Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	978953	978953	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:978953G>A	uc001ack.1	+	9	1689	c.1639G>A	c.(1639-1641)GAG>AAG	p.E547K		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	547	Kazal-like 6.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		AGCCCTGTGCGAGGCCGAGAC	0.692													5	78	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	982720	982720	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:982720C>A	uc001ack.1	+	20	3452	c.3402C>A	c.(3400-3402)TTC>TTA	p.F1134L		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	1134	SEA.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCAAGGTGTTCCAGGGCGTCC	0.657													19	64	---	---	---	---	PASS
GPR157	80045	broad.mit.edu	37	1	9188713	9188713	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9188713T>A	uc001apq.1	-	1	517	c.374A>T	c.(373-375)CAT>CTT	p.H125L	GPR157_uc010oad.1_Missense_Mutation_p.H125L|GPR157_uc001apr.2_Missense_Mutation_p.H125L|GPR157_uc001aps.2_Silent_p.P173P	NM_024980	NP_079256	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	125	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		CCTGACGACATGGAAGGCCCA	0.667													15	26	---	---	---	---	PASS
ALPL	249	broad.mit.edu	37	1	21894615	21894615	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21894615C>T	uc001bet.2	+	7	924	c.667C>T	c.(667-669)CGG>TGG	p.R223W	ALPL_uc010odn.1_Missense_Mutation_p.R171W|ALPL_uc010odo.1_Missense_Mutation_p.R168W|ALPL_uc010odp.1_Missense_Mutation_p.R146W|ALPL_uc001beu.3_Missense_Mutation_p.R223W	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	223			R -> Q (in HOPS).|R -> W (in HOPS; 3% of activity; severe allele).		response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	GGGGGGTGGCCGGAAATACAT	0.557													28	88	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38330016	38330016	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38330016G>A	uc001ccg.1	-	23	2688	c.2594C>T	c.(2593-2595)TCA>TTA	p.S865L	INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Missense_Mutation_p.S701L	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	945	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATTTTTTGCTGAATTTTTCAG	0.398													6	50	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43870165	43870165	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43870165G>T	uc009vws.1	+	4	526	c.442G>T	c.(442-444)GAG>TAG	p.E148*	C1orf84_uc001cjh.2_Nonsense_Mutation_p.E146*|C1orf84_uc001cji.1_RNA			Q5T011	SZT2_HUMAN	Homo sapiens mRNA for KIAA0467 protein, partial cds.	148						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTTCCAGCCTGAGATCTATGT	0.517													60	127	---	---	---	---	PASS
PTCH2	8643	broad.mit.edu	37	1	45293826	45293826	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45293826C>T	uc010olf.1	-	14	1759	c.1747G>A	c.(1747-1749)GAG>AAG	p.E583K	PTCH2_uc010olg.1_Missense_Mutation_p.E281K	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	583	Cytoplasmic (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)					TCCCCCAGCTCCTGGGGCAGG	0.582									Basal_Cell_Nevus_syndrome				4	118	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60506651	60506651	+	Intron	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60506651T>A	uc001czs.1	-							NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795								calcium ion binding			ovary(1)|breast(1)	2						CAACAACTCTTAGTATACACA	0.418													38	101	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86210415	86210415	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86210415C>A	uc001dlj.2	-	57	4648	c.4606G>T	c.(4606-4608)GGC>TGC	p.G1536C	COL24A1_uc001dli.2_Missense_Mutation_p.G651C|COL24A1_uc010osd.1_Missense_Mutation_p.G836C|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1536	Fibrillar collagen NC1.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TCTCGTGTGCCAAGAGGATTC	0.383													69	172	---	---	---	---	PASS
SLC35A3	23443	broad.mit.edu	37	1	100477024	100477024	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100477024G>A	uc001dsp.1	+	5	766	c.569G>A	c.(568-570)GGG>GAG	p.G190E	SLC35A3_uc001dsq.1_Missense_Mutation_p.G190E|SLC35A3_uc009wdy.1_Missense_Mutation_p.G190E|SLC35A3_uc001dsr.1_Missense_Mutation_p.G232E|SLC35A3_uc001dss.1_Missense_Mutation_p.G109E	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A	190					UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		GGCTTTGCTGGGGTTTACTTT	0.338													13	128	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101188862	101188862	+	Silent	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101188862A>T	uc001dti.2	+	3	747	c.627A>T	c.(625-627)ACA>ACT	p.T209T	VCAM1_uc001dtj.2_Silent_p.T209T|VCAM1_uc010ouj.1_Silent_p.T147T	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	209	Ig-like C2-type 2.|Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	CTGTGCCCACAGTAAGGCAGG	0.403													45	124	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118558758	118558758	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118558758G>A	uc001ehk.2	-	29	4185	c.4117C>T	c.(4117-4119)CAT>TAT	p.H1373Y		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1373						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GGAGGGTCATGGATTTCACCC	0.418													44	132	---	---	---	---	PASS
ANKRD35	148741	broad.mit.edu	37	1	145566772	145566772	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145566772G>T	uc001eob.1	+	11	2982	c.2874G>T	c.(2872-2874)CTG>CTT	p.L958L	NBPF10_uc001emp.3_Intron	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	958	Potential.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCTGCAGCTGCAGGTATGTT	0.498													4	71	---	---	---	---	PASS
TTC24	164118	broad.mit.edu	37	1	156554721	156554721	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156554721G>A	uc009wsc.1	+	5	604	c.464G>A	c.(463-465)GGG>GAG	p.G155E		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	435							binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGCGGAGGGGACCCCAGCA	0.612													5	11	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158262570	158262570	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158262570G>T	uc001fru.2	+	4	1087	c.795G>T	c.(793-795)CAG>CAT	p.Q265H	CD1C_uc001frv.2_Missense_Mutation_p.Q68H	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor	265	Extracellular (Potential).|Ig-like.				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					GGTATCTTCAGGTGATCCTGG	0.517													15	135	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158324246	158324246	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158324246C>T	uc001fse.2	+	2	377	c.138C>T	c.(136-138)GCC>GCT	p.A46A	CD1E_uc010pid.1_Silent_p.A44A|CD1E_uc010pie.1_Intron|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Silent_p.A46A|CD1E_uc001fsk.2_Silent_p.A46A|CD1E_uc001fsj.2_Silent_p.A46A|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Silent_p.A46A|CD1E_uc001fry.2_Silent_p.A46A|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Silent_p.A46A|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Silent_p.A46A|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	46					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					CCTCCTTTGCCAACCACAGCT	0.567													25	205	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158368476	158368476	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158368476G>T	uc010pih.1	-	1	781	c.781C>A	c.(781-783)CGG>AGG	p.R261R		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					GACTTGGGCCGCAGATAGATG	0.512													12	65	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158650461	158650461	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158650461T>C	uc001fst.1	-	5	789	c.590A>G	c.(589-591)CAT>CGT	p.H197R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	197	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AAATTTCTTATGCAGAACTTC	0.478													19	209	---	---	---	---	PASS
OR6K6	128371	broad.mit.edu	37	1	158724597	158724597	+	5'Flank	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158724597C>G	uc001fsw.1	+							NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_hematologic(112;0.0378)					TAACTCATTACAGAAAGGAAT	0.383													31	115	---	---	---	---	PASS
SLAMF9	89886	broad.mit.edu	37	1	159921550	159921550	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159921550G>C	uc001fus.2	-	4	888	c.771C>G	c.(769-771)ATC>ATG	p.I257M	SLAMF9_uc009wtd.2_Missense_Mutation_p.I166M|SLAMF9_uc001fut.2_3'UTR	NM_033438	NP_254273	Q96A28	SLAF9_HUMAN	SLAM family member 9 isoform 1	257	Helical; (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCTGGACTCGGATGACCCAGA	0.498													38	257	---	---	---	---	PASS
ITLN2	142683	broad.mit.edu	37	1	160917807	160917807	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160917807C>A	uc001fxd.2	-	7	795	c.737G>T	c.(736-738)GGA>GTA	p.G246V	ITLN2_uc009wts.2_Missense_Mutation_p.G245V|ITLN2_uc010pju.1_Missense_Mutation_p.G163V	NM_080878	NP_543154	Q8WWU7	ITLN2_HUMAN	intelectin 2 precursor	246	Fibrinogen C-terminal.				signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTGAACGAATCCTGCAACAAA	0.468													42	98	---	---	---	---	PASS
GPR161	23432	broad.mit.edu	37	1	168054995	168054995	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168054995A>G	uc001gfc.2	-	8	1678	c.1364T>C	c.(1363-1365)GTA>GCA	p.V455A	GPR161_uc001gfb.2_Missense_Mutation_p.V323A|GPR161_uc010pll.1_Missense_Mutation_p.V365A|GPR161_uc010plm.1_Missense_Mutation_p.V341A|GPR161_uc009wvo.2_Missense_Mutation_p.V472A|GPR161_uc001gfd.2_Missense_Mutation_p.V455A|GPR161_uc010pln.1_Missense_Mutation_p.V475A	NM_153832	NP_722561	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161 isoform 2	455	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)					GGACTTGTGTACTTCAGCTTT	0.517													21	86	---	---	---	---	PASS
C1orf112	55732	broad.mit.edu	37	1	169773208	169773208	+	Intron	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169773208G>T	uc001ggp.2	+						C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggo.2_Intron|C1orf112_uc001ggq.2_Intron|C1orf112_uc009wvt.2_Intron|C1orf112_uc010plu.1_Intron|C1orf112_uc009wvu.1_Intron|C1orf112_uc001ggr.2_Intron|C1orf112_uc010plv.1_Intron	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTATTTATCCGTAATCAGAAT	0.323													42	99	---	---	---	---	PASS
SLC9A11	284525	broad.mit.edu	37	1	173516829	173516829	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173516829A>C	uc001giz.2	-	13	1979	c.1556T>G	c.(1555-1557)ATG>AGG	p.M519R	SLC9A11_uc009wwe.2_Missense_Mutation_p.M77R|SLC9A11_uc010pmq.1_RNA	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	519					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						AGCACCAACCATTTGTATTGC	0.358													39	119	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175292496	175292496	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175292496G>A	uc001gkp.1	-	21	4155	c.4074C>T	c.(4072-4074)TTC>TTT	p.F1358F	TNR_uc009wwu.1_Silent_p.F1358F	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1358					axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CCACTGCTCAGAACTGTAAGG	0.458													26	147	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181707532	181707532	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181707532G>A	uc001gow.2	+	24	3747	c.3582G>A	c.(3580-3582)ACG>ACA	p.T1194T	CACNA1E_uc009wxs.2_Silent_p.T1082T|CACNA1E_uc001gox.1_Silent_p.T420T|CACNA1E_uc009wxt.2_Silent_p.T420T	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1194	III.|Helical; Name=S2 of repeat III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						ATGTGTTCACGGGCGTGTTCA	0.473													105	376	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181767477	181767477	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181767477G>C	uc001gow.2	+	47	6485	c.6320G>C	c.(6319-6321)AGC>ACC	p.S2107T	CACNA1E_uc009wxs.2_Missense_Mutation_p.S1995T|CACNA1E_uc009wxt.2_Missense_Mutation_p.S1376T	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2150	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TCTGACACCAGCACCCCAAGA	0.592													51	147	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186315403	186315403	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186315403C>T	uc001grv.2	-	23	3257	c.2960G>A	c.(2959-2961)CGT>CAT	p.R987H		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	987	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AATATTCTTACGCACTTCTTC	0.308			T	NTRK1	papillary thyroid								15	114	---	---	---	---	PASS
PLA2G4A	5321	broad.mit.edu	37	1	186957614	186957614	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186957614G>C	uc001gsc.2	+	18	2429	c.2224G>C	c.(2224-2226)GAG>CAG	p.E742Q	PLA2G4A_uc010pos.1_Missense_Mutation_p.E682Q	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	742					phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	TTTCAACAAGGAGTTTCTAAG	0.388													21	200	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196398707	196398707	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196398707C>G	uc001gtd.1	-	9	879	c.819G>C	c.(817-819)CAG>CAC	p.Q273H	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.Q273H|KCNT2_uc001gtf.1_Missense_Mutation_p.Q273H|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Missense_Mutation_p.Q273H|KCNT2_uc009wyv.1_Missense_Mutation_p.Q248H	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	273	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TTTTGTTTACCTGTATGGGTA	0.378													15	109	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030095	197030095	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030095C>T	uc001gtt.1	-	4	606	c.562G>A	c.(562-564)GGA>AGA	p.G188R		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	188	Sushi 3.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TTCTTTCCTCCAGCTGTGTAG	0.398													35	109	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201193963	201193963	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201193963G>A	uc001gwc.2	+	10	2699	c.1927G>A	c.(1927-1929)GGG>AGG	p.G643R	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						GACCCTGCAGGGGAAGGAGGT	0.602													8	53	---	---	---	---	PASS
ADORA1	134	broad.mit.edu	37	1	203098306	203098306	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203098306C>T	uc001gze.1	+	3	770	c.337C>T	c.(337-339)CTC>TTC	p.L113F	ADORA1_uc001gzf.1_Missense_Mutation_p.L113F|ADORA1_uc010pqg.1_5'UTR|ADORA1_uc009xak.1_5'UTR|ADORA1_uc010pqh.1_Missense_Mutation_p.L146F	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	113	Cytoplasmic (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)	CAAGATCCCTCTCCGGTGAGT	0.582													10	155	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215777494	215777494	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215777494G>T	uc001hks.2	+	13	1453	c.1159G>T	c.(1159-1161)GAG>TAG	p.E387*	KCTD3_uc001hkt.2_Nonsense_Mutation_p.E387*|KCTD3_uc010pub.1_Nonsense_Mutation_p.E285*|KCTD3_uc009xdn.2_Nonsense_Mutation_p.E139*	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	387						voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TAACTGGATCGAGATCGCCTA	0.443													29	161	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215972274	215972274	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215972274T>A	uc001hku.1	-	50	10320	c.9933A>T	c.(9931-9933)GAA>GAT	p.E3311D		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3311	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACACCACTCCTTCTTCTCCAC	0.502										HNSCC(13;0.011)			71	175	---	---	---	---	PASS
ITPKB	3707	broad.mit.edu	37	1	226924302	226924302	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226924302C>G	uc010pvo.1	-	2	1198	c.858G>C	c.(856-858)CGG>CGC	p.R286R	ITPKB_uc001hqh.2_Silent_p.R286R	NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B	286							ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				CTAGGCAGCTCCGAGTTCCCG	0.582													38	98	---	---	---	---	PASS
RAB4A	5867	broad.mit.edu	37	1	229438704	229438704	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229438704G>T	uc001hth.2	+	7	845	c.637G>T	c.(637-639)GCT>TCT	p.A213S	RAB4A_uc001hti.2_RNA|RAB4A_uc001htj.2_RNA|SPHAR_uc001htk.3_5'Flank	NM_004578	NP_004569	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	208							GDP binding|GTP binding|GTPase activity			ovary(1)	1	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				GGCCCCGAACGCTCAGGAGTG	0.577													57	140	---	---	---	---	PASS
PGBD5	79605	broad.mit.edu	37	1	230472849	230472849	+	Intron	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230472849C>A	uc010pwb.1	-						PGBD5_uc001htv.2_Intron	NM_024554	NP_078830	Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CCCCACTTGACTAACCTTGCT	0.592													14	132	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230838938	230838938	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230838938G>T	uc001hty.3	-	5	1915	c.1407C>A	c.(1405-1407)GCC>GCA	p.A469A	AGT_uc009xfe.2_3'UTR|AGT_uc009xff.2_Silent_p.A441A	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	469					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	GCAGGGCAGTGGCGCTTTGAT	0.612													21	131	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870440	237870440	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870440C>A	uc001hyl.1	+	68	9892	c.9772C>A	c.(9772-9774)CCA>ACA	p.P3258T	RYR2_uc010pxz.1_Missense_Mutation_p.P213T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3258					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAGAACAATCCAGAACGGGC	0.473													14	94	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237897051	237897051	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237897051G>A	uc001hyl.1	+	79	11206	c.11086G>A	c.(11086-11088)GCA>ACA	p.A3696T	RYR2_uc010pya.1_Missense_Mutation_p.A92T	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3696					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGATATTATGGCAAAGGTAAA	0.333													24	76	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947095	237947095	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947095C>G	uc001hyl.1	+	90	12203	c.12083C>G	c.(12082-12084)TCG>TGG	p.S4028W	RYR2_uc010pya.1_Missense_Mutation_p.S443W	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4028	EF-hand.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATTTGACGTCGTCTGATACT	0.418													16	48	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247654673	247654673	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247654673C>A	uc001icz.1	+	1	244	c.244C>A	c.(244-246)CTG>ATG	p.L82M		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	82					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCCTCAGCTGCTGTGGAACCT	0.542													18	136	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26680977	26680977	+	3'UTR	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26680977C>A	uc002rhk.2	-	47					OTOF_uc010yla.1_Silent_p.G705G|OTOF_uc002rhh.2_3'UTR|OTOF_uc002rhi.2_3'UTR|OTOF_uc002rhj.2_Silent_p.G1208G	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a						cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACATGAGCAGCCCCAACAGCG	0.597													16	51	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32865348	32865348	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32865348G>T	uc002rom.2	+	4	639	c.408G>T	c.(406-408)CTG>CTT	p.L136L	TTC27_uc010ymx.1_Silent_p.L86L	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	136							protein binding			central_nervous_system(1)	1						TTAAAGGACTGGATGCATTTG	0.333													21	83	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54856314	54856314	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54856314G>T	uc002rxu.2	+	14	2292	c.2043G>T	c.(2041-2043)CGG>CGT	p.R681R	SPTBN1_uc002rxv.1_Silent_p.R681R|SPTBN1_uc002rxx.2_Silent_p.R668R	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	681	Spectrin 4.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			GCAAGCACCGGGCGTTCGAGG	0.597													19	66	---	---	---	---	PASS
PNPT1	87178	broad.mit.edu	37	2	55899142	55899142	+	Silent	SNP	G	A	A	rs149239772	byFrequency	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55899142G>A	uc002rzf.2	-	10	959	c.906C>T	c.(904-906)TAC>TAT	p.Y302Y	PNPT1_uc002rzg.2_RNA	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	302					mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGTCATGCTCGTAATCTGTAA	0.328													66	243	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631360	63631360	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631360G>C	uc002sch.2	-	10	1704	c.1258C>G	c.(1258-1260)CGC>GGC	p.R420G	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.R261G|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.R228G|C2orf86_uc002sci.1_Missense_Mutation_p.R396G|C2orf86_uc010fcr.1_Missense_Mutation_p.R310G	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	420					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						CTGGGTAAGCGGTCTTCAGCC	0.463													9	214	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80773066	80773066	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80773066C>G	uc010ysh.1	+	10	1423	c.1418C>G	c.(1417-1419)CCA>CGA	p.P473R	CTNNA2_uc010yse.1_Missense_Mutation_p.P473R|CTNNA2_uc010ysf.1_Missense_Mutation_p.P473R|CTNNA2_uc010ysg.1_Missense_Mutation_p.P473R|CTNNA2_uc010ysi.1_Missense_Mutation_p.P105R	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	473					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCTGCCCGGCCACAGAGCAAA	0.512													10	46	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98373570	98373570	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98373570C>T	uc002syh.3	-	41	5873	c.5644G>A	c.(5644-5646)GAG>AAG	p.E1882K	TMEM131_uc002syg.2_Missense_Mutation_p.E262K	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1882						integral to membrane				ovary(4)|central_nervous_system(2)	6						ATTTAATTCTCGTGAGGAAAG	0.468													17	53	---	---	---	---	PASS
MGAT4A	11320	broad.mit.edu	37	2	99294817	99294817	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99294817C>A	uc002sze.2	-	3	526	c.212G>T	c.(211-213)CGT>CTT	p.R71L	MGAT4A_uc010fil.2_5'UTR	NM_012214	NP_036346	Q9UM21	MGT4A_HUMAN	alpha-1,3-mannosyl-glycoprotein	71	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1						TGCTCCTACACGCTTGAACTG	0.323													42	193	---	---	---	---	PASS
TSGA10	80705	broad.mit.edu	37	2	99635067	99635067	+	Silent	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99635067A>G	uc002szg.3	-	17	2482	c.1854T>C	c.(1852-1854)AAT>AAC	p.N618N	TSGA10_uc002szh.3_Silent_p.N618N|TSGA10_uc002szi.3_Silent_p.N618N|TSGA10_uc010fin.1_Silent_p.N618N	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	618	Interaction with HIF1A (By similarity).				spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						GTGTGACAACATTTCTGAACT	0.373													23	81	---	---	---	---	PASS
ST6GAL2	84620	broad.mit.edu	37	2	107446702	107446702	+	Intron	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107446702G>A	uc002tdq.2	-						ST6GAL2_uc002tdr.2_Intron|ST6GAL2_uc002tds.3_Intron	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide						growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						TACCACTAAGGAAAAAAAAAT	0.418													34	152	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109103087	109103087	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109103087G>C	uc002tec.2	+	16	4067	c.3913G>C	c.(3913-3915)GAG>CAG	p.E1305Q	GCC2_uc002ted.2_Missense_Mutation_p.E1204Q	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1305	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						ACTACAGGAAGAGTGCCGTGC	0.527													18	73	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109379867	109379867	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109379867G>C	uc002tem.3	+	20	2998	c.2872G>C	c.(2872-2874)GGT>CGT	p.G958R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	958					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						ATCGCCCAGGGGTGATGATTA	0.458													37	144	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109380026	109380026	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109380026C>T	uc002tem.3	+	20	3157	c.3031C>T	c.(3031-3033)CCG>TCG	p.P1011S		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1011					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TCAGCCCATGCCGGGTGAAGG	0.393													5	302	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113513644	113513644	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113513644G>T	uc002tie.2	-	4	1383	c.1304C>A	c.(1303-1305)ACA>AAA	p.T435K	CKAP2L_uc002tif.2_Missense_Mutation_p.T24K|CKAP2L_uc010yxp.1_Missense_Mutation_p.T270K|CKAP2L_uc010yxq.1_Missense_Mutation_p.T270K	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	435						centrosome					0						TTTGGGAGCTGTCTTGTTCAG	0.408													134	466	---	---	---	---	PASS
PSD4	23550	broad.mit.edu	37	2	113940807	113940807	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113940807G>A	uc002tjc.2	+	2	957	c.774G>A	c.(772-774)GAG>GAA	p.E258E	PSD4_uc002tjd.2_5'UTR|PSD4_uc002tje.2_Silent_p.E257E|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	258					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CTTGCTCAGAGAACAGTGCTT	0.607													38	116	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125671848	125671848	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125671848C>G	uc002tno.2	+	24	4268	c.3904C>G	c.(3904-3906)CGG>GGG	p.R1302G	CNTNAP5_uc010flu.2_Missense_Mutation_p.R1303G	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1302	Cytoplasmic (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		CGAGTGTAAACGGGAATATTT	0.408													20	62	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152529183	152529183	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152529183C>A	uc010fnx.2	-	37	4190	c.3999G>T	c.(3997-3999)AAG>AAT	p.K1333N		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1333	Nebulin 33.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATAAGCTTCCTTGTATTTAT	0.438													44	124	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166188012	166188012	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166188012C>A	uc002udc.2	+	14	2612	c.2322C>A	c.(2320-2322)CTC>CTA	p.L774L	SCN2A_uc002udd.2_Silent_p.L774L|SCN2A_uc002ude.2_Silent_p.L774L	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	774	II.|Helical; Name=S1 of repeat II; (Potential).				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	TAAATACACTCTTCATGGCTA	0.453													58	172	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179431000	179431000	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179431000G>T	uc010zfg.1	-	275	72379	c.72155C>A	c.(72154-72156)CCA>CAA	p.P24052Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P17747Q|TTN_uc010zfi.1_Missense_Mutation_p.P17680Q|TTN_uc010zfj.1_Missense_Mutation_p.P17555Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24979							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCAGGCGTTGGACGACCTTT	0.418													6	410	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179641088	179641088	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179641088G>T	uc010zfg.1	-	28	5727	c.5503C>A	c.(5503-5505)CAG>AAG	p.Q1835K	TTN_uc010zfh.1_Missense_Mutation_p.Q1789K|TTN_uc010zfi.1_Missense_Mutation_p.Q1789K|TTN_uc010zfj.1_Missense_Mutation_p.Q1789K|TTN_uc002unb.2_Missense_Mutation_p.Q1835K|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1835							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCTTTCTGATCTGTTGTT	0.473													72	272	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202632082	202632082	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202632082C>T	uc002uyo.2	-	3	401	c.45G>A	c.(43-45)AAG>AAA	p.K15K	ALS2_uc002uyp.3_Silent_p.K15K|ALS2_uc002uyq.2_Silent_p.K15K|ALS2_uc002uyr.2_Silent_p.K15K	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	15					cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						GGCCTCTTTCCTTGGATCCTT	0.448													36	61	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202672269	202672269	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202672269G>T	uc002uyt.2	+	2	225	c.176G>T	c.(175-177)GGA>GTA	p.G59V	CDK15_uc010ftm.2_5'UTR|CDK15_uc002uys.2_Missense_Mutation_p.G8V|CDK15_uc010ftn.1_Missense_Mutation_p.G8V|CDK15_uc010fto.1_Missense_Mutation_p.G59V	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	59							ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	CACCCCAGGGGACTTCAAGCT	0.428													23	277	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	211018231	211018231	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018231T>C	uc002vds.2	-	2	1284	c.1076A>G	c.(1075-1077)AAA>AGA	p.K359R	C2orf67_uc002vdt.2_Missense_Mutation_p.K359R|C2orf67_uc002vdw.2_Missense_Mutation_p.K359R|C2orf67_uc002vdy.1_Missense_Mutation_p.K359R|C2orf67_uc002vdv.2_Missense_Mutation_p.K359R|C2orf67_uc002vdx.1_Missense_Mutation_p.K359R	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	359										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TGCCACATTTTTTCTAAGGGT	0.363													34	120	---	---	---	---	PASS
AQP12B	653437	broad.mit.edu	37	2	241621951	241621951	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241621951G>C	uc010fzj.2	-	1	367	c.304C>G	c.(304-306)CTC>GTC	p.L102V	AQP12B_uc002vzt.2_RNA	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B	90						integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		TCGGCCATGAGGAACTCCTGC	0.697													3	42	---	---	---	---	PASS
CAND2	23066	broad.mit.edu	37	3	12861610	12861610	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12861610C>T	uc003bxk.2	+	11	3019	c.2970C>T	c.(2968-2970)GTC>GTT	p.V990V	CAND2_uc003bxj.2_Silent_p.V897V	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	990	HEAT 21.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						GGAGCACCGTCATCACAGCGG	0.587													28	70	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38938695	38938695	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38938695T>C	uc011ays.1	-	14	2243	c.2044A>G	c.(2044-2046)AAA>GAA	p.K682E	SCN11A_uc010hhn.1_5'Flank	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	682	Helical; Voltage-sensor; Name=S4 of repeat II; (By similarity).|II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	GGCCAGGATTTGGCTAACTTG	0.408													20	51	---	---	---	---	PASS
CLEC3B	7123	broad.mit.edu	37	3	45077203	45077203	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45077203G>T	uc003cok.3	+	3	492	c.396G>T	c.(394-396)TGG>TGT	p.W132C	CLEC3B_uc003col.2_Missense_Mutation_p.W90C	NM_003278	NP_003269	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	132	C-type lectin.				skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCGAGATCTGGCTGGGCCTCA	0.677													6	49	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52361927	52361927	+	Silent	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52361927G>C	uc011bef.1	+	6	1029	c.768G>C	c.(766-768)CGG>CGC	p.R256R	DNAH1_uc003ddt.1_Silent_p.R256R	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	256	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTGACTGCCGGACTCCCAGAG	0.577													16	50	---	---	---	---	PASS
NEK4	6787	broad.mit.edu	37	3	52745830	52745830	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52745830C>T	uc003dfq.3	-	16	2678	c.2489G>A	c.(2488-2490)CGC>CAC	p.R830H	NEK4_uc011bej.1_Missense_Mutation_p.R741H	NM_003157	NP_003148	P51957	NEK4_HUMAN	NIMA-related kinase 4	830					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		TTTCAACTGGCGAGCTTTCAC	0.333													33	350	---	---	---	---	PASS
ARL13B	200894	broad.mit.edu	37	3	93722705	93722705	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93722705G>T	uc003drc.2	+	3	619	c.333G>T	c.(331-333)ATG>ATT	p.M111I	ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Missense_Mutation_p.M96I|ARL13B_uc003drf.2_Missense_Mutation_p.M111I|ARL13B_uc003drg.2_Missense_Mutation_p.M8I	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	111							GTP binding				0						AAGAGGCTATGTCAGAAATGC	0.403													23	183	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983540	97983540	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983540C>A	uc003dsi.1	+	1	412	c.412C>A	c.(412-414)CGC>AGC	p.R138S		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						GGCATATGATCGCTATGTAGC	0.373													37	282	---	---	---	---	PASS
NIT2	56954	broad.mit.edu	37	3	100067652	100067652	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100067652C>A	uc003dtv.2	+	7	585	c.511C>A	c.(511-513)CAG>AAG	p.Q171K	NIT2_uc011bha.1_Silent_p.A139A	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	171	CN hydrolase.				nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						CCAAGGCTGCCAGCTGTTGGT	0.488													19	100	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100471703	100471703	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100471703A>T	uc003dun.2	-	33	3002	c.2917T>A	c.(2917-2919)TAT>AAT	p.Y973N	ABI3BP_uc003duj.2_Missense_Mutation_p.Y553N|ABI3BP_uc003duk.2_Missense_Mutation_p.Y682N|ABI3BP_uc003dul.2_Missense_Mutation_p.Y803N|ABI3BP_uc011bhd.1_Missense_Mutation_p.Y927N|ABI3BP_uc003dum.2_Missense_Mutation_p.Y384N	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	973						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						AATTTTTTATACCATGTCCTT	0.423													42	191	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101384599	101384599	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101384599G>A	uc003dve.3	-	4	1062	c.832C>T	c.(832-834)CTA>TTA	p.L278L		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	278	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TCAAAACTTAGTACAGAAGTA	0.353													34	156	---	---	---	---	PASS
C3orf30	152405	broad.mit.edu	37	3	118865207	118865207	+	Silent	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118865207A>T	uc003ecb.1	+	1	211	c.171A>T	c.(169-171)CTA>CTT	p.L57L	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.L57L	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	57										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		AGACTGCCCTAAGAGTGCCTA	0.537													28	53	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	121975948	121975948	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121975948G>A	uc003eev.3	+	3	578	c.206G>A	c.(205-207)CGC>CAC	p.R69H	CASR_uc003eew.3_Missense_Mutation_p.R69H	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	69	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CGTGGGTTTCGCTGGTTACAG	0.373													5	230	---	---	---	---	PASS
EEFSEC	60678	broad.mit.edu	37	3	128060231	128060231	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128060231G>A	uc003eki.2	+	5	980	c.942G>A	c.(940-942)GCG>GCA	p.A314A	EEFSEC_uc003ekj.2_Silent_p.A259A	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,	314						cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						CTGTCCATGCGGCCCTCATCT	0.597													11	182	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129023455	129023455	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129023455C>G	uc003elt.2	+	7	940	c.852C>G	c.(850-852)AGC>AGG	p.S284R	C3orf37_uc003elu.2_Missense_Mutation_p.S242R|C3orf37_uc003elv.2_Missense_Mutation_p.S284R|C3orf37_uc003elw.2_Missense_Mutation_p.S284R	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	284										ovary(1)	1						GTGGCAGTAGCCAGAGGATGT	0.483													51	490	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128091	147128091	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128091C>T	uc003ewe.2	+	1	911	c.192C>T	c.(190-192)TTC>TTT	p.F64F		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	64					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGACGGCCTTCACGTCGCAGG	0.692													6	55	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164748556	164748556	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164748556C>T	uc003fei.2	-	25	2898	c.2836G>A	c.(2836-2838)GAT>AAT	p.D946N		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	946	Lumenal.|P-type 2.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AAATCTGCATCTGGATAACAA	0.328										HNSCC(35;0.089)			142	225	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164780150	164780150	+	Intron	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164780150G>T	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AAATAGACCTGAAACACACCT	0.333										HNSCC(35;0.089)			14	174	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164908581	164908581	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164908581C>A	uc003fej.3	-	2	482	c.38G>T	c.(37-39)AGG>ATG	p.R13M	SLITRK3_uc003fek.2_Missense_Mutation_p.R13M	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	13						integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						CCACAACATCCTTCCTCTGTG	0.398										HNSCC(40;0.11)			14	180	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169540063	169540063	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169540063C>T	uc003fgb.2	+	1	354	c.354C>T	c.(352-354)CAC>CAT	p.H118H		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	118	LRR 5.										0						GCTTCCTCCACGCCCTGCGCG	0.612													15	229	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170198095	170198095	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170198095G>A	uc003fgz.2	-	7	2292	c.1976C>T	c.(1975-1977)GCG>GTG	p.A659V	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	659	Helical; (Potential).					integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GCACCAGACCGCAAACCGGAT	0.498													5	415	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180327959	180327959	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180327959G>C	uc003fkk.2	+	12	2074	c.1942G>C	c.(1942-1944)GAA>CAA	p.E648Q	TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	648							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TAGGAGATTTGAAAAGGATAT	0.393													24	224	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182870216	182870216	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182870216A>G	uc003flh.3	-	3	1059	c.835T>C	c.(835-837)TCC>CCC	p.S279P		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	279	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			AGAAGGTTGGATTTTCGGGTG	0.468													53	552	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194147857	194147857	+	Silent	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194147857A>C	uc003fty.3	-	28	3474	c.3072T>G	c.(3070-3072)GGT>GGG	p.G1024G	ATP13A3_uc003ftx.3_5'Flank	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	1024					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		CCCAAAAAAAACCCAAAGATT	0.388													17	148	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47427824	47427824	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47427824G>T	uc003gxh.2	+	9	1588	c.1214G>T	c.(1213-1215)CGC>CTC	p.R405L	GABRB1_uc011bze.1_Missense_Mutation_p.R335L	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	405	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	ATCCAGTACCGCAAGCCCCTG	0.662													17	22	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48512145	48512145	+	Silent	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48512145G>C	uc003gyh.1	-	59	8930	c.8325C>G	c.(8323-8325)CTC>CTG	p.L2775L	FRYL_uc003gyf.1_Silent_p.L171L|FRYL_uc003gyg.1_Silent_p.L1471L	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2775					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						CACCAAACTTGAGTGTTTCCA	0.408													48	119	---	---	---	---	PASS
UGT2B11	10720	broad.mit.edu	37	4	70080107	70080107	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70080107C>G	uc003heh.2	-	1	343	c.334G>C	c.(334-336)GAA>CAA	p.E112Q	uc003hei.1_Intron	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,	112					estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						ATTTCTTGTTCTTGTGAAAAA	0.289													12	164	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73178143	73178143	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73178143C>A	uc003hgk.1	-	13	1823	c.1786G>T	c.(1786-1788)GAG>TAG	p.E596*	ADAMTS3_uc003hgl.2_5'Flank	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	596	TSP type-1 1.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGCTGGTACTCAAAATTAACA	0.428													4	148	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89326086	89326086	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89326086A>T	uc011cdi.1	+	9	1334	c.1151A>T	c.(1150-1152)CAG>CTG	p.Q384L	HERC6_uc011cdj.1_Missense_Mutation_p.Q384L|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	384					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		CGAATTAGCCAGTCCATGGCA	0.423													71	92	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102946555	102946555	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102946555G>A	uc003hvy.3	+	9	1757	c.1483G>A	c.(1483-1485)GAT>AAT	p.D495N	BANK1_uc003hvx.3_Missense_Mutation_p.D480N|BANK1_uc010ill.2_Missense_Mutation_p.D362N|BANK1_uc003hvz.3_Missense_Mutation_p.D465N	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	495					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCCTGGTGCTGATCCAGAAAA	0.502													13	104	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958642	121958642	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958642A>G	uc003idq.1	-	4	1011	c.484T>C	c.(484-486)TAT>CAT	p.Y162H		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	162											0						GTGGTGGCATATACTTTGAAA	0.448													95	150	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125590641	125590641	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125590641G>C	uc003ifg.3	-	3	4057	c.3791C>G	c.(3790-3792)TCA>TGA	p.S1264*	ANKRD50_uc011cgo.1_Nonsense_Mutation_p.S1085*|ANKRD50_uc010inw.2_Nonsense_Mutation_p.S1264*	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1264	Ser-rich.									central_nervous_system(1)	1						TGCTTTAGTTGACTTCAAACT	0.403													48	632	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072945	134072945	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072945C>A	uc003iha.2	+	1	2476	c.1650C>A	c.(1648-1650)AGC>AGA	p.S550R	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.S550R	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	550	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		ACGCTGGCAGCCCCCAGGCGC	0.587													25	138	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146824008	146824008	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146824008C>A	uc003ikn.2	-	2	451	c.403G>T	c.(403-405)GAT>TAT	p.D135Y	ZNF827_uc003ikm.2_Missense_Mutation_p.D135Y|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	135					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					GCTGCAGCATCGAGTTTGAGG	0.597													3	52	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146824215	146824215	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146824215A>T	uc003ikn.2	-	2	244	c.196T>A	c.(196-198)TCC>ACC	p.S66T	ZNF827_uc003ikm.2_Missense_Mutation_p.S66T|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	66					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					GTGTCCGGGGACGTGGACTGC	0.567													49	106	---	---	---	---	PASS
TLR2	7097	broad.mit.edu	37	4	154624198	154624198	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154624198C>T	uc003inq.2	+	3	358	c.139C>T	c.(139-141)CCC>TCC	p.P47S	TLR2_uc003inr.2_Missense_Mutation_p.P47S|TLR2_uc003ins.2_Missense_Mutation_p.P47S	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	47	Extracellular (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				AAACTCCATTCCCTCAGGGCT	0.498													4	208	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160244614	160244614	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160244614G>T	uc003iqg.3	+	5	821	c.511G>T	c.(511-513)GAC>TAC	p.D171Y		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	171	cNMP.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GGATTAGCTGGACTCCTGGTC	0.398													58	103	---	---	---	---	PASS
IRF2	3660	broad.mit.edu	37	4	185320124	185320124	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185320124C>T	uc003iwf.3	-	7	839	c.639G>A	c.(637-639)CCG>CCA	p.P213P		NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2	213					blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TCATGCTGACCGGCTGCTCGT	0.587													55	100	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5461158	5461158	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5461158G>T	uc003jdm.3	+	13	1933	c.1711G>T	c.(1711-1713)GAA>TAA	p.E571*		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	571										ovary(1)|central_nervous_system(1)	2						ACGAATTAATGAAATCACTTC	0.378													66	266	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5464055	5464055	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5464055G>A	uc003jdm.3	+	13	4830	c.4608G>A	c.(4606-4608)GCG>GCA	p.A1536A		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1536										ovary(1)|central_nervous_system(1)	2						AGATTGTTGCGTCTGATCACA	0.348													5	59	---	---	---	---	PASS
FAM134B	54463	broad.mit.edu	37	5	16477887	16477887	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16477887G>A	uc003jfs.2	-	8	922	c.884C>T	c.(883-885)ACG>ATG	p.T295M	FAM134B_uc003jfr.2_Missense_Mutation_p.T154M	NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1	295					sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						GGCAGCAACCGTGAGGCTAAT	0.413													6	198	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26906200	26906200	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26906200C>T	uc003jgs.1	-	5	848	c.679G>A	c.(679-681)GAA>AAA	p.E227K	CDH9_uc010iug.2_Missense_Mutation_p.E227K	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	227	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TCTCTATTTTCTCTGCTCATG	0.413													31	196	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38960533	38960533	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38960533G>A	uc003jlp.2	-	20	1842	c.1818C>T	c.(1816-1818)TGC>TGT	p.C606C	RICTOR_uc003jlo.2_Silent_p.C606C|RICTOR_uc010ivf.2_Silent_p.C321C	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	606					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTGTAAACTGGCAACCTACAA	0.398													25	204	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52365934	52365934	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52365934C>T	uc003joy.2	+						ITGA2_uc011cqa.1_Intron|ITGA2_uc011cqb.1_Intron|ITGA2_uc011cqc.1_Intron|ITGA2_uc011cqd.1_Intron|ITGA2_uc011cqe.1_Intron	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor						axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TTTTTTTTATCATAGCCATTG	0.328													20	91	---	---	---	---	PASS
GZMK	3003	broad.mit.edu	37	5	54320565	54320565	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54320565G>A	uc003jpl.1	+	2	186	c.142G>A	c.(142-144)GGA>AGA	p.G48R		NM_002104	NP_002095	P49863	GRAK_HUMAN	granzyme K precursor	48	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CCAGTATGGCGGACATCACGT	0.473													13	45	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65083989	65083989	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65083989G>C	uc003juf.2	+	8	1119	c.1003G>C	c.(1003-1005)GAG>CAG	p.E335Q	NLN_uc003jue.2_Missense_Mutation_p.E335Q|NLN_uc003jug.2_Missense_Mutation_p.E164Q|NLN_uc010iww.2_Missense_Mutation_p.E30Q	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	335					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		AGCAGAACGAGAGTTTATTTT	0.368													29	203	---	---	---	---	PASS
RAD17	5884	broad.mit.edu	37	5	68677865	68677865	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68677865C>T	uc003jwo.2	+	4	584	c.522C>T	c.(520-522)TTC>TTT	p.F174F	RAD17_uc003jwg.2_Silent_p.F163F|RAD17_uc003jwh.2_Silent_p.F163F|RAD17_uc003jwi.2_Silent_p.F163F|RAD17_uc003jwj.2_Silent_p.F163F|RAD17_uc003jwk.2_Silent_p.F163F|RAD17_uc003jwl.2_Silent_p.F163F|RAD17_uc003jwm.2_5'UTR|RAD17_uc003jwn.2_Silent_p.F77F	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2	174					cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		AAGATGATTTCAAGGGGATGT	0.388								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					11	142	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82837222	82837222	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82837222A>C	uc003kii.3	+	8	8756	c.8400A>C	c.(8398-8400)GAA>GAC	p.E2800D	VCAN_uc003kij.3_Missense_Mutation_p.E1813D|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.E1464D	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	2800	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ATGTGATGGAAGGATCCAATC	0.448													25	272	---	---	---	---	PASS
FAM174A	345757	broad.mit.edu	37	5	99871540	99871540	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99871540A>T	uc003knj.1	+	1	426	c.306A>T	c.(304-306)GAA>GAT	p.E102D	uc003kni.2_5'Flank	NM_198507	NP_940909	Q8TBP5	F174A_HUMAN	family with sequence similarity 174, member A	102	Extracellular (Potential).					integral to membrane					0						AGGCCGGGGAAGGCTCGGTGG	0.706													6	9	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101593694	101593694	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101593694A>G	uc003knm.2	-	7	1513	c.1226T>C	c.(1225-1227)ATA>ACA	p.I409T		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	409	Extracellular (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TTGATTTTCTATAAATTTAGG	0.289													11	145	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127782240	127782240	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127782240C>G	uc003kuu.2	-	7	1325	c.886G>C	c.(886-888)GTG>CTG	p.V296L	FBN2_uc003kuv.2_Missense_Mutation_p.V263L|FBN2_uc003kuw.3_Missense_Mutation_p.V296L|FBN2_uc003kux.1_Missense_Mutation_p.V296L	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	296	EGF-like 4; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AAAGAGCCCACTGTATTGATA	0.433													35	170	---	---	---	---	PASS
MATR3	9782	broad.mit.edu	37	5	138658546	138658546	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138658546G>T	uc003ldu.2	+	15	2465	c.2038G>T	c.(2038-2040)GAT>TAT	p.D680Y	MATR3_uc010jfb.2_Missense_Mutation_p.D680Y|MATR3_uc003ldt.2_Missense_Mutation_p.D342Y|MATR3_uc003ldw.2_Missense_Mutation_p.D680Y|MATR3_uc003ldx.2_Missense_Mutation_p.D680Y|MATR3_uc010jfc.2_Missense_Mutation_p.D680Y|MATR3_uc003ldy.2_Missense_Mutation_p.D357Y|MATR3_uc011czb.1_Missense_Mutation_p.D392Y|MATR3_uc003ldz.2_Missense_Mutation_p.D680Y|MATR3_uc003lea.2_Missense_Mutation_p.D680Y|MATR3_uc003leb.2_Missense_Mutation_p.D342Y|MATR3_uc003lec.2_Missense_Mutation_p.D357Y	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3	680						nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGACGAGACCGATCTTGCTAA	0.428													13	82	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139193192	139193192	+	Missense_Mutation	SNP	C	T	T	rs147042685	byFrequency	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139193192C>T	uc003leu.1	+	3	875	c.670C>T	c.(670-672)CGC>TGC	p.R224C		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	224					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCCTGCGGCGCTCCATCTC	0.662													4	33	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515035	140515035	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515035A>G	uc003liq.2	+	1	236	c.19A>G	c.(19-21)AAA>GAA	p.K7E		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	7					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCGCTAGCAAAAACGCCACA	0.463													8	132	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140778610	140778610	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140778610G>C	uc003lkf.1	+	1	916	c.916G>C	c.(916-918)GAA>CAA	p.E306Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Missense_Mutation_p.E306Q	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	306	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGGATTTTGAAGAGACCAA	0.373													24	241	---	---	---	---	PASS
LARS	51520	broad.mit.edu	37	5	145557152	145557152	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145557152C>T	uc003lnx.1	-	2	321	c.83G>A	c.(82-84)AGA>AAA	p.R28K	LARS_uc011dbq.1_Missense_Mutation_p.R28K|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Missense_Mutation_p.R28K	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	28					leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	CTCAAACACTCTCTCAGTATC	0.328													13	154	---	---	---	---	PASS
GFOD1	54438	broad.mit.edu	37	6	13365729	13365729	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13365729A>G	uc003nat.1	-	2	1084	c.419T>C	c.(418-420)GTG>GCG	p.V140A	GFOD1_uc003nas.1_Missense_Mutation_p.V37A	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	140						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			CGGCTCGCCCACGTAGCCCTC	0.652													10	20	---	---	---	---	PASS
HIST1H2BC	8347	broad.mit.edu	37	6	26123851	26123851	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26123851C>A	uc003ngk.3	-	1	304	c.282G>T	c.(280-282)GAG>GAT	p.E94D	HIST1H2BC_uc003ngl.2_Missense_Mutation_p.E94D|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	NM_003526	NP_003517	P62807	H2B1C_HUMAN	histone cluster 1, H2bc	94					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1						CCGTCTGGATCTCCCTGGAGG	0.597													49	108	---	---	---	---	PASS
OR10C1	442194	broad.mit.edu	37	6	29408320	29408320	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29408320C>A	uc011dlp.1	+	1	528	c.528C>A	c.(526-528)TTC>TTA	p.F176L	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCCGCAGTTCTTCTGTGAGA	0.592													108	162	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32026137	32026137	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32026137C>T	uc003nzl.2	-	22	7725	c.7523G>A	c.(7522-7524)AGC>AAC	p.S2508N		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2568					actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						TTCTGTAGGGCTGGGGGTCTC	0.587													6	33	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43400184	43400184	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400184C>A	uc003ouy.1	+	3	681	c.466C>A	c.(466-468)CAG>AAG	p.Q156K	ABCC10_uc003ouz.1_Missense_Mutation_p.Q113K	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	156						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GTGGCATTGCCAGCGAGGCAC	0.642													9	310	---	---	---	---	PASS
GPR110	266977	broad.mit.edu	37	6	46977837	46977837	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46977837T>C	uc003oyt.2	-	11	1533	c.1334A>G	c.(1333-1335)TAC>TGC	p.Y445C	GPR110_uc011dwl.1_Missense_Mutation_p.Y133C	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	445	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						CTGATAGCTGTAACCCCTTTT	0.443													53	164	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55113587	55113587	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55113587C>G	uc003pcl.2	+	2	689	c.374C>G	c.(373-375)TCC>TGC	p.S125C	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Missense_Mutation_p.S60C	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	125	Extracellular (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTTGGACAGTCCCTTTGCAAA	0.423													16	441	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55198628	55198628	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55198628C>A	uc003pcm.1	+	3	288	c.202C>A	c.(202-204)CTG>ATG	p.L68M		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	68	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATACTGTAACCTGAGTATCCA	0.348													31	243	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69653876	69653876	+	Silent	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69653876T>G	uc003pev.3	+	6	1633	c.1185T>G	c.(1183-1185)GCT>GCG	p.A395A	BAI3_uc010kak.2_Silent_p.A395A	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	395	Extracellular (Potential).|TSP type-1 2.				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GTAATATTGCTCTTTGCCCAG	0.418													17	163	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	70070787	70070787	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70070787C>T	uc003pev.3	+	29	4070	c.3622C>T	c.(3622-3624)CGA>TGA	p.R1208*	BAI3_uc010kak.2_Nonsense_Mutation_p.R1208*|BAI3_uc011dxx.1_Nonsense_Mutation_p.R414*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1208	Cytoplasmic (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				TGGTCCTTGCCGAGCAGCCAC	0.358													28	112	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87970021	87970021	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87970021C>G	uc003plm.3	+	8	6715	c.6674C>G	c.(6673-6675)TCT>TGT	p.S2225C		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2225	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAGTGTAAATCTTCATTTACT	0.378													29	227	---	---	---	---	PASS
C6orf165	154313	broad.mit.edu	37	6	88138405	88138405	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88138405G>T	uc003plv.2	+	9	1114	c.1022G>T	c.(1021-1023)GGT>GTT	p.G341V	C6orf165_uc003plw.2_Missense_Mutation_p.G153V|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.G341V	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	341										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ATTGTGGTTGGTGTCCTCAGT	0.408													57	263	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96034548	96034548	+	Missense_Mutation	SNP	G	T	T	rs144076192	byFrequency	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96034548G>T	uc003poo.1	+	2	373	c.233G>T	c.(232-234)AGT>ATT	p.S78I	MANEA_uc003pon.2_Missense_Mutation_p.S78I	NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	78	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AATTTAAAAAGTGTTGAAATC	0.328													60	183	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102307216	102307216	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102307216C>T	uc003pqp.3	+	10	1621	c.1372C>T	c.(1372-1374)CGA>TGA	p.R458*	GRIK2_uc003pqn.2_Nonsense_Mutation_p.R458*|GRIK2_uc003pqo.3_Nonsense_Mutation_p.R458*|GRIK2_uc010kcw.2_Nonsense_Mutation_p.R458*	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	458	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TGGTAATGATCGATTTGAAGG	0.363													8	119	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102483445	102483445	+	Intron	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102483445G>C	uc003pqp.3	+						GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	CCCATGGGTAGGTTATATGTC	0.423													13	190	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117241518	117241518	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117241518G>A	uc003pxm.2	+	12	1291	c.1228G>A	c.(1228-1230)GTG>ATG	p.V410M		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	410					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TAATTCTATGGTGTCTGATAT	0.408													54	368	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135507145	135507145	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135507145G>T	uc003qfc.2	+	2	327	c.128G>T	c.(127-129)TGG>TTG	p.W43L	MYB_uc003qfh.2_Missense_Mutation_p.W43L|MYB_uc003qfi.2_Missense_Mutation_p.W43L|MYB_uc010kgi.2_Missense_Mutation_p.W43L|MYB_uc003qfq.2_Missense_Mutation_p.W43L|MYB_uc010kgj.2_Missense_Mutation_p.W43L|MYB_uc003qfo.2_Missense_Mutation_p.W43L|MYB_uc003qfu.2_Missense_Mutation_p.W43L|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_5'UTR|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_5'UTR|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.W43L|MYB_uc003qgd.1_5'Flank	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	43	HTH myb-type 1.				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AAAACAAGGTGGACCCGGGAA	0.403			T	NFIB	adenoid cystic carcinoma								4	146	---	---	---	---	PASS
TXLNB	167838	broad.mit.edu	37	6	139581568	139581568	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139581568C>T	uc011eds.1	-	6	1054	c.889G>A	c.(889-891)GAC>AAC	p.D297N		NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta	297	Potential.					cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		AATATTTTGTCCAGATGCTAA	0.388													16	72	---	---	---	---	PASS
SASH1	23328	broad.mit.edu	37	6	148840988	148840988	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148840988G>T	uc003qme.1	+	10	1643	c.1168G>T	c.(1168-1170)GAG>TAG	p.E390*	SASH1_uc011eeb.1_Nonsense_Mutation_p.E151*	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	390							protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CTCCCTCACCGAGGGGGAGAT	0.572													5	24	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150005649	150005649	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150005649C>A	uc003qmu.1	-	4	1124	c.576G>T	c.(574-576)CCG>CCT	p.P192P	LATS1_uc010kif.1_Silent_p.P87P|LATS1_uc003qmv.1_Silent_p.P192P|LATS1_uc003qmw.2_Silent_p.P192P|LATS1_uc010kig.1_Silent_p.P87P	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	192					cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CTCCTAGTGGCGGGCCATGCC	0.448													22	84	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152770771	152770771	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152770771G>C	uc010kiw.2	-	28	4003	c.3401C>G	c.(3400-3402)TCT>TGT	p.S1134C	SYNE1_uc003qot.3_Missense_Mutation_p.S1141C|SYNE1_uc003qou.3_Missense_Mutation_p.S1134C|SYNE1_uc010kjb.1_Missense_Mutation_p.S1117C|SYNE1_uc003qow.2_Missense_Mutation_p.S429C|SYNE1_uc003qox.1_Missense_Mutation_p.S650C	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1134	HAT 2.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGAGAACTCAGAGAATCTGAA	0.373										HNSCC(10;0.0054)			33	99	---	---	---	---	PASS
SYTL3	94120	broad.mit.edu	37	6	159166633	159166633	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159166633G>A	uc003qrp.2	+	11	1221	c.977G>A	c.(976-978)TGC>TAC	p.C326Y	SYTL3_uc011efp.1_Missense_Mutation_p.C326Y|SYTL3_uc003qro.2_Missense_Mutation_p.C258Y|SYTL3_uc003qrq.2_Missense_Mutation_p.C258Y|SYTL3_uc003qrr.2_Missense_Mutation_p.C326Y|SYTL3_uc003qrs.2_Missense_Mutation_p.C258Y|SYTL3_uc011efq.1_Missense_Mutation_p.C52Y	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	326	C2 1.				intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TTAGAAATATGCATCAAGGCC	0.328													8	87	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160543159	160543159	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160543159G>T	uc003qtc.2	+	1	297	c.192G>T	c.(190-192)TGG>TGT	p.W64C	SLC22A1_uc003qtd.2_Missense_Mutation_p.W64C	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	64	Extracellular (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		GCTGTGGCTGGAGCCCTGCGG	0.642													36	136	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2041689	2041689	+	Intron	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2041689G>A	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CCACTCCCGCGTCTGACTCAC	0.627													8	339	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5391596	5391596	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5391596G>A	uc003soi.3	-	17	5673	c.5324C>T	c.(5323-5325)CCC>CTC	p.P1775L	TNRC18_uc003soj.2_Missense_Mutation_p.P157L	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1775							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGTCAGCTTGGGGCCACCAGC	0.647													13	50	---	---	---	---	PASS
TWISTNB	221830	broad.mit.edu	37	7	19748468	19748468	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19748468C>A	uc003sup.1	-	1	193	c.172G>T	c.(172-174)GCG>TCG	p.A58S		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	58						microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1						GGCGACAGCGCGATGTGCCTT	0.592											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	49	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21751351	21751351	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21751351G>A	uc003svc.2	+	43	6908	c.6877G>A	c.(6877-6879)GAG>AAG	p.E2293K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2293	AAA 2 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CGCCAGCAATGAGCGCATTGC	0.522									Kartagener_syndrome				7	175	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	37172782	37172782	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37172782C>T	uc003tfk.1	-	14	1451	c.1144G>A	c.(1144-1146)GAC>AAC	p.D382N	ELMO1_uc011kbc.1_Missense_Mutation_p.D286N|ELMO1_uc010kxg.1_Missense_Mutation_p.D382N	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	382	ELMO.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						AGCATGTTGTCCAGAGCCAAC	0.448													11	109	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41729898	41729898	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41729898C>A	uc003thq.2	-	2	866	c.631G>T	c.(631-633)GTA>TTA	p.V211L	INHBA_uc003thr.2_Missense_Mutation_p.V211L	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	211					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						CGAGCGTCTACTACTTTTTCA	0.592										TSP Lung(11;0.080)			33	72	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43283525	43283525	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43283525T>A	uc003tid.1	+	3	626	c.21T>A	c.(19-21)AGT>AGA	p.S7R	HECW1_uc011kbi.1_Missense_Mutation_p.S7R|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	7					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						ACCTGTGTAGTGTGAAGGTCA	0.463													5	171	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44687346	44687346	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44687346A>C	uc003tln.2	+	4	614	c.505A>C	c.(505-507)ACA>CCA	p.T169P	OGDH_uc003tlm.2_Missense_Mutation_p.T169P|OGDH_uc011kbx.1_Intron|OGDH_uc011kby.1_Intron|OGDH_uc003tlp.2_Intron|OGDH_uc011kbz.1_Silent_p.P15P|OGDH_uc003tlo.1_5'UTR	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	169					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	TATCTCATCCACAGACAAACT	0.577													34	106	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64168413	64168413	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64168413G>A	uc003ttd.2	+	7	2517	c.1731G>A	c.(1729-1731)GAG>GAA	p.E577E	ZNF107_uc003tte.2_Silent_p.E577E	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	577					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				ATACTGGAGAGAACCTCTACA	0.338													6	197	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72409131	72409131	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72409131C>G	uc003twk.2	+	6	1278	c.1278C>G	c.(1276-1278)CTC>CTG	p.L426L	POM121_uc003twj.2_Silent_p.L161L|POM121_uc010lam.1_Silent_p.L161L	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	426	Ser-rich.|Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				ATTTTTAGCTCTGGAAGAGAA	0.473													71	231	---	---	---	---	PASS
TRIM74	378108	broad.mit.edu	37	7	75034322	75034322	+	Silent	SNP	C	T	T	rs150021451		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75034322C>T	uc003udc.1	+	4	896	c.696C>T	c.(694-696)TTC>TTT	p.F232F	TRIM74_uc010ldc.2_Silent_p.F232F|TRIM74_uc010ldd.2_Silent_p.F232F	NM_198924	NP_944606	Q86UV6	TRI74_HUMAN	tripartite motif-containing 73	232	Potential.					intracellular	zinc ion binding				0						TGGAACAGTTCGGCAATGAGG	0.657													4	163	---	---	---	---	PASS
STEAP1	26872	broad.mit.edu	37	7	89793811	89793811	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89793811C>T	uc003ujx.2	+	5	983	c.783C>T	c.(781-783)TCC>TCT	p.S261S		NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	261	Ferric oxidoreductase.|Helical; (Potential).				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)					GAATTGTTTCCCTTCTACTGG	0.368													39	378	---	---	---	---	PASS
PDK4	5166	broad.mit.edu	37	7	95223028	95223028	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95223028G>T	uc003uoa.2	-	3	647	c.327C>A	c.(325-327)GAC>GAA	p.D109E	PDK4_uc003unz.2_5'Flank	NM_002612	NP_002603	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase 4 precursor	109					glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity				0	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			ATGCTTTCTGGTCATCTGGGC	0.323													29	175	---	---	---	---	PASS
MEPCE	56257	broad.mit.edu	37	7	100028427	100028427	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100028427G>A	uc003uuw.2	+	1	899	c.786G>A	c.(784-786)CGG>CGA	p.R262R	ZCWPW1_uc003uut.2_5'Flank|ZCWPW1_uc011kjr.1_5'Flank|ZCWPW1_uc003uuu.1_5'Flank|ZCWPW1_uc011kjt.1_5'Flank|ZCWPW1_uc011kju.1_5'Flank|MEPCE_uc003uuv.2_5'UTR	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN	bin3, bicoid-interacting 3	262							methyltransferase activity			upper_aerodigestive_tract(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCGGAAGCGGCATAGACACC	0.597													5	345	---	---	---	---	PASS
ACHE	43	broad.mit.edu	37	7	100490047	100490047	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100490047C>G	uc003uxd.2	-	2	1617	c.1461G>C	c.(1459-1461)GGG>GGC	p.G487G	UFSP1_uc003uxc.3_5'Flank|ACHE_uc003uxe.2_Silent_p.G487G|ACHE_uc003uxf.2_Silent_p.G487G|ACHE_uc003uxg.2_Silent_p.G487G|ACHE_uc003uxh.2_Silent_p.G399G|ACHE_uc003uxi.2_Silent_p.G487G	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	487					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	CCAGGGGGATCCCAAAGATGA	0.607													21	71	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103191681	103191681	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103191681C>G	uc003vca.2	-	41	6295	c.6135G>C	c.(6133-6135)AGG>AGC	p.R2045S	RELN_uc010liz.2_Missense_Mutation_p.R2045S	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2045	BNR 9.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCCCGAAGTCCCTTGAAAATT	0.537													11	85	---	---	---	---	PASS
SYPL1	6856	broad.mit.edu	37	7	105733500	105733500	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105733500T>C	uc003vdp.2	-	5	622	c.540A>G	c.(538-540)ATA>ATG	p.I180M	SYPL1_uc003vdo.2_Missense_Mutation_p.I162M	NM_006754	NP_006745	Q16563	SYPL1_HUMAN	synaptophysin-like 1 isoform a	180	Vesicular (Potential).|MARVEL.				synaptic transmission	cytoplasmic vesicle membrane|integral to plasma membrane|melanosome|synaptic vesicle	transporter activity				0						GACCAGTAGCTATTTTAATAT	0.398													24	43	---	---	---	---	PASS
FEZF1	389549	broad.mit.edu	37	7	121942175	121942175	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121942175C>G	uc003vkd.2	-	4	1378	c.1304G>C	c.(1303-1305)GGC>GCC	p.G435A	FEZF1_uc003vkc.2_Missense_Mutation_p.G385A|uc010lko.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1	435	Pro-rich.				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						GCCTGGTTCGCCAGCTGGCGT	0.373													6	49	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122763268	122763268	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122763268A>G	uc003vkm.2	-	12	1287	c.1262T>C	c.(1261-1263)CTG>CCG	p.L421P	SLC13A1_uc010lks.2_Missense_Mutation_p.L297P	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	421						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	CCAAGTAATCAGTGGAGAGTA	0.398													52	186	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126249443	126249443	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126249443G>T	uc003vlr.2	-	7	1778	c.1467C>A	c.(1465-1467)GGC>GGA	p.G489G	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.G489G|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	489	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TGGTCCAGTGGCCGATGACTT	0.378										HNSCC(24;0.065)			61	265	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129103874	129103874	+	Intron	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129103874C>G	uc011koy.1	+						FAM40B_uc003vow.2_Intron|FAM40B_uc011koz.1_Intron	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a												0						TCTTTATTTTCTACTTCTCAG	0.438													3	91	---	---	---	---	PASS
TMEM140	55281	broad.mit.edu	37	7	134849492	134849492	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849492C>T	uc003vsi.2	+	2	580	c.299C>T	c.(298-300)CCT>CTT	p.P100L	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	100	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)	1						GCCCCCCAGCCTCTCCTCCTA	0.682													4	140	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142625776	142625776	+	Intron	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142625776C>A	uc003wby.1	-						TRPV5_uc003wbz.2_Intron	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,						protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					GGATGGGGAGCGTCTCTTACC	0.557													8	25	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149510794	149510794	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149510794T>C	uc010lpk.2	+	72	10079	c.10079T>C	c.(10078-10080)GTG>GCG	p.V3360A		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	3360	TIL 5.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCATCTGCGTGCAGCCGGGT	0.682													7	32	---	---	---	---	PASS
GIMAP5	55340	broad.mit.edu	37	7	150439684	150439684	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150439684A>G	uc003whr.1	+	3	809	c.457A>G	c.(457-459)AAA>GAA	p.K153E	GIMAP5_uc010lpu.2_Missense_Mutation_p.K11E	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	153	Cytoplasmic (Potential).|GTP (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTTCACCCACAAAGAGGACTT	0.562													63	188	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10465650	10465650	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10465650G>A	uc003wtc.2	-	4	6187	c.5958C>T	c.(5956-5958)ACC>ACT	p.T1986T		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1986					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CTGCCTCCTGGGTCTCCACTT	0.587													117	353	---	---	---	---	PASS
ATP6V1B2	526	broad.mit.edu	37	8	20055041	20055041	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20055041C>T	uc003wzp.2	+	1	338	c.124C>T	c.(124-126)CAG>TAG	p.Q42*		NM_001693	NP_001684	P21281	VATB2_HUMAN	vacuolar H+ATPase B2	42					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)		CTACCTCTCCCAGCCTCGCCT	0.647													4	16	---	---	---	---	PASS
TNFRSF10D	8793	broad.mit.edu	37	8	23003215	23003215	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23003215C>T	uc003xcz.1	-	5	794	c.702G>A	c.(700-702)AAG>AAA	p.K234K		NM_003840	NP_003831	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily,	234	Cytoplasmic (Potential).				anti-apoptosis|apoptosis	integral to membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		AAATGAATTTCTTCCGACATG	0.517													12	89	---	---	---	---	PASS
FZD3	7976	broad.mit.edu	37	8	28385506	28385506	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28385506A>G	uc003xgx.2	+	5	1707	c.1229A>G	c.(1228-1230)AAC>AGC	p.N410S	FZD3_uc010lvb.2_Missense_Mutation_p.N410S	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	410	Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		GAAAAGGAGAACCAAGATAAA	0.408													40	256	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505475	32505475	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505475C>T	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Missense_Mutation_p.P80L|NRG1_uc010lvt.2_Missense_Mutation_p.P80L	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TGCATTGTCCCCATCCTGGCT	0.567													18	172	---	---	---	---	PASS
FGFR1	2260	broad.mit.edu	37	8	38271765	38271765	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38271765G>A	uc003xlp.2	-	17	3033	c.2091C>T	c.(2089-2091)GGC>GGT	p.G697G	FGFR1_uc010lwf.2_RNA|FGFR1_uc011lbo.1_Silent_p.G695G|FGFR1_uc011lbp.1_Silent_p.G608G|FGFR1_uc011lbq.1_Silent_p.G606G|FGFR1_uc010lwk.2_Silent_p.G687G	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	697	Cytoplasmic (Potential).|Protein kinase.				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	ATGGGGAGCCGCCCAGAGTGA	0.607		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						6	94	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38871541	38871541	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38871541C>G	uc003xmr.2	+	4	390	c.312C>G	c.(310-312)ATC>ATG	p.I104M	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xmo.1_Missense_Mutation_p.I104M|ADAM9_uc003xmp.2_Missense_Mutation_p.I104M	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	104	Extracellular (Potential).			Missing (in Ref. 2; no nucleotide entry).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GGACTTTAATCACTGACCATC	0.308													6	230	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53030906	53030906	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53030906G>T	uc003xqz.2	-	19	3007	c.2851C>A	c.(2851-2853)CAG>AAG	p.Q951K	ST18_uc011ldq.1_Missense_Mutation_p.Q598K|ST18_uc011ldr.1_Missense_Mutation_p.Q916K|ST18_uc011lds.1_Missense_Mutation_p.Q856K|ST18_uc003xra.2_Missense_Mutation_p.Q951K	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	951	Potential.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ACCTGGGTCTGAAGTTTCATC	0.294													36	128	---	---	---	---	PASS
NPBWR1	2831	broad.mit.edu	37	8	53852526	53852526	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53852526C>A	uc011ldu.1	+	1	59	c.59C>A	c.(58-60)GCG>GAG	p.A20E		NM_005285	NP_005276	P48145	NPBW1_HUMAN	G protein-coupled receptor 7	20	Extracellular (Potential).				synaptic transmission	plasma membrane	opioid receptor activity|protein binding			ovary(2)|breast(1)	3		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				CCGGACCCGGCGCTGAGCTGC	0.716													14	28	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55534012	55534012	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55534012C>A	uc003xsd.1	+	2	634	c.486C>A	c.(484-486)GGC>GGA	p.G162G	RP1_uc011ldy.1_Silent_p.G162G	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	162	Doublecortin 2.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TCAGGAATGGCGACCCGAAGA	0.667													37	147	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55534051	55534051	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55534051G>T	uc003xsd.1	+	2	673	c.525G>T	c.(523-525)AGG>AGT	p.R175S	RP1_uc011ldy.1_Missense_Mutation_p.R175S	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	175	Doublecortin 2.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGAGCAGGAGGGTCACCCAGA	0.632													51	222	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618581	77618581	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618581G>T	uc003yav.2	+	2	2645	c.2258G>T	c.(2257-2259)TGC>TTC	p.C753F	ZFHX4_uc003yat.1_Missense_Mutation_p.C753F|ZFHX4_uc003yau.1_Missense_Mutation_p.C753F|ZFHX4_uc003yaw.1_Missense_Mutation_p.C753F	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	753						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTCAGTGGCTGCGGAACACCC	0.527										HNSCC(33;0.089)			15	54	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885255	88885255	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885255G>T	uc003ydz.2	-	1	1042	c.945C>A	c.(943-945)TCC>TCA	p.S315S		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	315	WD 2.									ovary(1)	1						GTAGGTAGGCGGAGTTATTCA	0.542													28	114	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885614	88885614	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885614C>A	uc003ydz.2	-	1	683	c.586G>T	c.(586-588)GCG>TCG	p.A196S		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	196										ovary(1)	1						GAGTGATACGCGTGGATGCTC	0.557													55	212	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	92998408	92998408	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92998408C>A	uc003yfd.2	-	8	1307	c.1223G>T	c.(1222-1224)AGT>ATT	p.S408I	RUNX1T1_uc003yfc.1_Missense_Mutation_p.S381I|RUNX1T1_uc003yfe.1_Missense_Mutation_p.S371I|RUNX1T1_uc010mao.2_Missense_Mutation_p.S381I|RUNX1T1_uc011lgi.1_Missense_Mutation_p.S419I|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Missense_Mutation_p.S371I	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	408	Poly-Ser.				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCTGCTGCTACTGCCGCCACC	0.498													49	127	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97316381	97316381	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97316381G>C	uc003yht.1	+	7	968	c.866G>C	c.(865-867)GGA>GCA	p.G289A	PTDSS1_uc003yhu.1_Missense_Mutation_p.G143A	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	289	Helical; (Potential).				phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	AGAGTAGCTGGAGTGTACCTT	0.413													34	456	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97321823	97321823	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97321823G>A	uc003yht.1	+	9	1148	c.1046G>A	c.(1045-1047)CGC>CAC	p.R349H	PTDSS1_uc003yhu.1_Missense_Mutation_p.R203H	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	349					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CAGTGCAAGCGCGTAGGAACA	0.428													7	122	---	---	---	---	PASS
OSR2	116039	broad.mit.edu	37	8	99961829	99961829	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99961829G>C	uc003yir.2	+	2	1184	c.649G>C	c.(649-651)GAT>CAT	p.D217H	OSR2_uc010mbn.2_Missense_Mutation_p.D217H|OSR2_uc003yiq.2_Missense_Mutation_p.D217H|OSR2_uc011lgx.1_Missense_Mutation_p.D338H	NM_001142462	NP_001135934	Q8N2R0	OSR2_HUMAN	odd-skipped related 2 isoform a	217	C2H2-type 2.				bone morphogenesis|chondrocyte differentiation|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic leg joint morphogenesis|embryonic skeletal joint morphogenesis|eyelid development in camera-type eye|head development|mesonephros development|metanephros development|middle ear morphogenesis|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|osteoblast proliferation|palate development|positive regulation of bone mineralization|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|zinc ion binding			central_nervous_system(1)	1	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			TCACCTGCGGGATCACAGGTG	0.547													42	100	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100880532	100880532	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100880532T>C	uc003yiv.2	+	59	11417	c.11306T>C	c.(11305-11307)ATA>ACA	p.I3769T	VPS13B_uc003yiw.2_Missense_Mutation_p.I3744T	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3769					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATTGCTGGTATAGTTGATCAG	0.478													23	65	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113301694	113301694	+	Silent	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113301694A>C	uc003ynu.2	-	57	9207	c.9048T>G	c.(9046-9048)ACT>ACG	p.T3016T	CSMD3_uc003yns.2_Silent_p.T2218T|CSMD3_uc003ynt.2_Silent_p.T2976T|CSMD3_uc011lhx.1_Silent_p.T2847T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3016	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AATAGTGAACAGTAGACCCAA	0.433										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			40	136	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113323377	113323377	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323377G>C	uc003ynu.2	-	50	7874	c.7715C>G	c.(7714-7716)CCA>CGA	p.P2572R	CSMD3_uc003yns.2_Missense_Mutation_p.P1774R|CSMD3_uc003ynt.2_Missense_Mutation_p.P2532R|CSMD3_uc011lhx.1_Missense_Mutation_p.P2468R|CSMD3_uc003ynw.1_Missense_Mutation_p.P283R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2572	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGGGGATTCTGGTGTACTACA	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			19	152	---	---	---	---	PASS
SHARPIN	81858	broad.mit.edu	37	8	145154057	145154057	+	Missense_Mutation	SNP	C	T	T	rs61732529		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145154057C>T	uc003zba.2	-	7	1458	c.974G>A	c.(973-975)CGC>CAC	p.R325H	SHARPIN_uc003zbb.2_Intron	NM_030974	NP_112236	Q9H0F6	SHRPN_HUMAN	shank-interacting protein-like 1	325					negative regulation of inflammatory response|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein linear polyubiquitination|regulation of CD40 signaling pathway|regulation of tumor necrosis factor-mediated signaling pathway	cytosol|LUBAC complex	polyubiquitin binding|zinc ion binding			ovary(1)	1	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGAAACAAGCGTCCAAGTTC	0.682													9	50	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15920371	15920371	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15920371A>G	uc003zmd.2	+	25	4019	c.3704A>G	c.(3703-3705)AAA>AGA	p.K1235R	C9orf93_uc003zme.2_Missense_Mutation_p.K1150R|C9orf93_uc011lmu.1_Missense_Mutation_p.K1243R	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	1235	Potential.										0				GBM - Glioblastoma multiforme(50;4.84e-07)		GCAGCCTTGAAATCAGAACTT	0.348													57	101	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20717842	20717842	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20717842A>T	uc003zog.1	+	5	470	c.107A>T	c.(106-108)GAA>GTA	p.E36V		NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	36						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		ggtttttcAGAAAAGATTCAC	0.279													45	74	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84608130	84608130	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84608130G>T	uc004amn.2	+	4	2792	c.2745G>T	c.(2743-2745)CTG>CTT	p.L915L		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	915						integral to membrane					0						TGAGGATGCTGTGGGGCCTTC	0.458													7	110	---	---	---	---	PASS
CENPP	401541	broad.mit.edu	37	9	95094618	95094618	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95094618G>A	uc004arz.2	+	2	814	c.274G>A	c.(274-276)GAG>AAG	p.E92K	CENPP_uc010mqx.2_Intron|CENPP_uc004ary.1_Missense_Mutation_p.E92K	NM_001012267	NP_001012267	Q6IPU0	CENPP_HUMAN	centromere protein P	92					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2						AACAAGCACTGAGATGACAGA	0.323													36	52	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99581238	99581238	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99581238T>A	uc004awp.1	-	6	1348	c.1067A>T	c.(1066-1068)CAT>CTT	p.H356L	ZNF782_uc011lup.1_Missense_Mutation_p.H224L	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	356	C2H2-type 3; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				AACCTTCTGATGTACACTGAA	0.413													5	482	---	---	---	---	PASS
NIPSNAP3A	25934	broad.mit.edu	37	9	107513369	107513369	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107513369G>C	uc004bch.1	+	2	298	c.193G>C	c.(193-195)GCT>CCT	p.A65P	NIPSNAP3A_uc011lvt.1_Missense_Mutation_p.A65P|NIPSNAP3A_uc011lvu.1_Missense_Mutation_p.A65P	NM_015469	NP_056284	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A	65						cytosol					0						TCTTCGGACAGCTCACTCTGA	0.368													29	345	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112172595	112172595	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112172595C>T	uc004bed.2	-	15	1526	c.1414G>A	c.(1414-1416)GGC>AGC	p.G472S	PTPN3_uc004beb.2_Missense_Mutation_p.G341S|PTPN3_uc004bec.2_Missense_Mutation_p.G296S|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Missense_Mutation_p.G427S|PTPN3_uc011lwh.1_Missense_Mutation_p.G318S|PTPN3_uc011lwd.1_5'UTR|PTPN3_uc011lwe.1_Missense_Mutation_p.G185S|PTPN3_uc011lwf.1_Missense_Mutation_p.G140S	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	472					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TGATCAACGCCGTCAGGTGAG	0.552													26	241	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113220768	113220768	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113220768G>T	uc010mtz.2	-	20	3896	c.3559C>A	c.(3559-3561)CAT>AAT	p.H1187N	SVEP1_uc010mua.1_Missense_Mutation_p.H1187N	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1187					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CTGATTTCATGCCTCTTTTTA	0.398													12	25	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119204776	119204776	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119204776G>A	uc004bjs.1	-	21	3655	c.3554C>T	c.(3553-3555)ACC>ATC	p.T1185I	ASTN2_uc004bjr.1_Missense_Mutation_p.T1181I|ASTN2_uc004bjt.1_Missense_Mutation_p.T1134I|ASTN2_uc004bjp.1_Missense_Mutation_p.T278I|ASTN2_uc004bjq.1_Missense_Mutation_p.T237I|ASTN2_uc011lxr.1_Missense_Mutation_p.T237I|ASTN2_uc011lxs.1_Missense_Mutation_p.T237I|ASTN2_uc011lxt.1_Missense_Mutation_p.T237I|ASTN2_uc004bjo.1_5'UTR	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	1185	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CGTCCTCAGGGTCACCGTGCT	0.507													16	232	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475354	120475354	+	Silent	SNP	G	T	T	rs150022134		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475354G>T	uc004bjz.2	+	3	1239	c.948G>T	c.(946-948)GTG>GTT	p.V316V	TLR4_uc004bka.2_Silent_p.V276V|TLR4_uc004bkb.2_Silent_p.V116V	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	316	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TTTCCCTGGTGAGTGTGACTA	0.323													10	251	---	---	---	---	PASS
WDR34	89891	broad.mit.edu	37	9	131396538	131396538	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131396538G>A	uc004bvq.1	-	8	1463	c.1339C>T	c.(1339-1341)CGG>TGG	p.R447W	WDR34_uc004bvs.1_Missense_Mutation_p.R438W|WDR34_uc004bvr.1_Missense_Mutation_p.R419W	NM_052844	NP_443076	Q96EX3	WDR34_HUMAN	WD repeat domain 34	447	WD 4.					cytoplasm				central_nervous_system(2)|skin(1)	3						ACCAAGGGCCGCACTGGGGAC	0.607													11	143	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137655544	137655544	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137655544C>T	uc004cfe.2	+	20	2377	c.1995C>T	c.(1993-1995)GAC>GAT	p.D665D		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	665	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TGCAGGGTGACGACGGAGAAG	0.592													13	183	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5979143	5979143	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5979143C>A	uc001iis.2	+	21	3127	c.3032C>A	c.(3031-3033)GCG>GAG	p.A1011E	FBXO18_uc001iir.2_Missense_Mutation_p.A954E|FBXO18_uc009xig.2_Missense_Mutation_p.A937E|FBXO18_uc001iit.2_Missense_Mutation_p.A1062E	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	1011					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						GGGCCCCTGGCGTTCCTGACA	0.622													5	38	---	---	---	---	PASS
IL2RA	3559	broad.mit.edu	37	10	6061910	6061910	+	Intron	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6061910G>T	uc001iiz.1	-						IL2RA_uc009xih.1_Intron|IL2RA_uc001ija.1_Intron	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor						cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TTCACCTGGGGGAGAGAGTAA	0.637													17	84	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15688894	15688894	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15688894G>T	uc001ioc.1	-	12	1158	c.1158C>A	c.(1156-1158)TTC>TTA	p.F386L	ITGA8_uc010qcb.1_Missense_Mutation_p.F371L	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	386	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						TAGCACTACCGAATCTCCCAA	0.478													21	73	---	---	---	---	PASS
MRC1	4360	broad.mit.edu	37	10	17905647	17905647	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17905647A>G	uc001ipk.2	+	11	1841	c.1738A>G	c.(1738-1740)ATC>GTC	p.I580V		NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor	580	C-type lectin 3.|Extracellular (Potential).				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						TCAGTGGACCATCGAGGAAGA	0.453													25	165	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21134270	21134270	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21134270C>G	uc001iqi.2	-	12	1541	c.1144G>C	c.(1144-1146)GAG>CAG	p.E382Q	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	382	Nebulin 10.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CCTTTAATCTCCTTCTCAAAA	0.343													19	104	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25701259	25701259	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25701259G>A	uc001isj.2	+	4	1252	c.1192G>A	c.(1192-1194)GGC>AGC	p.G398S		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	398	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						TTGCAGGGAGGGCTGCCCCTT	0.488													48	298	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31809823	31809823	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31809823A>C	uc001ivs.3	+	7	1623	c.1560A>C	c.(1558-1560)AAA>AAC	p.K520N	ZEB1_uc001ivr.3_Missense_Mutation_p.K302N|ZEB1_uc010qee.1_Missense_Mutation_p.K302N|ZEB1_uc010qef.1_Missense_Mutation_p.K302N|ZEB1_uc009xlj.1_Missense_Mutation_p.K446N|ZEB1_uc010qeg.1_Missense_Mutation_p.K379N|ZEB1_uc009xlk.1_Missense_Mutation_p.K302N|ZEB1_uc001ivt.3_Missense_Mutation_p.K302N|ZEB1_uc001ivu.3_Missense_Mutation_p.K521N|ZEB1_uc001ivv.3_Missense_Mutation_p.K500N|ZEB1_uc010qeh.1_Missense_Mutation_p.K453N|ZEB1_uc009xlo.1_Missense_Mutation_p.K503N|ZEB1_uc009xlp.2_Missense_Mutation_p.K504N	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	520					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				AGAAGGACAAAAGCTTTGAAG	0.368													23	168	---	---	---	---	PASS
MARCH8	220972	broad.mit.edu	37	10	45953836	45953836	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45953836C>A	uc001jci.1	-	7	966	c.727G>T	c.(727-729)GAA>TAA	p.E243*	MARCH8_uc001jch.2_Nonsense_Mutation_p.E525*|MARCH8_uc001jcj.1_Nonsense_Mutation_p.E243*|MARCH8_uc001jck.1_Nonsense_Mutation_p.E243*|uc001jcf.2_5'Flank|MARCH8_uc001jcg.1_Nonsense_Mutation_p.E112*	NM_001002266	NP_001002266	Q5T0T0	MARH8_HUMAN	cellular modulator of immune recognition isoform	243						cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TTGCTTGTTTCTGGACAGTTT	0.358													31	249	---	---	---	---	PASS
SYT15	83849	broad.mit.edu	37	10	46959979	46959979	+	3'UTR	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46959979G>T	uc001jea.2	-	8					SYT15_uc001jdz.2_Missense_Mutation_p.T388K|SYT15_uc001jeb.2_3'UTR|SYT15_uc010qfp.1_RNA	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						CTATCCGGATGTCAGATGAAA	0.343													4	99	---	---	---	---	PASS
SLC18A3	6572	broad.mit.edu	37	10	50819838	50819838	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50819838G>T	uc001jhw.2	+	1	1492	c.1052G>T	c.(1051-1053)CGC>CTC	p.R351L	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	351	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						CTGGCGGCGCGCTACCCACAC	0.697													9	108	---	---	---	---	PASS
ASAH2	56624	broad.mit.edu	37	10	52005028	52005028	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52005028C>A	uc001jjd.2	-	2	314	c.314G>T	c.(313-315)GGT>GTT	p.G105V	ASAH2_uc009xos.2_Missense_Mutation_p.G105V	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a	105	Lumenal (Potential).				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						TCGTCCAACACCAATATGGTA	0.453													21	256	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61830845	61830845	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61830845A>G	uc001jky.2	-	37	9986	c.9794T>C	c.(9793-9795)ATT>ACT	p.I3265T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3265					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ATCTGACTCAATCTGGTCCGC	0.438													86	333	---	---	---	---	PASS
EGR2	1959	broad.mit.edu	37	10	64573941	64573941	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64573941T>C	uc010qim.1	-	3	611	c.457A>G	c.(457-459)ACC>GCC	p.T153A	EGR2_uc010qin.1_Missense_Mutation_p.T103A|EGR2_uc001jmi.2_Missense_Mutation_p.T153A|EGR2_uc010qio.1_Missense_Mutation_p.T166A|EGR2_uc009xph.2_Missense_Mutation_p.T153A	NM_001136177	NP_001129649	P11161	EGR2_HUMAN	early growth response 2 protein isoform a	153					fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGGGACATGGTGCACACACCC	0.622													33	111	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64974581	64974581	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64974581C>T	uc001jmn.2	-	8	1646	c.1346G>A	c.(1345-1347)CGG>CAG	p.R449Q	JMJD1C_uc001jml.2_Missense_Mutation_p.R230Q|JMJD1C_uc001jmm.2_Missense_Mutation_p.R161Q|JMJD1C_uc010qiq.1_Missense_Mutation_p.R267Q|JMJD1C_uc009xpi.2_Missense_Mutation_p.R267Q|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmp.1_Missense_Mutation_p.R161Q	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	449					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					AACAGACTTCCGCTTCTCTGC	0.398													5	292	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67863009	67863009	+	Splice_Site	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67863009T>G	uc009xpn.1	-	14	2008	c.1885_splice	c.e14-1	p.T629_splice	CTNNA3_uc001jmw.2_Splice_Site_p.T629_splice	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CTCTGGGGTCTATAAAAAGAA	0.274													23	72	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687148	68687148	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687148G>T	uc001jmz.1	+	2	1024	c.474G>T	c.(472-474)AAG>AAT	p.K158N	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.K158N	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	158	Extracellular (Potential).|LRR 5.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GCTTGCGGAAGCTGCTGAGTT	0.463													71	199	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71158372	71158372	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71158372G>A	uc001jpl.3	+	17	2498	c.2397G>A	c.(2395-2397)CAG>CAA	p.Q799Q	HK1_uc001jpg.3_Silent_p.Q787Q|HK1_uc001jph.3_Silent_p.Q803Q|HK1_uc001jpi.3_Silent_p.Q803Q|HK1_uc001jpj.3_Silent_p.Q834Q|HK1_uc001jpk.3_Silent_p.Q798Q	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI	799	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						CACTGCTCCAGGTCCGGGCTA	0.612													11	34	---	---	---	---	PASS
TSPAN14	81619	broad.mit.edu	37	10	82264546	82264546	+	Intron	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82264546T>A	uc001kcj.3	+						TSPAN14_uc009xss.2_Intron|TSPAN14_uc001kci.3_Intron	NM_030927	NP_112189	Q8NG11	TSN14_HUMAN	tetraspanin 14 isoform 1							integral to membrane				ovary(1)|central_nervous_system(1)	2			Colorectal(32;0.229)			TAGGTGTAACTGTCGCAGGAC	0.507													25	105	---	---	---	---	PASS
NDUFB8	4714	broad.mit.edu	37	10	102289241	102289241	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102289241C>A	uc001kri.1	-	2	136	c.108G>T	c.(106-108)ATG>ATT	p.M36I	SEC31B_uc009xwo.1_5'UTR|SEC31B_uc010qpq.1_5'UTR|SEC31B_uc010qpr.1_RNA	NM_005004	NP_004995	O95169	NDUB8_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	36					mitochondrial electron transport, NADH to ubiquinone|transport	endoplasmic reticulum|integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0		Colorectal(252;0.234)		Epithelial(162;5.68e-10)|all cancers(201;4.05e-08)	NADH(DB00157)	GCCCCGGGAACATGTCCTTGG	0.592													13	81	---	---	---	---	PASS
NFKB2	4791	broad.mit.edu	37	10	104161252	104161252	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104161252C>T	uc001kvb.2	+	20	2535	c.2270C>T	c.(2269-2271)CCC>CTC	p.P757L	NFKB2_uc001kva.2_Missense_Mutation_p.P757L|NFKB2_uc001kvd.2_Missense_Mutation_p.P757L|NFKB2_uc009xxc.2_Missense_Mutation_p.P757L	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	757	ANK 7.		Missing (in truncated form p80HT).|Missing (in truncated form LB40).|Missing (in truncated form EB308).		innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		ATGGAGCCACCCCTGACCCCG	0.592			T	IGH@	B-NHL								9	71	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119013575	119013575	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119013575C>A	uc001ldd.1	+	5	571	c.540C>A	c.(538-540)AGC>AGA	p.S180R	SLC18A2_uc009xyy.1_5'UTR	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	180	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CCTTCTCCAGCAGCTATGCCT	0.597													30	268	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127708298	127708298	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127708298G>A	uc001ljk.2	-	22	3048	c.2635C>T	c.(2635-2637)CAA>TAA	p.Q879*	ADAM12_uc010qul.1_Nonsense_Mutation_p.Q830*	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	879	Cytoplasmic (Potential).				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GTCTCCCATTGTCCTGGGGTC	0.582													17	114	---	---	---	---	PASS
RNH1	6050	broad.mit.edu	37	11	499054	499054	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:499054T>C	uc001lpk.1	-	4	1983	c.575A>G	c.(574-576)CAG>CGG	p.Q192R	RNH1_uc001lpl.1_Missense_Mutation_p.Q192R|RNH1_uc001lpm.1_Missense_Mutation_p.Q192R|RNH1_uc001lpn.1_Missense_Mutation_p.Q192R|RNH1_uc001lpo.1_Missense_Mutation_p.Q192R|RNH1_uc009ybw.1_RNA|RNH1_uc001lpp.1_Missense_Mutation_p.Q192R|RNH1_uc001lpt.1_5'UTR|RNH1_uc001lpq.1_Missense_Mutation_p.Q192R|RNH1_uc001lpr.1_Missense_Mutation_p.Q192R|RNH1_uc001lps.1_Missense_Mutation_p.Q192R	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor	192	LRR 7.				mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTCAGGCCCTGGCACAGCAC	0.672													14	63	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1018740	1018740	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1018740G>T	uc001lsw.2	-	31	4112	c.4061C>A	c.(4060-4062)ACA>AAA	p.T1354K		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1354	Pro-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGCCGTTGTTCCTGGCAG	0.582													37	166	---	---	---	---	PASS
OR52A4	390053	broad.mit.edu	37	11	5142454	5142454	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5142454G>A	uc001lzz.1	-	1	355	c.355C>T	c.(355-357)CTG>TTG	p.L119L	OR52A4_uc001maa.2_RNA	NM_001005222	NP_001005222			olfactory receptor, family 52, subfamily A,											ovary(2)	2		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATGGCTAGCAGGACTCCTGAT	0.443													8	53	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221405	5221405	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221405T>G	uc010qyz.1	-	1	526	c.526A>C	c.(526-528)AAT>CAT	p.N176H		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGACAGTAATTAAAAAATTTC	0.398													18	135	---	---	---	---	PASS
ZNF143	7702	broad.mit.edu	37	11	9530358	9530358	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9530358A>C	uc001mhr.2	+	12	1458	c.1340A>C	c.(1339-1341)GAG>GCG	p.E447A	ZNF143_uc009yfu.2_Missense_Mutation_p.E446A|ZNF143_uc010rby.1_Missense_Mutation_p.E416A	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143	447					regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		GAGCCCATCGAGGAGGAGCAG	0.468													5	24	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	10050108	10050108	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10050108C>T	uc001mib.2	-						SBF2_uc001mif.3_Intron|SBF2_uc001mij.2_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		ACAGCTTCTGCAGAATGGGAG	0.408													9	246	---	---	---	---	PASS
NUCB2	4925	broad.mit.edu	37	11	17332406	17332406	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17332406G>A	uc001mmw.2	+	7	763	c.518G>A	c.(517-519)CGT>CAT	p.R173H	NUCB2_uc001mms.1_Missense_Mutation_p.R174H|NUCB2_uc001mmt.1_Missense_Mutation_p.R173H|NUCB2_uc001mmv.1_Missense_Mutation_p.R173H|NUCB2_uc009ygz.2_Missense_Mutation_p.R173H	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor	173	By similarity.					cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						GACAAGACTCGTCATGAAGAA	0.279													7	296	---	---	---	---	PASS
CHST1	8534	broad.mit.edu	37	11	45672017	45672017	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45672017G>A	uc001mys.1	-	4	1128	c.457C>T	c.(457-459)CGC>TGC	p.R153C		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	153	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GCCCCGCGGCGGAAGATCCTG	0.692													10	30	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47306482	47306482	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47306482C>T	uc001ner.1	+						MADD_uc001neq.2_Intron|MADD_uc001nev.1_Intron|MADD_uc001nes.1_Intron|MADD_uc001net.1_Intron|MADD_uc009yln.1_Intron|MADD_uc001neu.1_Intron|MADD_uc001nex.2_Intron|MADD_uc001nez.2_Intron|MADD_uc001new.2_Intron	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing						activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		TAATTTCATGCGGCCTTTAGG	0.527													4	204	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003175	50003175	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003175C>T	uc010ria.1	-	1	863	c.863G>A	c.(862-864)AGA>AAA	p.R288K		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	288	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						CTCAGCATTTCTGAGTGTGTA	0.393													33	148	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735469	55735469	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735469C>A	uc010rit.1	-	1	471	c.471G>T	c.(469-471)TTG>TTT	p.L157F		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	157	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					CGCAAAAGGGCAAAAGGAAAA	0.398													19	111	---	---	---	---	PASS
OR8K3	219473	broad.mit.edu	37	11	56086192	56086192	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56086192C>A	uc010rjf.1	+	1	410	c.410C>A	c.(409-411)TCA>TAA	p.S137*		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					GTAATCATGTCACGAAGGGTA	0.413													39	188	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143637	56143637	+	IGR	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143637G>A								OR8J1 (14966 upstream) : OR5R1 (41099 downstream)																							TTTCTATTGTGATGACATGCC	0.458													91	327	---	---	---	---	PASS
OR5B3	441608	broad.mit.edu	37	11	58170463	58170463	+	Silent	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58170463A>T	uc010rkf.1	-	1	420	c.420T>A	c.(418-420)GCT>GCA	p.A140A		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	140	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGGCCAGACGAGCACACACAG	0.493													32	136	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58189883	58189883	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58189883G>C	uc010rkg.1	-	1	852	c.852C>G	c.(850-852)AAC>AAG	p.N284K		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	284	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGACCACAGGGTTCAGCATGG	0.433													37	162	---	---	---	---	PASS
OR4D10	390197	broad.mit.edu	37	11	59245001	59245001	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245001G>T	uc001nnz.1	+	1	99	c.99G>T	c.(97-99)TTG>TTT	p.L33F		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TCCTACTCTTGGTGTATGTGA	0.423													74	268	---	---	---	---	PASS
PLAC1L	219990	broad.mit.edu	37	11	59811058	59811058	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59811058C>A	uc001nol.2	+	2	366	c.181C>A	c.(181-183)CGG>AGG	p.R61R		NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor	61						extracellular region				ovary(2)|skin(1)	3						CCCTGCAAATCGGATACATAC	0.388													21	77	---	---	---	---	PASS
PAAF1	80227	broad.mit.edu	37	11	73620469	73620469	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73620469T>A	uc001ouk.1	+	7	592	c.558T>A	c.(556-558)GAT>GAA	p.D186E	PAAF1_uc001oul.1_Missense_Mutation_p.D169E|PAAF1_uc009ytx.1_RNA|PAAF1_uc001oum.1_Missense_Mutation_p.D169E	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	186	WD 3.				interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					CCATCGTTGATCGGGGGAGGA	0.512													4	159	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	84027982	84027982	+	Intron	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84027982G>A	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Silent_p.F69F	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AGGTCCTGTTGAAGCTGGACC	0.607													23	162	---	---	---	---	PASS
SLC36A4	120103	broad.mit.edu	37	11	92899094	92899094	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92899094C>A	uc001pdn.2	-	8	954	c.857G>T	c.(856-858)GGC>GTC	p.G286V	SLC36A4_uc001pdm.2_Missense_Mutation_p.G151V	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	286	Helical; (Potential).				L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CACTCCTATGCCTTCAAAAGC	0.328													15	39	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116732021	116732021	+	Silent	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116732021G>C	uc001ppy.2	-	18	2112	c.2076C>G	c.(2074-2076)CCC>CCG	p.P692P	SIK3_uc001ppz.2_Silent_p.P591P|SIK3_uc001pqa.2_Silent_p.P692P|SIK3_uc001ppw.2_Silent_p.P109P|SIK3_uc001ppx.2_Intron|SIK3_uc001pqb.2_5'UTR	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	692	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						TGCTCATGGGGGGAGGACTAT	0.473													35	99	---	---	---	---	PASS
AMICA1	120425	broad.mit.edu	37	11	118065080	118065080	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118065080T>A	uc001psk.2	-	10	1319	c.1145A>T	c.(1144-1146)AAG>ATG	p.K382M	AMICA1_uc001psg.2_Missense_Mutation_p.K192M|AMICA1_uc001psh.2_Missense_Mutation_p.K343M|AMICA1_uc009yzw.1_RNA|AMICA1_uc001psi.2_Missense_Mutation_p.K372M|AMICA1_uc001psj.2_Missense_Mutation_p.K371M|AMICA1_uc010rxw.1_Missense_Mutation_p.K343M	NM_001098526	NP_001091996	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen	382	Cytoplasmic (Potential).				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane				ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCCACCTGACTTTTTTTCAAG	0.488													10	87	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120998575	120998575	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120998575G>T	uc010rzo.1	+	8	1889	c.1889G>T	c.(1888-1890)GGC>GTC	p.G630V		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	630	TIL 1.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGCACAGAGGGCTGCGAGTGC	0.657													34	63	---	---	---	---	PASS
OR8D2	283160	broad.mit.edu	37	11	124189385	124189385	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189385C>T	uc010sah.1	-	1	709	c.709G>A	c.(709-711)GCC>ACC	p.A237T		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		GTGCCAAAGGCTTTGGATTGC	0.433													65	170	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310358	124310358	+	Silent	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310358A>G	uc010sal.1	-	1	624	c.624T>C	c.(622-624)GGT>GGC	p.G208G		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CTGTGGGCACACCAATATCAA	0.488													48	93	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133794771	133794771	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133794771G>A	uc001qgx.3	-	15	2294	c.2063C>T	c.(2062-2064)GCC>GTC	p.A688V	IGSF9B_uc001qgy.1_Missense_Mutation_p.A530V	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	688	Fibronectin type-III 2.|Extracellular (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTGCATGACGGCCAGAACCCG	0.577													4	199	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1480998	1480998	+	Splice_Site	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1480998G>A	uc001qjb.2	+	16	3022	c.2781_splice	c.e16-1	p.K927_splice	ERC1_uc001qiz.2_Splice_Site|ERC1_uc001qjc.2_Splice_Site_p.K899_splice|ERC1_uc001qja.2_Splice_Site|ERC1_uc001qjd.2_Splice_Site|ERC1_uc001qjf.2_Splice_Site_p.K927_splice|ERC1_uc010sdv.1_Splice_Site_p.K635_splice|ERC1_uc001qje.2_Splice_Site	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TTCTTTTGCAGGCAAGAAGCT	0.313													6	85	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	2024039	2024039	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2024039C>G	uc001qjp.2	-	2	521	c.290G>C	c.(289-291)GGC>GCC	p.G97A	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.G97A	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	97	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAAGAGAGAGCCTGAGTATTT	0.478													23	138	---	---	---	---	PASS
NRIP2	83714	broad.mit.edu	37	12	2943847	2943847	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2943847C>T	uc001qlc.2	-	1	375	c.303G>A	c.(301-303)CCG>CCA	p.P101P	NRIP2_uc010sed.1_Silent_p.P101P|uc009zdz.1_5'Flank	NM_031474	NP_113662	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	101					proteolysis|transcription, DNA-dependent	cytoplasm|nucleus	aspartic-type endopeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GGCTGTCCAGCGGGAGCAGGT	0.657													18	220	---	---	---	---	PASS
KCNA5	3741	broad.mit.edu	37	12	5153548	5153548	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5153548C>A	uc001qni.2	+	1	464	c.235C>A	c.(235-237)CCT>ACT	p.P79T		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	79	2 X 11 AA tandem repeat of D-[SP]-G-V-R- P-L-P-P-L-P.|2.					Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4						GCGGCCCTTGCCTCCGCTGCC	0.746													5	9	---	---	---	---	PASS
TPI1	7167	broad.mit.edu	37	12	6979488	6979488	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6979488C>T	uc001qrk.2	+	7	729	c.691C>T	c.(691-693)CTT>TTT	p.L231F	TPI1_uc010sfo.1_Missense_Mutation_p.L149F	NM_000365	NP_000356	P60174	TPIS_HUMAN	triosephosphate isomerase 1 isoform 1	231					fatty acid biosynthetic process|gluconeogenesis|glycolysis|pentose-phosphate shunt	cytosol	triose-phosphate isomerase activity				0						GGATGGCTTCCTTGTGGGTGG	0.572											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	53	---	---	---	---	PASS
FAM90A1	55138	broad.mit.edu	37	12	8376048	8376048	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8376048C>G	uc001qui.2	-	6	988	c.429G>C	c.(427-429)CTG>CTC	p.L143L	FAM90A1_uc001quh.2_Silent_p.L143L	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	143							nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		CCCTCACCCTCAGATAATCAG	0.542													6	126	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18435602	18435602	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18435602G>A	uc001rdt.2	+	2	703	c.587G>A	c.(586-588)GGA>GAA	p.G196E	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.G196E|PIK3C2G_uc010sic.1_5'UTR	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	196					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				AAAAGGAGTGGACATGTGAAC	0.383													205	268	---	---	---	---	PASS
PLCZ1	89869	broad.mit.edu	37	12	18854689	18854689	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18854689C>T	uc010sid.1	-	8	1077	c.886G>A	c.(886-888)GTT>ATT	p.V296I	PLCZ1_uc001rdv.3_Missense_Mutation_p.V192I|PLCZ1_uc001rdw.3_Missense_Mutation_p.V37I|PLCZ1_uc001rdu.1_Missense_Mutation_p.V37I|PLCZ1_uc009zil.1_RNA	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1	296	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTATTTTTAACTAATATTTTG	0.338													3	52	---	---	---	---	PASS
AEBP2	121536	broad.mit.edu	37	12	19667652	19667652	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19667652C>G	uc001ref.2	+	7	1441	c.1415C>G	c.(1414-1416)ACT>AGT	p.T472S	AEBP2_uc001ree.2_Missense_Mutation_p.T472S|AEBP2_uc001reg.1_Missense_Mutation_p.T243S	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN	AE binding protein 2 isoform b	472	Interaction with SUZ12.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					CAGTTAAAAACTAAAGTAGTT	0.299													3	67	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21997858	21997858	+	Intron	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21997858C>A	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GTCTAAAAAGCAACCAACACA	0.388													21	83	---	---	---	---	PASS
BCAT1	586	broad.mit.edu	37	12	24985698	24985698	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24985698A>G	uc001rgd.3	-	9	1445	c.1003T>C	c.(1003-1005)TGT>CGT	p.C335R	BCAT1_uc001rgc.2_Missense_Mutation_p.C334R|BCAT1_uc010six.1_Missense_Mutation_p.C347R|BCAT1_uc010siy.1_Missense_Mutation_p.C298R|BCAT1_uc001rge.3_Missense_Mutation_p.C274R	NM_005504	NP_005495	P54687	BCAT1_HUMAN	branched chain aminotransferase 1, cytosolic	335					branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)	CAAACAACACAGGCTGTACCA	0.423													27	37	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29908774	29908774	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29908774A>G	uc001rjb.2	-	4	749	c.275T>C	c.(274-276)GTG>GCG	p.V92A	TMTC1_uc001rjc.1_Missense_Mutation_p.V92A	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	200	Helical; (Potential).					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAAGGGAGACACCGTGGAAGG	0.468													9	157	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40703026	40703026	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40703026C>T	uc001rmg.3	+	30	4429	c.4308C>T	c.(4306-4308)TTC>TTT	p.F1436F	LRRK2_uc009zjw.2_Silent_p.F274F|LRRK2_uc001rmi.2_Silent_p.F269F	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1436	Roc.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTGGCTCTTCAATATAAAGG	0.328													15	108	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49448310	49448310	+	Splice_Site	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49448310C>T	uc001rta.3	-	3	400	c.400_splice	c.e3+1	p.G134_splice		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCCTCACTCACCTCCAGGTTC	0.542			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	32	---	---	---	---	PASS
KRT83	3889	broad.mit.edu	37	12	52714744	52714744	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52714744T>C	uc001saf.2	-	1	439	c.376A>G	c.(376-378)ATC>GTC	p.I126V		NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83	126	Rod.|Coil 1A.				epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ACCTTGTCGATGAAGGCCGCG	0.567													88	276	---	---	---	---	PASS
AAAS	8086	broad.mit.edu	37	12	53715196	53715196	+	Silent	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53715196T>A	uc001scr.3	-	1	217	c.54A>T	c.(52-54)CTA>CTT	p.L18L	AAAS_uc001scs.3_Silent_p.L18L	NM_015665	NP_056480	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency,	18					carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore				ovary(1)	1						TGTGCTCATATAGGGTGACTT	0.637											OREG0021865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	139	364	---	---	---	---	PASS
ESYT1	23344	broad.mit.edu	37	12	56525258	56525258	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56525258C>T	uc001sjq.2	+						ESYT1_uc001sjr.2_Intron	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1							integral to membrane				ovary(4)|skin(1)	5						CTTCTTGCCTCAGCTACATGG	0.527													41	541	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57963315	57963315	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57963315C>T	uc001sor.1	+						KIF5A_uc010srr.1_Intron	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A						blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						TCTCCTCACCCAGGGCAAAGA	0.418													86	440	---	---	---	---	PASS
TMEM19	55266	broad.mit.edu	37	12	72092691	72092691	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72092691G>A	uc001sws.2	+	5	1232	c.649G>A	c.(649-651)GGA>AGA	p.G217R	TMEM19_uc001swr.1_Missense_Mutation_p.G203R|TMEM19_uc009zru.1_RNA	NM_018279	NP_060749	Q96HH6	TMM19_HUMAN	transmembrane protein 19	217						integral to membrane					0		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		TACCAATGGAGGAGTTACAGT	0.428													89	216	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73015511	73015511	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73015511G>C	uc001sxa.2	+	15	2550	c.2520G>C	c.(2518-2520)TGG>TGC	p.W840C		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	840	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TTTCAGATTGGATTTCCAGCA	0.388													28	80	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78360035	78360035	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78360035T>A	uc001syp.2	+	4	614	c.441T>A	c.(439-441)AGT>AGA	p.S147R	NAV3_uc001syo.2_Missense_Mutation_p.S147R	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	147	CH.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TCTGCCTTAGTTTTCTAGCAG	0.338										HNSCC(70;0.22)			15	165	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80648345	80648345	+	IGR	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80648345G>A								PPP1R12A (319110 upstream) : PTPRQ (189781 downstream)																							GAGCAAGACTGTCCAGGTAAT	0.308													9	69	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80746218	80746218	+	IGR	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80746218T>A								PPP1R12A (416983 upstream) : PTPRQ (91908 downstream)																							ATTACTGCTGTGAGTAACTGT	0.318													11	51	---	---	---	---	PASS
CDK17	5128	broad.mit.edu	37	12	96691046	96691046	+	Splice_Site	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96691046A>T	uc001tep.1	-	9	1362	c.873_splice	c.e9+1	p.K291_splice	CDK17_uc009ztk.2_Splice_Site_p.K291_splice|CDK17_uc010svb.1_Splice_Site_p.K238_splice	NM_002595	NP_002586	Q00537	CDK17_HUMAN	PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						AAGAAAACATACCTTTACGTT	0.363													22	78	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102576327	102576327	+	Missense_Mutation	SNP	G	T	T	rs74958875		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102576327G>T	uc001tjf.2	+	9	1297	c.1185G>T	c.(1183-1185)AGG>AGT	p.R395S	C12orf48_uc001tjg.2_Missense_Mutation_p.R314S|C12orf48_uc010swa.1_Missense_Mutation_p.R472S|C12orf48_uc001tjh.2_Missense_Mutation_p.R314S|C12orf48_uc010swb.1_Intron|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Missense_Mutation_p.R110S|C12orf48_uc001tjk.2_Missense_Mutation_p.R274S|C12orf48_uc009zud.2_Intron	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010	395					response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						TTTGACATAGGTCTCCCACAC	0.239													15	62	---	---	---	---	PASS
RBM19	9904	broad.mit.edu	37	12	114387903	114387903	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114387903T>C	uc009zwi.2	-	9	1201	c.1057A>G	c.(1057-1059)AAC>GAC	p.N353D	RBM19_uc001tvn.3_Missense_Mutation_p.N353D|RBM19_uc001tvm.2_Missense_Mutation_p.N353D	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	353	RRM 2.				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TACTCCCGGTTGCATTTCAGA	0.478													39	198	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124158247	124158247	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124158247G>T	uc001ufp.2	+	4	481	c.353G>T	c.(352-354)TGT>TTT	p.C118F	TCTN2_uc009zya.2_Missense_Mutation_p.C117F	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	118	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GAGTCCCCCTGTATCCTCCAG	0.458													93	375	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124303521	124303521	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124303521G>T	uc001uft.3	+	21	3476	c.3451G>T	c.(3451-3453)GTT>TTT	p.V1151F		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1151	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAAAGAACTGGTTGATAAGAT	0.363													9	37	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124979765	124979765	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124979765C>A	uc010tba.1	-	1	150	c.33G>T	c.(31-33)ACG>ACT	p.T11T	NCOR2_uc010tay.1_Silent_p.T11T|NCOR2_uc010taz.1_Silent_p.T11T|NCOR2_uc010tbb.1_Silent_p.T11T|NCOR2_uc010tbc.1_Silent_p.T11T|NCOR2_uc001ugj.1_Silent_p.T11T|NCOR2_uc001ugk.1_Silent_p.T11T	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	11					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGGCCCTCCACGTCTGTGCCA	0.642													21	49	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132496111	132496111	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132496111C>T	uc001ujn.2	+	15	3408	c.3373C>T	c.(3373-3375)CGT>TGT	p.R1125C	EP400_uc001ujl.2_Missense_Mutation_p.R1124C|EP400_uc001ujm.2_Missense_Mutation_p.R1125C	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1161	Interactions with RUVBL1 and RUVBL2.|Helicase ATP-binding.				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TGAATTGAAACGTTGGTGTCC	0.383													41	147	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19748086	19748086	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19748086C>A	uc009zzj.2	-	5	1319	c.1270G>T	c.(1270-1272)GAC>TAC	p.D424Y		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	424					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCTGCCAGGTCCTCGCGGGCC	0.582													52	155	---	---	---	---	PASS
IFT88	8100	broad.mit.edu	37	13	21163959	21163959	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21163959A>G	uc001unh.2	+	6	586	c.190A>G	c.(190-192)AAA>GAA	p.K64E	IFT88_uc001uni.2_Missense_Mutation_p.K55E|IFT88_uc001unj.2_Missense_Mutation_p.K54E|IFT88_uc010tcq.1_Intron	NM_175605	NP_783195	Q13099	IFT88_HUMAN	intraflagellar transport 88 homolog isoform 1	64					cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		GATAACTGCTAAAATATCAAG	0.328													27	58	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23911629	23911629	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23911629C>A	uc001uon.2	-	10	6975	c.6386G>T	c.(6385-6387)GGG>GTG	p.G2129V	SACS_uc001uoo.2_Missense_Mutation_p.G1982V|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	2129					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGGGAATCTCCCATCTTTAAT	0.378													39	109	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32914593	32914593	+	Missense_Mutation	SNP	G	A	A	rs80358849		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32914593G>A	uc001uub.1	+	11	6328	c.6101G>A	c.(6100-6102)CGT>CAT	p.R2034H		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2034					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ACTGCTATACGTACTCCAGAA	0.348			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			42	117	---	---	---	---	PASS
ALG5	29880	broad.mit.edu	37	13	37539757	37539757	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37539757C>A	uc001uvy.2	-	8	795	c.728G>T	c.(727-729)CGA>CTA	p.R243L	ALG5_uc010teq.1_Missense_Mutation_p.R213L|ALG5_uc010ter.1_RNA	NM_013338	NP_037470	Q9Y673	ALG5_HUMAN	dolichyl-phosphate beta-glucosyltransferase	243	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate beta-glucosyltransferase activity|oligosaccharyl transferase activity				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		AGCTGCTTCTCGAGTAAATAA	0.448													4	224	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78163268	78163268	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78163268C>T	uc001vki.2	+						SCEL_uc001vkj.2_Intron|SCEL_uc010thx.1_Intron	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1						embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		CTGCTGTTTTCTGTTTTAAAG	0.383													8	198	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454001	84454001	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454001C>A	uc001vlk.2	-	1	2528	c.1642G>T	c.(1642-1644)GGT>TGT	p.G548C		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	548	LRRCT 2.|Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		ACTTCGGAACCCAAGCGTTCT	0.532													21	52	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329379	88329379	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329379A>T	uc001vln.2	+	2	1955	c.1736A>T	c.(1735-1737)GAG>GTG	p.E579V	SLITRK5_uc010tic.1_Missense_Mutation_p.E338V	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	579	LRRCT 2.|Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CTGTGGGTGGAGCAGCTCAAA	0.527													24	243	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329602	88329602	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329602C>G	uc001vln.2	+	2	2178	c.1959C>G	c.(1957-1959)GGC>GGG	p.G653G	SLITRK5_uc010tic.1_Silent_p.G412G	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	653	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CGAGCTTGGGCGCAGGCGGAG	0.652													19	60	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110833740	110833740	+	Intron	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110833740T>C	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TCAACACCTGTTTTAAAGAGT	0.498													5	27	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20403890	20403890	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20403890G>T	uc001vwj.1	+	1	65	c.65G>T	c.(64-66)GGA>GTA	p.G22V		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AATTCCTGGGGACTTCAACTT	0.353													52	834	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404050	20404050	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404050C>A	uc001vwj.1	+	1	225	c.225C>A	c.(223-225)AAC>AAA	p.N75K		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GTCAGTCTAACTTTGCCACCC	0.378													105	451	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20444630	20444630	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20444630T>C	uc010tkx.1	+	1	953	c.953T>C	c.(952-954)GTG>GCG	p.V318A		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	318	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AACAAAGAAGTGAAGGCAGCT	0.383													29	120	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22279906	22279906	+	Intron	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22279906C>G	uc010tmf.1	+						uc001wbv.2_5'Flank					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		CAAGTGCTCCCCTCTGAAGGG	0.448													6	42	---	---	---	---	PASS
PYGL	5836	broad.mit.edu	37	14	51398405	51398405	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51398405G>A	uc001wyu.2	-	4	641	c.514C>T	c.(514-516)CGA>TGA	p.R172*	PYGL_uc010tqq.1_Nonsense_Mutation_p.R138*|PYGL_uc001wyv.2_5'UTR|PYGL_uc001wyw.3_Nonsense_Mutation_p.R172*	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1	172					glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	CATCCATCTCGGATCTTCTGA	0.413													69	154	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735389	52735389	+	Intron	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735389G>A	uc001wzq.2	+							NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor							integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	GTGAGTCCCCGGGCCCCGAGG	0.692													54	217	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58790254	58790254	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58790254G>T	uc001xdp.2	+	8	755	c.501G>T	c.(499-501)AAG>AAT	p.K167N	ARID4A_uc001xdo.2_Missense_Mutation_p.K167N|ARID4A_uc001xdq.2_Missense_Mutation_p.K167N	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	167					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						ATGAAGACAAGCGCCGTCTCA	0.373													54	92	---	---	---	---	PASS
ZBTB1	22890	broad.mit.edu	37	14	64989632	64989632	+	Silent	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64989632T>C	uc001xhh.3	+	4	1841	c.1410T>C	c.(1408-1410)TGT>TGC	p.C470C	ZBTB1_uc010aqg.2_Silent_p.C470C|ZBTB1_uc001xhi.2_Silent_p.C470C	NM_001123329	NP_001116801	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1 isoform	470	C2H2-type 2; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		CTCAACGATGTGGCGAGCCCC	0.423													65	153	---	---	---	---	PASS
C14orf49	161176	broad.mit.edu	37	14	95921782	95921782	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95921782C>A	uc001yei.3	-	5	1084	c.1069G>T	c.(1069-1071)GAG>TAG	p.E357*	C14orf49_uc010avi.2_Nonsense_Mutation_p.E357*|C14orf49_uc001yej.1_Nonsense_Mutation_p.E357*	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	357	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		TGCAGGCCCTCCTGGGCCAGC	0.667													6	46	---	---	---	---	PASS
EML1	2009	broad.mit.edu	37	14	100331948	100331948	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100331948G>T	uc001ygs.2	+	3	417	c.348G>T	c.(346-348)GGG>GGT	p.G116G	EML1_uc010avt.1_Silent_p.G103G|EML1_uc010tww.1_Silent_p.G85G|EML1_uc001ygq.2_Silent_p.G116G|EML1_uc001ygr.2_Silent_p.G116G	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	116						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CCCCCTCCGGGGTCAGGAAAG	0.498													17	69	---	---	---	---	PASS
CRIP2	1397	broad.mit.edu	37	14	105945787	105945787	+	Silent	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105945787C>G	uc001yrd.1	+	7	585	c.516C>G	c.(514-516)CCC>CCG	p.P172P	CRIP2_uc010tyr.1_Silent_p.P246P|CRIP2_uc001yre.1_Silent_p.P244P|CRIP2_uc001yrf.1_RNA|CRIP2_uc001yrg.2_RNA|CRIP2_uc001yrh.1_RNA	NM_001312	NP_001303	P52943	CRIP2_HUMAN	cysteine-rich protein 2	172	LIM zinc-binding 2.						zinc ion binding				0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.235)		ACGGCCAGCCCTACTGCCACA	0.642													10	111	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22382732	22382732	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22382732C>A	uc001yuc.1	+	7	1241	c.260C>A	c.(259-261)TCT>TAT	p.S87Y	LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Missense_Mutation_p.S87Y	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	87	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GACTTCCTCTCTGAGAAAAAG	0.507													18	258	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482888	22482888	+	IGR	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482888G>T								OR4N3P (68503 upstream) : MIR1268 (30341 downstream)																							GCTCAGCTCCGTGTAGGCTGT	0.522													60	621	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26825459	26825459	+	Intron	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26825459G>C	uc001zaz.2	-						GABRB3_uc010uae.1_Intron|GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GTGGATGCAGGACTCACCTGT	0.552													9	80	---	---	---	---	PASS
EIF2AK4	440275	broad.mit.edu	37	15	40280230	40280230	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40280230G>A	uc001zkm.1	+	15	2500	c.2450G>A	c.(2449-2451)GGA>GAA	p.G817E	EIF2AK4_uc010bbj.1_Missense_Mutation_p.G518E	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	817	Protein kinase 2.				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ATTGACCAGGGACTGTATCGA	0.398													26	185	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40942730	40942730	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40942730C>T	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TTTTTTTTTTCTGTTTCCAAA	0.308													6	27	---	---	---	---	PASS
DECR2	26063	broad.mit.edu	37	16	460303	460303	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:460303T>A	uc002chb.2	+	5	504	c.398T>A	c.(397-399)GTG>GAG	p.V133E	DECR2_uc002chc.2_Missense_Mutation_p.V49E|DECR2_uc010bqv.2_Missense_Mutation_p.V49E|DECR2_uc002chd.2_Missense_Mutation_p.V49E|DECR2_uc002che.1_RNA	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2	133						peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				TTCAAGACCGTGATGGACATC	0.607													15	91	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1607944	1607944	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1607944G>T	uc002cmb.2	-	19	2753	c.2391C>A	c.(2389-2391)CTC>CTA	p.L797L	IFT140_uc002clz.2_Silent_p.L448L	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	797	TPR 1.									ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				ACCTTTTGATGAGCTTGATGG	0.547													22	333	---	---	---	---	PASS
MMP25	64386	broad.mit.edu	37	16	3107201	3107201	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3107201C>T	uc002cth.2	+	5	1066	c.829C>T	c.(829-831)CAA>TAA	p.Q277*	uc002ctj.1_Intron	NM_022468	NP_071913	Q9NPA2	MMP25_HUMAN	matrix metalloproteinase 25 preproprotein	277					inflammatory response|proteolysis	anchored to membrane|cell surface|plasma membrane|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0						TGGCCTGCAGCAACTCTATGG	0.622													16	153	---	---	---	---	PASS
ACSM3	6296	broad.mit.edu	37	16	20788733	20788733	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20788733A>G	uc002dhr.2	+	4	656	c.469A>G	c.(469-471)AAA>GAA	p.K157E	ACSM3_uc002dhq.2_Missense_Mutation_p.K157E|ACSM3_uc010vba.1_Missense_Mutation_p.K149E	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	157					regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1						GCTGACCCAGAAAGACATTCT	0.388													15	189	---	---	---	---	PASS
OTOA	146183	broad.mit.edu	37	16	21721274	21721274	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21721274G>A	uc002djh.2	+	12	1171	c.1170G>A	c.(1168-1170)TTG>TTA	p.L390L	uc002diq.3_Intron|OTOA_uc010vbj.1_Silent_p.L311L|OTOA_uc002dji.2_Silent_p.L66L|OTOA_uc010vbk.1_Silent_p.L38L	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	404					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		TGGGTTCTTTGTCGGATGCAG	0.547													9	93	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25255279	25255279	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25255279C>A	uc002dod.3	-	6	2215	c.1808G>T	c.(1807-1809)AGG>ATG	p.R603M	ZKSCAN2_uc010vcl.1_Missense_Mutation_p.R399M	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	603					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		TCTTTCTTGCCTTGAAGGTGA	0.542													84	193	---	---	---	---	PASS
HS3ST4	9951	broad.mit.edu	37	16	26147076	26147076	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147076G>C	uc002dof.2	+	2	1270	c.878G>C	c.(877-879)AGG>ACG	p.R293T		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	293	Lumenal (Potential).|PAPS and substrate (By similarity).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		CCCGTGACCAGGGCCATCTCT	0.527													71	171	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31419188	31419188	+	Silent	SNP	C	T	T	rs145577588		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31419188C>T	uc002ebv.1	+	9	1009	c.960C>T	c.(958-960)GCC>GCT	p.A320A	ITGAD_uc010vfl.1_Missense_Mutation_p.P353S|ITGAD_uc010cap.1_Silent_p.A320A|ITGAD_uc002ebw.1_Missense_Mutation_p.P164S	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	320	Extracellular (Potential).|VWFA.				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ACTTTGCAGCCCTTGGCAGCA	0.587													12	111	---	---	---	---	PASS
ARMC5	79798	broad.mit.edu	37	16	31473727	31473727	+	Missense_Mutation	SNP	G	T	T	rs118073437	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31473727G>T	uc002ecc.2	+	3	1388	c.859G>T	c.(859-861)GTC>TTC	p.V287F	ARMC5_uc010vfn.1_Missense_Mutation_p.V382F|ARMC5_uc010vfo.1_Missense_Mutation_p.V319F|ARMC5_uc002eca.3_Missense_Mutation_p.V287F|ARMC5_uc010vfp.1_Intron|ARMC5_uc002ecb.2_Missense_Mutation_p.V287F	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	287	ARM 4.						binding			pancreas(1)	1						GGGCCCACTCGTCAGCCTGGC	0.652													20	61	---	---	---	---	PASS
ITFG1	81533	broad.mit.edu	37	16	47494854	47494854	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47494854G>A	uc002eet.2	-	1	165	c.103C>T	c.(103-105)CAC>TAC	p.H35Y	ITFG1_uc010vgh.1_Intron|PHKB_uc010vgi.1_5'Flank|PHKB_uc002eeu.3_5'Flank|PHKB_uc002eev.3_5'Flank|ITFG1_uc010cbf.1_5'Flank	NM_030790	NP_110417	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	35						extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				GTGACGTTGTGCAGCGCCCGC	0.716													6	25	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48145676	48145676	+	Intron	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48145676G>T	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				ACCTGCCCAGGTGTGAGTTAC	0.493													24	215	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48158147	48158147	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48158147G>C	uc002efc.1	-	10	1910	c.1564C>G	c.(1564-1566)CTC>GTC	p.L522V	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA|ABCC12_uc002efe.1_Missense_Mutation_p.L522V	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	522	ABC transporter 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				GCTGCAAGGAGGGAGCTCTTT	0.507													156	365	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50348274	50348274	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50348274C>G	uc002egd.1	+	23	3196	c.2928C>G	c.(2926-2928)GAC>GAG	p.D976E		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	976	Cytoplasmic (Potential).|Guanylate cyclase 2.				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	GTAAGCTGGACGGCATCAACA	0.637													7	61	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56917983	56917983	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56917983C>T	uc010ccm.2	+	14	1721	c.1692C>T	c.(1690-1692)TAC>TAT	p.Y564Y	SLC12A3_uc002ekd.3_Silent_p.Y564Y|SLC12A3_uc010ccn.2_Silent_p.Y563Y	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	564	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CATTCCAATACTACAACAAGT	0.612													8	82	---	---	---	---	PASS
DDX28	55794	broad.mit.edu	37	16	68055731	68055731	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68055731G>A	uc002evh.1	-	1	2229	c.1375C>T	c.(1375-1377)CGG>TGG	p.R459W	DUS2L_uc002evi.2_5'Flank|DUS2L_uc002evj.2_5'Flank|DUS2L_uc010vkk.1_5'Flank	NM_018380	NP_060850	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	459	Helicase C-terminal.					mitochondrial nucleoid|nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		TCCAGGCCCCGAGAGGCTATG	0.552													12	77	---	---	---	---	PASS
DDX28	55794	broad.mit.edu	37	16	68056949	68056949	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68056949G>A	uc002evh.1	-	1	1011	c.157C>T	c.(157-159)CGG>TGG	p.R53W	DUS2L_uc002evi.2_5'Flank|DUS2L_uc002evj.2_5'Flank|DUS2L_uc010vkk.1_5'Flank	NM_018380	NP_060850	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	53						mitochondrial nucleoid|nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		AGGTTCCGCCGCCTGCTCTGC	0.731													6	15	---	---	---	---	PASS
MARVELD3	91862	broad.mit.edu	37	16	71663316	71663316	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71663316C>A	uc002fat.2	+	2	577	c.514C>A	c.(514-516)CGA>AGA	p.R172R	MARVELD3_uc002fas.1_Silent_p.R172R|MARVELD3_uc002fau.2_Silent_p.R172R|MARVELD3_uc010cge.2_Missense_Mutation_p.D117E	NM_052858	NP_443090	Q96A59	MALD3_HUMAN	MARVEL domain containing 3 isoform 2	172	Cytoplasmic (Potential).					integral to membrane				skin(1)	1		Ovarian(137;0.125)				CAGGCCTGGACGAGAGGAGGT	0.517													16	104	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74336197	74336197	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74336197C>T	uc002fcq.2	+						PSMD7_uc010vmr.1_Intron	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						TGATGTAAGTCATCTTGCTAT	0.418													19	99	---	---	---	---	PASS
ZC3H18	124245	broad.mit.edu	37	16	88643785	88643785	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88643785T>A	uc002fky.2	+	2	454	c.254T>A	c.(253-255)GTG>GAG	p.V85E	ZC3H18_uc010voy.1_Splice_Site_p.E84_splice|ZC3H18_uc010voz.1_Missense_Mutation_p.V85E|ZC3H18_uc010vpa.1_Missense_Mutation_p.V85E	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	85						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GACTCAGAGGTGAATGAGCTG	0.632													5	30	---	---	---	---	PASS
ZNF276	92822	broad.mit.edu	37	16	89799888	89799888	+	Splice_Site	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89799888A>T	uc002fos.3	+	8	1378	c.1281_splice	c.e8-2	p.R427_splice	ZNF276_uc010ciq.2_Splice_Site_p.R213_splice|ZNF276_uc002fop.2_Splice_Site_p.R335_splice|ZNF276_uc002foq.3_Splice_Site_p.R352_splice|ZNF276_uc010cir.2_Splice_Site|ZNF276_uc002for.3_Splice_Site_p.R213_splice|ZNF276_uc010cis.2_Splice_Site_p.R186_splice|ZNF276_uc002fot.3_Splice_Site|ZNF276_uc010vpm.1_Splice_Site_p.R265_splice|ZNF276_uc010cit.1_Splice_Site_p.R186_splice	NM_001113525	NP_001106997	Q8N554	ZN276_HUMAN	zinc finger protein 276 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TCTTCATTGCAGGGAGGAGCT	0.627													15	130	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2202478	2202478	+	Silent	SNP	C	T	T	rs147802850	byFrequency	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202478C>T	uc002fub.1	-	2	1624	c.1569G>A	c.(1567-1569)ACG>ACA	p.T523T	SMG6_uc002fud.1_Silent_p.T492T	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	523					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						GGTTATAGCCCGTATAGGGAT	0.537													6	399	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3919650	3919650	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3919650C>A	uc002fxe.2	-	49	8176	c.8112G>T	c.(8110-8112)TCG>TCT	p.S2704S	ZZEF1_uc002fxg.1_Silent_p.S25S	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2704							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ACGGGTGTTTCGACTCCCTCA	0.612													46	148	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577156	7577156	+	Splice_Site	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577156C>A	uc002gim.2	-	8	977	c.783_splice	c.e8-1	p.S261_splice	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Splice_Site_p.S261_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.S129_splice|TP53_uc010cng.1_Splice_Site_p.S129_splice|TP53_uc002gii.1_Splice_Site_p.S129_splice|TP53_uc010cnh.1_Splice_Site_p.S261_splice|TP53_uc010cni.1_Splice_Site_p.S261_splice|TP53_uc002gij.2_Splice_Site_p.S261_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(18)|p.0?(7)|p.E258fs*71(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TAGATTACCACTACTCAGGAT	0.512		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			7	33	---	---	---	---	PASS
DHRS7C	201140	broad.mit.edu	37	17	9676195	9676195	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9676195G>A	uc010vvb.1	-	5	619	c.619C>T	c.(619-621)CGA>TGA	p.R207*	DHRS7C_uc010cof.2_Nonsense_Mutation_p.R206*	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	207						extracellular region	binding|oxidoreductase activity				0						ACTTCGGCTCGGAGGCAGTCA	0.602													5	36	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18023488	18023488	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18023488C>G	uc010vxh.1	+	2	1712	c.1374C>G	c.(1372-1374)TTC>TTG	p.F458L		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	458	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					CCGCCTTCTTCGAGCAGCAAG	0.642													4	51	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319268	21319268	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319268G>A	uc002gyv.1	+	3	1319	c.614G>A	c.(613-615)CGT>CAT	p.R205H		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	205	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GTGGCCCTGCGTGACGGCAAG	0.622										Prostate(3;0.18)			11	48	---	---	---	---	PASS
GOSR1	9527	broad.mit.edu	37	17	28819754	28819754	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28819754A>T	uc002hfe.2	+	6	524	c.498A>T	c.(496-498)GAA>GAT	p.E166D	GOSR1_uc002hfd.2_Missense_Mutation_p.E164D|GOSR1_uc002hff.2_Missense_Mutation_p.E101D	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1	166	Cytoplasmic (Potential).				intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						TTTTGAAAGAACATGACCACC	0.318													30	134	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35898443	35898443	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35898443C>T	uc002hoa.2	-	18	3583	c.3500G>A	c.(3499-3501)GGC>GAC	p.G1167D	SYNRG_uc010wde.1_Missense_Mutation_p.G1089D|SYNRG_uc010wdf.1_Missense_Mutation_p.G1089D|SYNRG_uc002hoc.2_Missense_Mutation_p.G1088D|SYNRG_uc002hoe.2_Missense_Mutation_p.G1089D|SYNRG_uc002hod.2_Missense_Mutation_p.G1044D|SYNRG_uc010wdg.1_Missense_Mutation_p.G961D|SYNRG_uc002hob.2_Missense_Mutation_p.G1167D	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	1167					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						ATATTCCATGCCTTGAGCTGA	0.308													69	350	---	---	---	---	PASS
DNAJC7	7266	broad.mit.edu	37	17	40135656	40135656	+	Splice_Site	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40135656T>C	uc002hyo.2	-	10	1248	c.1011_splice	c.e10-1	p.C337_splice	DNAJC7_uc010cxu.2_Splice_Site_p.C281_splice|DNAJC7_uc010cxv.2_Intron|DNAJC7_uc010wgb.1_Splice_Site_p.C281_splice|DNAJC7_uc010wgc.1_Splice_Site_p.C195_splice|DNAJC7_uc002hyp.2_Splice_Site_p.C281_splice	NM_003315	NP_003306	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7						chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding			ovary(1)	1		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				TCCATGTAACTGAGAAGGAAA	0.393													6	15	---	---	---	---	PASS
RPRML	388394	broad.mit.edu	37	17	45056142	45056142	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45056142G>A	uc002ilb.2	-	1	473	c.232C>T	c.(232-234)CTT>TTT	p.L78F	GOSR2_uc010wkh.1_Intron	NM_203400	NP_981945	Q8N4K4	RPRML_HUMAN	reprimo-like	78	Helical; (Potential).					integral to membrane					0						ACCACGGTAAGCGACAGCACG	0.682													5	34	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45895919	45895919	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45895919G>A	uc002ilx.1	-	6	636	c.433C>T	c.(433-435)CGC>TGC	p.R145C	OSBPL7_uc002ilw.1_5'Flank	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7	145					lipid transport		lipid binding				0						ATGTCCAGGCGGTGGGCTAGG	0.627													8	69	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51902007	51902007	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51902007A>T	uc002iua.2	+	1	1769	c.1613A>T	c.(1612-1614)AAC>ATC	p.N538I	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	538					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						AGATATGCAAACAGAGTAAAA	0.428													26	121	---	---	---	---	PASS
VEZF1	7716	broad.mit.edu	37	17	56060750	56060750	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56060750T>C	uc002ivf.1	-	2	181	c.38A>G	c.(37-39)CAT>CGT	p.H13R	VEZF1_uc010dcn.1_5'UTR	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	13					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						GGAAGCTTCATGGGCCTAAAA	0.493													46	148	---	---	---	---	PASS
OR4D1	26689	broad.mit.edu	37	17	56232691	56232691	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56232691G>A	uc010wno.1	+	1	177	c.177G>A	c.(175-177)ATG>ATA	p.M59I	MSX2P1_uc002ivn.2_5'Flank	NM_012374	NP_036506	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ACACACCCATGTATTTTCTGC	0.478													16	515	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67047206	67047206	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67047206A>T	uc002jhu.2	-	2	205	c.62T>A	c.(61-63)CTC>CAC	p.L21H	ABCA9_uc010dez.2_Missense_Mutation_p.L21H|ABCA9_uc002jhv.2_Missense_Mutation_p.L21H	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	21					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					CCATTTTTTGAGACAGTTCTT	0.373													12	110	---	---	---	---	PASS
C17orf70	80233	broad.mit.edu	37	17	79514179	79514179	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79514179G>A	uc002kaq.2	-	5	1984	c.1929C>T	c.(1927-1929)AGC>AGT	p.S643S	C17orf70_uc002kao.1_Silent_p.S292S|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Silent_p.S492S	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	643					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CTGTGTGCCTGCTCAGGGGCA	0.692													27	109	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80400154	80400154	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80400154A>C	uc002kew.2	+	12	1406	c.1355A>C	c.(1354-1356)CAC>CCC	p.H452P	HEXDC_uc002kev.3_Missense_Mutation_p.T482P|HEXDC_uc010diq.2_Silent_p.A454A|HEXDC_uc010wvm.1_RNA			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	452					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAAAACGTGCACCCCAGCCTG	0.677													9	16	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2960765	2960765	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2960765G>T	uc002klo.2	-	2	313	c.74C>A	c.(73-75)GCC>GAC	p.A25D		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	25	N-LIP.				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AGAGAGGGTGGCCTGGTTAAT	0.488													29	81	---	---	---	---	PASS
APCDD1	147495	broad.mit.edu	37	18	10471799	10471799	+	Missense_Mutation	SNP	C	T	T	rs143954637		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10471799C>T	uc002kom.3	+	3	869	c.515C>T	c.(514-516)CCG>CTG	p.P172L		NM_153000	NP_694545	Q8J025	APCD1_HUMAN	adenomatosis polyposis coli down-regulated 1	172	Extracellular (Potential).				hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)		CGCACATGCCCGGGCTTCCTC	0.657													17	189	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65181205	65181205	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65181205C>G	uc002lke.1	-	2	1895	c.671G>C	c.(670-672)CGC>CCC	p.R224P		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	214						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				GCCCCATGAGCGGACCTTGGA	0.383													17	187	---	---	---	---	PASS
ATP9B	374868	broad.mit.edu	37	18	76936834	76936834	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76936834A>T	uc002lmx.2	+	8	814	c.800A>T	c.(799-801)GAT>GTT	p.D267V	ATP9B_uc002lmv.1_Intron|ATP9B_uc002lmw.1_Missense_Mutation_p.D267V|ATP9B_uc002lmy.1_Intron|ATP9B_uc002lmz.1_5'UTR	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	267	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		ATTCGAACTGATCAACTAGAT	0.468													29	136	---	---	---	---	PASS
PQLC1	80148	broad.mit.edu	37	18	77710832	77710832	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77710832G>A	uc002lnl.2	-	2	267	c.95C>T	c.(94-96)CCC>CTC	p.P32L	PQLC1_uc010dre.2_5'UTR|PQLC1_uc002lnk.2_Missense_Mutation_p.P32L|PQLC1_uc010xfm.1_Missense_Mutation_p.P32L	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1	32	PQ-loop 1.					integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CGGGACGTAGGGCACCACCCC	0.667													5	23	---	---	---	---	PASS
FUT3	2525	broad.mit.edu	37	19	5843758	5843758	+	3'UTR	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5843758C>T	uc002mdk.2	-	2					FUT3_uc002mdm.2_3'UTR|FUT3_uc002mdj.2_3'UTR|FUT3_uc002mdl.2_3'UTR	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3						protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						GGCACCATGCCGGCCTCTCAG	0.622													32	42	---	---	---	---	PASS
EIF3G	8666	broad.mit.edu	37	19	10226670	10226670	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10226670C>T	uc002mnd.2	-	8	740	c.676G>A	c.(676-678)GGG>AGG	p.G226R		NM_003755	NP_003746	O75821	EIF3G_HUMAN	eukaryotic translation initiation factor 3,	226						cytosol|eukaryotic translation initiation factor 3 complex|nucleus|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			ATGGACTCCCCGCGGCGGCTG	0.677													12	10	---	---	---	---	PASS
RAVER1	125950	broad.mit.edu	37	19	10439520	10439520	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10439520G>A	uc002moa.2	-	3	685	c.605C>T	c.(604-606)TCG>TTG	p.S202L		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	185	RRM 2.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			ACGGGCAGCCGAGTCCTTCTT	0.642													13	19	---	---	---	---	PASS
ATG4D	84971	broad.mit.edu	37	19	10657905	10657905	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10657905G>C	uc002mov.2	+	5	931	c.811G>C	c.(811-813)GTG>CTG	p.V271L	ATG4D_uc010xlh.1_Missense_Mutation_p.V208L|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_Intron	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	271					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CCGCCTGGTGGTGTACGTTTC	0.627													9	24	---	---	---	---	PASS
ZNF791	163049	broad.mit.edu	37	19	12738992	12738992	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12738992G>A	uc002mua.2	+	4	811	c.649G>A	c.(649-651)GAA>AAA	p.E217K	ZNF791_uc010xml.1_Missense_Mutation_p.E185K|ZNF791_uc010dyu.1_Missense_Mutation_p.E108K|ZNF791_uc010xmm.1_Missense_Mutation_p.E108K	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791	217	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AAAGCCCTATGAATGTAAACA	0.418													17	94	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15807890	15807890	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15807890C>A	uc002nbl.2	+	13	1631	c.1570C>A	c.(1570-1572)CAG>AAG	p.Q524K		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					TGTAAGCTTGCAGTGACTTTC	0.577													26	68	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16032946	16032946	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16032946C>T	uc002nbu.2	-	9	1052	c.1016G>A	c.(1015-1017)TGG>TAG	p.W339*	CYP4F11_uc010eab.1_Nonsense_Mutation_p.W339*|CYP4F11_uc002nbt.2_Nonsense_Mutation_p.W339*	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	339					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GTATAGGACCCAGGAGAGACC	0.542													9	141	---	---	---	---	PASS
ZNF708	7562	broad.mit.edu	37	19	21477059	21477059	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21477059A>T	uc002npq.1	-	4	907	c.709T>A	c.(709-711)TCA>ACA	p.S237T	ZNF708_uc002npr.1_Missense_Mutation_p.S173T|ZNF708_uc010ecs.1_Missense_Mutation_p.S173T	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708	237	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						GTAAGAGTTGAGGACTGGTTA	0.353													28	71	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22375845	22375845	+	Silent	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22375845T>G	uc002nqs.1	-	2	421	c.103A>C	c.(103-105)AGA>CGA	p.R35R		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	35	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATCTCATGTCTCTTCATATTC	0.413													45	102	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934746	30934746	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934746G>C	uc002nsu.1	+	2	415	c.277G>C	c.(277-279)GAC>CAC	p.D93H	ZNF536_uc010edd.1_Missense_Mutation_p.D93H	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	93					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCGGGAGGTGGACACCAGCCT	0.667													7	25	---	---	---	---	PASS
GPI	2821	broad.mit.edu	37	19	34887209	34887209	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34887209G>A	uc002nvg.1	+	13	1169	c.1066G>A	c.(1066-1068)GAC>AAC	p.D356N	GPI_uc002nvf.2_Missense_Mutation_p.D395N|GPI_uc010xrv.1_Missense_Mutation_p.D367N|GPI_uc010xrw.1_Missense_Mutation_p.D328N|GPI_uc010edl.1_Missense_Mutation_p.D356N|GPI_uc002nvi.1_Missense_Mutation_p.D19N	NM_000175	NP_000166	P06744	G6PI_HUMAN	glucose phosphate isomerase	356					angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)					TTTCCAGGGCGACATGGAGTC	0.393													52	239	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36219920	36219920	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36219920C>A	uc010eei.2	+	22	4722	c.4722C>A	c.(4720-4722)CAC>CAA	p.H1574Q		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1574					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTTCTCACACCTGGAGGACC	0.602													13	239	---	---	---	---	PASS
WDR62	284403	broad.mit.edu	37	19	36594257	36594257	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36594257C>T	uc002odc.2	+	30	3603	c.3512C>T	c.(3511-3513)ACG>ATG	p.T1171M	WDR62_uc002odd.2_Missense_Mutation_p.T1176M	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	1171	WD 14.				cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCCTGCCTTACGAGCCTGGCG	0.642													51	143	---	---	---	---	PASS
ZNF565	147929	broad.mit.edu	37	19	36673707	36673707	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36673707G>A	uc002odn.2	-	5	1269	c.1161C>T	c.(1159-1161)GGC>GGT	p.G387G	ZNF565_uc010ees.2_Silent_p.G322G|ZNF565_uc002odo.2_Silent_p.G387G	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565	387					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			AGGGTCTGTCGCCAGTATGGA	0.463													27	307	---	---	---	---	PASS
GGN	199720	broad.mit.edu	37	19	38877212	38877212	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38877212G>A	uc002oij.1	-	3	825	c.690C>T	c.(688-690)GCC>GCT	p.A230A	GGN_uc002oik.1_Intron|GGN_uc010efy.1_Silent_p.A147A	NM_152657	NP_689870	Q86UU5	GGN_HUMAN	gametogenetin	230	Interaction with GGNBP1 (By similarity).|Pro-rich.				cell differentiation|multicellular organismal development|spermatogenesis						0	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCGCAGGCTGGGCCATTTCGC	0.677													5	86	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41356272	41356272	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41356272C>G	uc002opl.3	-	1	81	c.60G>C	c.(58-60)TTG>TTC	p.L20F	CYP2A6_uc010ehe.1_5'UTR|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	20					coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	AAACAGACATCAAGACCATTA	0.562													10	869	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43579569	43579569	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43579569C>A	uc002ovr.2	-	3	739	c.646G>T	c.(646-648)GAA>TAA	p.E216*	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Nonsense_Mutation_p.E216*|PSG2_uc010eiq.1_Nonsense_Mutation_p.E216*|PSG2_uc002ovs.3_Nonsense_Mutation_p.E216*|PSG2_uc002ovt.3_Nonsense_Mutation_p.E216*	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	216	Ig-like C2-type 1.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				ATTTCACATTCATAGGGTCCT	0.512													191	458	---	---	---	---	PASS
GPR4	2828	broad.mit.edu	37	19	46094366	46094366	+	Silent	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46094366G>T	uc002pcm.2	-	2	1704	c.759C>A	c.(757-759)GGC>GGA	p.G253G	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	253	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		CCCAGGGGCGGCCCAGGTAGA	0.622													38	58	---	---	---	---	PASS
FUT2	2524	broad.mit.edu	37	19	49206451	49206451	+	Missense_Mutation	SNP	G	A	A	rs143120145	byFrequency	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49206451G>A	uc002pke.3	+	2	349	c.238G>A	c.(238-240)GCC>ACC	p.A80T	FUT2_uc010emc.2_Missense_Mutation_p.A80T	NM_001097638	NP_001091107	Q10981	FUT2_HUMAN	fucosyltransferase 2	80	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	galactoside 2-alpha-L-fucosyltransferase activity			central_nervous_system(1)	1		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)		GGGCGAGTACGCCACACTGTA	0.627													9	46	---	---	---	---	PASS
GPR32	2854	broad.mit.edu	37	19	51274601	51274601	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51274601G>T	uc010ycf.1	+	1	744	c.744G>T	c.(742-744)TGG>TGT	p.W248C		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	248	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GGGAGGGCTGGGTCCATGCCA	0.612													8	119	---	---	---	---	PASS
SIGLEC14	100049587	broad.mit.edu	37	19	52149112	52149112	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52149112C>G	uc002pxf.3	-	3	743	c.623G>C	c.(622-624)GGC>GCC	p.G208A		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	208	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GAGGTTGGTGCCATGGTCCTC	0.637													25	64	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53612976	53612976	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53612976T>C	uc002qax.2	-	7	815	c.466A>G	c.(466-468)AAC>GAC	p.N156D	ZNF415_uc002qat.2_Missense_Mutation_p.N120D|ZNF415_uc002qaw.2_Missense_Mutation_p.N108D|ZNF415_uc010yds.1_Missense_Mutation_p.N108D|ZNF415_uc010ydt.1_Missense_Mutation_p.N108D|ZNF415_uc002qau.2_Missense_Mutation_p.N95D|ZNF415_uc002qav.2_Missense_Mutation_p.N120D|ZNF415_uc002qba.2_5'UTR|ZNF415_uc002qay.2_Missense_Mutation_p.N95D|ZNF415_uc002qaz.2_Missense_Mutation_p.N156D	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	156					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		GTCACTTTGTTGCAATTTCTT	0.373													9	214	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760442	54760442	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760442C>A	uc002qex.2	-	3	376	c.265G>T	c.(265-267)GTG>TTG	p.V89L	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.V89L|LILRB5_uc002qey.2_Missense_Mutation_p.V89L|LILRB5_uc002qez.2_Missense_Mutation_p.V89L|LILRB5_uc002qfa.1_Missense_Mutation_p.V79L|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	89	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGTCATACACCGTGGATGGA	0.607													57	486	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54974197	54974197	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54974197C>G	uc010yez.1	-	1	698	c.579G>C	c.(577-579)GAG>GAC	p.E193D		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	193					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		ACTCGGCACCCTCTGCCCCGT	0.731													4	26	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55451509	55451509	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55451509C>T	uc002qih.3	-	4	754	c.678G>A	c.(676-678)CTG>CTA	p.L226L	NLRP7_uc002qig.3_Silent_p.L226L|NLRP7_uc002qii.3_Silent_p.L226L|NLRP7_uc010esk.2_Silent_p.L226L|NLRP7_uc010esl.2_Silent_p.L254L	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	226	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CTTTGGAGATCAGCTCTGCAA	0.552													19	162	---	---	---	---	PASS
HSPBP1	23640	broad.mit.edu	37	19	55776691	55776691	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55776691G>A	uc002qjx.2	-	6	1208	c.1098C>T	c.(1096-1098)CTC>CTT	p.L366L	HSPBP1_uc002qjy.2_Silent_p.L320L|HSPBP1_uc002qkb.2_Missense_Mutation_p.P317S|HSPBP1_uc002qka.2_Silent_p.L320L|HSPBP1_uc002qkd.2_Silent_p.L320L|HSPBP1_uc002qkc.2_Silent_p.L320L|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	323					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGTGGCGGAGGAGCTCCTCCA	0.657													42	87	---	---	---	---	PASS
ZFP28	140612	broad.mit.edu	37	19	57065666	57065666	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57065666C>T	uc002qnj.2	+	8	1583	c.1512C>T	c.(1510-1512)CCC>CCT	p.P504P	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	504					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GGGAGAAACCCTTTGATTGCA	0.438													37	113	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326170	57326170	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326170C>A	uc002qnu.2	-	7	3991	c.3640G>T	c.(3640-3642)GCA>TCA	p.A1214S	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.A1185S|PEG3_uc002qnv.2_Missense_Mutation_p.A1214S|PEG3_uc002qnw.2_Missense_Mutation_p.A1090S|PEG3_uc002qnx.2_Missense_Mutation_p.A1088S|PEG3_uc010etr.2_Missense_Mutation_p.A1214S	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1214					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTCCTCTCTGCAGCACGATTC	0.488													45	110	---	---	---	---	PASS
ZNF8	7554	broad.mit.edu	37	19	58805630	58805630	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58805630G>A	uc002qry.1	+	4	586	c.456G>A	c.(454-456)GAG>GAA	p.E152E	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	152					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		CACTCAAGGAGCAGAATAACT	0.507													16	38	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3520918	3520918	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3520918A>T	uc002wim.2	+	3	634	c.544A>T	c.(544-546)AGT>TGT	p.S182C	ATRN_uc002wil.2_Missense_Mutation_p.S182C	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	182	Extracellular (Potential).|CUB.				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						TACAGAGTGTAGTTGGGACCA	0.338													70	372	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	15967362	15967362	+	Intron	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15967362T>C	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TCAATCACTGTTTTGAACAGG	0.348													5	47	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20066172	20066172	+	Intron	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20066172C>A	uc002wru.2	+						C20orf26_uc010gcw.1_Intron|C20orf26_uc010zse.1_Intron|C20orf26_uc010zsf.1_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CAGAAGAATTCGTGTTGAGGT	0.423													17	174	---	---	---	---	PASS
HNF4A	3172	broad.mit.edu	37	20	43058160	43058160	+	Intron	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43058160C>A	uc002xma.2	+						HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Intron	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TTTGTCCTTCCAGCCACCCCT	0.617													78	216	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44665972	44665972	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44665972G>T	uc010zxl.1	+	6	705	c.629G>T	c.(628-630)GGC>GTC	p.G210V	SLC12A5_uc002xra.2_Missense_Mutation_p.G187V|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Missense_Mutation_p.G187V	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	210	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TTCTACCTGGGCACTACCTTT	0.547													14	59	---	---	---	---	PASS
CD40	958	broad.mit.edu	37	20	44755307	44755307	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44755307C>T	uc002xrg.1	+	6	603	c.526C>T	c.(526-528)CAG>TAG	p.Q176*	CD40_uc002xrh.1_Intron|CD40_uc002xri.1_Nonsense_Mutation_p.Q176*|CD40_uc002xrj.1_RNA|CD40_uc002xrk.1_Intron|CD40_uc002xrl.1_5'Flank	NM_001250	NP_001241	P25942	TNR5_HUMAN	CD40 antigen isoform 1 precursor	176	TNFR-Cys 4.|Extracellular (Potential).				B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity			lung(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)			Simvastatin(DB00641)	GGTTGTGCAACAGGCAGGCAC	0.498									Immune_Deficiency_with_Hyper-IgM				20	129	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027084	55027084	+	Silent	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027084T>C	uc002xxp.2	+	6	1077	c.852T>C	c.(850-852)AGT>AGC	p.S284S	CASS4_uc002xxq.3_Silent_p.S284S|CASS4_uc002xxr.2_Silent_p.S284S|CASS4_uc010zze.1_Silent_p.S230S|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	284					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						ATCCTCCAAGTGGCAGATCCA	0.507													4	130	---	---	---	---	PASS
PMEPA1	56937	broad.mit.edu	37	20	56227421	56227421	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56227421G>A	uc002xyq.2	-	4	945	c.552C>T	c.(550-552)CGC>CGT	p.R184R	PMEPA1_uc002xyr.2_Silent_p.R134R|PMEPA1_uc002xys.2_Silent_p.R149R|PMEPA1_uc002xyt.2_Silent_p.R134R	NM_020182	NP_064567	Q969W9	PMEPA_HUMAN	transmembrane prostate androgen-induced protein	184	Cytoplasmic (Potential).				androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1						TTGGGGGTGCGCGCACCGACT	0.677													11	51	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415203	57415203	+	Silent	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415203C>A	uc002xzt.2	+	1	409	c.42C>A	c.(40-42)CGC>CGA	p.R14R	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCGAGCTCGCCATAATTACA	0.682			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			9	66	---	---	---	---	PASS
NTSR1	4923	broad.mit.edu	37	20	61386124	61386124	+	Missense_Mutation	SNP	C	A	A	rs140186245		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61386124C>A	uc002ydf.2	+	2	1173	c.802C>A	c.(802-804)CGC>AGC	p.R268S		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	268	Cytoplasmic (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGTCATGGTACGCCAGGCGGC	0.622													17	129	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61522414	61522414	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61522414C>A	uc002ydr.1	-	15	3703	c.3439G>T	c.(3439-3441)GGT>TGT	p.G1147C	DIDO1_uc002yds.1_Missense_Mutation_p.G1147C|DIDO1_uc002ydt.1_Missense_Mutation_p.G1147C|DIDO1_uc002ydu.1_Missense_Mutation_p.G1147C	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1147					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					GCTACAACACCAAAGCGGCCA	0.557													15	85	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15561360	15561360	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15561360G>C	uc002yjm.2	-	2	500	c.490C>G	c.(490-492)CTT>GTT	p.L164V	LIPI_uc010gkw.1_Missense_Mutation_p.L97V	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	143					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		CTTACCAAAAGATTTTTAATG	0.333													8	115	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22746194	22746194	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22746194C>T	uc002yld.1	+	9	1305	c.1056C>T	c.(1054-1056)GGC>GGT	p.G352G	NCAM2_uc011acb.1_Silent_p.G210G|NCAM2_uc011acc.1_Silent_p.G377G	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	352	Ig-like C2-type 4.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GCCTGGACGGCCGTATCGAAG	0.413													4	147	---	---	---	---	PASS
KRTAP10-7	386675	broad.mit.edu	37	21	46021554	46021554	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46021554T>G	uc002zfn.3	+	2	1043	c.1018T>G	c.(1018-1020)TGC>GGC	p.C340G	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	345	29.|30 X 5 AA repeats of C-C-X(3).					keratin filament					0						GGCCAGCTGCTGCCGCCCAGC	0.701													11	40	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29726514	29726514	+	Silent	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29726514C>T	uc003afj.2	-	21	2803	c.2619G>A	c.(2617-2619)GCG>GCA	p.A873A	AP1B1_uc003afi.2_Silent_p.A866A|AP1B1_uc003afk.2_Silent_p.A866A|AP1B1_uc003afl.2_Silent_p.A846A|AP1B1_uc003afh.2_Silent_p.A70A|AP1B1_uc011ako.1_Silent_p.A426A	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	873					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						GCTTGCTGCTCGCAGCCTCTG	0.652													29	92	---	---	---	---	PASS
ASCC2	84164	broad.mit.edu	37	22	30185168	30185168	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30185168C>T	uc003agr.2	-	20	2213	c.2108G>A	c.(2107-2109)CGG>CAG	p.R703Q	ASCC2_uc003ags.2_RNA|ASCC2_uc003agt.2_Missense_Mutation_p.R703Q|ASCC2_uc011akr.1_Missense_Mutation_p.R627Q	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	703					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			GCTGTCATGCCGGTACCTGAG	0.642													9	431	---	---	---	---	PASS
TCN2	6948	broad.mit.edu	37	22	31019016	31019016	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31019016G>A	uc003aip.1	+	8	1326	c.1168G>A	c.(1168-1170)GGA>AGA	p.G390R	TCN2_uc003aiq.1_Missense_Mutation_p.G386R|TCN2_uc003air.1_Missense_Mutation_p.G363R	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor	390					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAAGCGGCCGGAGAAAGGGA	0.562													14	135	---	---	---	---	PASS
C22orf28	51493	broad.mit.edu	37	22	32791054	32791054	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32791054C>A	uc003amm.2	-	9	1269	c.1138G>T	c.(1138-1140)GCT>TCT	p.A380S		NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	380					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						GGAGGGAAAGCGCGGGTGGAT	0.478													11	122	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38120361	38120361	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38120361A>G	uc003atr.2	+	7	2069	c.1798A>G	c.(1798-1800)ACA>GCA	p.T600A	TRIOBP_uc003atu.2_Missense_Mutation_p.T428A|TRIOBP_uc003atq.1_Missense_Mutation_p.T600A|TRIOBP_uc003ats.1_Missense_Mutation_p.T428A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	600					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CAACCCCACAACATCCTGTGC	0.577													14	157	---	---	---	---	PASS
MCHR1	2847	broad.mit.edu	37	22	41077401	41077401	+	Silent	SNP	T	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41077401T>G	uc003ayz.2	+	2	1006	c.738T>G	c.(736-738)CCT>CCG	p.P246P	MCHR1_uc003aza.2_Silent_p.P135P	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24	246	Helical; Name=4; (Potential).				elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						GCATCACCCCTGTGTGGCTGT	0.612													28	151	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41739497	41739497	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41739497G>A	uc003azw.2	+	13	1592	c.1376G>A	c.(1375-1377)CGG>CAG	p.R459Q	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	475					interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						GGCCGGCTCCGGAGCTCGGAG	0.667													10	89	---	---	---	---	PASS
PARVG	64098	broad.mit.edu	37	22	44584988	44584988	+	Intron	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44584988C>T	uc011aqe.1	+						PARVG_uc003bep.2_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				CCTCTCCTGCCTCCAGAGAGG	0.647													4	73	---	---	---	---	PASS
FAM19A5	25817	broad.mit.edu	37	22	49042420	49042420	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49042420G>C	uc003bim.3	+	2	241	c.124G>C	c.(124-126)GCC>CCC	p.A42P	FAM19A5_uc003bio.3_Missense_Mutation_p.A35P	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine	42						extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TCAGCTGGCCGCCGGCACCTG	0.577													3	24	---	---	---	---	PASS
GLRA2	2742	broad.mit.edu	37	X	14748527	14748527	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14748527C>A	uc010nep.2	+	10	1611	c.1279C>A	c.(1279-1281)CCA>ACA	p.P427T	GLRA2_uc010neq.2_Missense_Mutation_p.P427T|GLRA2_uc004cwe.3_Missense_Mutation_p.P427T|GLRA2_uc011mio.1_Missense_Mutation_p.P338T|GLRA2_uc011mip.1_Missense_Mutation_p.P405T	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A	427	Helical; (Probable).				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	AGCTGCCTTCCCATTGGCCTT	0.468													59	90	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23410788	23410788	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23410788A>T	uc004dal.3	+	3	1161	c.1153A>T	c.(1153-1155)ACC>TCC	p.T385S		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	385	Helical; (Potential).|SSD.				cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						GTACCTGGTCACCTTTGGCAT	0.468													53	78	---	---	---	---	PASS
FAM48B1	100130302	broad.mit.edu	37	X	24382696	24382696	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24382696G>T	uc011mjx.1	+	1	1819	c.1819G>T	c.(1819-1821)GGC>TGC	p.G607C		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						AGGCTCCACTGGCCTAAAGGC	0.612													14	11	---	---	---	---	PASS
LANCL3	347404	broad.mit.edu	37	X	37527655	37527655	+	Intron	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37527655C>G	uc011mkd.1	+						LANCL3_uc004ddp.1_Missense_Mutation_p.L380V	NM_198511	NP_940913	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3								catalytic activity				0						gatggaacatctgctgtatac	0.015													8	57	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48849876	48849876	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48849876G>T	uc004dly.1	-	6	456	c.421C>A	c.(421-423)CAG>AAG	p.Q141K	GRIPAP1_uc004dlz.2_5'Flank|GRIPAP1_uc004dma.2_Intron	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	141	Potential.					early endosome				breast(2)|kidney(1)	3						TTTTCAGCCTGTAGCCTCAGC	0.617													3	18	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53642764	53642764	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53642764C>T	uc004dsp.2	-	22	2392	c.1990G>A	c.(1990-1992)GAT>AAT	p.D664N		NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	664					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ATGAGCTCATCGACAGCACTC	0.443													29	39	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77267092	77267092	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77267092C>G	uc004ecx.3	+	9	2253	c.2093C>G	c.(2092-2094)TCT>TGT	p.S698C	ATP7A_uc004ecw.2_3'UTR	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	698	Extracellular (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						CTTCATTCTTCTATGTTCCTG	0.383													17	340	---	---	---	---	PASS
APOOL	139322	broad.mit.edu	37	X	84310876	84310876	+	Silent	SNP	G	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84310876G>A	uc004eem.2	+	5	353	c.339G>A	c.(337-339)CCG>CCA	p.P113P	APOOL_uc010nmp.2_Intron	NM_198450	NP_940852	Q6UXV4	APOOL_HUMAN	apolipoprotein O-like precursor	113						extracellular region					0						ATTTTCTTCCGAAAATGGGAG	0.338													15	8	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104464752	104464752	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104464752G>T	uc004ema.2	-	2	442	c.330C>A	c.(328-330)GAC>GAA	p.D110E	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.D110E	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	110						intracellular	zinc ion binding			ovary(2)	2						GCTTCTTCAGGTCTGATGCCA	0.617													10	25	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105279114	105279114	+	Silent	SNP	T	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105279114T>C	uc004eme.1	-	2	901	c.885A>G	c.(883-885)TTA>TTG	p.L295L	SERPINA7_uc010npd.2_Silent_p.L295L|SERPINA7_uc010npe.1_Silent_p.L295L	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	295					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	CCTTCTGTAGTAAGCGGTTCC	0.493													132	203	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112022909	112022909	+	Splice_Site	SNP	C	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112022909C>A	uc004epr.2	-	10	2474	c.2474_splice	c.e10-1	p.G825_splice	AMOT_uc004eps.2_Splice_Site_p.G416_splice|AMOT_uc011mtc.1_Intron	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1						actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						AGGAGAATGCCTACAAATGAA	0.458													19	26	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135960086	135960086	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135960086C>T	uc004fae.1	-	4	586	c.376G>A	c.(376-378)GGA>AGA	p.G126R	RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_Missense_Mutation_p.G126R|RBMX_uc011mwg.1_Missense_Mutation_p.G87R|RBMX_uc004faf.1_Intron|RBMX_uc010nsf.1_Missense_Mutation_p.G87R|RBMX_uc004fag.1_5'UTR	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	126						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ATGTGTCCTCCCCGTGAGGGA	0.547													39	40	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140995307	140995307	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140995307C>G	uc004fbt.2	+	4	2403	c.2117C>G	c.(2116-2118)TCT>TGT	p.S706C	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	706							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GACTCCCTGTCTTCTCTCCAT	0.552										HNSCC(15;0.026)			85	90	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16386305	16386306	+	Intron	INS	-	C	C	rs143272992		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386305_16386306insC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGTGATCTGGGCCCCCAAGGAC	0.599													6	3	---	---	---	---	
BTBD8	284697	broad.mit.edu	37	1	92592063	92592064	+	Intron	INS	-	GT	GT	rs148177634	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92592063_92592064insGT	uc001doo.2	+						BTBD8_uc010otc.1_Intron	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		CTCCTCAATCCTCTTCACTCAT	0.441													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30445955	30445956	+	IGR	INS	-	GGAAGGAA	GGAAGGAA			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30445955_30445956insGGAAGGAA								YPEL5 (62557 upstream) : LBH (8441 downstream)																							CTCTGTCCCTTggaaggaagga	0.282													4	2	---	---	---	---	
FEZ2	9637	broad.mit.edu	37	2	36785621	36785622	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36785621_36785622insT	uc002rph.2	-	6	985_986	c.938_939insA	c.(937-939)AACfs	p.N313fs	FEZ2_uc002rpe.2_Frame_Shift_Ins_p.N142fs|FEZ2_uc002rpf.2_Frame_Shift_Ins_p.N142fs|FEZ2_uc002rpg.2_Frame_Shift_Ins_p.N340fs|FEZ2_uc002rpi.2_Frame_Shift_Ins_p.N168fs|FEZ2_uc002rpj.2_Intron	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1	313					axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				ACGGTGGTCCGTTTTTTTTCTC	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42303371	42303374	+	IGR	DEL	GAAG	-	-	rs71974419		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42303371_42303374delGAAG								PKDCC (17705 upstream) : EML4 (93116 downstream)																							aagatggaaagaaggaaggaagga	0.000													5	3	---	---	---	---	
NCAPH	23397	broad.mit.edu	37	2	97017424	97017424	+	Intron	DEL	C	-	-	rs772153		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97017424delC	uc002svz.1	+						NCAPH_uc010fhu.1_Intron|NCAPH_uc010fhv.1_Intron|NCAPH_uc010yum.1_Intron|NCAPH_uc010fhw.1_Intron|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				aaaaaaaaaacaaaaacaaaC	0.189													7	4	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107021832	107021833	+	Intron	DEL	TT	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021832_107021833delTT	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						GGGGGGGttctttttttttttt	0.163													3	3	---	---	---	---	
RBM45	129831	broad.mit.edu	37	2	178986131	178986134	+	Intron	DEL	ACAC	-	-	rs11895951		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178986131_178986134delACAC	uc002ulv.2	+							NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45						cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			atgtatatatacacacacacacac	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208519446	208519447	+	IGR	INS	-	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208519446_208519447insC								FAM119A (29381 upstream) : CCNYL1 (56817 downstream)																							aaactctgcctcaaaaaaaaaa	0.168													4	2	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47087837	47087837	+	Intron	DEL	T	-	-	rs13063578		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47087837delT	uc003cqs.2	-						SETD2_uc003cqv.2_Intron|SETD2_uc003cqr.2_Intron	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		aaaaaaaaaataaaataaaat	0.080			N|F|S|Mis		clear cell renal carcinoma								4	2	---	---	---	---	
NT5DC2	64943	broad.mit.edu	37	3	52559181	52559181	+	Intron	DEL	T	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52559181delT	uc003deo.2	-						NT5DC2_uc003dem.2_Intron|NT5DC2_uc003den.2_Intron|NT5DC2_uc010hmi.2_Intron|NT5DC2_uc010hmj.2_Intron	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2								hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GGGGGGGGGGTTTCCTGGCCC	0.706													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													9	8	---	---	---	---	
C3orf15	89876	broad.mit.edu	37	3	119459682	119459683	+	Intron	INS	-	TGTG	TGTG	rs57901016		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119459682_119459683insTGTG	uc003ede.3	+						C3orf15_uc010hqz.2_Intron|C3orf15_uc011bjd.1_Intron|C3orf15_uc011bje.1_Intron	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha							mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		CTGTCAGCATTtgtgtgtgtgt	0.168													4	3	---	---	---	---	
PLD1	5337	broad.mit.edu	37	3	171417825	171417826	+	Intron	DEL	TC	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171417825_171417826delTC	uc003fhs.2	-						PLD1_uc003fht.2_Intron	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	CTTAGTtctttctctctctctc	0.277													4	3	---	---	---	---	
PITX2	5308	broad.mit.edu	37	4	111554138	111554138	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111554138delC	uc003iad.2	-	2	599	c.17delG	c.(16-18)CGCfs	p.R6fs	PITX2_uc003iae.2_Frame_Shift_Del_p.R6fs|PITX2_uc010iml.2_5'UTR|PITX2_uc003iaf.2_Frame_Shift_Del_p.R6fs	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	6					determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CACCAGTTTGCGGCAGTTGGT	0.602													276	161	---	---	---	---	
SRFBP1	153443	broad.mit.edu	37	5	121297441	121297442	+	5'Flank	INS	-	AA	AA	rs2972696	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121297441_121297442insAA	uc003kst.1	+							NM_152546	NP_689759	Q8NEF9	SRFB1_HUMAN	serum response factor binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		cacacacacacaAACCGAATCT	0.406													2	4	---	---	---	---	
IL17F	112744	broad.mit.edu	37	6	52109409	52109409	+	5'Flank	DEL	T	-	-	rs3215541		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52109409delT	uc003pam.1	-							NM_052872	NP_443104	Q96PD4	IL17F_HUMAN	interleukin 17F precursor						cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)					AATGCAGGGGTTTTTTTTTTT	0.418													7	4	---	---	---	---	
ZUFSP	221302	broad.mit.edu	37	6	116982068	116982068	+	Intron	DEL	T	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116982068delT	uc003pxf.1	-						ZUFSP_uc010kef.1_Intron	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		ttttctttgcttttttttttt	0.129													4	2	---	---	---	---	
IFNGR1	3459	broad.mit.edu	37	6	137518967	137518967	+	3'UTR	DEL	A	-	-	rs75851921		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137518967delA	uc003qho.2	-	7					IFNGR1_uc011edm.1_3'UTR	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTTTTTGTTTAAAAAAAAAAA	0.373													4	2	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35013117	35013117	+	Intron	DEL	C	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35013117delC	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						AAGGTTAAGTCAAAGTTACCT	0.313													39	17	---	---	---	---	
CCL26	10344	broad.mit.edu	37	7	75419496	75419497	+	5'Flank	INS	-	CTTTCTTT	CTTTCTTT	rs150074330	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419496_75419497insCTTTCTTT	uc003udt.1	-							NM_006072	NP_006063	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						ttccttccttcctttctttctt	0.000													6	3	---	---	---	---	
DMTF1	9988	broad.mit.edu	37	7	86822881	86822881	+	Intron	DEL	G	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86822881delG	uc003uih.2	+						DMTF1_uc003uii.2_Intron|DMTF1_uc003uij.2_Intron|DMTF1_uc011khb.1_Intron|DMTF1_uc003uik.2_Intron|DMTF1_uc003uil.2_Intron|DMTF1_uc003uin.2_Intron	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					AGGGACATTAGAAGAACAAAG	0.408													7	5	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99778503	99778503	+	Intron	DEL	G	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99778503delG	uc003utx.1	+						STAG3_uc010lgs.1_Intron|STAG3_uc011kjk.1_Intron	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGTACATCCTGtttttttttt	0.234													4	2	---	---	---	---	
GIMAP5	55340	broad.mit.edu	37	7	150438187	150438188	+	Intron	DEL	AC	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150438187_150438188delAC	uc003whr.1	+						GIMAP5_uc010lpu.2_Intron	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5							integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		acacacacagacacacacacac	0.351													5	3	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130867637	130867637	+	Intron	DEL	A	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130867637delA	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			gctctgcctcaaaaaaaaaaa	0.149													3	3	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	116019140	116019141	+	Intron	INS	-	A	A	rs10705989		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116019140_116019141insA	uc010muu.1	-						SLC31A1_uc004bgu.2_Intron|SLC31A1_uc004bgv.3_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						gaatccgtatcaaaaaaaaaaa	0.213													3	3	---	---	---	---	
LHX3	8022	broad.mit.edu	37	9	139090465	139090466	+	Intron	INS	-	C	C	rs147905773	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139090465_139090466insC	uc004cha.2	-						LHX3_uc004cgz.2_Intron	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a						inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CGCGCGCTCGTCCCCCCCCGAG	0.639													8	6	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140267711	140267729	+	Intron	DEL	GAGGGTGAAGCCACGGGCT	-	-	rs59889670		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140267711_140267729delGAGGGTGAAGCCACGGGCT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCAGGGGGCAGAGGGTGAAGCCACGGGCTGAGTCTTGGC	0.685													4	5	---	---	---	---	
BMS1	9790	broad.mit.edu	37	10	43311874	43311877	+	Intron	DEL	ACTA	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43311874_43311877delACTA	uc001jaj.2	+							NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein						ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						ATGATGAAATACTAACTGTTTTAC	0.417													4	3	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112355981	112355981	+	Intron	DEL	A	-	-	rs66754857		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112355981delA	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		accctgtctcaaaaaaaaaaa	0.119													5	4	---	---	---	---	
ACCS	84680	broad.mit.edu	37	11	44096363	44096363	+	Intron	DEL	T	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44096363delT	uc009yks.1	+						EXT2_uc010rfo.1_5'Flank|ACCS_uc010rfm.1_Intron|ACCS_uc010rfn.1_Intron|ACCS_uc001mxx.2_Intron	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase								1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						cttccttctCttttttttttt	0.070													4	3	---	---	---	---	
XRRA1	143570	broad.mit.edu	37	11	74631052	74631052	+	Intron	DEL	A	-	-	rs112064551		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74631052delA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						ATAAAACTGCAAAAAAAAAAA	0.333													4	2	---	---	---	---	
DRD2	1813	broad.mit.edu	37	11	113294976	113294976	+	Intron	DEL	T	-	-	rs11608185	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113294976delT	uc001pnz.2	-						DRD2_uc010rwv.1_Intron|DRD2_uc001poa.3_Intron|DRD2_uc001pob.3_Intron|DRD2_uc009yyr.1_Intron	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	AAAAACCACCTGGGGAAGCAC	0.423													3	3	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54967655	54967656	+	Intron	DEL	GT	-	-	rs56974446	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54967655_54967656delGT	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GAGAGAGAGAgtgtgtgtgtgt	0.292													8	4	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201447	+	Intron	DEL	AA	-	-	rs35024436		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446_123201447delAA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAAA	0.401													8	6	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133767906	133767906	+	Intron	DEL	A	-	-	rs75668420		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133767906delA	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ctgtctcaacaaaaaaaaaaa	0.114													4	3	---	---	---	---	
SLC25A21	89874	broad.mit.edu	37	14	37203617	37203618	+	Intron	INS	-	TA	TA	rs149858951	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37203617_37203618insTA	uc001wtz.1	-							NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		TTTTAGTGCTTTATATATAATT	0.297													4	2	---	---	---	---	
RTN1	6252	broad.mit.edu	37	14	60259077	60259078	+	Intron	INS	-	CA	CA	rs138580008	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60259077_60259078insCA	uc001xen.1	-							NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AGAAAAGACTTcacacacacac	0.322													3	3	---	---	---	---	
RPL3L	6123	broad.mit.edu	37	16	2002712	2002713	+	Intron	DEL	AC	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2002712_2002713delAC	uc002cnh.2	-							NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						CAACcacacaacacacacacac	0.228													11	5	---	---	---	---	
CES1	1066	broad.mit.edu	37	16	55845084	55845085	+	Intron	INS	-	G	G	rs138015167	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55845084_55845085insG	uc002eim.2	-						CES1_uc010ccf.2_Intron|CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	ATGAATCAAATGGGCTTATATC	0.347													4	2	---	---	---	---	
CHD3	1107	broad.mit.edu	37	17	7809667	7809667	+	Intron	DEL	G	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7809667delG	uc002gje.2	+						CHD3_uc002gjd.2_Intron|CHD3_uc002gjf.2_Intron|CHD3_uc002gjh.2_Intron	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				CAAGGCCAAAGGGAAAGACCC	0.582													21	11	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42958798	42958800	+	Intron	DEL	CTC	-	-	rs3217522		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42958798_42958800delCTC	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				CTTAGTACTTCTCCTATATTAGG	0.394													3	4	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43912267	43912268	+	3'UTR	INS	-	G	G	rs140399885	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43912267_43912268insG	uc010dap.2	+	14					CRHR1_uc010wjx.1_3'UTR|CRHR1_uc002ijp.2_3'UTR|CRHR1_uc002ijm.2_3'UTR|CRHR1_uc002ijn.2_3'UTR|CRHR1_uc010dar.2_3'UTR|CRHR1_uc010dao.2_3'UTR|CRHR1_uc010daq.2_3'UTR	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		ACTGACAGCCTGGGGGGGCCGC	0.678													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47342484	47342485	+	IGR	INS	-	TTCC	TTCC			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47342484_47342485insTTCC								PHOSPHO1 (34356 upstream) : ZNF652 (24084 downstream)																							CCGCTATTTAtttccttccttc	0.168													4	2	---	---	---	---	
MRPL38	64978	broad.mit.edu	37	17	73900852	73900852	+	Intron	DEL	C	-	-	rs71942292		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73900852delC	uc010wso.1	-						FBF1_uc002jqa.1_Intron|MRPL38_uc002jpz.1_Intron	NM_032478	NP_115867	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38 precursor							actin cytoskeleton|mitochondrion|ribosome				pancreas(1)	1			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGGCGACAGCCCCCCCCCCC	0.756													4	2	---	---	---	---	
PCP2	126006	broad.mit.edu	37	19	7698226	7698227	+	Intron	INS	-	TAAT	TAAT	rs151032321	by1000genomes	TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7698226_7698227insTAAT	uc002mgz.2	-							NM_174895	NP_777555	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2						signal transduction		GTPase activator activity				0						GCCCTACAAACTAGTCTTGTCA	0.609													1	6	---	---	---	---	
ZNF431	170959	broad.mit.edu	37	19	21366765	21366765	+	Frame_Shift_Del	DEL	A	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21366765delA	uc002npp.2	+	5	1806	c.1659delA	c.(1657-1659)TCAfs	p.S553fs	ZNF431_uc010ecq.2_Frame_Shift_Del_p.S462fs|ZNF431_uc010ecr.2_Frame_Shift_Del_p.S554fs	NM_133473	NP_597730	Q8TF32	ZN431_HUMAN	zinc finger protein 431	553					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(2)	2						ACCAGTCCTCAAACCTTATTA	0.343													75	41	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107406	42107409	+	IGR	DEL	CACG	-	-	rs111362097		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107406_42107409delCACG								CEACAM21 (14210 upstream) : CEACAM4 (17935 downstream)																							CCCAGTAGGacacgcacgcacgcg	0.162													4	2	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55777911	55777912	+	Intron	INS	-	C	C			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777911_55777912insC	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		catcaccatgacatcaccaaca	0.030													4	2	---	---	---	---	
PTTG1IP	754	broad.mit.edu	37	21	46274942	46274943	+	Intron	INS	-	G	G			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46274942_46274943insG	uc002zgb.1	-						PTTG1IP_uc011afj.1_Intron|PTTG1IP_uc011afk.1_Intron	NM_004339	NP_004330	P53801	PTTG_HUMAN	pituitary tumor-transforming gene 1						protein import into nucleus	cytoplasm|integral to membrane|nucleus				ovary(1)	1				Colorectal(79;0.0659)		AGATATTCTTAGGAGTGAGTTC	0.520													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18842473	18842473	+	Intron	DEL	G	-	-	rs66618606		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18842473delG	uc010grj.1	+						uc002zoe.2_RNA					Homo sapiens mRNA; cDNA DKFZp434K191 (from clone DKFZp434K191).																		AGCTGCTGGTGGGGAGGTCTT	0.647													8	10	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43459640	43459641	+	Intron	INS	-	T	T	rs77325620		TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43459640_43459641insT	uc003bdi.2	-						TTLL1_uc010gzh.2_Intron|TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		taatttccgtattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	102408326	102408329	+	IGR	DEL	GAAG	-	-			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102408326_102408329delGAAG								NXF3 (60304 upstream) : BEX4 (61691 downstream)																							gagagggagagaaggaaggaagga	0.083													4	2	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107408661	107408662	+	Frame_Shift_Ins	INS	-	A	A			TCGA-66-2767-01A-01D-1522-08	TCGA-66-2767-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107408661_107408662insA	uc004enw.3	-	38	3852_3853	c.3749_3750insT	c.(3748-3750)TTGfs	p.L1250fs	COL4A6_uc004env.3_Frame_Shift_Ins_p.L1249fs|COL4A6_uc011msn.1_Frame_Shift_Ins_p.L1225fs|COL4A6_uc010npk.2_Frame_Shift_Ins_p.L1225fs|COL4A6_uc010npj.2_5'Flank	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1250	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						TGAGTGAGGGCAAGGAGATGCC	0.589									Alport_syndrome_with_Diffuse_Leiomyomatosis				69	44	---	---	---	---	
