1893T>A	c.(1891-1893)TAT>TAA	p.Y631*		NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen	631					regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						GCTTGAGTTCATAGCCTCCCA	0.483													67	129	---	---	---	---	PASS
WWTR1	25937	broad.mit.edu	37	3	149374962	149374962	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374962C>A	uc003exe.2	-	1	148	c.132G>T	c.(130-132)CGG>CGT	p.R44R	WWTR1_uc003exf.2_Silent_p.R44R|WWTR1_uc011bns.1_Silent_p.R44R|WWTR1_uc003exh.2_Silent_p.R44R|uc010hvg.1_RNA|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	44					hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GGATCTTCTTCCGCCACGAGC	0.627													26	13	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157031515	157031515	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157031515C>G	uc003fbj.1	-	11	2222	c.1905G>C	c.(1903-1905)CAG>CAC	p.Q635H	VEPH1_uc003fbk.1_Missense_Mutation_p.Q635H|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	635						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CAGAATGACTCTGAATGGACA	0.463													57	210	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164757683	164757683	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164757683G>C	uc003fei.2	-	19	2298	c.2236C>G	c.(2236-2238)CTA>GTA	p.L746V		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	746	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	ACCTGTTTTAGAACAGGAGTA	0.348										HNSCC(35;0.089)			82	278	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164905998	164905998	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164905998G>C	uc003fej.3	-	2	3065	c.2621C>G	c.(2620-2622)CCT>CGT	p.P874R	SLITRK3_uc003fek.2_Missense_Mutation_p.P874R	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	874	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						GCCTCCCCCAGGAGGAAACAG	0.577										HNSCC(40;0.11)			67	211	---	---	---	---	PASS
EIF2B5	8893	broad.mit.edu	37	3	183855722	183855722	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183855722G>A	uc003fmp.2	+	4	907	c.543G>A	c.(541-543)ATG>ATA	p.M181I	EIF2B5_uc003fmq.2_5'UTR	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,	181					astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TTTCTGTGATGACGATGATCT	0.478													24	186	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184038451	184038451	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184038451G>T	uc003fnp.2	+	8	769	c.571G>T	c.(571-573)GAT>TAT	p.D191Y	EIF4G1_uc003fno.1_Missense_Mutation_p.D132Y|EIF4G1_uc010hxw.1_Missense_Mutation_p.D27Y|EIF4G1_uc003fnt.2_5'UTR|EIF4G1_uc003fnq.2_Missense_Mutation_p.D104Y|EIF4G1_uc003fnr.2_Missense_Mutation_p.D27Y|EIF4G1_uc010hxx.2_Missense_Mutation_p.D198Y|EIF4G1_uc003fns.2_Missense_Mutation_p.D151Y|EIF4G1_uc010hxy.2_Missense_Mutation_p.D198Y|EIF4G1_uc010hxz.1_Missense_Mutation_p.D104Y|EIF4G1_uc003fnv.3_Missense_Mutation_p.D191Y|EIF4G1_uc003fnu.3_Missense_Mutation_p.D191Y|EIF4G1_uc003fnw.2_Missense_Mutation_p.D198Y|EIF4G1_uc003fnx.2_5'UTR|EIF4G1_uc003fny.3_5'UTR	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	191	PABPC1-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGGAGGAAAGGATATCACAGA	0.552													12	211	---	---	---	---	PASS
ST6GAL1	6480	broad.mit.edu	37	3	186760650	186760650	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186760650A>T	uc003frb.2	+	4	591	c.159A>T	c.(157-159)AAA>AAT	p.K53N	ST6GAL1_uc003frc.2_Intron|ST6GAL1_uc003frd.2_Missense_Mutation_p.K53N	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide	53	Lumenal (Potential).				humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		GTCTGGGGAAATTGGCCATGG	0.517													58	486	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186943130	186943130	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186943130C>G	uc003frh.1	-	13	2055	c.1723G>C	c.(1723-1725)GAG>CAG	p.E575Q		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	575	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGGGGTCCCTCAGGCAGACAG	0.587													78	335	---	---	---	---	PASS
C3orf21	152002	broad.mit.edu	37	3	194877186	194877186	+	Silent	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194877186T>A	uc003fum.3	-	3	885	c.777A>T	c.(775-777)CCA>CCT	p.P259P	C3orf21_uc003ful.2_Silent_p.P56P|C3orf21_uc011bsw.1_Silent_p.P113P	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002	259						integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		ACCTGTAAACTGGCTGCATCT	0.567													52	143	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195486098	195486098	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195486098C>T	uc011bto.1	-	18	14959	c.14499G>A	c.(14497-14499)GTG>GTA	p.V4833V	MUC4_uc003fuz.2_Silent_p.V559V|MUC4_uc003fva.2_Silent_p.V441V|MUC4_uc003fvb.2_Silent_p.V477V|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Silent_p.V477V|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Silent_p.V441V|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Silent_p.V525V|MUC4_uc011bti.1_Silent_p.V525V|MUC4_uc011btj.1_Silent_p.V702V|MUC4_uc011btk.1_Silent_p.V441V|MUC4_uc011btl.1_Silent_p.V470V|MUC4_uc011btm.1_Silent_p.V650V|MUC4_uc011btn.1_Silent_p.V441V|MUC4_uc003fvo.2_Silent_p.V725V|MUC4_uc003fvp.2_Silent_p.V674V	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1718					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTTCAATCACACGACCAC	0.547													112	714	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197423861	197423861	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197423861C>T	uc003fyc.2	-	8	1504	c.1321G>A	c.(1321-1323)GAA>AAA	p.E441K	KIAA0226_uc003fyd.3_Missense_Mutation_p.E396K|KIAA0226_uc003fye.1_Missense_Mutation_p.E148K|KIAA0226_uc003fyf.2_Missense_Mutation_p.E289K	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	441	Ser-rich.				autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GTGCTGACTTCACTGCTTTGA	0.468													38	139	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2951675	2951675	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2951675G>C	uc003ggj.1	-	8	1340	c.1268C>G	c.(1267-1269)CCC>CGC	p.P423R	C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Missense_Mutation_p.P169R|NOP14_uc003ggk.3_Missense_Mutation_p.P423R|NOP14_uc003ggl.2_Missense_Mutation_p.P423R	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14	423					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						GAACGTGTAGGGCAGCTCGTC	0.552													101	212	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8602926	8602926	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8602926G>T	uc003glm.2	+	3	324	c.198G>T	c.(196-198)CAG>CAT	p.Q66H	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_5'UTR|CPZ_uc003glo.2_Missense_Mutation_p.Q55H|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	66	FZ.				proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						ACCTGCTTCAGCACCGGTCAT	0.652													56	25	---	---	---	---	PASS
PHOX2B	8929	broad.mit.edu	37	4	41750405	41750405	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41750405T>A	uc003gwf.3	-	1	583	c.223A>T	c.(223-225)AGC>TGC	p.S75C		NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	75					positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						TACGGACTGCTCTGGTGGTCC	0.582			Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				28	63	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060612	46060612	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060612T>C	uc003gxb.2	-	6	805	c.653A>G	c.(652-654)TAT>TGT	p.Y218C		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	218	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTTCCACTTATACTCAATTTC	0.358													18	87	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46930261	46930261	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46930261T>A	uc003gxg.2	-	9	1785	c.1646A>T	c.(1645-1647)AAA>ATA	p.K549I		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	549					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACTTTCTGATTTCTCCATAGT	0.279													52	85	---	---	---	---	PASS
CNGA1	1259	broad.mit.edu	37	4	47939169	47939169	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47939169C>A	uc003gxt.3	-	11	1608	c.1342G>T	c.(1342-1344)GTT>TTT	p.V448F	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.V517F	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	448	Extracellular (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						TTCTCATCAACTGTTTTTTTG	0.338													76	367	---	---	---	---	PASS
ART3	419	broad.mit.edu	37	4	77003475	77003475	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77003475A>G	uc003hjo.2	+	3	687	c.568A>G	c.(568-570)AAA>GAA	p.K190E	ART3_uc003hji.2_Missense_Mutation_p.K190E|ART3_uc003hjj.2_Missense_Mutation_p.K190E|ART3_uc003hjk.2_Missense_Mutation_p.K190E|ART3_uc010ija.1_Missense_Mutation_p.K190E|ART3_uc003hjn.2_Missense_Mutation_p.K190E|ART3_uc003hjp.2_Intron|ART3_uc010ijb.2_Intron|ART3_uc003hjq.2_Intron|ART3_uc003hjr.2_Missense_Mutation_p.K160E|ART3_uc010ijc.2_Missense_Mutation_p.K160E|ART3_uc010ijd.2_Missense_Mutation_p.K160E	NM_001130016	NP_001123488	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3 isoform a	190					protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ATATTCAGCCAAACCTCAGGC	0.408													5	116	---	---	---	---	PASS
SHROOM3	57619	broad.mit.edu	37	4	77677699	77677699	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77677699A>T	uc011cbx.1	+	8	5760	c.4807A>T	c.(4807-4809)ACT>TCT	p.T1603S	SHROOM3_uc003hkg.2_Missense_Mutation_p.T1381S	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	1603					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			CAGACTCCAAACTTCTATCAA	0.532													8	77	---	---	---	---	PASS
ANKRD56	345079	broad.mit.edu	37	4	77817078	77817078	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77817078C>A	uc003hki.2	-	1	1925	c.1925G>T	c.(1924-1926)GGT>GTT	p.G642V		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	642	ANK 1.										0						CCTGAGGTCACCATGTTTGGC	0.522													78	138	---	---	---	---	PASS
MRPL1	65008	broad.mit.edu	37	4	78792917	78792917	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78792917G>T	uc003hku.2	+	2	249	c.51G>T	c.(49-51)AGG>AGT	p.R17S		NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor	17							RNA binding				0						ATCATCAAAGGCATAGCCTTT	0.289													54	148	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89574024	89574024	+	Silent	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89574024C>G	uc003hrw.1	+	6	634	c.468C>G	c.(466-468)GGC>GGG	p.G156G	HERC3_uc003hrv.2_Silent_p.G156G|HERC3_uc011cdn.1_Silent_p.G38G	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	156	RCC1 4.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TTTCAGATGGCCAGTTCTTCA	0.498													28	31	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91230459	91230459	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91230459G>A	uc003hsv.3	+	2	1364	c.1024G>A	c.(1024-1026)GCT>ACT	p.A342T	FAM190A_uc003hsu.3_Missense_Mutation_p.A342T|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.A342T	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	342										large_intestine(1)|ovary(1)	2						GGAAACCTCTGCTGCTAATCA	0.423													53	54	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106155423	106155423	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106155423G>A	uc003hxk.2	+	3	710	c.324G>A	c.(322-324)CAG>CAA	p.Q108Q	TET2_uc011cez.1_Silent_p.Q129Q|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Silent_p.Q108Q|TET2_uc003hxi.1_Silent_p.Q108Q	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	108					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.Q108*(1)		haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGCTCCTTCAGATCAAGAAAT	0.418			Mis N|F		MDS								25	66	---	---	---	---	PASS
LARP7	51574	broad.mit.edu	37	4	113568940	113568940	+	Silent	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113568940A>G	uc003iay.2	+	8	1370	c.1092A>G	c.(1090-1092)AAA>AAG	p.K364K	LARP7_uc003iaz.2_Silent_p.K371K|LARP7_uc003iba.2_Silent_p.K285K|LARP7_uc003ibb.2_Silent_p.K364K	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	364	Lys-rich.				RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AAAAACATAAAGAGAGACATA	0.323													24	20	---	---	---	---	PASS
GAB1	2549	broad.mit.edu	37	4	144390336	144390336	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144390336G>C	uc003ije.2	+	10	2438	c.2079G>C	c.(2077-2079)GTG>GTC	p.V693V	GAB1_uc003ijd.2_Silent_p.V723V|GAB1_uc011chq.1_Silent_p.V590V	NM_002039	NP_002030	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1 isoform b	693					cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)					CGAAGAGTGTGAAATGAAAAT	0.418													22	48	---	---	---	---	PASS
MMAA	166785	broad.mit.edu	37	4	146576521	146576521	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146576521A>C	uc003ikh.3	+	7	1277	c.1192A>C	c.(1192-1194)ATT>CTT	p.I398L	MMAA_uc010iow.2_RNA	NM_172250	NP_758454	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria type A precursor	398						mitochondrion	GTP binding|nucleoside-triphosphatase activity			ovary(1)	1	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAAGGTTCTCATTGGGGCCCT	0.413													34	116	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175898418	175898418	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175898418G>T	uc003iuc.2	+	5	2412	c.1742G>T	c.(1741-1743)TGC>TTC	p.C581F	ADAM29_uc003iud.2_Missense_Mutation_p.C581F|ADAM29_uc010irr.2_Missense_Mutation_p.C581F|ADAM29_uc011cki.1_Missense_Mutation_p.C581F	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	581	Cys-rich.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GACATAATGTGCTGGAGTACT	0.433													80	143	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177032792	177032792	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177032792G>A	uc003iuj.2	+	3	289	c.133G>A	c.(133-135)GTA>ATA	p.V45I	WDR17_uc003iuk.2_Missense_Mutation_p.V21I|WDR17_uc003ium.3_Missense_Mutation_p.V21I|WDR17_uc003iul.1_Missense_Mutation_p.V21I	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	45										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GAACAAGGATGTATGTGCTGC	0.398													19	41	---	---	---	---	PASS
WWC2	80014	broad.mit.edu	37	4	184182512	184182512	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184182512A>G	uc010irx.2	+	11	1918	c.1736A>G	c.(1735-1737)CAT>CGT	p.H579R	WWC2_uc003ivk.3_Missense_Mutation_p.H374R|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Missense_Mutation_p.H261R|WWC2_uc003ivn.3_Missense_Mutation_p.H143R	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	579										ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GCCTCTCTCCATCAGTTCACT	0.483													3	14	---	---	---	---	PASS
ACSL1	2180	broad.mit.edu	37	4	185678778	185678778	+	Intron	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185678778G>A	uc003iww.2	-						ACSL1_uc011ckm.1_Intron|ACSL1_uc003iwt.1_Intron|ACSL1_uc003iwu.1_Intron|ACSL1_uc011ckn.1_Intron|ACSL1_uc003iws.1_Intron	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1						digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCACTCAGATGAAGGTCATAC	0.358													45	202	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1432617	1432617	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1432617G>A	uc003jck.2	-	4	736	c.615C>T	c.(613-615)AAC>AAT	p.N205N		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	205	Extracellular (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CAAAAGTGTCGTTGAGGCCCG	0.617													19	190	---	---	---	---	PASS
LPCAT1	79888	broad.mit.edu	37	5	1479781	1479781	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1479781G>A	uc003jcm.2	-	8	888	c.771C>T	c.(769-771)ATC>ATT	p.I257I		NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	257	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGAGCCACAGGATTTCCAGCC	0.463											OREG0016481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	129	---	---	---	---	PASS
MRPL36	64979	broad.mit.edu	37	5	1798922	1798922	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1798922T>C	uc003jcx.3	-	2	191	c.128A>G	c.(127-129)GAA>GGA	p.E43G	NDUFS6_uc003jcy.2_5'Flank	NM_032479	NP_115868	Q9P0J6	RM36_HUMAN	mitochondrial ribosomal protein L36 precursor	43					translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0				GBM - Glioblastoma multiforme(108;0.241)		TGCCCCGGGTTCCACAGCCAC	0.592													58	117	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34824081	34824081	+	Missense_Mutation	SNP	G	C	C	rs138949061		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34824081G>C	uc003jir.2	+	15	2330	c.2134G>C	c.(2134-2136)GAG>CAG	p.E712Q	RAI14_uc010iur.2_Missense_Mutation_p.E683Q|RAI14_uc011coj.1_Missense_Mutation_p.E712Q|RAI14_uc003jis.2_Missense_Mutation_p.E715Q|RAI14_uc003jit.2_Missense_Mutation_p.E712Q|RAI14_uc011cok.1_Missense_Mutation_p.E704Q	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	712	Potential.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					AGTGTTGAATGAGTTGACCCA	0.438													47	100	---	---	---	---	PASS
AGXT2	64902	broad.mit.edu	37	5	35035343	35035343	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35035343C>G	uc003jjf.2	-	5	644	c.565G>C	c.(565-567)GAC>CAC	p.D189H	AGXT2_uc011com.1_Missense_Mutation_p.D189H|AGXT2_uc011con.1_Missense_Mutation_p.D97H	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor	189					glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	GAAATGATGTCTATGTTGTTT	0.443													45	318	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	58652602	58652602	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58652602C>T	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrw.2_Missense_Mutation_p.R24H	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CTTTGAGAAACGCAATCTTGA	0.453													14	19	---	---	---	---	PASS
KIF2A	3796	broad.mit.edu	37	5	61681323	61681323	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61681323C>G	uc003jsy.3	+	20	2359	c.2048C>G	c.(2047-2049)TCT>TGT	p.S683C	KIF2A_uc003jsz.3_Missense_Mutation_p.S721C|KIF2A_uc010iwp.2_Missense_Mutation_p.S664C|KIF2A_uc003jsx.3_Missense_Mutation_p.S663C|KIF2A_uc010iwq.2_Missense_Mutation_p.S486C	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1	683	Potential.				blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		AAAGTGAAATCTTTCCGTGCA	0.428													3	6	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71489755	71489755	+	Silent	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71489755T>C	uc003kbw.3	+	5	814	c.573T>C	c.(571-573)CCT>CCC	p.P191P	MAP1B_uc010iyw.1_Silent_p.P208P|MAP1B_uc010iyx.1_Silent_p.P65P|MAP1B_uc010iyy.1_Silent_p.P65P	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	191						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGTTCTGTCCTGAAGAAGGGG	0.398													4	126	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77334898	77334898	+	Silent	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77334898T>A	uc003kfj.2	-	23	2903	c.2778A>T	c.(2776-2778)ATA>ATT	p.I926I		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	926					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TTTTCATGCCTATAGGAAGTT	0.269									Hermansky-Pudlak_syndrome				25	39	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77334899	77334899	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77334899A>T	uc003kfj.2	-	23	2902	c.2777T>A	c.(2776-2778)ATA>AAA	p.I926K		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	926					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TTTCATGCCTATAGGAAGTTT	0.269									Hermansky-Pudlak_syndrome				26	39	---	---	---	---	PASS
PCSK1	5122	broad.mit.edu	37	5	95728914	95728914	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95728914G>A	uc003kls.1	-	14	2259	c.2053C>T	c.(2053-2055)CCA>TCA	p.P685S	PCSK1_uc010jbi.1_Missense_Mutation_p.P375S	NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	685					cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GACTTCTTTGGTGATTGCTTT	0.512													6	233	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127420339	127420339	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127420339C>A	uc003kus.2	+	1	857	c.693C>A	c.(691-693)GCC>GCA	p.A231A	FLJ33630_uc003kun.2_5'Flank|FLJ33630_uc003kuo.2_5'Flank|FLJ33630_uc003kup.1_5'Flank|FLJ33630_uc003kuq.1_5'Flank|FLJ33630_uc003kur.2_5'Flank|SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Silent_p.A231A	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	231	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGCACACAGCCGCGCAGCTGG	0.622													8	28	---	---	---	---	PASS
CCNI2	645121	broad.mit.edu	37	5	132088668	132088668	+	3'UTR	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132088668C>G	uc003kxq.1	+	6					CCNI2_uc011cxg.1_3'UTR|CCNI2_uc011cxh.1_3'UTR|SEPT8_uc003kxr.2_Intron	NM_001039780	NP_001034869	Q6ZMN8	CCNI2_HUMAN	cyclin I family, member 2						regulation of cyclin-dependent protein kinase activity		protein kinase binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTAGCCCCTCTGCCTCCACC	0.498													32	49	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134018131	134018131	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134018131C>G	uc003kzs.2	+	9	1738	c.1450C>G	c.(1450-1452)CAA>GAA	p.Q484E	SEC24A_uc011cxu.1_Missense_Mutation_p.Q248E	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	484					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACCAGAAGTTCAAAATGCTAC	0.308													93	51	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139886511	139886511	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139886511A>T	uc003lfs.1	+	19	3624	c.3500A>T	c.(3499-3501)TAT>TTT	p.Y1167F	ANKHD1_uc003lfq.1_Missense_Mutation_p.Y1186F|ANKHD1_uc003lfr.2_Missense_Mutation_p.Y1167F|ANKHD1_uc003lft.1_Missense_Mutation_p.Y378F|ANKHD1_uc003lfu.1_Missense_Mutation_p.Y647F|ANKHD1_uc003lfv.1_Missense_Mutation_p.Y244F|ANKHD1-EIF4EBP3_uc011czh.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1167						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGGAGGATATGTTAATATC	0.383													133	81	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140221129	140221129	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221129C>T	uc003lhs.2	+	1	223	c.223C>T	c.(223-225)CTG>TTG	p.L75L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.L75L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	75	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGGACCTTCTGGAGGTAAG	0.647													86	299	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554031	140554031	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554031C>A	uc003lit.2	+	1	1789	c.1615C>A	c.(1615-1617)CCC>ACC	p.P539T		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	539	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGCGGCTCCCCCGCGCTGAG	0.692													59	36	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554309	140554309	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554309C>T	uc003lit.2	+	1	2067	c.1893C>T	c.(1891-1893)AGC>AGT	p.S631S		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	631	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCTGCTGAGCGAGCGCGACG	0.687													39	292	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559155	140559155	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559155C>G	uc011dai.1	+	1	1726	c.1540C>G	c.(1540-1542)CTG>GTG	p.L514V	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	514	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACGGCCACCTGTTCGCCCT	0.687													70	400	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559354	140559354	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559354C>T	uc011dai.1	+	1	1925	c.1739C>T	c.(1738-1740)GCG>GTG	p.A580V	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	580	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGCCCCGGGCGGCCGAGCCG	0.706													25	110	---	---	---	---	PASS
PCDHGC4	56098	broad.mit.edu	37	5	140865571	140865571	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140865571C>T	uc003lky.1	+	1	831	c.831C>T	c.(829-831)GTC>GTT	p.V277V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Silent_p.V277V	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	277	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTAACGTCACCTTTTATT	0.527													34	138	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148712284	148712284	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148712284G>T	uc003lqh.2	+	17	2133	c.2002G>T	c.(2002-2004)GCC>TCC	p.A668S	AFAP1L1_uc010jgy.2_Missense_Mutation_p.A668S|AFAP1L1_uc003lqi.1_Missense_Mutation_p.A283S	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	668	Potential.						protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGGAAGAAGCCGTGGCCAC	0.547													6	45	---	---	---	---	PASS
RBM22	55696	broad.mit.edu	37	5	150071393	150071393	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150071393G>A	uc003lst.2	-	11	1305	c.1183C>T	c.(1183-1185)CGG>TGG	p.R395W		NM_018047	NP_060517	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	395	Pro-rich.				protein import into nucleus, translocation	catalytic step 2 spliceosome|cytoplasm	calcium-dependent protein binding|nucleotide binding|RNA binding|zinc ion binding				0		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGGAGCCCGCATGAAAGGA	0.537													4	147	---	---	---	---	PASS
ANXA6	309	broad.mit.edu	37	5	150488040	150488040	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150488040C>T	uc003ltl.1	-	23	1908	c.1756G>A	c.(1756-1758)GTC>ATC	p.V586I	ANXA6_uc011dcp.1_Missense_Mutation_p.V554I|ANXA6_uc003ltm.1_Missense_Mutation_p.V580I|ANXA6_uc003ltn.1_Missense_Mutation_p.V373I|ANXA6_uc003lto.1_Missense_Mutation_p.V173I	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1	586	Annexin 7.					melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCATCCCTGACATCCCCAGAC	0.527													11	266	---	---	---	---	PASS
MED7	9443	broad.mit.edu	37	5	156566273	156566273	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156566273C>G	uc010jik.2	-	2	562	c.170G>C	c.(169-171)CGC>CCC	p.R57P	MED7_uc003lwm.3_Missense_Mutation_p.R57P	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	57					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCCAAAGGGCGGATGATAAG	0.398													26	131	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161580227	161580227	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161580227C>T	uc003lyz.3	+	9	1615	c.1257C>T	c.(1255-1257)TGC>TGT	p.C419C	GABRG2_uc010jjc.2_Silent_p.C467C|GABRG2_uc003lyy.3_Silent_p.C427C|GABRG2_uc011dej.1_Silent_p.C324C	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	419	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		GTTTTTTCTGCTGTTTTGAAG	0.468													129	76	---	---	---	---	PASS
RARS	5917	broad.mit.edu	37	5	167943953	167943953	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167943953C>G	uc003lzx.2	+	13	1664	c.1623C>G	c.(1621-1623)ATC>ATG	p.I541M	RARS_uc011deo.1_Missense_Mutation_p.I335M	NM_002887	NP_002878	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	541					arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TCACTAGAATCAGGTAATTGT	0.338													58	277	---	---	---	---	PASS
SH3PXD2B	285590	broad.mit.edu	37	5	171766306	171766306	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171766306C>A	uc003mbr.2	-	13	1974	c.1803G>T	c.(1801-1803)AAG>AAT	p.K601N		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	601					adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGGCCAAGACCTTGTGGCCAC	0.567													77	51	---	---	---	---	PASS
STC2	8614	broad.mit.edu	37	5	172755103	172755103	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172755103C>G	uc003mco.1	-	1	1404	c.94G>C	c.(94-96)GAG>CAG	p.E32Q	STC2_uc003mcn.1_5'Flank	NM_003714	NP_003705	O76061	STC2_HUMAN	stanniocalcin 2 precursor	32					cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGGGGACCCTCGGGTGGGTTG	0.647													29	124	---	---	---	---	PASS
KIAA1191	57179	broad.mit.edu	37	5	175782611	175782611	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175782611G>A	uc003mdw.2	-	4	542	c.170C>T	c.(169-171)CCA>CTA	p.P57L	KIAA1191_uc003mdx.2_Missense_Mutation_p.P38L|KIAA1191_uc003mdy.2_Missense_Mutation_p.P57L|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177	Q96A73	K1191_HUMAN	hypothetical protein LOC57179 isoform a	57							protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		TGGAATCACTGGCTTCCAAGG	0.577													44	134	---	---	---	---	PASS
RMND5B	64777	broad.mit.edu	37	5	177573150	177573150	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177573150C>A	uc003mim.2	+	8	910	c.730C>A	c.(730-732)CGG>AGG	p.R244R	RMND5B_uc003min.2_Silent_p.R244R|RMND5B_uc003mio.2_Silent_p.R231R|RMND5B_uc003mip.2_Silent_p.R244R|RMND5B_uc011dgf.1_Silent_p.R285R|RMND5B_uc003miq.2_Silent_p.R184R	NM_022762	NP_073599	Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog	244										ovary(1)|skin(1)	2	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGTACCTGCGGCTGGGCTT	0.642											OREG0017097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	17	---	---	---	---	PASS
IRF4	3662	broad.mit.edu	37	6	401482	401482	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:401482G>A	uc003msz.3	+	7	917	c.804G>A	c.(802-804)ACG>ACA	p.T268T	IRF4_uc010jne.1_Silent_p.T268T|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Silent_p.T267T|IRF4_uc003mtc.1_Silent_p.T98T	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	268					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		AGCTGACCACGTCCAGCCCCG	0.612			T	IGH@	MM 								52	30	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	13228281	13228281	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13228281G>T	uc010jpc.2	+	9	1552	c.1220G>T	c.(1219-1221)AGC>ATC	p.S407I	PHACTR1_uc011dir.1_Missense_Mutation_p.S476I|PHACTR1_uc003nag.1_Missense_Mutation_p.S407I|PHACTR1_uc003nah.1_Missense_Mutation_p.S407I	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	407						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GACGACGACAGCTCATTATAC	0.333													32	31	---	---	---	---	PASS
HIST1H2AM	8336	broad.mit.edu	37	6	27860774	27860774	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27860774G>C	uc003nkb.1	-	1	190	c.154C>G	c.(154-156)CTG>GTG	p.L52V	HIST1H3J_uc003nka.2_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003514	NP_003505	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	52					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			ovary(2)	2						ACCGCCGCCAGGTAAACCGGC	0.652													26	83	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31911428	31911428	+	5'Flank	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31911428C>A	uc003nyj.3	+						C2_uc003nyc.2_Silent_p.P312P|C2_uc011doo.1_Silent_p.P279P|C2_uc011dop.1_Silent_p.P311P|C2_uc003nyf.2_Silent_p.P525P|C2_uc010jtk.2_Silent_p.P393P|C2_uc011doq.1_Silent_p.P496P|C2_uc003nyg.2_Silent_p.P302P|CFB_uc011dor.1_Silent_p.P372P|C2_uc003nyh.1_Silent_p.P176P|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						CAGGAGACCCCAAATCCCAGT	0.522													33	105	---	---	---	---	PASS
WDR46	9277	broad.mit.edu	37	6	33254660	33254660	+	Silent	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33254660A>G	uc003ods.2	-	10	1071	c.1027T>C	c.(1027-1029)TTA>CTA	p.L343L	WDR46_uc011dra.1_Silent_p.L289L|WDR46_uc010juo.1_RNA|PFDN6_uc003odt.1_5'Flank|PFDN6_uc010jup.1_5'Flank	NM_005452	NP_005443	O15213	WDR46_HUMAN	WD repeat domain 46 isoform 1	343	WD 4.										0						GGACTCCATAAAGACACAGTA	0.483													61	144	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56504859	56504859	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56504859C>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron|DST_uc003pde.2_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTGTACCTTCAGACAGTAAA	0.338													19	91	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87969026	87969026	+	Silent	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87969026A>G	uc003plm.3	+	8	5720	c.5679A>G	c.(5677-5679)CAA>CAG	p.Q1893Q		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1893					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TAAACATTCAATTTAATGACA	0.358													5	77	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102511876	102511876	+	Intron	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102511876A>C	uc003pqp.3	+						GRIK2_uc003pqo.3_Missense_Mutation_p.T868P|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	CCATCCAGACACTGTTTAGTA	0.284													12	50	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136990473	136990473	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136990473G>C	uc003qhc.2	-	8	1675	c.1314C>G	c.(1312-1314)CTC>CTG	p.L438L	MAP3K5_uc011edk.1_Silent_p.L283L|MAP3K5_uc010kgw.1_Silent_p.L438L	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	438					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CTGCCAGGAGGAGGACCGCAT	0.388													32	117	---	---	---	---	PASS
TAB2	23118	broad.mit.edu	37	6	149700431	149700431	+	Silent	SNP	G	A	A	rs150699204	byFrequency	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149700431G>A	uc003qmj.2	+	3	1558	c.1380G>A	c.(1378-1380)ACG>ACA	p.T460T	TAB2_uc011eec.1_Silent_p.T428T|TAB2_uc010kia.1_Silent_p.T460T|TAB2_uc010kib.1_Silent_p.T460T|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	460					activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						AGCCCAATACGAAATACACTT	0.463													33	93	---	---	---	---	PASS
C6orf70	55780	broad.mit.edu	37	6	170169794	170169794	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170169794G>A	uc003qxg.1	+	12	1251	c.1218G>A	c.(1216-1218)CTG>CTA	p.L406L	C6orf70_uc011ehb.1_Silent_p.L280L|C6orf70_uc003qxh.1_Silent_p.L406L|C6orf70_uc010kky.1_Silent_p.L280L|C6orf70_uc003qxi.1_Silent_p.L54L	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	406	Helical; (Potential).					integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		ATGACTGTCTGCTATCAGTTT	0.308													9	52	---	---	---	---	PASS
PHF14	9678	broad.mit.edu	37	7	11075331	11075331	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11075331A>G	uc003sry.1	+	8	1955	c.1520A>G	c.(1519-1521)AAG>AGG	p.K507R	PHF14_uc011jxi.1_Missense_Mutation_p.K222R|PHF14_uc003srz.2_Missense_Mutation_p.K507R|PHF14_uc011jxj.1_Missense_Mutation_p.K222R	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2	507							zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		AGAAAGTGGAAGAGAAAAAAC	0.368													51	179	---	---	---	---	PASS
TXNDC3	51314	broad.mit.edu	37	7	37924760	37924760	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37924760G>T	uc003tfn.2	+	14	1525	c.1153G>T	c.(1153-1155)GCC>TCC	p.A385S		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	385	NDK 2.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TCCATCTCTAGCCCTTGTTTT	0.358									Kartagener_syndrome				17	49	---	---	---	---	PASS
DDX56	54606	broad.mit.edu	37	7	44612228	44612228	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44612228C>T	uc003tlg.2	-	4	1142	c.499G>A	c.(499-501)GAA>AAA	p.E167K	DDX56_uc003tle.2_RNA|DDX56_uc003tlf.2_Missense_Mutation_p.E103K|DDX56_uc003tlh.2_RNA|DDX56_uc010kyg.2_Missense_Mutation_p.E167K|DDX56_uc010kyh.1_RNA	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 56	167	DEAD box.|Helicase ATP-binding.				rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding			upper_aerodigestive_tract(1)	1						AGGTCAGCTTCGTCCACCACC	0.498													61	196	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44739744	44739744	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44739744T>G	uc003tln.2	+	19	2544	c.2435T>G	c.(2434-2436)CTT>CGT	p.L812R	OGDH_uc011kbx.1_Missense_Mutation_p.L808R|OGDH_uc011kby.1_Missense_Mutation_p.L662R|OGDH_uc003tlp.2_Missense_Mutation_p.L823R|OGDH_uc011kbz.1_Missense_Mutation_p.L607R	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	812					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	CTGCAGGACCTTAAAGAAGCC	0.488													53	192	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44874124	44874124	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44874124C>T	uc003tma.2	-	5	518	c.363G>A	c.(361-363)AAG>AAA	p.K121K	H2AFV_uc003tlz.2_Intron|H2AFV_uc011kca.1_5'Flank|H2AFV_uc003tmb.2_Silent_p.K83K|H2AFV_uc003tmc.2_3'UTR|H2AFV_uc003tmd.2_Silent_p.K95K	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1	121					nucleosome assembly	nucleosome|nucleus	DNA binding				0						GCTGTCCCTTCTTTCCAATCA	0.373													18	67	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48056919	48056919	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48056919C>G	uc003tof.2	-	4	325	c.228G>C	c.(226-228)CAG>CAC	p.Q76H	SUN3_uc003tog.2_Missense_Mutation_p.Q76H|SUN3_uc011kcf.1_Missense_Mutation_p.Q64H	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1	76						integral to membrane				central_nervous_system(1)	1						GTCTGGATTTCTGAGGAACAT	0.289													7	67	---	---	---	---	PASS
PHKG1	5260	broad.mit.edu	37	7	56149926	56149926	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56149926A>T	uc003trz.1	-	7	763	c.568T>A	c.(568-570)TAC>AAC	p.Y190N	PSPH_uc003trj.2_Intron|PHKG1_uc003try.1_Missense_Mutation_p.Y84N|PHKG1_uc011kdb.1_Missense_Mutation_p.Y222N|PHKG1_uc011kdc.1_Missense_Mutation_p.Y181N|PHKG1_uc011kdd.1_Missense_Mutation_p.Y136N	NM_006213	NP_006204	Q16816	PHKG1_HUMAN	phosphorylase kinase gamma subunit 1	190	Protein kinase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			large_intestine(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GGGGCCAGGTAACTGGGGGTC	0.527													11	58	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82585285	82585285	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82585285C>T	uc003uhx.2	-	5	5273	c.4984G>A	c.(4984-4986)GGA>AGA	p.G1662R	PCLO_uc003uhv.2_Missense_Mutation_p.G1662R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1593					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CGTAGCCCTCCTCCTCCAGTA	0.368													15	181	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91715617	91715617	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91715617T>C	uc003ulg.2	+	37	9325	c.9100T>C	c.(9100-9102)TTC>CTC	p.F3034L	AKAP9_uc003ulf.2_Missense_Mutation_p.F3026L|AKAP9_uc003uli.2_Missense_Mutation_p.F2657L|AKAP9_uc003ulj.2_Missense_Mutation_p.F804L|AKAP9_uc003ulk.2_Missense_Mutation_p.F309L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3038					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCAACAAGTTTTCTTAGAAGA	0.423			T	BRAF	papillary thyroid								108	440	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	92000830	92000830	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92000830G>T	uc003ulw.2	+	11	1902	c.1526G>T	c.(1525-1527)TGT>TTT	p.C509F	ANKIB1_uc010lew.1_5'UTR	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	509							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GCCGCCAATTGTCTCTGGTTA	0.408													6	30	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101870950	101870950	+	Splice_Site	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101870950G>T	uc003uyx.3	+	21	3471	c.3433_splice	c.e21+1	p.G1145_splice	CUX1_uc003uys.3_Splice_Site_p.G1156_splice|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AACAACCTCGGTAGGTTCTCC	0.597													14	88	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116423347	116423347	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116423347C>T	uc003vij.2	+						MET_uc010lkh.2_Intron|MET_uc011knj.1_Intron	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TAATTTTTGTCCTTTCTGTAG	0.338			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				26	148	---	---	---	---	PASS
ING3	54556	broad.mit.edu	37	7	120606683	120606683	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120606683C>A	uc003vjn.2	+	6	502	c.368C>A	c.(367-369)TCT>TAT	p.S123Y	ING3_uc003vjo.2_5'UTR|ING3_uc003vjp.2_Missense_Mutation_p.S123Y|ING3_uc011kns.1_Missense_Mutation_p.S108Y	NM_019071	NP_061944	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3 isoform 1	123					histone H2A acetylation|histone H4 acetylation|positive regulation of apoptosis|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Piccolo NuA4 histone acetyltransferase complex	zinc ion binding			ovary(1)	1	all_neural(327;0.117)					CTTTTAGGATCTTTGGAATTA	0.428													39	285	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122033251	122033251	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122033251T>A	uc010lkp.2	-	21	3170	c.3007A>T	c.(3007-3009)ACC>TCC	p.T1003S	CADPS2_uc011knx.1_Missense_Mutation_p.T378S|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	1003	Interaction with DRD2.|MHD1.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						AATACACACGTGGACTCATAT	0.458													11	59	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129095105	129095105	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129095105G>A	uc011koy.1	+	8	767	c.727G>A	c.(727-729)GAG>AAG	p.E243K	FAM40B_uc003vow.2_Missense_Mutation_p.E243K|FAM40B_uc011koz.1_5'Flank	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	243											0						GCATAATGAGGAGCCTTTTGC	0.502													84	467	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129120722	129120722	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129120722C>T	uc011koy.1	+	19	2081	c.2041C>T	c.(2041-2043)CGG>TGG	p.R681W	FAM40B_uc003vow.2_Missense_Mutation_p.R681W|FAM40B_uc011koz.1_Missense_Mutation_p.R173W	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	681											0						GAAACATTCCCGGACCATGGT	0.428													119	162	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130150030	130150030	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130150030C>T	uc003vqh.1	-							NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					GGTCTGAATTCAGAGAGCAGA	0.428													82	62	---	---	---	---	PASS
CLEC5A	23601	broad.mit.edu	37	7	141635757	141635757	+	Intron	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141635757A>G	uc003vwv.1	-						CLEC5A_uc011krm.1_Intron|CLEC5A_uc003vww.1_Intron|CLEC5A_uc010lnq.1_Intron|CLEC5A_uc010lnr.1_Intron	NM_013252	NP_037384	Q9NY25	CLC5A_HUMAN	C-type lectin, superfamily member 5						anti-apoptosis|cellular defense response|innate immune response|interspecies interaction between organisms|osteoblast development	cell surface|integral to plasma membrane	sugar binding|viral receptor activity				0	Melanoma(164;0.0171)					CAGACTGAAGAGGTCCAAGAA	0.373													12	104	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143632546	143632546	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632546C>T	uc011ktv.1	+	1	221	c.221C>T	c.(220-222)GCC>GTC	p.A74V		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					GTCTCCTATGCCACAAGCGTA	0.512													94	656	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143632547	143632547	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632547C>A	uc011ktv.1	+	1	222	c.222C>A	c.(220-222)GCC>GCA	p.A74A		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					TCTCCTATGCCACAAGCGTAG	0.512													94	662	---	---	---	---	PASS
NOBOX	135935	broad.mit.edu	37	7	144098543	144098543	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144098543G>C	uc011kue.1	-	4	440	c.440C>G	c.(439-441)TCT>TGT	p.S147C		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	147					cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					GGCTTCTCCAGAGACTGCTGG	0.647													33	29	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149492724	149492724	+	Missense_Mutation	SNP	C	G	G	rs113524670		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149492724C>G	uc010lpk.2	+	44	6504	c.6504C>G	c.(6502-6504)GAC>GAG	p.D2168E		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2168	F5/8 type C.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACTATCGTGACCTCCTGCCTG	0.587													97	378	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	152142868	152142868	+	IGR	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152142868G>T								FABP5L3 (2770 upstream) : LOC100128822 (18341 downstream)																							GAATAGTGGGGATGGCACAGC	0.652													60	67	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	153584801	153584801	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153584801G>C	uc003wli.2	+	1	383	c.33G>C	c.(31-33)AAG>AAC	p.K11N		NM_001039350	NP_001034439	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 3	Error:Variant_position_missing_in_P42658_after_alignment					cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGACCGCTAAGATGCAGGGGA	0.587													7	44	---	---	---	---	PASS
SGCZ	137868	broad.mit.edu	37	8	13948076	13948076	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13948076C>A	uc003wwq.2	-	8	1475	c.815G>T	c.(814-816)AGC>ATC	p.S272I	SGCZ_uc010lss.2_Missense_Mutation_p.S225I	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta	259	Poly-Ser.|Extracellular (Potential).				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ACTTGAGGAGCTGGGTGAAGA	0.428													41	182	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17611496	17611496	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17611496G>C	uc003wxv.2	-	2	2295	c.1821C>G	c.(1819-1821)GCC>GCG	p.A607A	MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Silent_p.A607A|MTUS1_uc010lsz.2_Silent_p.A607A	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	607						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		TCGATTTCACGGCAGATGTTG	0.433													88	458	---	---	---	---	PASS
FGL1	2267	broad.mit.edu	37	8	17722242	17722242	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17722242C>T	uc003wxx.2	-	9	1122	c.798G>A	c.(796-798)CTG>CTA	p.L266L	FGL1_uc003wxy.2_Silent_p.L266L|FGL1_uc003wxz.2_Silent_p.L265L|FGL1_uc003wya.2_Silent_p.L266L|FGL1_uc003wyb.2_Silent_p.L266L|FGL1_uc003wyc.2_Silent_p.L266L|FGL1_uc003wyd.2_RNA|FGL1_uc003wye.2_Silent_p.L316L|FGL1_uc003wyf.2_Silent_p.L236L	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor	266	Fibrinogen C-terminal.				signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		ATACACCATTCAGGTTTGCAG	0.413													10	39	---	---	---	---	PASS
CSGALNACT1	55790	broad.mit.edu	37	8	19362722	19362722	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19362722A>T	uc011kyn.1	-	4	1688	c.624T>A	c.(622-624)GAT>GAA	p.D208E	CSGALNACT1_uc011kyo.1_Missense_Mutation_p.D208E|CSGALNACT1_uc003wzg.2_RNA|CSGALNACT1_uc011kyp.1_Missense_Mutation_p.D207E|CSGALNACT1_uc003wzh.2_RNA	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate	208	Lumenal (Potential).				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		CTTCTATGAAATCAGAGGCCG	0.532													52	120	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30706460	30706460	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30706460C>A	uc003xil.2	-	1	74	c.74G>T	c.(73-75)AGT>ATT	p.S25I	TEX15_uc011lbc.1_Missense_Mutation_p.S412I	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	25										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATTAAGACCACTTAAAATATT	0.378													107	125	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33318925	33318925	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33318925C>A	uc003xje.2	-	2	402	c.46G>T	c.(46-48)GTC>TTC	p.V16F	FUT10_uc003xjd.2_Intron|FUT10_uc011lbi.1_Intron|FUT10_uc003xjf.2_5'UTR|FUT10_uc003xjg.2_5'UTR|FUT10_uc003xjh.2_Missense_Mutation_p.V16F|FUT10_uc003xji.1_Missense_Mutation_p.V16F	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	16	Helical; Signal-anchor for type II membrane protein; (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		GTGGCTGTGACGCACAGGCAA	0.552													45	59	---	---	---	---	PASS
ASH2L	9070	broad.mit.edu	37	8	37972489	37972489	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37972489G>T	uc003xkt.3	+	7	806	c.748G>T	c.(748-750)GAT>TAT	p.D250Y	ASH2L_uc011lbk.1_Missense_Mutation_p.D111Y|ASH2L_uc003xku.3_Missense_Mutation_p.D156Y|ASH2L_uc010lwa.2_Missense_Mutation_p.D156Y	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	250					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				TCCAGAAGAAGATTACCCCAA	0.338													13	74	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55538974	55538974	+	Silent	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55538974T>A	uc003xsd.1	+	4	2680	c.2532T>A	c.(2530-2532)TCT>TCA	p.S844S	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	844					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGTGGCATCTGGGTATTTGA	0.333													45	65	---	---	---	---	PASS
PDE7A	5150	broad.mit.edu	37	8	66701134	66701134	+	Intron	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66701134T>A	uc003xvq.2	-						PDE7A_uc003xvr.2_Intron|PDE7A_uc003xvp.2_Nonsense_Mutation_p.K15*	NM_002604	NP_002595	Q13946	PDE7A_HUMAN	phosphodiesterase 7A isoform b							cell fraction|cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding				0			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Dyphylline(DB00651)|Ketotifen(DB00920)	GTGATCCACTTGATAAGAACC	0.388													33	154	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68169977	68169977	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68169977T>C	uc003xxo.1	-	17	2906	c.2516A>G	c.(2515-2517)CAC>CGC	p.H839R	ARFGEF1_uc003xxl.1_Missense_Mutation_p.H293R	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	839	SEC7.				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTGTGGACTGTGAAGGTCTGT	0.313													44	195	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92401612	92401612	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92401612G>T	uc003yex.2	+	17	2000	c.1722G>T	c.(1720-1722)CTG>CTT	p.L574L	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Silent_p.L574L|SLC26A7_uc003yfa.2_Silent_p.L574L	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	574	STAS.|Cytoplasmic (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			ATTTAATCCTGGATTGCAGTG	0.398													107	260	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92401613	92401613	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92401613G>T	uc003yex.2	+	17	2001	c.1723G>T	c.(1723-1725)GAT>TAT	p.D575Y	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.D575Y|SLC26A7_uc003yfa.2_Missense_Mutation_p.D575Y	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	575	STAS.|Cytoplasmic (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTTAATCCTGGATTGCAGTGG	0.398													108	257	---	---	---	---	PASS
STK3	6788	broad.mit.edu	37	8	99539019	99539019	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99539019T>C	uc003yip.2	-	10	1409	c.1268A>G	c.(1267-1269)AAC>AGC	p.N423S	STK3_uc003yio.2_Missense_Mutation_p.N451S	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3	423					apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		AGGAAAAACGTTTTTGGACAT	0.338													79	92	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106801085	106801085	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106801085G>T	uc003ymd.2	+	6	695	c.672G>T	c.(670-672)CTG>CTT	p.L224L	ZFPM2_uc011lhs.1_5'UTR	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	224					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CACGCCTGCTGGACTCAATTC	0.498													17	119	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106813738	106813738	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813738C>T	uc003ymd.2	+	8	1451	c.1428C>T	c.(1426-1428)AGC>AGT	p.S476S	ZFPM2_uc011lhs.1_Silent_p.S207S	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	476					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGCCCTCTAGCCCAAGACTTG	0.443													53	241	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110424514	110424514	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110424514G>C	uc003yne.2	+	20	2210	c.2106G>C	c.(2104-2106)CAG>CAC	p.Q702H		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	702	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACAGAGGGCAGAAGACAGCTG	0.408										HNSCC(38;0.096)			22	104	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113326155	113326155	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113326155C>G	uc003ynu.2	-	49	7835	c.7676G>C	c.(7675-7677)GGC>GCC	p.G2559A	CSMD3_uc003yns.2_Missense_Mutation_p.G1761A|CSMD3_uc003ynt.2_Missense_Mutation_p.G2519A|CSMD3_uc011lhx.1_Missense_Mutation_p.G2455A|CSMD3_uc003ynw.1_Missense_Mutation_p.G270A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2559	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TATCCGGAAGCCTTTTTTGTT	0.308										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			62	123	---	---	---	---	PASS
DEPDC6	64798	broad.mit.edu	37	8	120977528	120977528	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120977528A>T	uc003yow.3	+	4	669	c.482A>T	c.(481-483)TAT>TTT	p.Y161F	DEPDC6_uc011lid.1_Missense_Mutation_p.Y60F	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6	161	DEP 2.				intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GGGGTCAAGTATGAGCGCACC	0.522													75	99	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964616	123964616	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964616A>T	uc003ypk.1	+	3	1433	c.866A>T	c.(865-867)CAG>CTG	p.Q289L		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	289	Required for interaction with NFYA.|Required for homodimerization.|Required for repressor activity.|Homeobox 1.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TACCCGACCCAGGCTGAGTTG	0.517													109	132	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139825240	139825240	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139825240A>G	uc003yvd.2	-	8	1715	c.1268T>C	c.(1267-1269)ATC>ACC	p.I423T		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	423	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTCACAATAGATCACAATCCG	0.512										HNSCC(7;0.00092)			77	110	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144874791	144874791	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874791G>A	uc003yzp.1	-	31	4199	c.4192C>T	c.(4192-4194)CAG>TAG	p.Q1398*	SCRIB_uc003yzn.1_Nonsense_Mutation_p.Q131*|SCRIB_uc003yzo.1_Nonsense_Mutation_p.Q1398*	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1398	Potential.				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCTCTCTTCTGCTGTAGTTTT	0.682													8	9	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145692682	145692682	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145692682G>T	uc003zcz.2	+	4	492	c.427G>T	c.(427-429)GGG>TGG	p.G143W	CYHR1_uc003zcv.2_5'Flank|CYHR1_uc003zcw.2_5'Flank|CYHR1_uc003zcx.2_5'Flank|CYHR1_uc003zcy.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	143					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCTGCTCCAGGGGACTCAGCC	0.617											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	61	111	---	---	---	---	PASS
B4GALT1	2683	broad.mit.edu	37	9	33135352	33135352	+	Silent	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33135352C>G	uc003zsg.2	-	2	672	c.483G>C	c.(481-483)GTG>GTC	p.V161V		NM_001497	NP_001488	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	161	Lumenal (Potential).				oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	basolateral plasma membrane|brush border membrane|desmosome|external side of plasma membrane|extracellular region|glycocalyx|Golgi cisterna membrane|Golgi trans cisterna|integral to membrane	alpha-tubulin binding|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|beta-tubulin binding|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity|protein binding|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	CGCCCATCTTCACATTTGGGT	0.577													19	101	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34493233	34493233	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34493233G>C	uc003zum.2	+	9	916	c.723G>C	c.(721-723)CAG>CAC	p.Q241H		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	241					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		TTGAGAAGCAGGAAAAGACCA	0.463									Kartagener_syndrome				36	170	---	---	---	---	PASS
CNTFR	1271	broad.mit.edu	37	9	34556282	34556282	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34556282G>C	uc003zup.1	-	7	1020	c.739C>G	c.(739-741)CGA>GGA	p.R247G	CNTFR_uc003zuq.1_Missense_Mutation_p.R247G	NM_147164	NP_671693	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	247	Fibronectin type-III 2.				nervous system development	anchored to membrane|extrinsic to membrane|plasma membrane	ciliary neurotrophic factor receptor activity|receptor binding			ovary(3)|central_nervous_system(1)|skin(1)	5	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		ATGAGGGGTCGGTAGCGCAGA	0.612													8	49	---	---	---	---	PASS
RUSC2	9853	broad.mit.edu	37	9	35555352	35555352	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35555352G>C	uc003zww.2	+	3	2565	c.2310G>C	c.(2308-2310)GAG>GAC	p.E770D	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.E770D	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	770						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CTGAGCCAGAGACCTCTCGGC	0.652													9	274	---	---	---	---	PASS
SIT1	27240	broad.mit.edu	37	9	35650382	35650382	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35650382C>T	uc003zxe.1	-	3	364	c.267G>A	c.(265-267)CTG>CTA	p.L89L	SIT1_uc003zxf.1_RNA	NM_014450	NP_055265	Q9Y3P8	SIT1_HUMAN	SHP2-interacting transmembrane adaptor protein	89	Cytoplasmic (Potential).				regulation of T cell activation|signal transduction	integral to plasma membrane	kinase binding|SH2 domain binding				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTTCCCATACAGCGGGACCT	0.587													23	137	---	---	---	---	PASS
CNTNAP3	79937	broad.mit.edu	37	9	39177329	39177329	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39177329C>A	uc004abi.2	-	6	1152	c.913G>T	c.(913-915)GAT>TAT	p.D305Y	CNTNAP3_uc004abj.2_Missense_Mutation_p.D305Y|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Missense_Mutation_p.D305Y|CNTNAP3_uc011lqs.1_Missense_Mutation_p.D305Y|CNTNAP3_uc004abl.1_Missense_Mutation_p.D217Y	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	305	Extracellular (Potential).|Laminin G-like 1.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AAATTAAGATCCAAGTAACTG	0.368													64	73	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84608637	84608637	+	Silent	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84608637T>C	uc004amn.2	+	4	3299	c.3252T>C	c.(3250-3252)GAT>GAC	p.D1084D		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1084						integral to membrane					0						CAACAGAGGATGGCAGACAGA	0.498													16	93	---	---	---	---	PASS
ZCCHC6	79670	broad.mit.edu	37	9	88967621	88967621	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88967621G>A	uc004aoq.2	-	2	709	c.494C>T	c.(493-495)ACG>ATG	p.T165M	ZCCHC6_uc011ltf.1_RNA|ZCCHC6_uc004aor.2_RNA|ZCCHC6_uc004aos.2_RNA|ZCCHC6_uc004aot.2_Missense_Mutation_p.T165M|ZCCHC6_uc004aou.2_Missense_Mutation_p.T165M|ZCCHC6_uc004aov.2_Missense_Mutation_p.T165M|ZCCHC6_uc004aow.2_Missense_Mutation_p.T165M|ZCCHC6_uc010mqf.1_Missense_Mutation_p.T165M	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	165					RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						CATTTCTGACGTGGTTTCTAG	0.403													49	252	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117797579	117797579	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117797579C>G	uc004bjj.3	-	22	6053	c.5691G>C	c.(5689-5691)GAG>GAC	p.E1897D	TNC_uc010mvf.2_Missense_Mutation_p.E1624D	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1897	Fibronectin type-III 15.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	p.E1897K(1)		central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						CCGACTGAACCTCAGTAGCAG	0.433													40	170	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117848712	117848712	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117848712T>C	uc004bjj.3	-	3	1660	c.1298A>G	c.(1297-1299)GAC>GGC	p.D433G	TNC_uc010mvf.2_Missense_Mutation_p.D433G	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	433	EGF-like 9.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						CTGGCTGCAGTCCTCCCCAGT	0.587													11	187	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123253762	123253762	+	Intron	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123253762G>T	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						GATCCTACCAGAAGAAAATGA	0.313													10	69	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123253763	123253763	+	Intron	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123253763A>T	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						ATCCTACCAGAAGAAAATGAA	0.313													10	68	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131765730	131765730	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131765730C>A	uc004bws.1	+	38	4453	c.4431C>A	c.(4429-4431)ATC>ATA	p.I1477I	NUP188_uc004bwu.2_Silent_p.I820I	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1477					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						TGCGTGATATCCAGGTGGGGG	0.567													119	75	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134351441	134351441	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134351441A>C	uc004can.3	+	15	3980	c.3925A>C	c.(3925-3927)AAG>CAG	p.K1309Q	BAT2L1_uc010mzj.1_Missense_Mutation_p.K892Q|BAT2L1_uc004cao.3_Missense_Mutation_p.K667Q	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1309							protein binding				0						ACGCCAAGATAAGCCCCCTCG	0.642											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	110	---	---	---	---	PASS
GTF3C4	9329	broad.mit.edu	37	9	135553825	135553825	+	Silent	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135553825T>C	uc010mzv.2	+	2	1077	c.819T>C	c.(817-819)AGT>AGC	p.S273S	GTF3C4_uc010mzw.2_RNA	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC 4	273					transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		ACGTTGGCAGTGTGCTCCTGG	0.517													191	71	---	---	---	---	PASS
UBAC1	10422	broad.mit.edu	37	9	138831596	138831596	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138831596A>C	uc004cgt.2	-	8	1104	c.886T>G	c.(886-888)TCC>GCC	p.S296A	UBAC1_uc004cgs.1_Missense_Mutation_p.S296A|UBAC1_uc004cgu.2_RNA	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1	296	UBA 2.					Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		TCCATCAGGGAAATGACGGCC	0.597													12	178	---	---	---	---	PASS
SNAPC4	6621	broad.mit.edu	37	9	139270830	139270830	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139270830C>T	uc004chh.2	-	22	4397	c.4388G>A	c.(4387-4389)CGG>CAG	p.R1463Q	CARD9_uc004chg.3_5'Flank|CARD9_uc011mdw.1_5'Flank|CARD9_uc011mdx.1_5'Flank|CARD9_uc010nbj.2_5'Flank	NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	1463					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CCTCCGCTTCCGGGTGTGCCT	0.632													97	126	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33208813	33208813	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33208813C>T	uc001iws.3	-	11	1605	c.1469G>A	c.(1468-1470)AGG>AAG	p.R490K	ITGB1_uc001iwp.3_Missense_Mutation_p.R490K|ITGB1_uc001iwq.3_Missense_Mutation_p.R490K|ITGB1_uc001iwr.3_Missense_Mutation_p.R490K|ITGB1_uc001iwt.3_Missense_Mutation_p.R490K|ITGB1_uc001iwu.1_Missense_Mutation_p.R490K	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	490	Extracellular (Potential).|I.|Cysteine-rich tandem repeats.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				CCCAGCTTACCTGCACGCGCC	0.453													8	189	---	---	---	---	PASS
A1CF	29974	broad.mit.edu	37	10	52587900	52587900	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52587900T>A	uc001jjj.2	-	7	948	c.760A>T	c.(760-762)ATC>TTC	p.I254F	A1CF_uc010qhn.1_Missense_Mutation_p.I262F|A1CF_uc001jji.2_Missense_Mutation_p.I254F|A1CF_uc001jjh.2_Missense_Mutation_p.I262F|A1CF_uc010qho.1_Missense_Mutation_p.I262F|A1CF_uc009xov.2_Missense_Mutation_p.I254F	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	254	RRM 3.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						CCTGGTTTGATATTGTTGAAT	0.209													8	85	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63191022	63191022	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63191022C>G	uc001jlo.2	-	3	708	c.339G>C	c.(337-339)TTG>TTC	p.L113F	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlq.2_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	113						integral to membrane					0	Prostate(12;0.0112)					CATTGGATGTCAATGTTTGAT	0.408													19	101	---	---	---	---	PASS
ARID5B	84159	broad.mit.edu	37	10	63816878	63816878	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63816878G>A	uc001jlt.1	+	6	875	c.849G>A	c.(847-849)GTG>GTA	p.V283V	ARID5B_uc001jlu.1_Silent_p.V40V	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	283					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					TTTTCCAGGTGAAATGTGAGG	0.448													27	32	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69925552	69925552	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69925552G>T	uc001jnm.3	+	10	1762	c.1577G>T	c.(1576-1578)AGC>ATC	p.S526I	MYPN_uc001jnl.1_Missense_Mutation_p.S526I|MYPN_uc001jnn.3_Missense_Mutation_p.S251I|MYPN_uc001jno.3_Missense_Mutation_p.S526I|MYPN_uc009xps.2_Missense_Mutation_p.S526I|MYPN_uc009xpt.2_Missense_Mutation_p.S526I|MYPN_uc010qit.1_Missense_Mutation_p.S232I|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	526	Ig-like 2.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						ACAGTGTCAAGCATTGCACAG	0.433													85	50	---	---	---	---	PASS
CHST3	9469	broad.mit.edu	37	10	73765698	73765698	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73765698T>C	uc001jsn.2	+	2	538	c.98T>C	c.(97-99)ATA>ACA	p.I33T		NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3	33	Helical; Signal-anchor for type II membrane protein; (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						TTTGTGGTGATAGTTTTTGTC	0.473													76	76	---	---	---	---	PASS
CHST3	9469	broad.mit.edu	37	10	73765715	73765715	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73765715G>T	uc001jsn.2	+	2	555	c.115G>T	c.(115-117)GAA>TAA	p.E39*		NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3	39	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						TGTCTTCATCGAAAAGGAAAA	0.483													75	71	---	---	---	---	PASS
ENTPD1	953	broad.mit.edu	37	10	97471761	97471761	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97471761C>G	uc001kli.3	+						ENTPD1_uc001kle.1_Intron	NM_001098175	NP_001091645	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		gtaagaaattcttaccagtca	0.000													24	43	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104140418	104140418	+	Silent	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104140418A>G	uc001kux.1	+	38	5385	c.5145A>G	c.(5143-5145)GAA>GAG	p.E1715E	GBF1_uc001kuy.1_Silent_p.E1711E|GBF1_uc001kuz.1_Silent_p.E1712E	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1715					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TACGAGATGAACTCTTCAAGC	0.468													156	425	---	---	---	---	PASS
CCDC147	159686	broad.mit.edu	37	10	106163575	106163575	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106163575G>C	uc001kyh.2	+	14	2262	c.2128G>C	c.(2128-2130)GTG>CTG	p.V710L		NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147	710	Potential.									ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TCCCCTGAATGTGCACAGATG	0.512													11	26	---	---	---	---	PASS
CASP7	840	broad.mit.edu	37	10	115486075	115486075	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115486075G>C	uc001lan.2	+	6	738	c.564G>C	c.(562-564)GGG>GGC	p.G188G	CASP7_uc001lam.2_Missense_Mutation_p.G177A|CASP7_uc001lao.2_Silent_p.G221G|CASP7_uc001lap.2_Silent_p.G188G|CASP7_uc001laq.2_Silent_p.G188G|CASP7_uc010qsa.1_Silent_p.G273G|CASP7_uc010qsb.1_Silent_p.G163G	NM_033339	NP_203125	P55210	CASP7_HUMAN	caspase 7 isoform alpha	188					activation of caspase activity by cytochrome c|cellular component disassembly involved in apoptosis|induction of apoptosis by intracellular signals|proteolysis	cytosol|endoplasmic reticulum membrane|mitochondrial membrane|nucleoplasm	cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		CTTGCCGAGGGACCGAGCTTG	0.368													27	109	---	---	---	---	PASS
BTBD16	118663	broad.mit.edu	37	10	124096123	124096123	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124096123G>C	uc001lgc.1	+	15	1629	c.1378G>C	c.(1378-1380)GGC>CGC	p.G460R	BTBD16_uc001lgd.1_Missense_Mutation_p.G459R	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	460										skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				CCTGGTTGACGGCAAGTGGCA	0.542													9	43	---	---	---	---	PASS
HRAS	3265	broad.mit.edu	37	11	534285	534285	+	Missense_Mutation	SNP	C	A	A	rs104894226		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:534285C>A	uc001lpv.2	-	2	226	c.38G>T	c.(37-39)GGT>GTT	p.G13V	HRAS_uc010qvw.1_Missense_Mutation_p.G13V|HRAS_uc010qvx.1_Missense_Mutation_p.G13V|HRAS_uc010qvy.1_RNA	NM_005343	NP_005334	P01112	RASH_HUMAN	v-Ha-ras Harvey rat sarcoma viral oncogene	13	GTP.		G -> D (in FCSS).|G -> C (in FCSS).		activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding	p.G13R(33)|p.G13V(10)|p.G13D(9)|p.G13S(9)|p.G13C(6)|p.G13G(1)|p.G12_G13insAG(1)		urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)	CTTGCCCACACCGCCGGCGCC	0.642		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			15	37	---	---	---	---	PASS
KRTAP5-6	440023	broad.mit.edu	37	11	1718688	1718688	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1718688C>A	uc001lua.2	+	1	264	c.213C>A	c.(211-213)GGC>GGA	p.G71G		NM_001012416	NP_001012416	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	71	6 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGGGCTGTGGCTCTTGTGGGG	0.632													51	92	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068595	5068595	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068595C>A	uc010qyv.1	+	1	840	c.840C>A	c.(838-840)CTC>CTA	p.L280L		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGCCAATCTCTATTTGATTA	0.393													52	166	---	---	---	---	PASS
OR52A5	390054	broad.mit.edu	37	11	5153381	5153381	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153381G>T	uc010qyx.1	-	1	492	c.492C>A	c.(490-492)CTC>CTA	p.L164L		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	164	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGCATTTGATGAGCCCTAAGG	0.463													34	103	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5686040	5686040	+	Nonstop_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5686040C>G	uc001mbm.1	-	8	1738	c.1481G>C	c.(1480-1482)TGA>TCA	p.*494S	TRIM78P_uc009yer.2_Intron|TRIM5_uc001mbl.1_RNA|TRIM5_uc001mbn.2_Intron|TRIM5_uc001mbo.2_Intron	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha	494					interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		TAAGAAGGTTCAAGAGCTTGG	0.413													23	74	---	---	---	---	PASS
TRIM3	10612	broad.mit.edu	37	11	6479499	6479499	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6479499C>G	uc001mdh.2	-	4	546	c.159G>C	c.(157-159)CAG>CAC	p.Q53H	TRIM3_uc001mdi.2_Missense_Mutation_p.Q53H|TRIM3_uc010raj.1_5'UTR|TRIM3_uc009yfd.2_Missense_Mutation_p.Q53H|TRIM3_uc010rak.1_Missense_Mutation_p.Q53H|TRIM3_uc001mdj.2_5'UTR	NM_006458	NP_006449	O75382	TRIM3_HUMAN	tripartite motif-containing 3	53	RING-type.				nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding			central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGTCAGGCTCTGGGCAGGGA	0.547													30	71	---	---	---	---	PASS
TPP1	1200	broad.mit.edu	37	11	6640070	6640070	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6640070G>T	uc001mel.1	-	3	227	c.166C>A	c.(166-168)CAG>AAG	p.Q56K	TPP1_uc001mek.1_5'UTR|TPP1_uc010rar.1_Missense_Mutation_p.Q56K	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein	56					bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		TCCACATTCTGCTGTCTCAGG	0.617													39	90	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30928170	30928170	+	RNA	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30928170C>T	uc001mss.1	-	8		c.1124G>A			uc009yjk.1_Missense_Mutation_p.G789R|uc009yjj.1_RNA					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		AATGGAACCCCTGGAAGCAAT	0.453													15	42	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45246120	45246120	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45246120G>A	uc001myo.2	+	8	1446	c.1197G>A	c.(1195-1197)TGG>TGA	p.W399*		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	399										upper_aerodigestive_tract(1)	1						AGGGGGACTGGAAGGTCCCCC	0.577													71	123	---	---	---	---	PASS
OR4A5	81318	broad.mit.edu	37	11	51411845	51411845	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411845A>C	uc001nhi.1	-	1	551	c.551T>G	c.(550-552)CTG>CGG	p.L184R		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				AGTGCATGCCAGTTCCAGTAA	0.418													24	43	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595463	55595463	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595463T>C	uc001nhy.1	+	1	769	c.769T>C	c.(769-771)TAC>CAC	p.Y257H		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	257	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				AACAATCCTTTACATTTATTG	0.502										HNSCC(27;0.073)			36	123	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595507	55595507	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595507C>A	uc001nhy.1	+	1	813	c.813C>A	c.(811-813)GAC>GAA	p.D271E		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				GAGATGTTGACAAAGTGGCCA	0.488										HNSCC(27;0.073)			23	87	---	---	---	---	PASS
OR5T1	390155	broad.mit.edu	37	11	56043883	56043883	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043883C>A	uc001nio.1	+	1	769	c.769C>A	c.(769-771)CTA>ATA	p.L257I		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	257	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)					TGGAGCTCACCTAACTGGAGT	0.423													68	310	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60271261	60271261	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60271261G>C	uc001npr.2	+	5	616	c.559G>C	c.(559-561)GGG>CGG	p.G187R		NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	187	Extracellular (Potential).					integral to membrane	receptor activity				0						GTGCATCAATGGGGTAGCTGG	0.473													25	72	---	---	---	---	PASS
ALDH3B1	221	broad.mit.edu	37	11	67786655	67786655	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67786655G>A	uc010rpy.1	+	6	527	c.411G>A	c.(409-411)CTG>CTA	p.L137L	ALDH3B1_uc001omz.2_Silent_p.L137L|ALDH3B1_uc001ona.2_Silent_p.L100L|ALDH3B1_uc001onb.2_RNA	NM_001161473	NP_001154945	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3B1 isoform a	137					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase				0					NADH(DB00157)	GTGTGGTGCTGAAGCCATCGG	0.527													8	12	---	---	---	---	PASS
RELT	84957	broad.mit.edu	37	11	73105576	73105576	+	Silent	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73105576C>G	uc001otv.2	+	9	1008	c.843C>G	c.(841-843)CTC>CTG	p.L281L	RELT_uc001otw.2_Silent_p.L281L|RELT_uc001otx.2_RNA	NM_152222	NP_689408	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor precursor	281	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane	binding|receptor activity			upper_aerodigestive_tract(1)	1						GCCACCATCTCCACACCGTGC	0.701													78	51	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76076958	76076958	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76076958G>A	uc001oxh.1	-	2	148	c.148C>T	c.(148-150)CAG>TAG	p.Q50*		NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	50	THAP-type.				negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						TTATTTAGCTGATCAGGTGTT	0.368													30	107	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	100126572	100126572	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100126572G>A	uc001pga.2	+	17	2425	c.2086G>A	c.(2086-2088)GAC>AAC	p.D696N	CNTN5_uc001pfz.2_Missense_Mutation_p.D696N|CNTN5_uc001pgb.2_Missense_Mutation_p.D622N|CNTN5_uc010ruk.1_5'UTR	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	696	Fibronectin type-III 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CCCAGCAGCTGACAACCACAG	0.522													59	51	---	---	---	---	PASS
ANGPTL5	253935	broad.mit.edu	37	11	101771167	101771167	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101771167G>T	uc001pgl.2	-	7	1251	c.655C>A	c.(655-657)CTT>ATT	p.L219I		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5 precursor	219	Fibrinogen C-terminal.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TAACCTAGAAGATCTCCAAAT	0.348													29	30	---	---	---	---	PASS
BCL9L	283149	broad.mit.edu	37	11	118769687	118769687	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118769687C>A	uc001pug.2	-	8	4902	c.3937G>T	c.(3937-3939)GTG>TTG	p.V1313L	BCL9L_uc009zal.2_Missense_Mutation_p.V1308L	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1313	Pro-rich.				negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GGCCGGATCACCTCGCTCAGC	0.642													25	59	---	---	---	---	PASS
ABCG4	64137	broad.mit.edu	37	11	119020852	119020852	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119020852G>A	uc001pvs.2	+	2	513	c.177G>A	c.(175-177)GTG>GTA	p.V59V	ABCG4_uc009zar.2_Silent_p.V59V	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	59	Cytoplasmic (Potential).				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GCTCAGCCGTGGACATCGAGT	0.642													4	158	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	863246	863246	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:863246T>A	uc001qio.3	+	1	1022	c.515T>A	c.(514-516)GTG>GAG	p.V172E	WNK1_uc001qin.2_Missense_Mutation_p.V172E|WNK1_uc001qip.3_Missense_Mutation_p.V172E	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	172					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCTAGCCTTGTGGGGAGCAAA	0.697													24	21	---	---	---	---	PASS
KCNA1	3736	broad.mit.edu	37	12	5020854	5020854	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5020854A>T	uc001qnh.2	+	2	1415	c.310A>T	c.(310-312)AGG>TGG	p.R104W		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	104					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCGCCTGCGGAGGCCGGTCAA	0.617													16	64	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7585977	7585977	+	Missense_Mutation	SNP	G	T	T	rs117072358	byFrequency	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7585977G>T	uc001qsy.2	-	3	464	c.438C>A	c.(436-438)AAC>AAA	p.N146K	CD163L1_uc010sge.1_Missense_Mutation_p.N146K	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	146	SRCR 1.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						TACCATAACAGTTCACACCAA	0.428													66	152	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9009755	9009755	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9009755C>T	uc001quz.3	+						A2ML1_uc001qva.1_Intron|A2ML1_uc010sgm.1_Intron	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor							extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						CCTTTTGGATCCCAGGAGACA	0.483													23	157	---	---	---	---	PASS
TAS2R42	353164	broad.mit.edu	37	12	11339133	11339133	+	Silent	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11339133A>G	uc001qzr.1	-	1	411	c.411T>C	c.(409-411)TCT>TCC	p.S137S	PRB4_uc001qzf.1_Intron	NM_181429	NP_852094	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	137	Helical; Name=3; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			GTAAGAACAAAGACAATATAA	0.328													11	48	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19496351	19496351	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19496351G>C	uc001reb.2	+	17	2422	c.2336G>C	c.(2335-2337)AGA>ACA	p.R779T	PLEKHA5_uc010sie.1_Missense_Mutation_p.R882T|PLEKHA5_uc001rea.2_Missense_Mutation_p.R837T|PLEKHA5_uc009zin.2_Missense_Mutation_p.R537T|PLEKHA5_uc010sif.1_Missense_Mutation_p.R710T|PLEKHA5_uc010sig.1_Missense_Mutation_p.R698T|PLEKHA5_uc010sih.1_Missense_Mutation_p.R671T|PLEKHA5_uc001rec.1_Missense_Mutation_p.R525T|PLEKHA5_uc009zio.2_Missense_Mutation_p.R101T	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	779							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AAGCAGCAAAGAGGTACTACA	0.318													11	60	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21196375	21196375	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21196375T>A	uc010sin.1	+	6	694	c.694T>A	c.(694-696)TTG>ATG	p.L232M	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.L279M	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	232						membrane	transporter activity				0						ATTCTTTTTCTTGCCTCTAAA	0.358													55	156	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21331541	21331541	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21331541G>C	uc001req.3	+	6	617	c.513G>C	c.(511-513)TGG>TGC	p.W171C		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	171	Helical; Name=4; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	CATACATGTGGATATATGTGT	0.338													20	213	---	---	---	---	PASS
GYS2	2998	broad.mit.edu	37	12	21733447	21733447	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21733447G>C	uc001rfb.2	-	2	387	c.132C>G	c.(130-132)ATC>ATG	p.I44M		NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2	44					glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						TCACAGTATAGATGCCTCCAA	0.333													5	324	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22070004	22070004	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22070004G>A	uc001rfi.1	-	4	460	c.440C>T	c.(439-441)ACA>ATA	p.T147I	ABCC9_uc001rfh.2_Missense_Mutation_p.T147I|ABCC9_uc001rfj.1_Missense_Mutation_p.T147I	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	147	Helical; Name=4; (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TATTGTTTTTGTAATAAAGGC	0.373													152	185	---	---	---	---	PASS
CACNB3	784	broad.mit.edu	37	12	49221640	49221640	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49221640G>A	uc001rsl.1	+	13	1614	c.1413G>A	c.(1411-1413)CGG>CGA	p.R471R	CACNB3_uc010sly.1_Silent_p.R458R|CACNB3_uc010slz.1_Silent_p.R470R|CACNB3_uc001rsk.1_Silent_p.R318R	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	471					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	ACAGTGACCGGAACTGGCAGC	0.657													20	77	---	---	---	---	PASS
TMPRSS12	283471	broad.mit.edu	37	12	51252702	51252702	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51252702C>T	uc001rwx.3	+	3	565	c.518C>T	c.(517-519)GCA>GTA	p.A173V	TMPRSS12_uc001rwy.2_Missense_Mutation_p.A173V	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor	173	Peptidase S1.|Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity				0						AATGATATTGCACTTTTTCAC	0.313													8	17	---	---	---	---	PASS
KRT82	3888	broad.mit.edu	37	12	52794402	52794402	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52794402A>G	uc001sai.1	-	4	801	c.686T>C	c.(685-687)GTG>GCG	p.V229A		NM_033033	NP_149022	Q9NSB4	KRT82_HUMAN	keratin 82	229	Coil 1B.|Rod.					keratin filament	protein binding|structural constituent of epidermis			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.193)		GGCTGTGTCCACGTCCTGCAG	0.602													47	56	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53448142	53448142	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53448142G>C	uc001sbp.2	+	7	574	c.439G>C	c.(439-441)GCG>CCG	p.A147P	uc001sbk.1_RNA|TENC1_uc001sbl.2_Missense_Mutation_p.A23P|TENC1_uc001sbm.2_Missense_Mutation_p.A157P|TENC1_uc001sbn.2_Missense_Mutation_p.A157P|TENC1_uc001sbo.1_Missense_Mutation_p.A147P	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	147	Phosphatase tensin-type.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CGCCTTCCCCGCGCGGCCCGA	0.692													31	47	---	---	---	---	PASS
GPR182	11318	broad.mit.edu	37	12	57390016	57390016	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57390016G>A	uc001smk.2	+	2	1117	c.1023G>A	c.(1021-1023)AAG>AAA	p.K341K	RDH16_uc010sqx.1_Intron	NM_007264	NP_009195	O15218	GP182_HUMAN	G protein-coupled receptor 182	341	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(1)	1						ACCTTCCTAAGGACCAGACCA	0.567													59	239	---	---	---	---	PASS
MARS	4141	broad.mit.edu	37	12	57910367	57910367	+	3'UTR	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57910367G>T	uc001sog.2	+	21					MARS_uc001sof.1_Intron|MARS_uc001soh.1_3'UTR	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase						methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	AAAAGTAAAAGACCTTGGCTC	0.413													11	39	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64521760	64521760	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64521760C>G	uc010ssp.1	+	21	2716	c.2660C>G	c.(2659-2661)CCA>CGA	p.P887R	SRGAP1_uc001srv.2_Missense_Mutation_p.P824R	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	887					axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTAGGGTCCCCAAGCCTTGCC	0.642													72	94	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94975638	94975638	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94975638C>A	uc001tdj.2	-	2	873	c.755G>T	c.(754-756)GGC>GTC	p.G252V	TMCC3_uc001tdi.2_Missense_Mutation_p.G221V	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	252						integral to membrane				ovary(1)|skin(1)	2						ATCATCACTGCCATACTTGGG	0.562													35	129	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100169348	100169348	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100169348C>A	uc001tge.1	-	7	1356	c.939G>T	c.(937-939)GAG>GAT	p.E313D	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Missense_Mutation_p.E279D	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	313						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GGGAAGGAGACTCAACAGGAG	0.398													19	73	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101295607	101295607	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101295607T>A	uc010svm.1	+	2	616	c.44T>A	c.(43-45)GTC>GAC	p.V15D	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Missense_Mutation_p.V15D|ANO4_uc001thx.2_Missense_Mutation_p.V15D	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	15	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						AAAACCAAAGTCTTCCACCCA	0.468										HNSCC(74;0.22)			31	123	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101693755	101693755	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101693755C>G	uc001tia.1	+	14	1747	c.1591C>G	c.(1591-1593)CTT>GTT	p.L531V		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	531					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						GGACAGACCTCTTGAGAAAGA	0.428													204	298	---	---	---	---	PASS
SPIC	121599	broad.mit.edu	37	12	101870684	101870684	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101870684T>A	uc001tid.2	+	2	161	c.2T>A	c.(1-3)ATG>AAG	p.M1K	SPIC_uc009zua.2_5'Flank|SPIC_uc010svp.1_5'Flank	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	1						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						TAATGAAATATGGTAAGCTGA	0.259													8	32	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105589136	105589136	+	Intron	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105589136C>A	uc001tlf.1	-						APPL2_uc010swt.1_Intron|APPL2_uc001tlg.1_Intron|APPL2_uc010swu.1_Intron|APPL2_uc009zuq.2_Intron	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH						cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						GCCTAAAAATCCACAGGAAGA	0.498													27	88	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109835579	109835579	+	Silent	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109835579A>C	uc010sxn.1	+	4	484	c.484A>C	c.(484-486)AGA>CGA	p.R162R		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						CAACTCCAGCAGATTTGGGAA	0.343													9	42	---	---	---	---	PASS
C12orf76	400073	broad.mit.edu	37	12	110480255	110480255	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110480255C>T	uc001tqd.1	-	5	674	c.309G>A	c.(307-309)GGG>GGA	p.G103G	C12orf76_uc001tqe.1_RNA|C12orf76_uc010sxx.1_RNA|C12orf76_uc001tqb.1_RNA|C12orf76_uc001tqc.1_Missense_Mutation_p.G48E	NM_207435	NP_997318	Q8N812	CL076_HUMAN	hypothetical protein LOC400073	103										large_intestine(1)	1						GAAAATGGTTCCCATCAACAC	0.383													22	69	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121670841	121670841	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121670841G>C	uc001tzr.2	+	11	1390	c.1086G>C	c.(1084-1086)AAG>AAC	p.K362N	P2RX4_uc009zxc.2_Missense_Mutation_p.K335N|P2RX4_uc001tzs.2_Missense_Mutation_p.K378N|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Missense_Mutation_p.K261N	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	362	Cytoplasmic (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACTGCATGAAGAAAAGACTCT	0.502													189	253	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130831075	130831075	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130831075G>A	uc001uik.2	+	5	567	c.477G>A	c.(475-477)AAG>AAA	p.K159K	PIWIL1_uc001uij.1_Silent_p.K159K	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	159					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TAATTGGAAAGTGTCATGCTT	0.393													83	51	---	---	---	---	PASS
MRP63	78988	broad.mit.edu	37	13	21751154	21751154	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21751154G>C	uc001unw.2	+	2	589	c.99G>C	c.(97-99)CAG>CAC	p.Q33H	SKA3_uc001unt.2_5'Flank|SKA3_uc001unv.2_5'Flank|SKA3_uc001unu.2_5'Flank	NM_024026	NP_076931	Q9BQC6	RT63_HUMAN	mitochondrial ribosomal protein 63	33											0		all_cancers(29;2.76e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.43e-05)|Epithelial(112;0.000285)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|Lung(94;0.0932)		GCGCCAAGCAGAACATGATCC	0.682													4	59	---	---	---	---	PASS
SHISA2	387914	broad.mit.edu	37	13	26621140	26621140	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26621140G>T	uc001uqm.1	-	2	484	c.399C>A	c.(397-399)TCC>TCA	p.S133S		NM_001007538	NP_001007539	Q6UWI4	SHSA2_HUMAN	shisa homolog 2 precursor	133	Cytoplasmic (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2						CTGCCACCAGGGACCCCAAGA	0.552													28	29	---	---	---	---	PASS
MRPS31	10240	broad.mit.edu	37	13	41341022	41341022	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41341022T>G	uc001uxm.3	-	2	375	c.300A>C	c.(298-300)TTA>TTC	p.L100F		NM_005830	NP_005821	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31 precursor	100						mitochondrion|ribosome	protein domain specific binding				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		TAATAATGCCTAACAAGTCTT	0.398													80	95	---	---	---	---	PASS
MLNR	2862	broad.mit.edu	37	13	49796434	49796434	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49796434C>T	uc010tgj.1	+	2	1160	c.1160C>T	c.(1159-1161)GCG>GTG	p.A387V		NM_001507	NP_001498	O43193	MTLR_HUMAN	motilin receptor	387	Cytoplasmic (Potential).				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity				0		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		AGGGACACTGCGGGGGAAGTT	0.577													44	37	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77724913	77724913	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77724913T>C	uc001vkf.2	-	48	7064	c.6973A>G	c.(6973-6975)ATG>GTG	p.M2325V	MYCBP2_uc010aev.2_Missense_Mutation_p.M1729V	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2325	Filamin.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTCACTATCATTGGTTCATAT	0.358													134	94	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329946	88329946	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329946G>A	uc001vln.2	+	2	2522	c.2303G>A	c.(2302-2304)CGA>CAA	p.R768Q	SLITRK5_uc010tic.1_Missense_Mutation_p.R527Q	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	768	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TACCGCTCCCGAGAGGGCAAC	0.522													21	59	---	---	---	---	PASS
RAP2A	5911	broad.mit.edu	37	13	98086847	98086847	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98086847C>T	uc001vnd.2	+	1	373	c.123C>T	c.(121-123)CGC>CGT	p.R41R		NM_021033	NP_066361	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family precursor	41					actin cytoskeleton reorganization|cellular protein localization|establishment of protein localization|positive regulation of protein autophosphorylation|Rap protein signal transduction|regulation of dendrite morphogenesis|regulation of JNK cascade	recycling endosome membrane	GTP binding|GTPase activity|protein binding			central_nervous_system(1)	1	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			ACTTCTACCGCAAGGAGATCG	0.622													24	93	---	---	---	---	PASS
DOCK9	23348	broad.mit.edu	37	13	99578088	99578088	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99578088C>T	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ATAGCTTACTCACTTCGGAAG	0.373													5	7	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20864868	20864868	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20864868A>T	uc001vxe.2	-	10	1611	c.1571T>A	c.(1570-1572)ATG>AAG	p.M524K	TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.M416K	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	524	TROVE.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AAGCATGGCCATGAAGGGAAG	0.423													10	25	---	---	---	---	PASS
FLJ10357	55701	broad.mit.edu	37	14	21542484	21542484	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21542484A>T	uc001vzp.2	+	3	624	c.595A>T	c.(595-597)AGT>TGT	p.S199C	FLJ10357_uc001vzn.1_Missense_Mutation_p.S199C|FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_Translation_Start_Site	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	199					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		ACATCAGCCAAGTACACTGCC	0.622													14	35	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21883988	21883988	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21883988C>T	uc001was.1	-	6	1052	c.958G>A	c.(958-960)GAA>AAA	p.E320K	CHD8_uc001war.1_Missense_Mutation_p.E216K	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	599					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ACCTCTTCTTCTTCTTCATCA	0.433													45	120	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23868085	23868085	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23868085G>C	uc001wjv.2	-	15	1810	c.1743C>G	c.(1741-1743)ATC>ATG	p.I581M		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	581	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CGGCGTAGTGGATCAGGGAGA	0.547													29	92	---	---	---	---	PASS
SRP54	6729	broad.mit.edu	37	14	35482666	35482666	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35482666G>C	uc001wso.2	+	9	1102	c.751G>C	c.(751-753)GAT>CAT	p.D251H	SRP54_uc010tpp.1_Missense_Mutation_p.D202H|SRP54_uc010tpq.1_Missense_Mutation_p.D187H	NM_003136	NP_003127	P61011	SRP54_HUMAN	signal recognition particle 54kDa isoform 1	251	GTP (By similarity).|G-domain.				GTP catabolic process|response to drug|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition|SRP-dependent cotranslational protein targeting to membrane, translocation	cytosol|nuclear speck|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|drug binding|endoplasmic reticulum signal peptide binding|GDP binding|GTP binding|nucleoside-triphosphatase activity|ribonucleoprotein binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		GACAAAACTTGATGGCCATGC	0.433													35	112	---	---	---	---	PASS
MGAT2	4247	broad.mit.edu	37	14	50089211	50089211	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50089211G>C	uc001wwr.2	+	1	1723	c.1225G>C	c.(1225-1227)GAA>CAA	p.E409Q	SDCCAG1_uc010anj.1_Intron|RPL36AL_uc001wwq.1_5'Flank	NM_002408	NP_002399	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein	409	Lumenal (Potential).				oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity				0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CATGTTTCCAGAAACTCTAAC	0.403													5	90	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51227052	51227052	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51227052T>A	uc001wym.2	-	17	2113	c.1922A>T	c.(1921-1923)GAC>GTC	p.D641V	NIN_uc001wyi.2_Missense_Mutation_p.D641V|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.D641V|NIN_uc010tqp.1_Missense_Mutation_p.D647V|NIN_uc001wyo.2_Missense_Mutation_p.D641V	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	641	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CACGGTTTCGTCCAGCTGCTT	0.458			T	PDGFRB	MPD								33	90	---	---	---	---	PASS
PIGH	5283	broad.mit.edu	37	14	68059354	68059354	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68059354G>A	uc001xjr.1	-	3	569	c.472C>T	c.(472-474)CAG>TAG	p.Q158*		NM_004569	NP_004560	Q14442	PIGH_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	158					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|mitochondrion|nucleolus	phosphatidylinositol N-acetylglucosaminyltransferase activity			ovary(1)	1				all cancers(60;0.000592)|OV - Ovarian serous cystadenocarcinoma(108;0.00395)|BRCA - Breast invasive adenocarcinoma(234;0.00933)		ATGCTCACCTGGAAGACGGGT	0.383													30	66	---	---	---	---	PASS
MLH3	27030	broad.mit.edu	37	14	75514890	75514890	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75514890G>T	uc001xrd.1	-	2	1685	c.1469C>A	c.(1468-1470)TCT>TAT	p.S490Y	MLH3_uc001xre.1_Missense_Mutation_p.S490Y|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	490					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TTCCAGGAAAGATTTTTTATG	0.378								MMR					109	94	---	---	---	---	PASS
ISM2	145501	broad.mit.edu	37	14	77945036	77945036	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77945036C>G	uc001xtz.2	-	5	1070	c.996G>C	c.(994-996)TGG>TGC	p.W332C	ISM2_uc001xua.2_Missense_Mutation_p.G217A|ISM2_uc001xty.2_Missense_Mutation_p.W244C|ISM2_uc010tvl.1_Missense_Mutation_p.W251C	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	332	TSP type-1.					extracellular region				skin(1)	1						ACCAGGGACTCCACTCCTTCT	0.473													26	71	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93118071	93118071	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93118071C>T	uc001yap.2	+	6	829	c.677C>T	c.(676-678)TCG>TTG	p.S226L	RIN3_uc010auk.2_5'UTR|RIN3_uc001yaq.2_Missense_Mutation_p.S151L|RIN3_uc001yar.1_5'UTR|RIN3_uc001yas.1_5'UTR	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	226					endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				ATCGAGCTGTCGGTAGGAAAT	0.602													9	90	---	---	---	---	PASS
BDKRB1	623	broad.mit.edu	37	14	96730239	96730239	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96730239A>G	uc001yfh.2	+	3	428	c.220A>G	c.(220-222)ATC>GTC	p.I74V	BDKRB1_uc010avn.2_Missense_Mutation_p.I74V	NM_000710	NP_000701	P46663	BKRB1_HUMAN	bradykinin receptor B1	74	Helical; Name=2; (Potential).				elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		CGTGGCAGAAATCTACCTGGC	0.532													59	39	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22368615	22368615	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22368615C>G	uc010tzu.1	+	1	40	c.40C>G	c.(40-42)CTC>GTC	p.L14V	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGAATTTGTTCTCACTGGCCT	0.333													90	455	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25315598	25315598	+	Intron	SNP	C	T	T	rs149955138	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25315598C>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-8_uc001yxr.2_RNA|SNORD116-3_uc001yxs.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						ATGAGTCCTCCAAAAAAACAT	0.488													39	155	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25344717	25344717	+	Intron	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25344717G>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-26_uc001yyl.2_RNA|SNORD116-27_uc001yym.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AATCATTTCTGTGCCACTTCT	0.443													20	128	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34130624	34130624	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34130624C>A	uc001zhi.2	+	89	12513	c.12443C>A	c.(12442-12444)TCT>TAT	p.S4148Y	RYR3_uc010bar.2_Missense_Mutation_p.S4143Y	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4148	Helical; Name=M3; (Potential).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCCTGTGCCTCTGTGAAGAGG	0.498													59	80	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40590445	40590445	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40590445C>G	uc001zld.2	-	11	1435	c.1134G>C	c.(1132-1134)ATG>ATC	p.M378I	PLCB2_uc010bbo.2_Missense_Mutation_p.M378I|PLCB2_uc010ucm.1_Missense_Mutation_p.M378I	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	378	PI-PLC X-box.				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TGTCTGTGGTCATGGTGAAGC	0.607													22	52	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40627441	40627441	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40627441G>T	uc001zlh.3	-	11	1539	c.1523C>A	c.(1522-1524)ACG>AAG	p.T508K	C15orf52_uc010ucn.1_Missense_Mutation_p.T298K	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	508										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GCCTCCTCTCGTGGGCCGGCT	0.682													105	196	---	---	---	---	PASS
IVD	3712	broad.mit.edu	37	15	40705252	40705252	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40705252C>A	uc001zls.3	+	7	1093	c.759C>A	c.(757-759)ACC>ACA	p.T253T	IVD_uc001zlq.2_Silent_p.T223T|IVD_uc001zlr.2_5'Flank	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1	250					leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		GCTCTAACACCTGTGAGCTAA	0.522													14	50	---	---	---	---	PASS
MAPKBP1	23005	broad.mit.edu	37	15	42115432	42115432	+	Intron	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42115432G>A	uc001zok.3	+						MAPKBP1_uc001zoj.3_Intron|MAPKBP1_uc010bcj.2_Intron|MAPKBP1_uc010bci.2_Intron|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_Intron|MAPKBP1_uc010bcl.2_Intron	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein											central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TGAGAAGCCTGATGGGTTCAG	0.612													11	36	---	---	---	---	PASS
VPS39	23339	broad.mit.edu	37	15	42481356	42481356	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42481356C>T	uc001zpd.2	-	6	482	c.331G>A	c.(331-333)GTT>ATT	p.V111I	VPS39_uc001zpc.2_Missense_Mutation_p.V100I	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	111	CNH.				protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		GCCTTTGAAACCGTAGTGATT	0.368													16	80	---	---	---	---	PASS
TMOD3	29766	broad.mit.edu	37	15	52179913	52179913	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52179913C>G	uc002abm.2	+						TMOD3_uc010bfc.1_Intron	NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		TCGCAGGTATCACCTAAAACA	0.378													25	125	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64005097	64005097	+	Intron	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64005097G>A	uc002amp.2	-						HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TTTCACTCCTGTCTCACATGT	0.388													6	33	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65490998	65490998	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65490998C>A	uc002aon.2	-	9	1807	c.1626G>T	c.(1624-1626)GTG>GTT	p.V542V		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	542					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						GCAGCCTGTCCACAAATGTGA	0.512													31	49	---	---	---	---	PASS
ZWILCH	55055	broad.mit.edu	37	15	66797698	66797698	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66797698G>T	uc002aqb.2	+	1	268	c.22G>T	c.(22-24)GCA>TCA	p.A8S	RPL4_uc002apv.2_5'Flank|RPL4_uc010bhr.2_5'Flank|RPL4_uc002apw.2_5'Flank|RPL4_uc002apx.2_5'UTR|RPL4_uc010ujq.1_5'Flank|SNORD16_uc010bht.2_5'Flank|SNORD18A_uc002apz.1_5'Flank|ZWILCH_uc010bhu.1_5'UTR|ZWILCH_uc002aqa.2_5'UTR|ZWILCH_uc010bhv.2_5'UTR	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN	Zwilch	8					cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding			ovary(1)	1						GCTGAACTGCGCAGCAGAGGA	0.607													41	144	---	---	---	---	PASS
GOLGA6B	55889	broad.mit.edu	37	15	72954811	72954811	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72954811G>A	uc010uks.1	+	11	1107	c.1066G>A	c.(1066-1068)GAG>AAG	p.E356K		NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	356	Potential.										0						GAGAGTGCGGGAGCAGGAGAG	0.567													87	430	---	---	---	---	PASS
NEO1	4756	broad.mit.edu	37	15	73547047	73547047	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73547047C>A	uc002avm.3	+	13	2111	c.1969C>A	c.(1969-1971)CCT>ACT	p.P657T	NEO1_uc010ukx.1_Missense_Mutation_p.P657T|NEO1_uc010uky.1_Missense_Mutation_p.P657T|NEO1_uc010ukz.1_Missense_Mutation_p.P81T|NEO1_uc002avn.3_Missense_Mutation_p.P322T	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor	657	Extracellular (Potential).|Fibronectin type-III 3.				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						CTGGCAGCCACCTGCTCCAGC	0.433													30	196	---	---	---	---	PASS
FAM154B	283726	broad.mit.edu	37	15	82574517	82574517	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82574517A>C	uc002bgv.2	+	3	380	c.311A>C	c.(310-312)TAC>TCC	p.Y104S	FAM154B_uc010unr.1_Missense_Mutation_p.Y89S|FAM154B_uc010uns.1_RNA	NM_001008226	NP_001008227	Q658L1	F154B_HUMAN	hypothetical protein LOC283726	104										skin(2)	2						GAACAAACTTACCACCCGCCT	0.363													8	318	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2350063	2350063	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2350063G>C	uc002cpy.1	-	13	2266	c.1554C>G	c.(1552-1554)TAC>TAG	p.Y518*	ABCA3_uc010bsk.1_Nonsense_Mutation_p.Y460*|ABCA3_uc010bsl.1_Nonsense_Mutation_p.Y518*	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	518					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				CGGCTTCAAAGTACTCGTTTC	0.617													106	91	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3593454	3593454	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3593454C>T	uc010btn.2	-	18	3321	c.2910G>A	c.(2908-2910)TTG>TTA	p.L970L		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	970					I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TGTTCACAGCCAAGGCTTCCC	0.532													7	16	---	---	---	---	PASS
TNFRSF17	608	broad.mit.edu	37	16	12061699	12061699	+	Silent	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12061699A>C	uc002dbv.2	+	3	768	c.550A>C	c.(550-552)AGG>CGG	p.R184R	TNFRSF17_uc010buy.2_3'UTR|TNFRSF17_uc010buz.2_Silent_p.R135R	NM_001192	NP_001183	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily,	184	Cytoplasmic (Potential).				cell proliferation|multicellular organismal development	endomembrane system|integral to membrane|plasma membrane					0						AATTTCTGCTAGGTAATTAAC	0.413			T	IL2	intestinal T-cell lymphoma								13	64	---	---	---	---	PASS
TNFRSF17	608	broad.mit.edu	37	16	12061709	12061709	+	3'UTR	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12061709C>T	uc002dbv.2	+	3					TNFRSF17_uc010buy.2_3'UTR|TNFRSF17_uc010buz.2_3'UTR	NM_001192	NP_001183	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily,						cell proliferation|multicellular organismal development	endomembrane system|integral to membrane|plasma membrane					0						AGGTAATTAACCATTTCGACT	0.408			T	IL2	intestinal T-cell lymphoma								13	62	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19567052	19567052	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19567052A>G	uc002dgn.1	+	1	13	c.1A>G	c.(1-3)ATG>GTG	p.M1V	C16orf62_uc002dgo.1_Missense_Mutation_p.M1V|C16orf62_uc010vas.1_5'UTR|C16orf62_uc002dgm.1_Missense_Mutation_p.M1V	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	1						integral to membrane				ovary(1)	1						GACTGGGAAGATGGCCGTCTT	0.617													12	41	---	---	---	---	PASS
FAM192A	80011	broad.mit.edu	37	16	57188238	57188238	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57188238G>T	uc010vhk.1	-	7	988	c.729C>A	c.(727-729)TCC>TCA	p.S243S	FAM192A_uc002ekz.3_Silent_p.S242S|FAM192A_uc002ekv.3_Silent_p.S165S|FAM192A_uc002ekw.3_Silent_p.S242S|FAM192A_uc002ekx.3_Silent_p.S242S|FAM192A_uc002eky.3_Silent_p.S242S	NM_024946	NP_079222	Q9GZU8	F192A_HUMAN	NEFA-interacting nuclear protein NIP30	243						nucleus					0						TTCGGAAGATGGAGGAGACAA	0.592													7	36	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65016169	65016169	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016169C>G	uc002eoi.2	-	8	1469	c.1035G>C	c.(1033-1035)TTG>TTC	p.L345F	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Missense_Mutation_p.L345F|CDH11_uc010vin.1_Missense_Mutation_p.L219F|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	345	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCTCTACCTTCAAGCTATAGG	0.448			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			49	56	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67298340	67298340	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67298340G>A	uc002esm.2	+	13	1991	c.1928G>A	c.(1927-1929)CGG>CAG	p.R643Q	SLC9A5_uc010cee.2_Missense_Mutation_p.R348Q|SLC9A5_uc010vji.1_Missense_Mutation_p.R147Q	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	643					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		AACATGAAGCGGCGGCTGGAG	0.577													31	6	---	---	---	---	PASS
THAP11	57215	broad.mit.edu	37	16	67877203	67877203	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67877203C>G	uc002euo.2	+	1	991	c.746C>G	c.(745-747)TCG>TGG	p.S249W	CENPT_uc002eun.3_Intron	NM_020457	NP_065190	Q96EK4	THA11_HUMAN	THAP domain containing 11	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		TACTCCTTGTCGTCAGGCACC	0.592													73	347	---	---	---	---	PASS
VAC14	55697	broad.mit.edu	37	16	70834811	70834811	+	Translation_Start_Site	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70834811G>T	uc002ezm.2	-	1	251	c.-7C>A	c.(-9--5)AGCTG>AGATG		VAC14_uc010cfw.2_Translation_Start_Site|VAC14_uc002ezn.2_Translation_Start_Site	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				CATGGTGGCAGCTGGGGGAAC	0.557													8	30	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70926361	70926361	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70926361C>A	uc002ezr.2	-	56	9445	c.9317G>T	c.(9316-9318)GGT>GTT	p.G3106V		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3107										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GGTCAGTGAACCCTTTTTGGG	0.428													83	126	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74339275	74339275	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74339275G>C	uc002fcq.2	+	7	751	c.619G>C	c.(619-621)GAT>CAT	p.D207H	PSMD7_uc010vmr.1_Missense_Mutation_p.D130H	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7	207					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						CAAGCTTCTGGATATCAGGAG	0.522													12	69	---	---	---	---	PASS
ZC3H18	124245	broad.mit.edu	37	16	88689746	88689746	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88689746G>T	uc002fky.2	+	10	1987	c.1787G>T	c.(1786-1788)CGG>CTG	p.R596L	ZC3H18_uc010voz.1_Missense_Mutation_p.R620L|ZC3H18_uc010chw.2_RNA	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	596	Ser-rich.					nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TCAGGAAGCCGGTCCAGGTAT	0.627													56	26	---	---	---	---	PASS
TSR1	55720	broad.mit.edu	37	17	2233662	2233662	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2233662C>G	uc002fuj.2	-						SNORD91B_uc002fuk.1_5'Flank|SNORD91A_uc002ful.1_RNA	NM_018128	NP_060598	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation						ribosome assembly	nucleolus	protein binding			ovary(1)	1						ATTGACTTCTCTATTATTCTC	0.368													28	84	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579314	7579314	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579314T>G	uc002gim.2	-	4	567	c.373A>C	c.(373-375)ACG>CCG	p.T125P	TP53_uc002gig.1_Missense_Mutation_p.T125P|TP53_uc002gih.2_Missense_Mutation_p.T125P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.T125P|TP53_uc010cni.1_Missense_Mutation_p.T125P|TP53_uc002gij.2_Missense_Mutation_p.T125P|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.T86P|TP53_uc010cnk.1_Missense_Mutation_p.T140P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	125	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in a sporadic cancer; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T125T(15)|p.0?(7)|p.T125M(7)|p.T125K(3)|p.G59fs*23(3)|p.T125R(3)|p.V73fs*9(1)|p.T125P(1)|p.G105_T125del21(1)|p.T125fs*45(1)|p.Y126fs*11(1)|p.Y107fs*44(1)|p.T125fs*24(1)|p.T125A(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAACTGACCGTGCAAGTCACA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			45	42	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7662770	7662770	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7662770C>T	uc002giu.1	+	15	2493	c.2479C>T	c.(2479-2481)CGG>TGG	p.R827W		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	827	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTACATGATTCGGCTGGACCG	0.522													4	78	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10304654	10304654	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10304654C>G	uc002gmm.2	-	24	3141	c.3046G>C	c.(3046-3048)GAG>CAG	p.E1016Q	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1016	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TTGTCCTCCTCTGCCTGCAGG	0.453									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				8	316	---	---	---	---	PASS
KSR1	8844	broad.mit.edu	37	17	25924359	25924359	+	Silent	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25924359A>T	uc010crg.2	+	10	1399	c.954A>T	c.(952-954)ACA>ACT	p.T318T	KSR1_uc002gzj.1_RNA|KSR1_uc002gzm.2_Silent_p.T119T	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	453					Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CCTCCTCCACACCCTCCTCAC	0.647													8	25	---	---	---	---	PASS
SEZ6	124925	broad.mit.edu	37	17	27308587	27308587	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27308587G>T	uc002hdp.2	-	2	720	c.526C>A	c.(526-528)CCC>ACC	p.P176T	SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.P176T|SEZ6_uc002hdq.1_Missense_Mutation_p.P51T|SEZ6_uc010crz.1_Missense_Mutation_p.P176T	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	176	Pro-rich.|Extracellular (Potential).					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CTGCTGGGGGGTGTAGTGCTG	0.637													17	28	---	---	---	---	PASS
SLC6A4	6532	broad.mit.edu	37	17	28544291	28544291	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28544291C>A	uc002hey.3	-	6	1274	c.730G>T	c.(730-732)GGG>TGG	p.G244W		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	244	Extracellular (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	TCCTGGAGCCCCTTAGACCGG	0.587													66	141	---	---	---	---	PASS
SLC6A4	6532	broad.mit.edu	37	17	28548847	28548847	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28548847A>G	uc002hey.3	-	3	674	c.130T>C	c.(130-132)TCC>CCC	p.S44P		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	44	Cytoplasmic (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	TACCCATTGGATATTTGCCCG	0.542													119	226	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38504711	38504711	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38504711T>A	uc002huk.1	+	3	777	c.322T>A	c.(322-324)TGC>AGC	p.C108S	RARA_uc002hul.3_Missense_Mutation_p.C108S|RARA_uc010wfe.1_Intron|RARA_uc002hun.1_Missense_Mutation_p.C103S	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	108	NR C4-type.|Nuclear receptor.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CTGTGAGGGCTGCAAGGTGAG	0.592			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								29	90	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39742654	39742654	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39742654C>G	uc002hxf.1	-	1	494	c.433G>C	c.(433-435)GTG>CTG	p.V145L	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Missense_Mutation_p.V145L	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	145	Coil 1A.|Rod.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CGGATCTTCACTTCCAGGTCG	0.577													111	207	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42477794	42477794	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42477794A>T	uc002igw.1	-	8	1715	c.1651T>A	c.(1651-1653)TGG>AGG	p.W551R	GPATCH8_uc002igv.1_Missense_Mutation_p.W473R|GPATCH8_uc010wiz.1_Missense_Mutation_p.W473R	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	551						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TCTGATGGCCACTGGAGGGCA	0.443											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	102	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42883087	42883087	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42883087G>A	uc002ihj.2	-	2	610	c.99C>T	c.(97-99)ATC>ATT	p.I33I	GJC1_uc002ihk.2_Silent_p.I33I|GJC1_uc002ihl.2_Silent_p.I33I|GJC1_uc010czx.2_Silent_p.I33I|GJC1_uc010czy.1_5'Flank	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	33	Helical; (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				CTGTAAGGACGATCCGGAAGA	0.478													25	97	---	---	---	---	PASS
HIGD1B	51751	broad.mit.edu	37	17	42926621	42926621	+	Splice_Site	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42926621G>A	uc002ihm.2	+	2	343	c.101_splice	c.e2-1	p.G34_splice		NM_016438	NP_057522	Q9P298	HIG1B_HUMAN	HIG1 hypoxia inducible domain family, member 1B							integral to membrane					0		Prostate(33;0.109)				TCTGCCCACAGGCTTAGGAGG	0.567													18	105	---	---	---	---	PASS
DYNLL2	140735	broad.mit.edu	37	17	56164509	56164509	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56164509G>A	uc010wnn.1	+	2	332	c.58G>A	c.(58-60)GAT>AAT	p.D20N		NM_080677	NP_542408	Q96FJ2	DYL2_HUMAN	dynein, light chain, LC8-type 2	20					activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|microtubule-based process|transport	centrosome|cytosol|dynein complex|microtubule|myosin complex|plasma membrane	motor activity				0						CATGCAACAGGATGCCGTTGA	0.517													13	94	---	---	---	---	PASS
MTMR4	9110	broad.mit.edu	37	17	56581810	56581810	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56581810C>T	uc002iwj.2	-	13	1449	c.1339G>A	c.(1339-1341)GGG>AGG	p.G447R		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	447	Myotubularin phosphatase.					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AACTTGTGCCCAAAATCCAGC	0.483													5	95	---	---	---	---	PASS
PPM1E	22843	broad.mit.edu	37	17	57057444	57057444	+	Silent	SNP	C	A	A	rs151205066		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57057444C>A	uc002iwx.2	+	7	1447	c.1320C>A	c.(1318-1320)ACC>ACA	p.T440T	PPM1E_uc010ddd.2_Silent_p.T203T	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E	449	PP2C-like.				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			TCTATGACACCGTGAACCCTG	0.498													43	58	---	---	---	---	PASS
TUBD1	51174	broad.mit.edu	37	17	57955528	57955528	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57955528C>T	uc002ixw.1	-	5	983	c.705G>A	c.(703-705)CTG>CTA	p.L235L	TUBD1_uc010ddf.1_Silent_p.L235L|TUBD1_uc010ddg.1_Silent_p.L200L|TUBD1_uc010ddh.1_Silent_p.L116L|TUBD1_uc010wok.1_Silent_p.L235L|TUBD1_uc002ixx.1_Silent_p.L235L|TUBD1_uc010wol.1_Silent_p.L19L|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin	235					cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			ACACACTTCCCAGCTGATGTG	0.403													82	155	---	---	---	---	PASS
HEATR6	63897	broad.mit.edu	37	17	58153505	58153505	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58153505G>C	uc002iyk.1	-	2	330	c.313C>G	c.(313-315)CTT>GTT	p.L105V	HEATR6_uc010wos.1_5'Flank	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	105							binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			AATCTGTTAAGTAAATGGTGG	0.383													4	107	---	---	---	---	PASS
PRKAR1A	5573	broad.mit.edu	37	17	66519041	66519041	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66519041G>T	uc002jhg.2	+	3	502	c.322G>T	c.(322-324)GAA>TAA	p.E108*	PRKAR1A_uc002jhh.2_Nonsense_Mutation_p.E108*|PRKAR1A_uc002jhi.2_Nonsense_Mutation_p.E108*|PRKAR1A_uc002jhj.2_Nonsense_Mutation_p.E108*|PRKAR1A_uc002jhk.2_5'UTR|PRKAR1A_uc002jhl.2_Nonsense_Mutation_p.E108*|PRKAR1A_uc002jhm.2_Nonsense_Mutation_p.E108*	NM_212471	NP_997636	P10644	KAP0_HUMAN	cAMP-dependent protein kinase, regulatory	108	Dimerization and phosphorylation.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity|protein binding			adrenal_gland(4)|lung(3)|thyroid(2)|soft_tissue(2)|breast(1)	12	Breast(10;1.64e-13)					CTACACGGAGGAAGATGCGGC	0.493			T|Mis|N|F|S	RET	papillary thyroid	myxoma|endocrine|papillary thyroid			Carney_Complex|Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial|Cardiac_Myxomas_Familial_Clustering_of				48	99	---	---	---	---	PASS
AFMID	125061	broad.mit.edu	37	17	76200744	76200744	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76200744G>T	uc002jva.3	+	5	331	c.316G>T	c.(316-318)GAG>TAG	p.E106*	AFMID_uc002jvb.3_Intron|AFMID_uc002juz.3_Nonsense_Mutation_p.E106*	NM_001010982	NP_001010982	Q63HM1	AFMID_HUMAN	arylformamidase isoform 1	106						cytosol|nucleus	arylformamidase activity			large_intestine(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)			CAGTAAGGATGAGTCTGCCTT	0.577													29	60	---	---	---	---	PASS
FOXK2	3607	broad.mit.edu	37	17	80540717	80540717	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80540717C>A	uc002kfn.2	+	5	1181	c.1010C>A	c.(1009-1011)GCC>GAC	p.A337D	FOXK2_uc002kfm.1_Missense_Mutation_p.A337D|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2	337	Fork-head.				embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ATAGACCCAGCCTCTGAAAGC	0.498													52	70	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8088778	8088778	+	Silent	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8088778A>T	uc002knn.3	+	11	2288	c.1785A>T	c.(1783-1785)ACA>ACT	p.T595T	PTPRM_uc010dkv.2_Silent_p.T595T|PTPRM_uc010wzl.1_Silent_p.T382T	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	595	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				AACTTGAGACACCTTTGAATC	0.473													28	260	---	---	---	---	PASS
SPIRE1	56907	broad.mit.edu	37	18	12479814	12479814	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12479814C>T	uc002kre.2	-	10	1335	c.1288G>A	c.(1288-1290)GGT>AGT	p.G430S	SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Missense_Mutation_p.G296S|SPIRE1_uc010wzx.1_Missense_Mutation_p.G219S|SPIRE1_uc010wzy.1_Missense_Mutation_p.G416S	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a	430						cytoskeleton|perinuclear region of cytoplasm	actin binding				0						GATGTCAAACCTCCATTCACC	0.463													35	221	---	---	---	---	PASS
SS18	6760	broad.mit.edu	37	18	23619384	23619384	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23619384T>A	uc002kvm.2	-	6	722	c.644A>T	c.(643-645)TAC>TTC	p.Y215F	SS18_uc002kvn.2_Missense_Mutation_p.Y215F|SS18_uc010xbf.1_Missense_Mutation_p.Y133F|SS18_uc010xbg.1_Missense_Mutation_p.Y163F|SS18_uc010xbh.1_Missense_Mutation_p.Y163F|SS18_uc010xbi.1_Missense_Mutation_p.Y192F|SS18_uc010dlz.1_Missense_Mutation_p.Y163F	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	215	Gln-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					TGGCATATTGTATTGCTGAGA	0.418			T	SSX1| SSX2	synovial sarcoma								46	266	---	---	---	---	PASS
FHOD3	80206	broad.mit.edu	37	18	34310661	34310661	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34310661G>C	uc002kzt.1	+	16	2991	c.2894G>C	c.(2893-2895)AGG>ACG	p.R965T	FHOD3_uc002kzs.1_Missense_Mutation_p.R982T|FHOD3_uc010dmz.1_Missense_Mutation_p.R697T|FHOD3_uc010dnb.1_5'UTR	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	965	FH2.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GATTCCAAGAGGAGTAACGCC	0.413													82	96	---	---	---	---	PASS
SMAD7	4092	broad.mit.edu	37	18	46476230	46476230	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46476230C>A	uc002ldg.2	-	1	852	c.565G>T	c.(565-567)GAG>TAG	p.E189*	SMAD7_uc010xde.1_5'Flank	NM_005904	NP_005895	O15105	SMAD7_HUMAN	SMAD family member 7	189	MH1.				adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)					CACACCAGCTCGGGGTTGATC	0.572											OREG0024975	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	18	---	---	---	---	PASS
CBLN2	147381	broad.mit.edu	37	18	70205426	70205426	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70205426C>A	uc002lku.2	-	4	895	c.660G>T	c.(658-660)TTG>TTT	p.L220F	CBLN2_uc002lkv.2_Missense_Mutation_p.L220F	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	220	C1q.					integral to membrane					0		Esophageal squamous(42;0.131)				GAGGAAACACCAAGAAGCCCG	0.517													5	155	---	---	---	---	PASS
ZNF77	58492	broad.mit.edu	37	19	2934610	2934610	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2934610C>T	uc002lws.3	-	4	646	c.515G>A	c.(514-516)AGC>AAC	p.S172N		NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77	172					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGAGGCAGCTGCAGGCTTG	0.512													46	70	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4297977	4297977	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4297977C>T	uc002lzx.1	-						TMIGD2_uc010dtv.1_Intron	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCTGGCTCCCGTACCTGGG	0.522													93	269	---	---	---	---	PASS
TRIP10	9322	broad.mit.edu	37	19	6744953	6744953	+	Missense_Mutation	SNP	G	C	C	rs148404026		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6744953G>C	uc002mfs.2	+	9	998	c.932G>C	c.(931-933)CGA>CCA	p.R311P	TRIP10_uc010dux.1_Missense_Mutation_p.R311P|TRIP10_uc002mfr.2_Missense_Mutation_p.R311P|TRIP10_uc010duy.2_RNA|TRIP10_uc010duz.2_Missense_Mutation_p.R130P	NM_004240	NP_004231	Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	311	Interaction with CDC42.|Interaction with PDE6G (By similarity).				actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding			ovary(1)	1						CCTGAACTCCGAGGCCCGGGT	0.662													33	38	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6897258	6897258	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6897258T>C	uc002mfw.2	+	4	375	c.337T>C	c.(337-339)TCT>CCT	p.S113P	EMR1_uc010dvc.2_Missense_Mutation_p.S113P|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Missense_Mutation_p.S113P	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	113	Extracellular (Potential).|EGF-like 2; calcium-binding (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					AGATGGTTTCTCTTCTCCCAC	0.502													63	76	---	---	---	---	PASS
FCER2	2208	broad.mit.edu	37	19	7761738	7761738	+	Missense_Mutation	SNP	G	C	C	rs147413598	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7761738G>C	uc002mhn.2	-	8	626	c.442C>G	c.(442-444)CTA>GTA	p.L148V	FCER2_uc010xjs.1_Missense_Mutation_p.L70V|FCER2_uc010xjt.1_Missense_Mutation_p.L70V|FCER2_uc002mhm.2_Missense_Mutation_p.L148V|FCER2_uc010dvo.2_Missense_Mutation_p.L148V	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor	148	Extracellular (Potential).				positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						TCCATCCTTAGCTTTGTCACC	0.567													5	9	---	---	---	---	PASS
RAB11B	9230	broad.mit.edu	37	19	8467418	8467418	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8467418C>A	uc002mju.3	+	4	576	c.480C>A	c.(478-480)AAC>AAA	p.N160K	RAB11B_uc010xkd.1_Missense_Mutation_p.N160K	NM_004218	NP_004209	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	160					cell cycle|protein transport|small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity				0						ATTCCACTAACGTAGAGGAAG	0.552													23	79	---	---	---	---	PASS
PRAM1	84106	broad.mit.edu	37	19	8564041	8564041	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8564041C>T	uc002mkd.2	-	2	671	c.651G>A	c.(649-651)GCG>GCA	p.A217A	PRAM1_uc002mkc.2_Silent_p.A217A	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	265	Pro-rich.						lipid binding|protein binding				0						ACTCAGGCTGCGCAGGCTTCT	0.637													13	39	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068663	9068663	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068663C>T	uc002mkp.2	-	3	18987	c.18783G>A	c.(18781-18783)AAG>AAA	p.K6261K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6263	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTCTGTGATCTTCGCCAGTG	0.473													36	149	---	---	---	---	PASS
ZNF266	10781	broad.mit.edu	37	19	9526346	9526346	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9526346G>C	uc002mll.2	-	3	454	c.188C>G	c.(187-189)TCC>TGC	p.S63C	ZNF266_uc002mlm.2_Missense_Mutation_p.S63C|ZNF266_uc002mln.2_Missense_Mutation_p.S63C|ZNF266_uc002mlo.2_Missense_Mutation_p.S63C|ZNF266_uc010dwp.2_Missense_Mutation_p.S63C|ZNF266_uc010dwq.2_Missense_Mutation_p.S63C	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	63					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AATCCCACTGGAGGTTGGCTC	0.363													46	112	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10577637	10577637	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10577637G>C	uc002moj.2	+	15	2109	c.2001G>C	c.(1999-2001)GAG>GAC	p.E667D	PDE4A_uc002mok.2_Missense_Mutation_p.E641D|PDE4A_uc002mol.2_Missense_Mutation_p.E606D|PDE4A_uc002mom.2_Missense_Mutation_p.E428D|PDE4A_uc002mon.2_Missense_Mutation_p.E122D|PDE4A_uc002moo.2_3'UTR	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	667	Catalytic.				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	ATGCCCAGGAGATCTTGGACA	0.582													5	187	---	---	---	---	PASS
ZNF491	126069	broad.mit.edu	37	19	11917176	11917176	+	Silent	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11917176T>C	uc002mso.1	+	3	693	c.408T>C	c.(406-408)TGT>TGC	p.C136C		NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	136	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GTAAGTTTTGTGGGAAAGCCT	0.378													56	142	---	---	---	---	PASS
TRMT1	55621	broad.mit.edu	37	19	13226547	13226547	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13226547C>A	uc002mwj.2	-	3	596	c.346G>T	c.(346-348)GTC>TTC	p.V116F	NACC1_uc002mwm.2_5'Flank|TRMT1_uc002mwk.2_Missense_Mutation_p.V116F|TRMT1_uc002mwl.3_Missense_Mutation_p.V116F|TRMT1_uc010xmz.1_5'UTR	NM_017722	NP_060192	Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 isoform 1	116							RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		AAGTCCACGACCACTTTTTGC	0.532													191	437	---	---	---	---	PASS
ZSWIM4	65249	broad.mit.edu	37	19	13915621	13915621	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13915621G>A	uc002mxh.1	+	3	560	c.371G>A	c.(370-372)GGA>GAA	p.G124E	ZSWIM4_uc010xng.1_5'UTR	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	124							zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACCTGAGCGGAAACATCCGC	0.577											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	81	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	16000383	16000383	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16000383G>A	uc002nbs.1	-	7	818	c.768C>T	c.(766-768)TTC>TTT	p.F256F	CYP4F2_uc010xot.1_Silent_p.F107F|CYP4F2_uc010xou.1_Silent_p.F107F	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	256					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						AGGCCCTGCGGAAACGCTGCC	0.572													46	223	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16641678	16641678	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16641678C>T	uc002nei.1	-	6	762	c.688G>A	c.(688-690)GCC>ACC	p.A230T	MED26_uc002nee.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	230	CID.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						AGCTCCCGGGCCTGCTTGCGC	0.692													15	85	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17088306	17088306	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17088306A>C	uc002nfb.2	-	15	1803	c.1771T>G	c.(1771-1773)TCT>GCT	p.S591A		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	544						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						AGATGAAGAGAGGTCACACAC	0.592													13	87	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17370241	17370241	+	Intron	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17370241G>T	uc002nfs.1	-						USHBP1_uc002nfr.1_5'Flank|USHBP1_uc002nft.1_Intron|USHBP1_uc010xpk.1_Intron|USHBP1_uc010eam.1_Intron	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1								PDZ domain binding			ovary(1)	1						CAATGCTCCTGTTCCCGAAGG	0.547													91	206	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24309505	24309505	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24309505G>C	uc002nru.2	+	4	837	c.703G>C	c.(703-705)GAG>CAG	p.E235Q	ZNF254_uc010xrk.1_Missense_Mutation_p.E150Q	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	235					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TTATACTGAAGAGAAACCTTA	0.328													49	97	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34791809	34791809	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34791809T>A	uc002nvd.3	+	2	1290	c.431T>A	c.(430-432)ATG>AAG	p.M144K	KIAA0355_uc010edk.1_Missense_Mutation_p.M134K	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	144										ovary(1)	1	Esophageal squamous(110;0.162)					AAGATGCTAATGGAACTTAGT	0.478													11	147	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229990	38229990	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229990C>G	uc002ohe.2	-	4	1423	c.1401G>C	c.(1399-1401)AAG>AAC	p.K467N	ZNF573_uc010efs.2_Missense_Mutation_p.K380N|ZNF573_uc002ohd.2_Missense_Mutation_p.K465N|ZNF573_uc002ohf.2_Missense_Mutation_p.K409N|ZNF573_uc002ohg.2_Missense_Mutation_p.K379N	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	447					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			CAAAAAGTTTCTTACCAGTGT	0.348													46	211	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40903752	40903752	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40903752G>A	uc002onr.2	-	7	776	c.507C>T	c.(505-507)GGC>GGT	p.G169G	PRX_uc002onq.2_Silent_p.G30G|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	169	Arg/Lys-rich (basic).|Nuclear localization signal (By similarity).				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGGCTTTGAGGCCCCGACGCA	0.672													5	16	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41125356	41125356	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41125356G>A	uc002ooh.1	+	26	3376	c.3376G>A	c.(3376-3378)GAC>AAC	p.D1126N	LTBP4_uc002oog.1_Missense_Mutation_p.D1089N|LTBP4_uc002ooi.1_Missense_Mutation_p.D1059N|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Missense_Mutation_p.D260N|LTBP4_uc002ool.1_Missense_Mutation_p.D138N|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1126	Pro-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAAGAGTTTGACCCCATGAC	0.542													62	101	---	---	---	---	PASS
ITPKC	80271	broad.mit.edu	37	19	41224129	41224129	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41224129C>G	uc002oot.2	+	1	1122	c.1089C>G	c.(1087-1089)TTC>TTG	p.F363L	ADCK4_uc002oor.2_5'Flank|ADCK4_uc002oos.2_5'Flank	NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C	363						cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTCTTCTTTCGACGAGTCTG	0.667													27	123	---	---	---	---	PASS
ITPKC	80271	broad.mit.edu	37	19	41245400	41245400	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41245400G>A	uc002oot.2	+	7	2020	c.1987G>A	c.(1987-1989)GAG>AAG	p.E663K		NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C	663						cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GGGCAACCGTGAGGACGGCTA	0.637													12	33	---	---	---	---	PASS
ZFP112	7771	broad.mit.edu	37	19	44833689	44833689	+	Silent	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44833689G>T	uc010ejj.2	-	5	752	c.639C>A	c.(637-639)GTC>GTA	p.V213V	ZFP112_uc002ozc.3_Silent_p.V207V|ZFP112_uc010xwy.1_Silent_p.V230V|ZFP112_uc010xwz.1_Silent_p.V212V	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						AGAGCCAACTGACACTGTCAC	0.358													111	218	---	---	---	---	PASS
ZC3H4	23211	broad.mit.edu	37	19	47570093	47570093	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47570093G>A	uc002pga.3	-	15	3470	c.3432C>T	c.(3430-3432)AGC>AGT	p.S1144S	ZC3H4_uc002pgb.1_RNA	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1144							nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GGCTGATACCGCTCAGCACAC	0.716													7	11	---	---	---	---	PASS
C5AR1	728	broad.mit.edu	37	19	47823920	47823920	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47823920A>C	uc002pgj.1	+	2	935	c.886A>C	c.(886-888)AAC>CAC	p.N296H		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	296	Helical; Name=7; (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CTGCTGCATCAACCCCATCAT	0.582													7	280	---	---	---	---	PASS
MYBPC2	4606	broad.mit.edu	37	19	50944129	50944129	+	Intron	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50944129C>T	uc002psf.2	+							NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CGTTCCCCCACCCGCCAGGGA	0.572													8	45	---	---	---	---	PASS
SHANK1	50944	broad.mit.edu	37	19	51165684	51165684	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51165684C>T	uc002psx.1	-	23	6043	c.6024G>A	c.(6022-6024)GAG>GAA	p.E2008E	SHANK1_uc002psw.1_Silent_p.E1392E	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2008					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TGACCTTGTGCTCCGAGGCGG	0.716													3	9	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54745997	54745997	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54745997G>T	uc010erh.1	-	3	384	c.260C>A	c.(259-261)TCC>TAC	p.S87Y	LILRA6_uc002qew.1_Missense_Mutation_p.S87Y|LILRB3_uc002qeh.1_Missense_Mutation_p.S87Y|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.S87Y|LILRA6_uc002qek.1_Missense_Mutation_p.S87Y|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.S87Y|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S87Y|LILRB3_uc002qep.1_Missense_Mutation_p.S87Y|LILRB3_uc002qeq.1_Missense_Mutation_p.S87Y|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S87Y|LILRA6_uc010yep.1_Missense_Mutation_p.S87Y|LILRA6_uc010yeq.1_Missense_Mutation_p.S87Y|LILRA6_uc002qet.3_RNA|LILRA6_uc002qeu.1_Missense_Mutation_p.S87Y|LILRA6_uc002qev.1_5'Flank	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	87	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGTGTCATGGATGGGATGGA	0.567													64	503	---	---	---	---	PASS
TRIB3	57761	broad.mit.edu	37	20	368956	368956	+	Intron	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:368956A>C	uc002wdm.2	+						TRIB3_uc002wdn.2_Intron	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN	tribbles 3						apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		GTACGTGCCCATGGGCGGCTG	0.622													23	105	---	---	---	---	PASS
SNRPB	6628	broad.mit.edu	37	20	2443759	2443759	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2443759T>C	uc002wfz.1	-	5	698	c.535A>G	c.(535-537)ATG>GTG	p.M179V	SNRPB_uc002wga.1_Missense_Mutation_p.M179V|SNRPB_uc010zpv.1_Missense_Mutation_p.M100V|SNRPB_uc002wgb.2_Missense_Mutation_p.M179V|SNORD119_uc010gam.1_5'Flank	NM_198216	NP_937859	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptide B/B'	179	|Repeat-rich region.				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|protein binding|RNA binding			ovary(1)	1						CCTCGGCCCATAGGTGGGGGA	0.577													79	291	---	---	---	---	PASS
NOP56	10528	broad.mit.edu	37	20	2635176	2635176	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2635176G>C	uc002wgh.2	+	4	378	c.325G>C	c.(325-327)GGG>CGG	p.G109R	NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_5'UTR|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank|SNORD86_uc010gaq.1_5'Flank|SNORD56_uc010gar.2_5'Flank|SNORD57_uc002wgo.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A	109					rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						GGAGGAGTTAGGGTACAACTG	0.522													45	186	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20177306	20177306	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20177306T>A	uc002wru.2	+	16	1759	c.1683T>A	c.(1681-1683)TTT>TTA	p.F561L	C20orf26_uc010zse.1_Missense_Mutation_p.F541L	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	561										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		TGCATCACTTTGCCCTCAACC	0.453													82	117	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35425292	35425292	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35425292A>C	uc002xgd.1	-	13	3088	c.2761T>G	c.(2761-2763)TTA>GTA	p.L921V	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	921											0		Myeloproliferative disorder(115;0.00874)				CACCTCTTTAAACCATTTCCT	0.587													23	103	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47864358	47864358	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47864358C>G	uc002xui.2	-	14	5450	c.5203G>C	c.(5203-5205)GAA>CAA	p.E1735Q		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1735							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TGGACCTGTTCTAGTCGAGTC	0.493													96	142	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	30909641	30909641	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30909641C>G	uc011acs.1	-	17	3137	c.2673G>C	c.(2671-2673)AAG>AAC	p.K891N	GRIK1_uc002ynn.2_Missense_Mutation_p.K876N|GRIK1_uc011act.1_Missense_Mutation_p.K752N	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	Error:Variant_position_missing_in_P39086_after_alignment					central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TTGACTTTTTCTTTATTTTTT	0.393													52	41	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33065678	33065678	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33065678C>A	uc002ypd.2	-	12	1868	c.1442G>T	c.(1441-1443)AGA>ATA	p.R481I	SFRS15_uc002ype.2_Missense_Mutation_p.R481I|SFRS15_uc010glu.2_Missense_Mutation_p.R466I|SFRS15_uc002ypf.1_Missense_Mutation_p.R155I	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	481						nucleus	nucleotide binding|RNA binding				0						TCGATCCCGTCTTTCTTGAGA	0.483													51	97	---	---	---	---	PASS
SIM2	6493	broad.mit.edu	37	21	38072165	38072165	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38072165C>T	uc002yvr.2	+	1	175	c.119C>T	c.(118-120)GCG>GTG	p.A40V	SIM2_uc002yvp.2_Missense_Mutation_p.A40V|SIM2_uc002yvq.2_Missense_Mutation_p.A40V	NM_005069	NP_005060	Q14190	SIM2_HUMAN	single-minded homolog 2 long isoform	40	Helix-loop-helix motif.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1						CTGGACAAAGCGTCCATCATC	0.647													10	4	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38309157	38309157	+	Silent	SNP	A	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38309157A>T	uc010gnb.2	-	4	1789	c.588T>A	c.(586-588)ATT>ATA	p.I196I	HLCS_uc002yvs.2_Silent_p.I196I|HLCS_uc010gnc.1_Silent_p.I343I	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	196					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	GGTGGTAGAGAATATAACTGT	0.577													18	64	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47704496	47704496	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47704496C>G	uc002zir.1	-	1	741	c.705G>C	c.(703-705)AAG>AAC	p.K235N	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	235					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					TAGGTCCTCTCTTCTCTTCCT	0.393													32	108	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21101933	21101933	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21101933C>T	uc002zsz.3	-	29	3358	c.3127G>A	c.(3127-3129)GCC>ACC	p.A1043T		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1043					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GTGGCCATGGCCAGCCCCGTG	0.483													4	142	---	---	---	---	PASS
C22orf43	51233	broad.mit.edu	37	22	23962792	23962792	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23962792G>T	uc002zxf.2	-	5	672	c.395C>A	c.(394-396)TCA>TAA	p.S132*		NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233	132	Asp-rich.									skin(1)	1						CTGGACACGTGACGGTAAAAT	0.393													48	196	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36900335	36900335	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36900335C>G	uc003apn.3	-	3	967	c.859G>C	c.(859-861)GCC>CCC	p.A287P	FOXRED2_uc003apo.3_Missense_Mutation_p.A287P|FOXRED2_uc003app.3_Missense_Mutation_p.A287P	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	287					ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						TTCAGGATGGCCAGATCCGTC	0.567													30	132	---	---	---	---	PASS
PVALB	5816	broad.mit.edu	37	22	37211230	37211230	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37211230C>G	uc010gwz.2	-	2	141	c.111G>C	c.(109-111)AAG>AAC	p.K37N	PVALB_uc003apx.2_Missense_Mutation_p.K37N	NM_002854	NP_002845	P20472	PRVA_HUMAN	parvalbumin	37							calcium ion binding			skin(1)	1						CACTCTTTTTCTTCAGGCCGA	0.522													3	138	---	---	---	---	PASS
GGA1	26088	broad.mit.edu	37	22	38028721	38028721	+	3'UTR	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38028721C>G	uc003atc.2	+	17					GGA1_uc003atd.2_3'UTR|GGA1_uc003ate.2_3'UTR|GGA1_uc003atf.2_3'UTR|SH3BP1_uc003atg.1_5'Flank	NM_013365	NP_037497	Q9UJY5	GGA1_HUMAN	golgi associated, gamma adaptin ear containing,						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding			breast(2)|ovary(1)	3	Melanoma(58;0.0574)					GCCTCTAGAACAGAGGGGCTG	0.607													4	12	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38121718	38121718	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38121718C>A	uc003atr.2	+	7	3426	c.3155C>A	c.(3154-3156)CCC>CAC	p.P1052H	TRIOBP_uc003atu.2_Missense_Mutation_p.P880H|TRIOBP_uc003atq.1_Missense_Mutation_p.P1052H|TRIOBP_uc003ats.1_Missense_Mutation_p.P880H	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1052					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					AGTGAACCGCCCCACCACGAG	0.672													95	85	---	---	---	---	PASS
TMEM184B	25829	broad.mit.edu	37	22	38621457	38621457	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38621457G>A	uc003avf.1	-	7	985	c.761C>T	c.(760-762)TCC>TTC	p.S254F	TMEM184B_uc003avg.1_Missense_Mutation_p.S254F|TMEM184B_uc003avh.1_Missense_Mutation_p.S188F|TMEM184B_uc010gxl.1_RNA	NM_012264	NP_036396	Q9Y519	T184B_HUMAN	transmembrane protein 184B	254	Helical; (Potential).					integral to membrane					0	Melanoma(58;0.045)					AAAGATGACGGACTTGACCAT	0.617													51	109	---	---	---	---	PASS
RPL3	6122	broad.mit.edu	37	22	39709250	39709250	+	Silent	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39709250G>A	uc003axi.2	-	9	1181	c.1113C>T	c.(1111-1113)ACC>ACT	p.T371T	RPL3_uc003axh.2_Silent_p.T322T|RPL3_uc003axj.2_Silent_p.T219T|RPL3_uc010gxx.2_Intron|RPL3_uc003axg.2_Silent_p.T319T|RPL3_uc003axk.1_Silent_p.T219T	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a	371					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)					CAAACTTGGAGGTGGTGTCAA	0.572													11	22	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40661018	40661018	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40661018G>T	uc011aor.1	+	5	995	c.784G>T	c.(784-786)GAC>TAC	p.D262Y	TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Missense_Mutation_p.D262Y|TNRC6B_uc003ayo.2_Missense_Mutation_p.D66Y	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	262					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CTGGAAATCTGACCCTAAGGC	0.463													23	140	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40676076	40676076	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40676076G>C	uc011aor.1	+	10	3551	c.3340G>C	c.(3340-3342)GAT>CAT	p.D1114H	TNRC6B_uc003aym.2_Missense_Mutation_p.D367H|TNRC6B_uc003ayn.3_Missense_Mutation_p.D1061H|TNRC6B_uc003ayo.2_Missense_Mutation_p.D918H	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	1114					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CATGAGGAAGGATCGATCTGG	0.403													6	382	---	---	---	---	PASS
PNPLA5	150379	broad.mit.edu	37	22	44285245	44285245	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44285245G>C	uc003beg.2	-	4	763	c.666C>G	c.(664-666)TTC>TTG	p.F222L	PNPLA5_uc011aqc.1_Missense_Mutation_p.F82L|PNPLA5_uc003beh.2_Missense_Mutation_p.F108L	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	222					lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TGAGCCCCAGGAAGAAGTTCT	0.567													40	255	---	---	---	---	PASS
LDOC1L	84247	broad.mit.edu	37	22	44892926	44892926	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44892926C>T	uc003beu.1	-	2	848	c.511G>A	c.(511-513)GCA>ACA	p.A171T		NM_032287	NP_115663	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	171										ovary(1)	1		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CGCAACTCTGCCAGGAACCCC	0.597													36	65	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46780531	46780531	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46780531C>A	uc003bhw.1	-	20	6792	c.6792G>T	c.(6790-6792)CCG>CCT	p.P2264P	CELSR1_uc011arc.1_Silent_p.P585P	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	2264	Extracellular (Potential).				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGTCGAATCGCGGGACCCTGG	0.522													38	53	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50582559	50582559	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50582559G>C	uc003bjj.2	+	18	2475	c.2392G>C	c.(2392-2394)GTC>CTC	p.V798L	MOV10L1_uc003bjk.3_Missense_Mutation_p.V798L|MOV10L1_uc011arp.1_Missense_Mutation_p.V778L|MOV10L1_uc003bjl.2_5'Flank	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	798					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TCGGATTTTAGTCTGTGCGCC	0.572													9	559	---	---	---	---	PASS
GYG2	8908	broad.mit.edu	37	X	2793967	2793967	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2793967C>G	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TATTCCTCATCTATATGACCT	0.478													14	12	---	---	---	---	PASS
GEMIN8	54960	broad.mit.edu	37	X	14038351	14038351	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14038351G>C	uc004cwb.2	-	4	661	c.318C>G	c.(316-318)ATC>ATG	p.I106M	GEMIN8_uc004cwc.2_Missense_Mutation_p.I106M|GEMIN8_uc004cwd.2_Missense_Mutation_p.I106M	NM_017856	NP_060326	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	106					spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0						TGGATGCCTGGATCCTACTGC	0.483													77	78	---	---	---	---	PASS
GRPR	2925	broad.mit.edu	37	X	16170713	16170713	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16170713C>G	uc004cxj.2	+	3	1753	c.1100C>G	c.(1099-1101)TCC>TGC	p.S367C		NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	367	Cytoplasmic (Potential).				cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					ACCAACCCCTCCGTGGCCACC	0.532													78	88	---	---	---	---	PASS
ATP6AP2	10159	broad.mit.edu	37	X	40448380	40448380	+	Intron	SNP	T	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40448380T>A	uc004det.2	+						ATP6AP2_uc010nhc.2_Intron|ATP6AP2_uc011mkl.1_Intron|ATP6AP2_uc011mkm.1_Intron|ATP6AP2_uc011mkn.1_Intron	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory						angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0						TATGTATATATTTTTTAAATG	0.393													19	77	---	---	---	---	PASS
SYN1	6853	broad.mit.edu	37	X	47435889	47435889	+	Intron	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47435889C>G	uc004die.2	-						SYN1_uc004did.2_Intron	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia							cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1						TTTGGTCTCTCCACTCACATG	0.577													12	97	---	---	---	---	PASS
TBC1D25	4943	broad.mit.edu	37	X	48418401	48418401	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48418401G>A	uc004dka.1	+	6	1216	c.1105G>A	c.(1105-1107)GAC>AAC	p.D369N	TBC1D25_uc011mly.1_Missense_Mutation_p.D311N|TBC1D25_uc004dkb.1_Missense_Mutation_p.D115N|TBC1D25_uc011mlz.1_Missense_Mutation_p.D115N|TBC1D25_uc011mma.1_Missense_Mutation_p.D115N|TBC1D25_uc004dkc.1_Missense_Mutation_p.D115N|TBC1D25_uc011mmb.1_Missense_Mutation_p.D373N|TBC1D25_uc011mmc.1_Missense_Mutation_p.D115N|TBC1D25_uc011mmd.1_Missense_Mutation_p.D115N	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	369	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(1)	1						CTTCCACCCTGACGGCCGCGC	0.562													20	7	---	---	---	---	PASS
KCND1	3750	broad.mit.edu	37	X	48826210	48826210	+	Missense_Mutation	SNP	C	T	T	rs147309267		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48826210C>T	uc004dlx.1	-	1	2042	c.469G>A	c.(469-471)GGG>AGG	p.G157R	KCND1_uc004dlw.1_5'Flank	NM_004979	NP_004970	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related	157	Cytoplasmic (Potential).					voltage-gated potassium channel complex	metal ion binding|voltage-gated potassium channel activity			ovary(2)|lung(1)	3						GGGCCGTCCCCGGCCTGCTCT	0.647													6	8	---	---	---	---	PASS
FAAH2	158584	broad.mit.edu	37	X	57313306	57313306	+	Silent	SNP	G	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57313306G>C	uc004dvc.2	+	1	197	c.48G>C	c.(46-48)GCG>GCC	p.A16A		NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	16	Helical; (Potential).					integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						TCTTGCGGGCGCTAGGCTTTC	0.567										HNSCC(52;0.14)			7	18	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67940189	67940189	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67940189T>C	uc004dxa.2	+	7	2105	c.1733T>C	c.(1732-1734)GTG>GCG	p.V578A	STARD8_uc004dxb.2_Missense_Mutation_p.V658A|STARD8_uc004dxc.3_Missense_Mutation_p.V578A	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	578	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						CTCATCCACGTGCAGCGCACG	0.607													12	0	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73812708	73812708	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73812708C>G	uc004ebu.2	-	5	732	c.442G>C	c.(442-444)GGG>CGG	p.G148R	RLIM_uc004ebw.2_Missense_Mutation_p.G148R	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	148					random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TTTTGGCTCCCATTATTACGG	0.418													5	296	---	---	---	---	PASS
GPR174	84636	broad.mit.edu	37	X	78426582	78426582	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78426582C>G	uc004edg.1	+	1	114	c.78C>G	c.(76-78)TAC>TAG	p.Y26*		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	26	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						CAGTGACATACACTGTCATTC	0.373										HNSCC(63;0.18)			4	59	---	---	---	---	PASS
TBX22	50945	broad.mit.edu	37	X	79282760	79282760	+	Silent	SNP	G	C	C	rs150811689	byFrequency	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79282760G>C	uc010nmg.1	+	7	938	c.804G>C	c.(802-804)ACG>ACC	p.T268T	TBX22_uc004edi.1_Silent_p.T148T|TBX22_uc004edj.1_Silent_p.T268T	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	268	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						CATAGATTACGAAACTAAAAA	0.348													15	7	---	---	---	---	PASS
DIAPH2	1730	broad.mit.edu	37	X	96684741	96684741	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96684741C>G	uc004efu.3	+	26	3634	c.3238C>G	c.(3238-3240)CCA>GCA	p.P1080A	DIAPH2_uc004eft.3_Missense_Mutation_p.P1080A	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	1080	DAD.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						TCCAAGGAATCCAGGTAAAAC	0.393													38	30	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130217169	130217169	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130217169A>G	uc004evz.2	+	3	629	c.284A>G	c.(283-285)GAT>GGT	p.D95G	ARHGAP36_uc004ewa.2_Missense_Mutation_p.D83G|ARHGAP36_uc004ewb.2_Missense_Mutation_p.D64G|ARHGAP36_uc004ewc.2_5'Flank	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	95					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						AACACCTTGGATAAGTGGTTT	0.413													152	60	---	---	---	---	PASS
SPANXN2	494119	broad.mit.edu	37	X	142795457	142795457	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795457C>T	uc004fbz.2	-	2	975	c.221G>A	c.(220-222)CGA>CAA	p.R74Q		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	74										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGTTCTCTCGGGACTGGTC	0.428													7	392	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152823611	152823611	+	Silent	SNP	C	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152823611C>T	uc004fht.1	+	15	2601	c.2475C>T	c.(2473-2475)ATC>ATT	p.I825I	ATP2B3_uc004fhs.1_Silent_p.I825I|ATP2B3_uc010nuf.1_5'Flank	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	825	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCGACATCATCCTGACCG	0.597													147	39	---	---	---	---	PASS
L1CAM	3897	broad.mit.edu	37	X	153132842	153132842	+	Silent	SNP	C	A	A			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153132842C>A	uc004fjb.2	-	16	2214	c.2106G>T	c.(2104-2106)CCG>CCT	p.P702P	L1CAM_uc004fjc.2_Silent_p.P702P|L1CAM_uc010nuo.2_Silent_p.P697P	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	702	Fibronectin type-III 1.|Extracellular (Potential).				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTCAGAGACCGGGCTGGGCT	0.602													162	47	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100480713	100480714	+	Intron	INS	-	AA	AA			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100480713_100480714insAA	uc001dsp.1	+						SLC35A3_uc001dsq.1_Intron|SLC35A3_uc009wdy.1_Intron|SLC35A3_uc001dsr.1_Intron|SLC35A3_uc001dss.1_Intron	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A						UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		gactccgtctcaaaaaaaaaaa	0.084													4	2	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150390386	150390387	+	Intron	INS	-	TC	TC	rs140431392	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150390386_150390387insTC	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						tcttttctttttctctctctct	0.104													6	3	---	---	---	---	
CELF3	11189	broad.mit.edu	37	1	151677284	151677285	+	Intron	INS	-	GT	GT	rs138717096	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151677284_151677285insGT	uc001eys.1	-						CELF3_uc010pdh.1_Intron|CELF3_uc001eyr.2_Intron|CELF3_uc009wmy.2_Intron|CELF3_uc009wmx.1_Intron	NM_007185	NP_009116	Q5SZQ8	CELF3_HUMAN	trinucleotide repeat containing 4						nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2						GGTCACGGAGGGTGTGTGTGTG	0.460													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208428858	208428858	+	IGR	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208428858delT								PLXNA2 (11193 upstream) : None (None downstream)																							tttctttttcttttttttttt	0.149													3	3	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236577755	236577755	+	Intron	DEL	T	-	-	rs34360581		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236577755delT	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CAGAAATTAATTTTTTTCTTT	0.254													12	9	---	---	---	---	
SDCCAG8	10806	broad.mit.edu	37	1	243507432	243507452	+	Intron	DEL	CTCTAGGGGGCACCAAAAGAT	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243507432_243507452delCTCTAGGGGGCACCAAAAGAT	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TCTATATGACCTCTAGGGGGCACCAAAAGATCTAATTGCAG	0.330													27	18	---	---	---	---	
SMPD4	55627	broad.mit.edu	37	2	130912742	130912742	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130912742delG	uc002tqq.1	-	15	2017	c.1497delC	c.(1495-1497)CCCfs	p.P499fs	SMPD4_uc002tqo.1_5'UTR|SMPD4_uc002tqp.1_Frame_Shift_Del_p.P238fs|SMPD4_uc010yzy.1_Frame_Shift_Del_p.P248fs|SMPD4_uc010yzz.1_Frame_Shift_Del_p.P163fs|SMPD4_uc002tqr.1_Frame_Shift_Del_p.P470fs|SMPD4_uc002tqs.1_Frame_Shift_Del_p.P367fs|SMPD4_uc002tqt.1_Frame_Shift_Del_p.P348fs|SMPD4_uc010zaa.1_Frame_Shift_Del_p.P357fs|SMPD4_uc010zab.1_Frame_Shift_Del_p.P397fs|SMPD4_uc010zac.1_Frame_Shift_Del_p.P240fs|SMPD4_uc010zad.1_Frame_Shift_Del_p.P135fs	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	460					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	GCGCGTGCTTGGGGCTGACCA	0.602													92	49	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141459894	141459894	+	Intron	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141459894delT	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGTTACAGACTATATTTGATT	0.323										TSP Lung(27;0.18)			118	78	---	---	---	---	
C2orf88	84281	broad.mit.edu	37	2	191064921	191064929	+	3'UTR	DEL	AAATGTGAC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191064921_191064929delAAATGTGAC	uc002urq.2	+	3					C2orf88_uc002urr.2_3'UTR|C2orf88_uc002urs.2_3'UTR|C2orf88_uc002urt.2_3'UTR	NM_001042521	NP_001035986	Q9BSF0	CB088_HUMAN	hypothetical protein LOC84281												0						TAGTTTGAATAAATGTGACAAAAGCAAAA	0.364													82	40	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242352633	242352634	+	Intron	INS	-	T	T	rs141753202	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242352633_242352634insT	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ATTTGGGATAATTTTTTTTTAC	0.248													3	3	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	123813761	123813762	+	Intron	DEL	GT	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123813761_123813762delGT	uc003ehg.2	+						KALRN_uc003ehd.2_Intron|KALRN_uc003ehe.2_Intron|KALRN_uc010hru.1_Intron|KALRN_uc010hrv.1_Intron|KALRN_uc010hrw.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GGTATCCTGAGTGTGTGTATGC	0.317													81	41	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140139744	140139744	+	Intron	DEL	C	-	-	rs11338320		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140139744delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AGTCCTATTGCGCAGCTAGGT	0.517										HNSCC(16;0.037)			5	5	---	---	---	---	
ATP13A5	344905	broad.mit.edu	37	3	193069205	193069207	+	Intron	DEL	GAG	-	-	rs138530610		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193069205_193069207delGAG	uc011bsq.1	-							NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TATGCATTCAGAGCCATGCCCAC	0.286													3	5	---	---	---	---	
CLOCK	9575	broad.mit.edu	37	4	56345718	56345718	+	Intron	DEL	C	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56345718delC	uc003haz.1	-						CLOCK_uc003hba.1_Intron	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AAGCACATAGCTTTTGGAAAt	0.209													5	3	---	---	---	---	
NIPBL	25836	broad.mit.edu	37	5	37038517	37038518	+	Intron	INS	-	TATG	TATG	rs141082325	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37038517_37038518insTATG	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TATCTTGAGTATTATTTCTATA	0.337													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37348864	37348865	+	Intron	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37348864_37348865insT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTGAGTTGGGCttttttttttt	0.173													4	2	---	---	---	---	
NUDT12	83594	broad.mit.edu	37	5	102886823	102886823	+	Intron	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886823delT	uc003koi.2	-						NUDT12_uc011cvb.1_Intron	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		ACATGCAAAGttttttttttt	0.139													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115822791	115822792	+	Intron	INS	-	A	A	rs111384042		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115822791_115822792insA	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AAATCAGTAACaaaaaaaaaaa	0.267													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124187225	124187228	+	IGR	DEL	CTTT	-	-	rs111256114		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124187225_124187228delCTTT								ZNF608 (102725 upstream) : None (None downstream)																							tccttccttcctttcttccttcct	0.029													5	3	---	---	---	---	
SPINK13	153218	broad.mit.edu	37	5	147649399	147649399	+	Intron	DEL	A	-	-	rs71764680		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147649399delA	uc003lpc.2	+						uc003lpb.1_Intron|SPINK13_uc010jgt.2_Intron	NM_001040129	NP_001035218	Q1W4C9	ISK13_HUMAN	serine PI Kazal type 5-like 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0						TTTTTGGCAGAAAAAAAAAAG	0.393													4	2	---	---	---	---	
HIST1H3J	8356	broad.mit.edu	37	6	27861102	27861108	+	5'Flank	DEL	TATTAAC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27861102_27861108delTATTAAC	uc003nka.2	-						HIST1H2AM_uc003nkb.1_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003535	NP_003526	P68431	H31_HUMAN	histone cluster 1, H3j						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						ACTATATTGATATTAACGTCATCTGAG	0.391													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	63171063	63171063	+	IGR	DEL	C	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63171063delC								KHDRBS2 (174963 upstream) : LGSN (814794 downstream)																							AGAACTGCCTCCCACTGTAAA	0.378													8	5	---	---	---	---	
PKD1L1	168507	broad.mit.edu	37	7	47920137	47920163	+	Intron	DEL	CCCAAAGTGCTGGGATTACAAGCGTGA	-	-	rs113663040		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47920137_47920163delCCCAAAGTGCTGGGATTACAAGCGTGA	uc003tny.1	-							NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						gcctcggcctcccaaagtgctgggattacaagcgtgagccactgtgc	0.137													4	2	---	---	---	---	
FAM40B	57464	broad.mit.edu	37	7	129125451	129125453	+	In_Frame_Del	DEL	AGA	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129125451_129125453delAGA	uc011koy.1	+	21	2326_2328	c.2286_2288delAGA	c.(2284-2289)GCAGAA>GCA	p.E764del	FAM40B_uc011koz.1_In_Frame_Del_p.E256del	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	764											0						ACTTCCAAGCAGAAGAATGTACC	0.488													90	56	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150311028	150311029	+	IGR	INS	-	CTCTAT	CTCTAT	rs141505392	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150311028_150311029insCTCTAT								GIMAP4 (39988 upstream) : GIMAP6 (11437 downstream)																							tctctatttacctctatctcta	0.094													6	5	---	---	---	---	
NUDT18	79873	broad.mit.edu	37	8	21968864	21968873	+	5'Flank	DEL	TGTGTGTGTG	-	-	rs72021577		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21968864_21968873delTGTGTGTGTG	uc003xaq.1	-						NUDT18_uc003xar.1_5'Flank	NM_024815	NP_079091	Q6ZVK8	NUD18_HUMAN	nudix (nucleoside diphosphate linked moiety								hydrolase activity|metal ion binding|protein binding				0				Colorectal(74;0.00185)|COAD - Colon adenocarcinoma(73;0.0608)|READ - Rectum adenocarcinoma(5;0.0986)		ATATTTGCTCtgtgtgtgtgtgtgtgtgtg	0.324													4	3	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135602948	135602950	+	Intron	DEL	ACC	-	-	rs142344777		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135602948_135602950delACC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			caacaccacgaccaccatcacca	0.015													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138676648	138676649	+	IGR	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138676648_138676649insT								None (None upstream) : FAM135B (465619 downstream)																							tctttccttccttTTTTTTTTT	0.213													6	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	334047	334048	+	Intron	INS	-	CTTCTGG	CTTCTGG	rs146663671	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:334047_334048insCTTCTGG	uc003zgf.2	+						DOCK8_uc011lls.1_Intron|DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgg.2_Intron|DOCK8_uc003zgh.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TATCAGCTAGACCCAAGTGCAT	0.302													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331927	8331950	+	Intron	DEL	AAATCCTAAATTTATTTACTCTTG	-	-	rs3837248		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331927_8331950delAAATCCTAAATTTATTTACTCTTG	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ACATACCTTTAAATCCTAAATTTATTTACTCTTGAAATCCTAAA	0.335										TSP Lung(15;0.13)			3	3	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73477745	73477753	+	Intron	DEL	TTCATGCTC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73477745_73477753delTTCATGCTC	uc004aid.2	-						TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aie.2_Intron|TRPM3_uc004aif.2_Intron|TRPM3_uc004aig.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						aagactaaatttcatgctcttaaccacCC	0.211													58	30	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77427483	77427483	+	Intron	DEL	A	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77427483delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTGGGTACAGAAAAAAAAAAA	0.159													4	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92007622	92007625	+	Intron	DEL	TTCT	-	-	rs67832119		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92007622_92007625delTTCT	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						TGTCTTCTAGTTCTTTCTTTTTCG	0.265													4	3	---	---	---	---	
GLT6D1	360203	broad.mit.edu	37	9	138516743	138516744	+	Intron	DEL	TT	-	-	rs35067667		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138516743_138516744delTT	uc010nbd.1	-							NM_182974	NP_892019	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1						carbohydrate metabolic process	integral to membrane	transferase activity, transferring hexosyl groups			ovary(1)	1		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		gcccaggtaatttttttttttt	0.000													4	2	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73805245	73805245	+	Intron	DEL	T	-	-	rs10717136		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73805245delT	uc001ouu.2	-							NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					acttgttaggttttttttttt	0.154													4	2	---	---	---	---	
BHLHE41	79365	broad.mit.edu	37	12	26275572	26275583	+	In_Frame_Del	DEL	GCCGCCGCCGCT	-	-	rs12831005		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26275572_26275583delGCCGCCGCCGCT	uc001rhb.2	-	5	1156_1167	c.865_876delAGCGGCGGCGGC	c.(865-876)AGCGGCGGCGGCdel	p.SGGG289del		NM_030762	NP_110389	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix domain containing, class	289_292					cell differentiation|cell proliferation|organ morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						cgccccccgggccgccgccgctgccgccgccg	0.542													4	2	---	---	---	---	
TRHDE	29953	broad.mit.edu	37	12	72969246	72969247	+	Intron	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72969246_72969247insT	uc001sxa.2	+							NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TTATCCTATTATTTTTTCTAAT	0.396													121	58	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88177962	88177967	+	IGR	DEL	TGACTT	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88177962_88177967delTGACTT								MGAT4C (945281 upstream) : C12orf50 (195849 downstream)																							CAGCAAGGGATGACTTTGTAGTTAGC	0.427													102	54	---	---	---	---	
ORAI1	84876	broad.mit.edu	37	12	122079130	122079131	+	Frame_Shift_Ins	INS	-	C	C			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122079130_122079131insC	uc010szz.1	+	3	680_681	c.487_488insC	c.(487-489)TCCfs	p.S163fs		NM_032790	NP_116179	Q96D31	CRCM1_HUMAN	calcium release-activated calcium channel	163	Cytoplasmic (Potential).				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		GGTCAAGGAGTCCCCCCATGAG	0.619													55	32	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123024333	123024333	+	Intron	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123024333delT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		tttgaatgacttttttttttt	0.164													6	3	---	---	---	---	
SLC7A7	9056	broad.mit.edu	37	14	23247786	23247787	+	Intron	INS	-	A	A	rs143089787	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23247786_23247787insA	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		AAAATGCCTTTAAAAATTTACA	0.149													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87757781	87757792	+	IGR	DEL	GGAAGGACGGAA	-	-	rs72161798		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87757781_87757792delGGAAGGACGGAA								AGBL1 (185498 upstream) : NCRNA00052 (362368 downstream)																							gagggaggggggaaggacggaaggaaggaagg	0.222													4	2	---	---	---	---	
CP110	9738	broad.mit.edu	37	16	19559446	19559447	+	Intron	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19559446_19559447insT	uc002dgl.3	+						CP110_uc002dgk.3_Intron			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;						centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						TTTCAATGGGATTTTTTTTCTT	0.317													42	25	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69726958	69726959	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69726958_69726959insT	uc002exm.1	+	12	4384_4385	c.3176_3177insT	c.(3175-3177)AATfs	p.N1059fs	NFAT5_uc002exi.2_Frame_Shift_Ins_p.N983fs|NFAT5_uc002exj.1_Frame_Shift_Ins_p.N983fs|NFAT5_uc002exk.1_Frame_Shift_Ins_p.N983fs|NFAT5_uc002exl.1_Frame_Shift_Ins_p.N1077fs|NFAT5_uc002exn.1_Frame_Shift_Ins_p.N1076fs|NFAT5_uc002exo.1_RNA	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	1059					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						CAATCTGGAAATTTTTTGCAGC	0.411													272	131	---	---	---	---	
TAX1BP3	30851	broad.mit.edu	37	17	3569036	3569037	+	Intron	INS	-	AA	AA	rs71379530		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3569036_3569037insAA	uc002fwc.2	-						P2RX5_uc002fwd.2_Intron|TAX1BP3_uc002fwe.1_Intron	NM_014604	NP_055419	O14907	TX1B3_HUMAN	Tax1 binding protein 3						activation of Cdc42 GTPase activity|negative regulation of protein localization at cell surface|negative regulation of Wnt receptor signaling pathway|Rho protein signal transduction|Wnt receptor signaling pathway	cytoplasm|nucleus	protein C-terminus binding				0				COAD - Colon adenocarcinoma(5;0.0761)		CTCTGGGCTCCaaaaaaaaaaa	0.465													10	5	---	---	---	---	
TBC1D3C	414060	broad.mit.edu	37	17	34588193	34588193	+	Intron	DEL	C	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34588193delC	uc002hlk.1	-						TBC1D3C_uc002hll.1_Intron|TBC1D3G_uc010wcv.1_Intron|TBC1D3G_uc002hlm.2_Intron|uc002hlo.1_5'Flank	NM_001001418	NP_001001418	Q6IPX1	TBC3C_HUMAN	TBC1 domain family member 3C							intracellular	Rab GTPase activator activity				0		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGCCACAAGCCATGGGTGCC	0.592													4	2	---	---	---	---	
TNS4	84951	broad.mit.edu	37	17	38638837	38638838	+	Intron	INS	-	AC	AC			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38638837_38638838insAC	uc010cxb.2	-						TNS4_uc002huu.3_5'Flank	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			ctctactaaagacacacacaca	0.000													4	2	---	---	---	---	
CSH2	1443	broad.mit.edu	37	17	61952870	61952871	+	5'Flank	INS	-	CTTC	CTTC			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61952870_61952871insCTTC	uc002jch.2	-						CSH2_uc002jcg.2_5'Flank|CSH2_uc002jci.2_5'Flank|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						ttccttcctttcttccttcctt	0.000													8	4	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67532020	67532021	+	Intron	INS	-	AC	AC	rs138344495	by1000genomes	TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67532020_67532021insAC	uc002jij.2	+							NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					AAAAGGAAAGTacacacacaca	0.267													4	2	---	---	---	---	
CCDC40	55036	broad.mit.edu	37	17	78063308	78063311	+	Intron	DEL	TCTC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78063308_78063311delTCTC	uc010dht.2	+						CCDC40_uc002jxm.3_Intron|CCDC40_uc002jxn.3_Intron	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATATCCCTGTtctctctctctctg	0.181													3	3	---	---	---	---	
ZNF93	81931	broad.mit.edu	37	19	20028754	20028754	+	Intron	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20028754delT	uc002non.2	+						ZNF93_uc002nom.2_Intron	NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						TCCTTCTTTCTTTTTTtttct	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21749277	21749278	+	IGR	DEL	TC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21749277_21749278delTC								ZNF429 (10209 upstream) : ZNF100 (157566 downstream)																							AGAAATTATTTCTGTTTTCCCC	0.401													6	3	---	---	---	---	
CAPN12	147968	broad.mit.edu	37	19	39233490	39233491	+	Intron	INS	-	A	A	rs34722370		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39233490_39233491insA	uc002ojd.1	-							NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			gaccccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49858279	49858282	+	Intron	DEL	CATA	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49858279_49858282delCATA	uc002pnj.2	-						TEAD2_uc002png.2_Intron|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		tacatacatgcatacatacataca	0.225													4	2	---	---	---	---	
VSX1	30813	broad.mit.edu	37	20	25059184	25059184	+	Intron	DEL	T	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25059184delT	uc002wuf.2	-						VSX1_uc002wue.2_Intron|VSX1_uc010gdd.1_Intron|VSX1_uc010gde.1_Intron|VSX1_uc010gdf.1_Intron	NM_014588	NP_055403	Q9NZR4	VSX1_HUMAN	visual system homeobox 1 isoform a						response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AGGTAGTCTCTTTTTTTTTTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	30939262	30939262	+	IGR	DEL	G	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30939262delG								SEC14L4 (37564 upstream) : GAL3ST1 (11362 downstream)																							GTCACCTTGCGGGGGGACTCT	0.577													71	38	---	---	---	---	
RFPL3	10738	broad.mit.edu	37	22	32752978	32752979	+	5'Flank	INS	-	G	G			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32752978_32752979insG	uc003amj.2	+						RFPL3_uc010gwn.2_Intron	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1								zinc ion binding			ovary(1)	1						GGCTGGCCTGTGGGTGGGCGAG	0.624													8	5	---	---	---	---	
ZBED4	9889	broad.mit.edu	37	22	50280595	50280596	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50280595_50280596delAC	uc003bix.2	+	2	3755_3756	c.3285_3286delAC	c.(3283-3288)GAACACfs	p.E1095fs		NM_014838	NP_055653	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	1095_1096						cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AGGTGCTTGAACACAGCTGTGA	0.579													76	44	---	---	---	---	
FAM116B	414918	broad.mit.edu	37	22	50754053	50754056	+	Intron	DEL	ACTC	-	-	rs71964200		TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50754053_50754056delACTC	uc011aru.1	-						FAM116B_uc011arv.1_Intron	NM_001001794	NP_001001794	Q8NEG7	F116B_HUMAN	family with sequence similarity 116, member B												0		all_cancers(38;4.34e-09)|all_epithelial(38;3.03e-08)|all_lung(38;0.00141)|Breast(42;0.00387)|Lung NSC(38;0.0199)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		gcacacacatactcacacacagat	0.314													5	3	---	---	---	---	
FAM9B	171483	broad.mit.edu	37	X	8993373	8993387	+	3'UTR	DEL	ACAGAGGTTGAAGAG	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8993373_8993387delACAGAGGTTGAAGAG	uc011mhu.1	-	8					FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_3'UTR	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B							nucleus					0		Hepatocellular(5;0.219)				CATCAGAATAACAGAGGTTGAAGAGACAACTGGGT	0.326													4	3	---	---	---	---	
BMX	660	broad.mit.edu	37	X	15554697	15554697	+	Intron	DEL	A	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15554697delA	uc004cww.2	+						BMX_uc004cwx.3_Intron|BMX_uc004cwy.3_Intron	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase						cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					GATTTTCTTTAAAAAAAAAAA	0.313													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82130969	82130969	+	IGR	DEL	A	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82130969delA								None (None upstream) : POU3F4 (632300 downstream)																							ATTATAAACTAAAAAAAAAAa	0.139													3	3	---	---	---	---	
UBE2A	7319	broad.mit.edu	37	X	118716913	118716913	+	Intron	DEL	A	-	-			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118716913delA	uc004erl.2	+						UBE2A_uc004erm.2_Intron|UBE2A_uc004ern.2_Intron|UBE2A_uc004ero.2_Intron|UBE2A_uc004erp.2_Intron	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						cttctcccttaaaaaaaaaaa	0.169								Direct_reversal_of_damage|Rad6_pathway					6	3	---	---	---	---	
ARHGEF6	9459	broad.mit.edu	37	X	135765123	135765124	+	Intron	INS	-	T	T			TCGA-66-2758-01A-02D-1522-08	TCGA-66-2758-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135765123_135765124insT	uc004fab.2	-						ARHGEF6_uc011mwd.1_Intron|ARHGEF6_uc011mwe.1_Intron	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6						apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					ATTAACGGTAATTTTTTTTTTA	0.297													8	12	---	---	---	---	
