Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MXRA8	54587	broad.mit.edu	37	1	1289896	1289896	+	Intron	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1289896G>A	uc001aew.2	-						MXRA8_uc001aex.3_Intron|MXRA8_uc001aey.3_Intron|MXRA8_uc010nyl.1_Intron|MXRA8_uc001aez.2_Intron|MXRA8_uc001afa.2_Intron	NM_032348	NP_115724	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8 precursor							integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGGTCTGCGGGGAACGCGGGG	0.721													13	43	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17552360	17552360	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17552360G>A	uc001bah.1	+	5	555	c.463G>A	c.(463-465)GAC>AAC	p.D155N		NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	155					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GGTGAACTGTGACCGGGACAA	0.592													41	144	---	---	---	---	PASS
RAP1GAP	5909	broad.mit.edu	37	1	21936075	21936075	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21936075A>G	uc001bex.2	-	15	1322	c.1064T>C	c.(1063-1065)TTC>TCC	p.F355S	RAP1GAP_uc001bev.2_Missense_Mutation_p.F355S|RAP1GAP_uc001bew.2_Missense_Mutation_p.F419S|RAP1GAP_uc001bey.2_Missense_Mutation_p.F355S	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c	355	Rap-GAP.				regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CACCTTCCTGAACACAGCGGG	0.612													27	145	---	---	---	---	PASS
MTF1	4520	broad.mit.edu	37	1	38300828	38300828	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38300828T>C	uc001cce.1	-	6	1054	c.913A>G	c.(913-915)AGT>GGT	p.S305G	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	305	C2H2-type 6.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTTTTGAGACTGTATTGAGTG	0.393													3	176	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39799867	39799867	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39799867A>G	uc010oiu.1	+	1	3058	c.2927A>G	c.(2926-2928)AAA>AGA	p.K976R	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2541	Plectin 9.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAACTCAAAAGAGTTGAG	0.363													5	153	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60476071	60476071	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60476071C>T	uc001czs.1	-	9	1277	c.1185G>A	c.(1183-1185)TTG>TTA	p.L395L	C1orf87_uc001czr.1_5'Flank	NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795	395							calcium ion binding			ovary(1)|breast(1)	2						CACCTGTAGGCAAATCAGATA	0.388													16	102	---	---	---	---	PASS
SFRS11	9295	broad.mit.edu	37	1	70716181	70716181	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70716181G>A	uc001des.2	+	12	1376	c.1252G>A	c.(1252-1254)GTA>ATA	p.V418I	SFRS11_uc001det.2_Missense_Mutation_p.V418I|SFRS11_uc001deu.2_Missense_Mutation_p.V425I|SFRS11_uc001dev.2_Missense_Mutation_p.V228I|SFRS11_uc001dew.2_Missense_Mutation_p.V358I	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	418					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						TGATAAAGATGTAAAAGTATG	0.189													32	115	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74701805	74701805	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74701805C>T	uc001dgf.1	+	2	111	c.60C>T	c.(58-60)GTC>GTT	p.V20V	TNNI3K_uc001dgc.1_Silent_p.V121V|TNNI3K_uc001dgd.2_Silent_p.V121V|TNNI3K_uc001dge.1_Silent_p.V121V	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	20						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						AGAAAAAAGTCAGTGAATCAT	0.308													5	55	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82408777	82408777	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82408777C>T	uc001dit.3	+	6	703	c.522C>T	c.(520-522)CCC>CCT	p.P174P	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Silent_p.P174P|LPHN2_uc001div.2_Silent_p.P174P|LPHN2_uc009wcd.2_Silent_p.P174P	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	174	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ATTTCATGCCCTGGACTCCCT	0.398													36	151	---	---	---	---	PASS
LPAR3	23566	broad.mit.edu	37	1	85279701	85279701	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85279701T>C	uc001dkl.2	-	2	929	c.890A>G	c.(889-891)GAC>GGC	p.D297G	LPAR3_uc009wcj.1_Missense_Mutation_p.D297G	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	297	Helical; Name=7; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						CATGTCCTCGTCCTTGTAGGA	0.567													23	129	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111854925	111854925	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111854925G>A	uc001eas.2	+	4	272	c.169G>A	c.(169-171)GCC>ACC	p.A57T	CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	57					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CCTGATCTACGCCTTTGCTGG	0.542													21	126	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152277864	152277864	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152277864A>G	uc001ezu.1	-	3	9534	c.9498T>C	c.(9496-9498)CGT>CGC	p.R3166R		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3166	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTCCTCATTACGTGTTGTTC	0.557									Ichthyosis				207	422	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152283889	152283889	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283889G>C	uc001ezu.1	-	3	3509	c.3473C>G	c.(3472-3474)TCC>TGC	p.S1158C	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1158	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCCTCTTGGGACGCTGAGTG	0.597									Ichthyosis				9	694	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325143	152325143	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325143G>T	uc001ezw.3	-	3	5192	c.5119C>A	c.(5119-5121)CAC>AAC	p.H1707N	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1707							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGATGATAGTGGGCATGTCTA	0.488													110	531	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158651388	158651388	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158651388A>G	uc001fst.1	-	4	659	c.460T>C	c.(460-462)TTG>CTG	p.L154L		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	154	Spectrin 2.		L -> LL (in EL2).		actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GCCCGCAGCAACTGGTCACCC	0.522													83	224	---	---	---	---	PASS
ITLN1	55600	broad.mit.edu	37	1	160850481	160850481	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160850481A>T	uc001fxc.2	-	6	698	c.582T>A	c.(580-582)TAT>TAA	p.Y194*		NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor	194	Fibrinogen C-terminal.				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TTCCTTCTCCATATTTCACTG	0.453													102	225	---	---	---	---	PASS
RC3H1	149041	broad.mit.edu	37	1	173933297	173933297	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173933297C>A	uc001gju.3	-	10	1732	c.1645G>T	c.(1645-1647)GCC>TCC	p.A549S	RC3H1_uc010pms.1_Missense_Mutation_p.A549S|RC3H1_uc001gjv.2_Missense_Mutation_p.A549S|RC3H1_uc010pmt.1_Missense_Mutation_p.A549S	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin	549	Pro-rich.				cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ACAGGTAAGGCAGAAATACTC	0.398													24	68	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196436902	196436902	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196436902G>A	uc001gtd.1	-	7	534	c.474C>T	c.(472-474)TCC>TCT	p.S158S	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.S158S|KCNT2_uc001gtf.1_Silent_p.S158S|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Silent_p.S158S|KCNT2_uc009wyv.1_Silent_p.S133S	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	158	Helical; Name=Segment S3; (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						GATTCCTTAAGGAAGGCCAGA	0.303													6	59	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197576299	197576299	+	Silent	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197576299C>A	uc001guf.3	-	13	1163	c.825G>T	c.(823-825)GTG>GTT	p.V275V	DENND1B_uc010ppe.1_Silent_p.V255V|DENND1B_uc010ppf.1_RNA|DENND1B_uc001gue.3_Silent_p.V245V|DENND1B_uc001gug.3_Silent_p.V74V	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2	275	DENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						ATTTGTTTTTCACTCTCTATA	0.274													3	58	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848337	215848337	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848337G>T	uc001hku.1	-	63	13303	c.12916C>A	c.(12916-12918)CTC>ATC	p.L4306I		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4306	Fibronectin type-III 28.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAAGGATAGAGCATTTCATTC	0.393										HNSCC(13;0.011)			56	138	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850766	216850766	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850766C>G	uc001hkw.1	-	2	290	c.124G>C	c.(124-126)GAA>CAA	p.E42Q	ESRRG_uc001hky.1_Missense_Mutation_p.E19Q|ESRRG_uc009xdp.1_Missense_Mutation_p.E19Q|ESRRG_uc001hkz.1_Missense_Mutation_p.E19Q|ESRRG_uc010puc.1_Missense_Mutation_p.E19Q|ESRRG_uc001hla.1_Missense_Mutation_p.E19Q|ESRRG_uc001hlb.1_Missense_Mutation_p.E19Q|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.E19Q|ESRRG_uc001hld.1_Missense_Mutation_p.E19Q|ESRRG_uc001hkx.1_Missense_Mutation_p.E47Q|ESRRG_uc009xdo.1_Missense_Mutation_p.E19Q|ESRRG_uc001hle.1_Missense_Mutation_p.E19Q	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	42				E->A: 4-fold increase in transcriptional activity.	positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CTGGAAGGTTCCGTCTTGATG	0.478													30	66	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223177009	223177009	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223177009C>G	uc001hnu.1	+	8	2417	c.2270C>G	c.(2269-2271)TCG>TGG	p.S757W		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	757					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		GTGTTCCGGTCGTCCCATCCT	0.463													45	151	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228509756	228509756	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228509756G>A	uc009xez.1	+	55	15258	c.15214G>A	c.(15214-15216)GTA>ATA	p.V5072I	OBSCN_uc001hsn.2_Missense_Mutation_p.V5072I	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5072					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCGCCAGGCGGTAACTCGCTT	0.592													3	17	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248570209	248570209	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570209C>A	uc010pzm.1	+	1	914	c.914C>A	c.(913-915)GCC>GAC	p.A305D		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	305	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TACGGGGCTGCCATGTACACC	0.527													84	139	---	---	---	---	PASS
IFT172	26160	broad.mit.edu	37	2	27676897	27676897	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27676897C>T	uc002rku.2	-	33	3714	c.3663G>A	c.(3661-3663)GGG>GGA	p.G1221G	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1221					cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					GGAGCAGCAGCCCTTCTGCTT	0.622													49	247	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32466102	32466102	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32466102C>G	uc002roi.2	-	5	2596	c.2350G>C	c.(2350-2352)GCT>CCT	p.A784P	NLRC4_uc002roj.1_Missense_Mutation_p.A784P|NLRC4_uc010ezt.1_Missense_Mutation_p.A119P	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	784	LRR 6.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GAAATCTGACCTAGTTTTATA	0.378													38	64	---	---	---	---	PASS
MTA3	57504	broad.mit.edu	37	2	42871290	42871290	+	Silent	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42871290C>G	uc002rso.1	+	7	907	c.237C>G	c.(235-237)GTC>GTG	p.V79V	MTA3_uc002rsp.1_Silent_p.V79V|MTA3_uc002rsq.2_Silent_p.V135V|MTA3_uc002rsr.2_Silent_p.V135V	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	135	BAH.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ACTCATTGGTCTATGACCCCT	0.353													10	103	---	---	---	---	PASS
CLEC4F	165530	broad.mit.edu	37	2	71043700	71043700	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71043700G>T	uc002shf.2	-	4	890	c.813C>A	c.(811-813)AAC>AAA	p.N271K	CLEC4F_uc010yqv.1_Missense_Mutation_p.N271K	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN	C-type lectin, superfamily member 13	271	Extracellular (Potential).				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(5)	5						TTAAAACCTGGTTCTGGGTCC	0.438													77	225	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79313613	79313613	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79313613C>A	uc002sny.2	-	4	313	c.201G>T	c.(199-201)ATG>ATT	p.M67I	REG1B_uc010ffv.1_Missense_Mutation_p.M67I|REG1B_uc010ffw.2_3'UTR	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	67	C-type lectin.				cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						TGCCTGAATTCATGTTCTGGC	0.498													50	101	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101646111	101646111	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101646111G>A	uc010fiv.2	-	12	2150	c.2019C>T	c.(2017-2019)CTC>CTT	p.L673L	TBC1D8_uc002tau.3_Silent_p.L430L	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	673	Rab-GAP TBC.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						GCATGATGCTGAGGAACAGGG	0.557													7	94	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109380809	109380809	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109380809G>A	uc002tem.3	+	20	3940	c.3814G>A	c.(3814-3816)GCA>ACA	p.A1272T		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1272	RanBD1 1.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CCTTGATTATGCAGATGAGTT	0.383													60	226	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135744425	135744425	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135744425G>A	uc002tue.1	-	7	2048	c.2017C>T	c.(2017-2019)CAT>TAT	p.H673Y	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.H560Y|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Missense_Mutation_p.H401Y|YSK4_uc002tui.3_Missense_Mutation_p.H690Y	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	673							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTCGCACATGACAATAAACA	0.393													52	348	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566354	136566354	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566354C>A	uc002tuu.1	-	8	3574	c.3563G>T	c.(3562-3564)AGC>ATC	p.S1188I		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1188	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTCAGTGAAGCTTGGCAGGCG	0.537													59	155	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139316664	139316664	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139316664C>G	uc002tvh.2	+	6	953	c.553C>G	c.(553-555)CGT>GGT	p.R185G		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	185						nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GCCTGAGTGTCGTCTAGCAGA	0.373													6	200	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168105153	168105153	+	Silent	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168105153T>A	uc002udx.2	+	8	7269	c.7251T>A	c.(7249-7251)GGT>GGA	p.G2417G	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.G2242G|XIRP2_uc010fpq.2_Silent_p.G2195G|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2242					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GAAAAACCGGTGTGTTGCCAC	0.438													48	121	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170029730	170029730	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170029730G>T	uc002ues.2	-	57	11232	c.11019C>A	c.(11017-11019)AGC>AGA	p.S3673R		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3673	LDL-receptor class A 29.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GATGGGCAGAGCTCACTGAAA	0.468													10	46	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170042283	170042283	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042283C>T	uc002ues.2	-	50	9788	c.9575G>A	c.(9574-9576)CGG>CAG	p.R3192Q		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3192	EGF-like 12; calcium-binding (Potential).|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACTGTTTTGCCGGCAGGTCTT	0.428													82	225	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179736969	179736969	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179736969T>C	uc002unf.1	-	3	302	c.245A>G	c.(244-246)AAA>AGA	p.K82R		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	82	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CCGTTCTGCTTTCTGGTTTTC	0.423													3	140	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191903920	191903920	+	Intron	SNP	T	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191903920T>G	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc010zgk.1_Intron|STAT4_uc002uso.2_Intron	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			AGAAATAGAGTCTACCTGGGA	0.433													9	84	---	---	---	---	PASS
NIF3L1	60491	broad.mit.edu	37	2	201760025	201760025	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201760025G>A	uc002uwm.2	+	4	729	c.638G>A	c.(637-639)TGT>TAT	p.C213Y	NIF3L1_uc002uwl.2_Missense_Mutation_p.C186Y|NIF3L1_uc002uwn.2_Missense_Mutation_p.C186Y|NIF3L1_uc002uwo.2_Missense_Mutation_p.C213Y|NIF3L1_uc002uwp.2_Missense_Mutation_p.C213Y|NIF3L1_uc002uwq.2_Missense_Mutation_p.C213Y	NM_001136039	NP_001129511	Q9GZT8	NIF3L_HUMAN	NIF3 NGG1 interacting factor 3-like 1 isoform 1	213					positive regulation of transcription, DNA-dependent		transcription factor binding			skin(1)	1						AATCTGAATTGTACTCAGAAG	0.373													46	181	---	---	---	---	PASS
LANCL1	10314	broad.mit.edu	37	2	211300191	211300191	+	Intron	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211300191T>A	uc010zjh.1	-						LANCL1_uc002ved.2_Intron|LANCL1_uc010fuq.2_Intron	NM_001136574	NP_001130046	O43813	LANC1_HUMAN	lanthionine synthetase C-like protein 1							cytoplasm|integral to plasma membrane|microtubule cytoskeleton|nucleus	catalytic activity|G-protein coupled receptor activity|glutathione binding|low-density lipoprotein particle receptor binding|SH3 domain binding|zinc ion binding				0				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		AAACTGAAAATGAGACCAAGT	0.363													17	94	---	---	---	---	PASS
KCNE4	23704	broad.mit.edu	37	2	223917651	223917651	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223917651G>A	uc002vnl.3	+	2	257	c.103G>A	c.(103-105)GAG>AAG	p.E35K		NM_080671	NP_542402	Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related	35						integral to membrane	voltage-gated potassium channel activity			ovary(1)	1		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CAATGGCAACGAGTACTTCTA	0.592													5	99	---	---	---	---	PASS
ECEL1	9427	broad.mit.edu	37	2	233344865	233344865	+	Nonstop_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233344865A>G	uc002vsv.2	-	18	2531	c.2326T>C	c.(2326-2328)TGA>CGA	p.*776R	ECEL1_uc010fya.1_Nonstop_Mutation_p.*774R|ECEL1_uc010fyb.1_Nonstop_Mutation_p.*483R	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	776					neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		AGCCAGGCTCACCACACGGAA	0.672													14	34	---	---	---	---	PASS
NDUFA10	4705	broad.mit.edu	37	2	240951107	240951107	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240951107C>T	uc002vyn.2	-	6	756	c.676G>A	c.(676-678)GAA>AAA	p.E226K	NDUFA10_uc010fzc.1_Missense_Mutation_p.E256K	NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	226					mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	ATCTTCATTTCATGTGGCTAA	0.403													34	81	---	---	---	---	PASS
ZNF197	10168	broad.mit.edu	37	3	44685345	44685345	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44685345G>A	uc003cnm.2	+	6	2929	c.2723G>A	c.(2722-2724)GGA>GAA	p.G908E	ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	908	C2H2-type 20.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AATGAGTGTGGAAAAGACTTT	0.358													66	144	---	---	---	---	PASS
KIF9	64147	broad.mit.edu	37	3	47316965	47316965	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47316965A>G	uc010hjp.2	-	4	713	c.109T>C	c.(109-111)TTA>CTA	p.L37L	KIF9_uc003cqx.2_Silent_p.L37L|KIF9_uc003cqy.2_Silent_p.L37L|KIF9_uc011bat.1_RNA|KIF9_uc011bau.1_RNA|KIF9_uc003cra.3_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2	37	Kinesin-motor.				blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TCTTTTTTTAAGTGAATATCA	0.363													16	85	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52366376	52366376	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52366376G>T	uc011bef.1	+	8	1513	c.1252G>T	c.(1252-1254)GCC>TCC	p.A418S	DNAH1_uc003ddt.1_Missense_Mutation_p.A418S	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	418	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAAGCAGTGGGCCCTGAGCAC	0.582													13	46	---	---	---	---	PASS
TIGIT	201633	broad.mit.edu	37	3	114026870	114026870	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114026870G>A	uc003ebg.1	+	4	661	c.627G>A	c.(625-627)GGG>GGA	p.G209G		NM_173799	NP_776160	Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	209	Cytoplasmic (Potential).				negative regulation of interleukin-12 production|negative regulation of T cell activation|positive regulation of interleukin-10 production	cell surface|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)	1						CACCTGCTGGGCTCTGTGGAG	0.572													50	267	---	---	---	---	PASS
PCOLCE2	26577	broad.mit.edu	37	3	142567068	142567068	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142567068T>G	uc003evd.2	-	3	635	c.439A>C	c.(439-441)AAC>CAC	p.N147H		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	147						extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						CCTCTTTCGTTTGGTTCAGCA	0.438													109	62	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155203221	155203221	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203221G>A	uc011bok.1	-	22	3199	c.2922C>T	c.(2920-2922)GAC>GAT	p.D974D	PLCH1_uc011boj.1_Silent_p.D974D|PLCH1_uc011bol.1_Silent_p.D936D	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	974					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GAAGGTTTCTGTCAACAGGCA	0.468													47	263	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164786893	164786893	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164786893C>A	uc003fei.2	-	4	408	c.346G>T	c.(346-348)GTT>TTT	p.V116F		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	116	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	ATGTCTTGAACGTTATAACCA	0.378										HNSCC(35;0.089)			69	61	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907836	164907836	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907836A>C	uc003fej.3	-	2	1227	c.783T>G	c.(781-783)TGT>TGG	p.C261W	SLITRK3_uc003fek.2_Missense_Mutation_p.C261W	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	261	LRRCT 1.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						AAGGGGTCTCACAGGTAATGT	0.473										HNSCC(40;0.11)			6	447	---	---	---	---	PASS
MRPL47	57129	broad.mit.edu	37	3	179320569	179320569	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179320569A>G	uc003fjz.2	-	2	137	c.115T>C	c.(115-117)TTG>CTG	p.L39L	MRPL47_uc003fka.2_Intron|MRPL47_uc003fkb.2_Intron|NDUFB5_uc003fkc.2_5'Flank|NDUFB5_uc003fkd.2_5'Flank|NDUFB5_uc003fke.2_5'Flank	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	39					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			CTCTTAGGCAACAAACTAAGA	0.289													24	321	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114294795	114294795	+	Intron	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114294795T>A	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc010imr.2_Intron|ANK2_uc010ims.2_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCAGGGAGACTTGTAGGCATT	0.338													3	47	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156634686	156634686	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156634686C>T	uc003iov.2	+	8	2059	c.1523C>T	c.(1522-1524)GCA>GTA	p.A508V	GUCY1A3_uc010iqc.2_Missense_Mutation_p.A508V|GUCY1A3_uc003iow.2_Missense_Mutation_p.A508V|GUCY1A3_uc010iqd.2_Missense_Mutation_p.A507V|GUCY1A3_uc003iox.2_Missense_Mutation_p.A508V|GUCY1A3_uc003ioz.2_Missense_Mutation_p.A273V|GUCY1A3_uc003ioy.2_Missense_Mutation_p.A508V|GUCY1A3_uc010iqe.2_Missense_Mutation_p.A273V|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.A508V	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	508	Guanylate cyclase.				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		ATGCTCAATGCACTGTACACT	0.502													27	47	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177067317	177067317	+	Intron	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177067317A>G	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATGGGTATGTATTTTTGGATT	0.294													33	117	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	22078793	22078793	+	5'UTR	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22078793G>T	uc010iuc.2	-	2					CDH12_uc011cno.1_5'UTR|CDH12_uc003jgk.2_5'UTR	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CATTGGCAAAGGCTTTCCTAC	0.448										HNSCC(59;0.17)			61	184	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262200	45262200	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262200C>G	uc003jok.2	-	8	2521	c.2496G>C	c.(2494-2496)AGG>AGC	p.R832S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	832	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GGACAGTGCTCCTGCCCCCTG	0.677													27	56	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262826	45262826	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262826G>A	uc003jok.2	-	8	1895	c.1870C>T	c.(1870-1872)CAG>TAG	p.Q624*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	624	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TTCACAATCTGCTTGAGGATT	0.433													20	162	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102465368	102465368	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102465368C>A	uc003kod.3	+	2	594	c.75C>A	c.(73-75)TTC>TTA	p.F25L	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.F25L|PPIP5K2_uc010jbo.1_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	25					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						GACATTTCTTCCACCATGCAG	0.358													10	33	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153056685	153056685	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153056685G>C	uc003lva.3	+	7	1358	c.993G>C	c.(991-993)TGG>TGC	p.W331C	GRIA1_uc003luy.3_Missense_Mutation_p.W331C|GRIA1_uc003luz.3_Missense_Mutation_p.W236C|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.W251C|GRIA1_uc011dcx.1_Missense_Mutation_p.W262C|GRIA1_uc011dcy.1_Missense_Mutation_p.W341C|GRIA1_uc011dcz.1_Missense_Mutation_p.W341C|GRIA1_uc010jia.1_Missense_Mutation_p.W311C	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	331	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTGTTCCCTGGGGCCAAGGGA	0.552													9	34	---	---	---	---	PASS
GABRB2	2561	broad.mit.edu	37	5	160838029	160838029	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160838029T>A	uc003lys.1	-	6	711	c.493A>T	c.(493-495)AGG>TGG	p.R165W	GABRB2_uc011deh.1_Missense_Mutation_p.R4W|GABRB2_uc003lyr.1_Missense_Mutation_p.R165W|GABRB2_uc003lyt.1_Missense_Mutation_p.R165W|GABRB2_uc010jiu.1_Missense_Mutation_p.R102W	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	165	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GGGTACCTCCTTAGGTCCATC	0.443													26	78	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169446101	169446101	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169446101G>T	uc003maf.2	+	33	3450	c.3370G>T	c.(3370-3372)GAT>TAT	p.D1124Y	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.D616Y	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1124	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGAAGTGGGGATTTCAAAAA	0.453													85	173	---	---	---	---	PASS
MAK	4117	broad.mit.edu	37	6	10764777	10764777	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10764777C>G	uc003mzl.2	-	13	2009	c.1780G>C	c.(1780-1782)GCA>CCA	p.A594P	SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jos.1_Intron|MAK_uc010jot.2_RNA|MAK_uc010jou.2_RNA|MAK_uc003mzm.2_Missense_Mutation_p.A594P	NM_005906	NP_005897	P20794	MAK_HUMAN	male germ cell-associated kinase	594					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|cyclin-dependent protein kinase activity			breast(2)|skin(1)	3	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				AGGTTTTTTGCTGTAGGATTA	0.458													71	169	---	---	---	---	PASS
NEDD9	4739	broad.mit.edu	37	6	11190369	11190369	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11190369T>A	uc003mzv.2	-	5	1900	c.1733A>T	c.(1732-1734)GAG>GTG	p.E578V	NEDD9_uc010joz.2_Missense_Mutation_p.E578V|NEDD9_uc003mzw.3_Missense_Mutation_p.E432V	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	578					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GTGTGGGTACTCCGTTGAGTT	0.617													41	105	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12161770	12161770	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12161770G>T	uc003nac.2	+	8	6765	c.6586G>T	c.(6586-6588)GAC>TAC	p.D2196Y	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2196					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CGATGATGAGGACAGCCAGGC	0.478													34	83	---	---	---	---	PASS
FAM8A1	51439	broad.mit.edu	37	6	17601125	17601125	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17601125C>T	uc003ncc.2	+	1	608	c.485C>T	c.(484-486)GCG>GTG	p.A162V		NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	162						integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			CCCCAggccgcggcgccgccg	0.632													4	19	---	---	---	---	PASS
HSPA1L	3305	broad.mit.edu	37	6	31777883	31777883	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31777883C>T	uc003nxh.2	-	2	2050	c.1867G>A	c.(1867-1869)GGA>AGA	p.G623R	HSPA1L_uc010jte.2_Missense_Mutation_p.G623R	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	623					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6						TACCCTGTTCCGCAGGCAGGC	0.458													27	96	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38952061	38952061	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38952061G>A	uc003ooe.1	+	85	12980	c.12380G>A	c.(12379-12381)CGT>CAT	p.R4127H	DNAH8_uc003oog.1_Missense_Mutation_p.R576H	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTTGACAAACGTCTACTTAAT	0.348													29	89	---	---	---	---	PASS
GPR111	222611	broad.mit.edu	37	6	47649746	47649746	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47649746G>T	uc010jzj.1	+	6	1452	c.1451G>T	c.(1450-1452)CGC>CTC	p.R484L	GPR111_uc010jzk.1_Missense_Mutation_p.R416L|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	484	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						ACCTATTTACGCCATGTGTGC	0.468													39	132	---	---	---	---	PASS
PGK2	5232	broad.mit.edu	37	6	49754437	49754437	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49754437G>A	uc003ozu.2	-	1	571	c.464C>T	c.(463-465)TCC>TTC	p.S155F		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	155					glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					CCCTAGCTTGGAAAGTGATGC	0.498													40	106	---	---	---	---	PASS
CNR1	1268	broad.mit.edu	37	6	88854426	88854426	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854426G>C	uc011dzq.1	-	2	4131	c.568C>G	c.(568-570)CTG>GTG	p.L190V	CNR1_uc010kbz.2_Missense_Mutation_p.L190V|CNR1_uc011dzr.1_Missense_Mutation_p.L190V|CNR1_uc011dzs.1_Missense_Mutation_p.L190V|CNR1_uc003pmq.3_Missense_Mutation_p.L190V|CNR1_uc011dzt.1_Missense_Mutation_p.L190V|CNR1_uc010kca.2_Missense_Mutation_p.L157V	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	190	Helical; Name=3; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	AGTTTGAACAGAAACACGTTG	0.577													5	56	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109871346	109871346	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109871346C>T	uc003ptn.2	-	25	2988	c.2911G>A	c.(2911-2913)GAA>AAA	p.E971K	AKD1_uc011eat.1_Missense_Mutation_p.E50K	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	971					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						AAAAACTTTTCTTTAGCCTCA	0.408													30	213	---	---	---	---	PASS
SERINC1	57515	broad.mit.edu	37	6	122772854	122772854	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122772854C>A	uc003pyy.1	-	7	875	c.805G>T	c.(805-807)GTC>TTC	p.V269F		NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1	269	Helical; (Potential).				phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)		ATTGTGTAGACTGTAATTACT	0.299													3	68	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599751	136599751	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599751G>T	uc003qgx.1	-	4	521	c.268C>A	c.(268-270)CGA>AGA	p.R90R	BCLAF1_uc003qgw.1_Silent_p.R90R|BCLAF1_uc003qgy.1_Silent_p.R88R|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.R88R	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	90					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TAACCACCTCGATGATATCTA	0.458													39	315	---	---	---	---	PASS
OPRM1	4988	broad.mit.edu	37	6	154412554	154412554	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154412554A>C	uc003qpr.2	+	3	1348	c.1111A>C	c.(1111-1113)AAC>CAC	p.N371H	OPRM1_uc011efc.1_Missense_Mutation_p.N290H|OPRM1_uc011efd.1_Missense_Mutation_p.N271H|OPRM1_uc011efe.1_Missense_Mutation_p.N464H|OPRM1_uc003qpn.2_Missense_Mutation_p.N371H|OPRM1_uc003qpo.1_Missense_Mutation_p.N371H|OPRM1_uc011eff.1_Missense_Mutation_p.N371H|OPRM1_uc011efg.1_Missense_Mutation_p.N371H|OPRM1_uc011efh.1_Missense_Mutation_p.N371H|OPRM1_uc003qpq.1_Missense_Mutation_p.N371H|OPRM1_uc003qpt.1_Missense_Mutation_p.N371H|OPRM1_uc011efi.1_Missense_Mutation_p.N371H|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Missense_Mutation_p.N271H|OPRM1_uc003qpu.2_Missense_Mutation_p.N271H	NM_000914	NP_000905	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1	371	Cytoplasmic (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	AATTCGTCAGAACACTAGAGA	0.423													12	86	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	168947856	168947856	+	Intron	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168947856C>T	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GAAGGTGAGCCGGGGTGGGGA	0.512													40	128	---	---	---	---	PASS
NPSR1	387129	broad.mit.edu	37	7	34698163	34698163	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34698163T>C	uc003teg.1	+	1	267	c.139T>C	c.(139-141)TCC>CCC	p.S47P	AAA1_uc010kwo.1_Intron|AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron|AAA1_uc003teb.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Missense_Mutation_p.S47P|NPSR1_uc010kwt.1_5'UTR|NPSR1_uc010kwu.1_5'UTR|NPSR1_uc010kwv.1_Missense_Mutation_p.S47P|NPSR1_uc003tei.1_Missense_Mutation_p.S47P|NPSR1_uc010kww.1_Missense_Mutation_p.S47P|NPSR1_uc011kar.1_Missense_Mutation_p.S47P	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma	47	Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	CTTCTACTACTCCTTTAAGGT	0.453													22	98	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36552884	36552884	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36552884C>A	uc003tfh.3	-	21	2103	c.1702G>T	c.(1702-1704)GTG>TTG	p.V568L	AOAH_uc010kxf.2_Missense_Mutation_p.R607S|AOAH_uc011kba.1_Missense_Mutation_p.V536L	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	568					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						TCTCCAAACACCTGTTTAATC	0.552													39	126	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38768288	38768288	+	Intron	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38768288C>A	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron|VPS41_uc003tgx.2_Intron	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						TCAATTTTACCCACCATCAAC	0.413													31	114	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66474576	66474576	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66474576G>T	uc003tvn.2	+	4	429	c.280G>T	c.(280-282)GCA>TCA	p.A94S	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	94	Flavodoxin-like.				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				TTAGGGATTCGCAACAGTTCT	0.398													61	144	---	---	---	---	PASS
TRIM50	135892	broad.mit.edu	37	7	72727109	72727109	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72727109T>G	uc010lbd.1	-	7	1397	c.1272A>C	c.(1270-1272)GAA>GAC	p.E424D	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Missense_Mutation_p.E424D|TRIM50_uc003txz.1_Missense_Mutation_p.E423D	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	424	B30.2/SPRY.					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						AGAAGGTGAGTTCGCCCTGCT	0.672													2	6	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82545860	82545860	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82545860C>T	uc003uhx.2	-	7	11731	c.11442G>A	c.(11440-11442)AAG>AAA	p.K3814K	PCLO_uc003uhv.2_Silent_p.K3814K|PCLO_uc010lec.2_Silent_p.K779K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3745					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTCTCTCTCCTTTAATAGGG	0.448													32	153	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94058634	94058634	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94058634G>T	uc003ung.1	+	51	4317	c.3846G>T	c.(3844-3846)GAG>GAT	p.E1282D	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1282	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGATGAGGAGACTGGCAACC	0.478										HNSCC(75;0.22)			49	64	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100732826	100732826	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100732826A>G	uc003uxq.2	+	3	2464	c.2233A>G	c.(2233-2235)ATC>GTC	p.I745V	TRIM56_uc003uxr.2_Intron	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	745					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					TAACGGGACCATCCACATCTT	0.607													34	23	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101870787	101870787	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101870787G>C	uc003uyx.3	+	21	3309	c.3271G>C	c.(3271-3273)GAG>CAG	p.E1091Q	CUX1_uc003uys.3_Missense_Mutation_p.E1102Q|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	1091					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CAAGCCACCAGAGCCCAGTGA	0.637													9	64	---	---	---	---	PASS
JHDM1D	80853	broad.mit.edu	37	7	139791688	139791688	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139791688C>T	uc003vvm.2	-	19	2651	c.2647G>A	c.(2647-2649)GGT>AGT	p.G883S	JHDM1D_uc010lng.2_RNA	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	883					midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					GAAGTTTCACCAACTGGCCTT	0.502													69	80	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142562028	142562028	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142562028C>A	uc011kst.1	+	7	1257	c.470C>A	c.(469-471)ACA>AAA	p.T157K	EPHB6_uc011ksu.1_Missense_Mutation_p.T157K|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_Intron|EPHB6_uc003wbu.2_5'UTR	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	157	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					AAGGTGGACACAATTGCAGCA	0.527													31	200	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142640367	142640367	+	Missense_Mutation	SNP	C	A	A	rs138511569		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142640367C>A	uc003wcb.2	-	16	1977	c.1767G>T	c.(1765-1767)CAG>CAT	p.Q589H		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	589	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					ACCCACAGAGCTGGTAGAAGA	0.557													21	27	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151874332	151874332	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151874332C>G	uc003wla.2	-	38	8425	c.8206G>C	c.(8206-8208)GAT>CAT	p.D2736H	MLL3_uc003wkz.2_Missense_Mutation_p.D1797H|MLL3_uc003wky.2_Missense_Mutation_p.D245H	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2736	Asp-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCCAAATTATCTAAAGTATCC	0.373			N		medulloblastoma								6	155	---	---	---	---	PASS
MCPH1	79648	broad.mit.edu	37	8	6266789	6266789	+	Intron	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6266789C>T	uc003wqi.2	+						MCPH1_uc003wqh.2_Intron|MCPH1_uc011kwl.1_Intron|uc003wqf.2_5'Flank	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		ATGTTCATATCTTGTTTTCAG	0.333													28	51	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51621485	51621485	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51621485G>T	uc010lxy.1	+	18	1602	c.1231G>T	c.(1231-1233)GGA>TGA	p.G411*	SNTG1_uc003xqs.1_Nonsense_Mutation_p.G411*|SNTG1_uc010lxz.1_Nonsense_Mutation_p.G411*|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	411					cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCATCTAATGGGACTCACAAT	0.358													5	180	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71075761	71075761	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71075761G>T	uc003xyn.1	-	8	933	c.771C>A	c.(769-771)CCC>CCA	p.P257P		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	257					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TTTCCTTCATGGGAACTCTTC	0.398			T	RUNXBP2	AML								14	53	---	---	---	---	PASS
CA3	761	broad.mit.edu	37	8	86356323	86356323	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86356323G>T	uc003ydj.2	+	4	495	c.412G>T	c.(412-414)GAT>TAT	p.D138Y	CA3_uc011lfv.1_RNA	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III	138					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						GAAGCAGCGCGATGGGATCGC	0.383													35	49	---	---	---	---	PASS
POLR2K	5440	broad.mit.edu	37	8	101163649	101163649	+	Intron	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101163649G>A	uc003yjf.2	+							NM_005034	NP_005025	P53803	RPAB4_HUMAN	DNA directed RNA polymerase II polypeptide K						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GTGGAGGTAAGAGTAGCACTT	0.338													4	123	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113392599	113392599	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113392599A>G	uc003ynu.2	-	38	6277	c.6118T>C	c.(6118-6120)TTT>CTT	p.F2040L	CSMD3_uc003yns.2_Missense_Mutation_p.F1242L|CSMD3_uc003ynt.2_Missense_Mutation_p.F2000L|CSMD3_uc011lhx.1_Missense_Mutation_p.F1936L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2040	Extracellular (Potential).|CUB 11.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCAAGATGAAATCCTGCAGCA	0.274										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	184	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116616272	116616272	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116616272G>T	uc003ynz.2	-	3	2344	c.1885C>A	c.(1885-1887)CTC>ATC	p.L629I	TRPS1_uc011lhy.1_Missense_Mutation_p.L633I|TRPS1_uc003yny.2_Missense_Mutation_p.L642I|TRPS1_uc010mcy.2_Missense_Mutation_p.L629I	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	629	C2H2-type 3; atypical.				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGAAAGAGGAGTACATCTACG	0.512									Langer-Giedion_syndrome				3	88	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116632234	116632234	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116632234C>A	uc003ynz.2	-	2	511	c.52G>T	c.(52-54)GGC>TGC	p.G18C	TRPS1_uc011lhy.1_Missense_Mutation_p.G22C|TRPS1_uc003yny.2_Missense_Mutation_p.G31C|TRPS1_uc010mcy.2_Missense_Mutation_p.G18C	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	18					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AGGATCTGGCCCTCGCCTTCA	0.438									Langer-Giedion_syndrome				67	59	---	---	---	---	PASS
NSMCE2	286053	broad.mit.edu	37	8	126369942	126369942	+	Intron	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126369942C>G	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CCCAACATCTCCTTGATTACA	0.428													9	55	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134030218	134030218	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134030218G>T	uc003ytw.2	+	38	6799	c.6758G>T	c.(6757-6759)GGC>GTC	p.G2253V	TG_uc010mdw.2_Missense_Mutation_p.G1012V|TG_uc011ljb.1_Missense_Mutation_p.G622V|TG_uc011ljc.1_Missense_Mutation_p.G386V	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2253					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AACTGGACAGGCTCCTGGGAT	0.542													45	63	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145006714	145006714	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145006714G>A	uc003zaf.1	-	16	2412	c.2242C>T	c.(2242-2244)CGC>TGC	p.R748C	PLEC_uc003zab.1_Missense_Mutation_p.R611C|PLEC_uc003zac.1_Missense_Mutation_p.R615C|PLEC_uc003zad.2_Missense_Mutation_p.R611C|PLEC_uc003zae.1_Missense_Mutation_p.R579C|PLEC_uc003zag.1_Missense_Mutation_p.R589C|PLEC_uc003zah.2_Missense_Mutation_p.R597C|PLEC_uc003zaj.2_Missense_Mutation_p.R638C	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	748	Spectrin 2.|Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GACCTGAGGCGGGCCTTGGAG	0.657													3	109	---	---	---	---	PASS
C9orf46	55848	broad.mit.edu	37	9	5358283	5358283	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5358283C>T	uc003zjc.2	-	6	604	c.400G>A	c.(400-402)GAA>AAA	p.E134K	C9orf46_uc003zjd.2_Missense_Mutation_p.E134K	NM_018465	NP_060935	Q9HBL7	CI046_HUMAN	hypothetical protein LOC55848	134						integral to membrane				ovary(1)	1	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.00106)|Lung(218;0.125)		CTGGCTTTTTCAATGCTTTCA	0.348													23	61	---	---	---	---	PASS
RPS6	6194	broad.mit.edu	37	9	19378869	19378869	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19378869G>A	uc003znv.1	-	3	228	c.186C>T	c.(184-186)CCC>CCT	p.P62P	RPS6_uc003znu.1_Silent_p.P31P|RPS6_uc003znw.1_Silent_p.P31P	NM_001010	NP_001001	P62753	RS6_HUMAN	ribosomal protein S6	62					endocrine pancreas development|glucose homeostasis|insulin receptor signaling pathway|positive regulation of apoptosis|rRNA processing|TOR signaling cascade|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding			ovary(1)	1		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CCTGCTTCATGGGGAAACCTT	0.448													23	33	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27949217	27949217	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27949217C>A	uc003zqu.1	-	2	1647	c.1453G>T	c.(1453-1455)GCT>TCT	p.A485S	LINGO2_uc010mjf.1_Missense_Mutation_p.A485S|LINGO2_uc003zqv.1_Missense_Mutation_p.A485S	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	485	Ig-like C2-type.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GCATTGCTAGCGATGCAAACA	0.493													3	115	---	---	---	---	PASS
FCN1	2219	broad.mit.edu	37	9	137809662	137809662	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137809662A>G	uc004cfi.2	-	1	148	c.56T>C	c.(55-57)TTC>TCC	p.F19S		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	19					opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GATATGCAGGAACAAGACTAG	0.577													17	99	---	---	---	---	PASS
SLC34A3	142680	broad.mit.edu	37	9	140130626	140130626	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140130626C>A	uc004cmf.1	+	13	1744	c.1558C>A	c.(1558-1560)CCC>ACC	p.P520T	SLC34A3_uc011met.1_Missense_Mutation_p.P520T	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	520	Helical; Name=M8; (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TGTCGGGGGTCCCCTGGTGGG	0.731											OREG0019630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	10	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24833113	24833113	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24833113G>A	uc001iru.3	+	19	5317	c.4914G>A	c.(4912-4914)GTG>GTA	p.V1638V	KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Silent_p.V1321V|KIAA1217_uc001iry.2_Intron|KIAA1217_uc001isa.1_Silent_p.V474V	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	1638					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						AAAACACAGTGAGGAGGCAAG	0.473													24	102	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69935090	69935090	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69935090G>A	uc001jnm.3	+	13	2760	c.2575G>A	c.(2575-2577)GGA>AGA	p.G859R	MYPN_uc001jnn.3_Missense_Mutation_p.G584R|MYPN_uc001jno.3_Missense_Mutation_p.G859R|MYPN_uc009xpt.2_Missense_Mutation_p.G859R|MYPN_uc010qit.1_Missense_Mutation_p.G565R|MYPN_uc010qiu.1_Intron	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	859						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						GCCATCCCAGGGATTAGCGAA	0.423													14	66	---	---	---	---	PASS
HKDC1	80201	broad.mit.edu	37	10	71005859	71005859	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71005859G>T	uc001jpf.3	+	8	1033	c.900G>T	c.(898-900)CTG>CTT	p.L300L	HKDC1_uc010qje.1_Silent_p.L163L	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	300					glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						TCAGTGGCCTGTACCTGGGGG	0.532													61	104	---	---	---	---	PASS
TMEM20	159371	broad.mit.edu	37	10	95660692	95660692	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95660692A>G	uc001kjg.1	+	3	604	c.543A>G	c.(541-543)AAA>AAG	p.K181K	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Silent_p.K180K|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Silent_p.K164K|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	181	DUF6 1.					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		TCAAGGAAAAATATAGCCCTT	0.453													47	122	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123970465	123970465	+	Silent	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123970465G>A	uc001lfv.2	+	9	6885	c.6525G>A	c.(6523-6525)ACG>ACA	p.T2175T	TACC2_uc001lfw.2_Silent_p.T321T|TACC2_uc009xzx.2_Silent_p.T2130T|TACC2_uc010qtv.1_Silent_p.T2179T|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Silent_p.T253T|TACC2_uc001lga.2_Silent_p.T253T|TACC2_uc009xzy.2_Silent_p.T253T|TACC2_uc001lgb.2_Silent_p.T210T|TACC2_uc010qtw.1_Silent_p.T270T	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	2175						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGACGAAAACGGAATCTGCCA	0.587													48	145	---	---	---	---	PASS
CTBP2	1488	broad.mit.edu	37	10	126694154	126694154	+	Intron	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126694154C>A	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lid.3_Missense_Mutation_p.C75F|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		AAGCGTGCAGCACAAAGCTGG	0.612													3	38	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7063963	7063963	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7063963G>C	uc001mfb.1	+	4	1029	c.706G>C	c.(706-708)GAC>CAC	p.D236H		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	236	NACHT.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GATATCAAAGGACTGGCCCAG	0.418													59	110	---	---	---	---	PASS
OR8H3	390152	broad.mit.edu	37	11	55890082	55890082	+	Silent	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55890082C>T	uc001nii.1	+	1	234	c.234C>T	c.(232-234)GTC>GTT	p.V78V		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	78	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					CAACTGTCGTCACACCTAAAA	0.438													110	761	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57088079	57088079	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57088079G>T	uc001njr.2	-	2	514	c.202C>A	c.(202-204)CCC>ACC	p.P68T	TNKS1BP1_uc001njs.2_Missense_Mutation_p.P68T|TNKS1BP1_uc009ymd.1_5'UTR	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	68	Arg/Glu/Lys/Pro-rich (charged).				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				GGACCCCGGGGAGGCCGAGGC	0.677													10	39	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57088089	57088089	+	Silent	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57088089C>A	uc001njr.2	-	2	504	c.192G>T	c.(190-192)GGG>GGT	p.G64G	TNKS1BP1_uc001njs.2_Silent_p.G64G|TNKS1BP1_uc009ymd.1_5'UTR	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	64	Arg/Glu/Lys/Pro-rich (charged).				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				GAGGCCGAGGCCCAACAGGCA	0.672													10	35	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68181283	68181283	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68181283G>A	uc001ont.2	+	12	2705	c.2630G>A	c.(2629-2631)CGG>CAG	p.R877Q	LRP5_uc009ysg.2_Missense_Mutation_p.R287Q	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	877	Beta-propeller 3.|LDL-receptor class B 15.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						ACTAGCGGCCGGAACCGCACC	0.577													4	93	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72292489	72292489	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72292489G>T	uc010rrc.1	-	23	2200	c.1957C>A	c.(1957-1959)CCC>ACC	p.P653T	PDE2A_uc001oso.2_Missense_Mutation_p.P632T|PDE2A_uc010rra.1_Missense_Mutation_p.P646T|PDE2A_uc001osn.2_Missense_Mutation_p.P397T|PDE2A_uc010rrb.1_Missense_Mutation_p.P644T|PDE2A_uc010rrd.1_Missense_Mutation_p.P538T	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	653	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TGGTAGGGGGGATCCCGGTAG	0.587													7	11	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89911046	89911046	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89911046C>A	uc001pdf.3	+	16	1728	c.1619C>A	c.(1618-1620)CCA>CAA	p.P540Q	NAALAD2_uc009yvx.2_Missense_Mutation_p.P507Q|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	540	Extracellular (Potential).|NAALADase.				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGCAGCTACCCAGTGTACCAC	0.308													56	169	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92624033	92624033	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92624033G>T	uc001pdj.3	+	25	13445	c.13428G>T	c.(13426-13428)CCG>CCT	p.P4476P	FAT3_uc001pdi.3_Silent_p.P948P	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4508	Pro-rich.|Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGTGGGCCCGCCTGCCAGCT	0.567										TCGA Ovarian(4;0.039)			10	50	---	---	---	---	PASS
ANKK1	255239	broad.mit.edu	37	11	113266779	113266779	+	Intron	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113266779C>G	uc001pny.2	+							NM_178510	NP_848605	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1								ATP binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|ovary(1)|breast(1)	8		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		GCCTGAGCCTCCCTTTGCAGG	0.527													28	58	---	---	---	---	PASS
TMPRSS5	80975	broad.mit.edu	37	11	113563832	113563832	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113563832C>G	uc001poc.3	-	9	1047	c.925G>C	c.(925-927)GTC>CTC	p.V309L	TMPRSS5_uc009yys.2_Missense_Mutation_p.V300L|TMPRSS5_uc009yyt.2_Missense_Mutation_p.V265L|TMPRSS5_uc001pod.3_Missense_Mutation_p.V50L|TMPRSS5_uc010rww.1_Missense_Mutation_p.V230L|TMPRSS5_uc009yyu.2_Missense_Mutation_p.V50L|TMPRSS5_uc010rwx.1_Missense_Mutation_p.V196L	NM_030770	NP_110397	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	309	Peptidase S1.|Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)	1		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		AGGAGGGCGACGTCGTAGTCA	0.647													4	15	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124745138	124745138	+	Silent	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124745138T>A	uc001qbc.2	+	14	2397	c.2205T>A	c.(2203-2205)CCT>CCA	p.P735P	ROBO3_uc010saq.1_5'Flank|ROBO3_uc001qbd.2_5'Flank|ROBO3_uc010sar.1_5'Flank|ROBO3_uc001qbe.2_5'Flank|ROBO3_uc001qbf.1_5'Flank	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	735	Fibronectin type-III 2.|Extracellular (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GAGGACTCCCTCCAGGGACCC	0.592													32	108	---	---	---	---	PASS
OR10AD1	121275	broad.mit.edu	37	12	48596562	48596562	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48596562C>G	uc001rrl.1	-	1	514	c.514G>C	c.(514-516)GAC>CAC	p.D172H		NM_001004134	NP_001004134	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATGTGGTTGTCTCTGCGGAAG	0.512													17	44	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88512421	88512421	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88512421T>A	uc001tar.2	-	16	1966	c.1622A>T	c.(1621-1623)GAG>GTG	p.E541V	CEP290_uc001tat.2_Missense_Mutation_p.E303V|CEP290_uc009zsl.1_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	541	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						CACACTTGCCTCTTTCAAAAG	0.343													7	116	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102559553	102559553	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102559553A>G	uc001tjf.2	+	6	825	c.713A>G	c.(712-714)TAT>TGT	p.Y238C	C12orf48_uc001tjg.2_Missense_Mutation_p.Y157C|C12orf48_uc010swa.1_Missense_Mutation_p.Y315C|C12orf48_uc001tjh.2_Missense_Mutation_p.Y157C|C12orf48_uc010swb.1_Missense_Mutation_p.Y124C|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Translation_Start_Site|C12orf48_uc001tjk.2_Missense_Mutation_p.Y238C|C12orf48_uc009zud.2_Missense_Mutation_p.Y238C	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010	238					response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						GGGAAAGGATATGCACCACCA	0.338													70	109	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112672921	112672921	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112672921C>T	uc009zwc.2	-	30	4627	c.4609G>A	c.(4609-4611)GAA>AAA	p.E1537K		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GACTGGTCTTCCCGCTTGTGG	0.363													11	10	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120606105	120606105	+	Splice_Site	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120606105C>G	uc001txo.2	-	16	1533	c.1520_splice	c.e16-1	p.E507_splice		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTTTGGCCTCTGCAAGAAAC	0.498													48	73	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23915054	23915054	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23915054C>G	uc001uon.2	-	10	3550	c.2961G>C	c.(2959-2961)AAG>AAC	p.K987N	SACS_uc001uoo.2_Missense_Mutation_p.K840N|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	987					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGCTAGTGGTCTTTAACTGTT	0.358													70	211	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77760022	77760022	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77760022T>A	uc001vkf.2	-	32	4405	c.4314A>T	c.(4312-4314)GAA>GAT	p.E1438D	MYCBP2_uc010aev.2_Missense_Mutation_p.E842D	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1438					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTGGGTAAATTTCACAGGTAT	0.368													28	42	---	---	---	---	PASS
OR4K13	390433	broad.mit.edu	37	14	20502131	20502131	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20502131T>A	uc010tkz.1	-	1	787	c.787A>T	c.(787-789)AGC>TGC	p.S263C		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GAGTATCTGCTGAAGGGCCAG	0.393													5	49	---	---	---	---	PASS
OR6S1	341799	broad.mit.edu	37	14	21109376	21109376	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21109376G>T	uc001vxv.1	-	1	475	c.475C>A	c.(475-477)CTT>ATT	p.L159I		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	159	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		GTGGGACCAAGCACAGGGACG	0.617													8	35	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623456	21623456	+	Silent	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623456G>C	uc010tlp.1	-	1	729	c.729C>G	c.(727-729)ACC>ACG	p.T243T		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	243	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CACACAGTGAGGTGTCTACAC	0.468													11	31	---	---	---	---	PASS
C14orf106	55320	broad.mit.edu	37	14	45706840	45706840	+	Intron	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45706840A>G	uc001wwf.2	-						C14orf106_uc010anh.2_Intron	NM_018353	NP_060823	Q6P0N0	M18BP_HUMAN	chromosome 14 open reading frame 106						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding				0						ATAATGAAATAGTATACTTAC	0.294													8	75	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47324244	47324244	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47324244G>T	uc001wwj.3	-	15	2855	c.2659C>A	c.(2659-2661)CCA>ACA	p.P887T	MDGA2_uc001wwh.3_Missense_Mutation_p.P89T|MDGA2_uc001wwi.3_Missense_Mutation_p.P658T	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	887	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						GAAGTAATTGGGTATATATTA	0.323													12	115	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64882081	64882081	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64882081G>A	uc001xhb.2	+	5	633	c.246G>A	c.(244-246)ATG>ATA	p.M82I	MTHFD1_uc010aqe.2_Missense_Mutation_p.M118I|MTHFD1_uc010aqf.2_Missense_Mutation_p.M138I	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	82	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	TTTAGGTGATGAAGTACATTA	0.338													29	196	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68052672	68052672	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68052672T>C	uc001xjl.1	+	28	3933	c.3791T>C	c.(3790-3792)GTG>GCG	p.V1264A	PLEKHH1_uc010tsw.1_Missense_Mutation_p.V832A|PLEKHH1_uc001xjn.1_Missense_Mutation_p.V779A|PLEKHH1_uc010tsx.1_Missense_Mutation_p.V129A|PLEKHH1_uc001xjo.1_Missense_Mutation_p.V129A|PLEKHH1_uc001xjp.1_Missense_Mutation_p.V129A	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	1264	FERM.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCACAGCAAGTGCACATCACT	0.502													48	308	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73464861	73464861	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73464861A>G	uc001xnm.2	-	3	1286	c.646T>C	c.(646-648)TCC>CCC	p.S216P	ZFYVE1_uc010arj.2_Missense_Mutation_p.S216P	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	216						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		ACAGTGCAGGACTCCTGGGTC	0.502													9	90	---	---	---	---	PASS
CYP46A1	10858	broad.mit.edu	37	14	100157471	100157471	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100157471G>A	uc001ygo.2	+	2	173	c.173G>A	c.(172-174)CGT>CAT	p.R58H	CYP46A1_uc001ygn.1_Missense_Mutation_p.V6M	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46	58					bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				GTTGGTGGCCGTGTGCTCCAA	0.498													5	275	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106780810	106780810	+	RNA	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106780810C>A	uc010tyt.1	-	413		c.15052G>T								Parts of antibodies, mostly variable regions.												0						GCACCTGGGACAGGACCACTG	0.592													9	68	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34072409	34072409	+	Intron	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34072409C>A	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTTTGTTTCCAGGCAACGCC	0.562													5	35	---	---	---	---	PASS
ASB7	140460	broad.mit.edu	37	15	101188614	101188614	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101188614C>G	uc002bwk.2	+	6	1673	c.904C>G	c.(904-906)CCA>GCA	p.P302A		NM_198243	NP_937886	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box-containing protein 7	302	SOCS box.				intracellular signal transduction					skin(1)	1	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TGATGAACTACCAATTGCCAA	0.373													56	72	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1505780	1505780	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1505780G>C	uc002clv.2	-	11	1043	c.933C>G	c.(931-933)AGC>AGG	p.S311R	CLCN7_uc002clw.2_Missense_Mutation_p.S287R	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	311						integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				CCTCCTCCAAGCTGAACAGGA	0.642													5	50	---	---	---	---	PASS
TXNDC11	51061	broad.mit.edu	37	16	11785786	11785786	+	Silent	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11785786C>A	uc010buu.1	-	9	1403	c.1341G>T	c.(1339-1341)GCG>GCT	p.A447A	TXNDC11_uc002dbg.1_Silent_p.A420A	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	447					cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						AGCAGGGGGACGCTGTGATCG	0.642													3	45	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28995152	28995152	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28995152G>T	uc010vdi.1	+	12	1506	c.1366G>T	c.(1366-1368)GAG>TAG	p.E456*	uc010vct.1_Intron|SPNS1_uc002drx.2_Nonsense_Mutation_p.E383*|SPNS1_uc002dsa.2_Nonsense_Mutation_p.E456*|SPNS1_uc002drz.2_Nonsense_Mutation_p.E404*|SPNS1_uc010byp.2_Nonsense_Mutation_p.E382*|SPNS1_uc010byq.1_Intron|LAT_uc010vdj.1_5'Flank|LAT_uc002dsb.2_5'Flank|LAT_uc002dsd.2_5'Flank|LAT_uc002dsc.2_5'Flank|LAT_uc010vdk.1_5'Flank|LAT_uc010vdl.1_5'Flank	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	456					lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						CTTCTTGTCCGAGTTCCGGGC	0.642													53	103	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30516559	30516559	+	Intron	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30516559G>A	uc002dyi.3	+						ITGAL_uc002dyj.3_Intron|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor						blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	ACTACCCCTCGCTCAGCAGGG	0.617													6	59	---	---	---	---	PASS
ZNF689	115509	broad.mit.edu	37	16	30616439	30616439	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30616439G>A	uc002dyx.2	-	3	969	c.649C>T	c.(649-651)CGC>TGC	p.R217C	ZNF689_uc010bzy.2_5'UTR	NM_138447	NP_612456	Q96CS4	ZN689_HUMAN	zinc finger protein HIT-39	217	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)			AGGTTCTTGCGCTGGGAGAAA	0.612													21	118	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46655228	46655228	+	Missense_Mutation	SNP	G	C	C	rs140408371		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46655228G>C	uc002eec.3	-	1	84	c.44C>G	c.(43-45)GCC>GGC	p.A15G		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	15										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				CGGCGCCATGGCCGCTGCCTC	0.687													9	72	---	---	---	---	PASS
CDH15	1013	broad.mit.edu	37	16	89261398	89261398	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89261398C>G	uc002fmt.2	+	14	2357	c.2280C>G	c.(2278-2280)GAC>GAG	p.D760E		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	760	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCGATGAGGACCAGGACTACG	0.657													5	17	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10216611	10216611	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10216611C>T	uc002gmk.1	-	30	4135	c.4045G>A	c.(4045-4047)GAA>AAA	p.E1349K		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1349	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCATACTGTTCCCGCAGCAGG	0.592													53	76	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40837084	40837084	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40837084C>A	uc002iay.2	+	4	655	c.439C>A	c.(439-441)CGC>AGC	p.R147S	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	147	Extracellular (Potential).|F5/8 type C.				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCGCTACATCCGCATCGTGCC	0.627													26	73	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	49731086	49731086	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49731086G>T	uc002itw.3	-	5	1463	c.477C>A	c.(475-477)ATC>ATA	p.I159I	CA10_uc002itu.3_Silent_p.I88I|CA10_uc002itv.3_Silent_p.I165I|CA10_uc002itx.3_Silent_p.I159I|CA10_uc002ity.3_Silent_p.I159I|CA10_uc002itz.2_Silent_p.I159I	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	159					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			GGTTATAGTGGATGAGCTGCA	0.403													23	96	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65105343	65105343	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65105343C>T	uc010wqk.1	-	29	4568	c.4381G>A	c.(4381-4383)GAA>AAA	p.E1461K	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.E1460K|HELZ_uc010der.2_Missense_Mutation_p.E4K	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CTGTGGCCTTCTTGCAGCATG	0.517													48	87	---	---	---	---	PASS
CDC42EP4	23580	broad.mit.edu	37	17	71282411	71282411	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71282411T>C	uc002jjn.2	-	2	376	c.229A>G	c.(229-231)AGT>GGT	p.S77G	CDC42EP4_uc002jjo.2_Missense_Mutation_p.S77G|CDC42EP4_uc002jjp.1_Intron	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	77					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			GACAGGAGACTGCGTTTGGAA	0.642													24	92	---	---	---	---	PASS
CDC42EP4	23580	broad.mit.edu	37	17	71282412	71282412	+	Silent	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71282412G>C	uc002jjn.2	-	2	375	c.228C>G	c.(226-228)CGC>CGG	p.R76R	CDC42EP4_uc002jjo.2_Silent_p.R76R|CDC42EP4_uc002jjp.1_Intron	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	76					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			ACAGGAGACTGCGTTTGGAAG	0.642													24	92	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80417879	80417879	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80417879G>T	uc002kfg.3	+	2	179	c.39G>T	c.(37-39)AAG>AAT	p.K13N	NARF_uc002kff.3_5'UTR|NARF_uc010wvo.1_Missense_Mutation_p.K13N|NARF_uc010wvp.1_5'UTR|NARF_uc010dit.2_Missense_Mutation_p.K13N|NARF_uc002kfj.3_Missense_Mutation_p.K13N|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Missense_Mutation_p.K13N	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a	13						lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			AATGTAGTAAGAAAACAAAAA	0.393													12	76	---	---	---	---	PASS
ADCYAP1	116	broad.mit.edu	37	18	905462	905462	+	Silent	SNP	A	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:905462A>C	uc010dkg.2	+	2	194	c.75A>C	c.(73-75)TCA>TCC	p.S25S	ADCYAP1_uc010dkh.2_Silent_p.S25S	NM_001099733	NP_001093203	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide	25					activation of adenylate cyclase activity|cell-cell signaling|female pregnancy|nerve growth factor receptor signaling pathway|regulation of G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|peptide hormone receptor binding				0						TCTACAGCTCACCTGCCGCCG	0.637													7	47	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561086	44561086	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561086G>T	uc002lcr.1	-	1	903	c.550C>A	c.(550-552)CCT>ACT	p.P184T	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	184					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GCGGGCTCAGGGCCCTCGGGC	0.701													35	67	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76755137	76755137	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76755137C>A	uc002lmt.2	+	2	3146	c.3146C>A	c.(3145-3147)ACT>AAT	p.T1049N	SALL3_uc010dra.2_Missense_Mutation_p.T584N	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1049					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		AGCCAAAGCACTCCTAGCCTG	0.547													11	65	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1789540	1789540	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1789540G>A	uc002ltw.2	-	23	2899	c.2665C>T	c.(2665-2667)CGT>TGT	p.R889C	ATP8B3_uc002ltv.2_Missense_Mutation_p.R852C|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	889	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGAGCTACGGCGGGCTCTG	0.692													7	15	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9049179	9049179	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9049179G>A	uc002mkp.2	-	5	32656	c.32452C>T	c.(32452-32454)CCA>TCA	p.P10818S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10820	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTTGTAGCTGGTTCACCAGGG	0.488													91	191	---	---	---	---	PASS
ZNF439	90594	broad.mit.edu	37	19	11978109	11978109	+	Intron	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11978109C>A	uc002mss.2	+						ZNF439_uc002msr.2_Intron	NM_152262	NP_689475	Q8NDP4	ZN439_HUMAN	zinc finger protein 439						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ATTTGTTTCTCATTTTTGACA	0.333													41	87	---	---	---	---	PASS
HAUS8	93323	broad.mit.edu	37	19	17169692	17169692	+	Intron	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17169692G>A	uc002nfe.2	-						HAUS8_uc002nff.2_Intron|HAUS8_uc002nfg.1_Intron|HAUS8_uc002nfh.1_Intron	NM_033417	NP_219485	Q9BT25	HAUS8_HUMAN	sarcoma antigen NY-SAR-48 isoform a						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole					0						AAATCCTTAAGAAAAGAAAAA	0.423													15	85	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21240364	21240364	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21240364C>T	uc002npj.2	+	5	1360	c.1250C>T	c.(1249-1251)ACT>ATT	p.T417I	ZNF430_uc002npk.2_Missense_Mutation_p.T416I	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	417	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						TCGACCCTTACTAAACATAAA	0.348													20	58	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769803	31769803	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769803T>G	uc002nsy.3	-	2	961	c.896A>C	c.(895-897)CAC>CCC	p.H299P		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	299	C2H2-type 2.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					TTTTTGGTAGTGTTTTGTTTT	0.532													15	244	---	---	---	---	PASS
FXYD3	5349	broad.mit.edu	37	19	35613674	35613674	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35613674C>A	uc010xsn.1	+	7	429	c.103C>A	c.(103-105)CAC>AAC	p.H35N	FXYD3_uc010xsl.1_Missense_Mutation_p.H35N|FXYD3_uc010xsm.1_Missense_Mutation_p.H92N|FXYD3_uc002nxw.2_Missense_Mutation_p.H35N|FXYD3_uc002nxv.2_Missense_Mutation_p.H35N|FXYD3_uc010xso.1_Missense_Mutation_p.H35N	NM_001136011	NP_001129483	Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	35	Extracellular (Potential).					chloride channel complex|integral to plasma membrane	chloride channel activity				0	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTAGACTGGCACAGCCTCCA	0.522													7	222	---	---	---	---	PASS
ZFP82	284406	broad.mit.edu	37	19	36884570	36884570	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36884570T>A	uc002ody.1	-	5	907	c.672A>T	c.(670-672)AAA>AAT	p.K224N		NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog	224					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						ATTCATAGAGTTTTTCACCAG	0.408													34	383	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41081468	41081468	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41081468G>T	uc002ony.2	+	36	7774	c.7688G>T	c.(7687-7689)AGG>ATG	p.R2563M	SPTBN4_uc002onz.2_Missense_Mutation_p.R2563M|SPTBN4_uc010egx.2_Missense_Mutation_p.R1306M|SHKBP1_uc002oob.2_5'Flank|SHKBP1_uc002ooc.2_5'Flank|SHKBP1_uc002ood.2_5'Flank|SHKBP1_uc010xvl.1_5'Flank|SHKBP1_uc002ooe.2_5'Flank|SHKBP1_uc002oof.2_5'Flank|SHKBP1_uc010xvm.1_5'Flank	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2563					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCGGGCGCAGGAAGTGACTT	0.622													5	149	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50780014	50780014	+	Silent	SNP	G	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50780014G>T	uc002prr.1	+	27	3605	c.3558G>T	c.(3556-3558)CGG>CGT	p.R1186R	MYH14_uc010enu.1_Silent_p.R1227R|MYH14_uc002prq.1_Silent_p.R1194R	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	1186	Potential.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCCAATAAAGGTCCAAGAGGG	0.557													4	87	---	---	---	---	PASS
KLK7	5650	broad.mit.edu	37	19	51480876	51480876	+	Silent	SNP	G	A	A	rs17855561		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51480876G>A	uc002puo.2	-	6	780	c.678C>T	c.(676-678)TGC>TGT	p.C226C	KLK7_uc002pup.2_Silent_p.C226C|KLK7_uc010yco.1_Silent_p.C100C|KLK7_uc010eok.2_Silent_p.C154C	NM_139277	NP_644806	P49862	KLK7_HUMAN	stratum corneum chymotryptic enzyme	226	Peptidase S1.			C -> W (in Ref. 6; AAH32005).	epidermis development|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		TGGGTTGGCCGCAAGGGAAAG	0.517													4	167	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25188036	25188036	+	Intron	SNP	A	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25188036A>C	uc002wuj.2	+						ENTPD6_uc010zsy.1_Intron|ENTPD6_uc010gdj.1_Intron|ENTPD6_uc010zsz.1_Intron|ENTPD6_uc002wum.2_Intron|ENTPD6_uc010zta.1_Intron|ENTPD6_uc002wun.2_Intron|ENTPD6_uc002wuk.2_Intron|ENTPD6_uc002wul.2_Intron|ENTPD6_uc010ztb.1_Intron|ENTPD6_uc010ztc.1_Intron|ENTPD6_uc002wuo.2_Intron|ENTPD6_uc010ztd.1_5'Flank	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6							Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						CCCCAGAGGTACCCGCCTCTC	0.517													6	11	---	---	---	---	PASS
COX4I2	84701	broad.mit.edu	37	20	30231265	30231265	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30231265G>A	uc002wwj.1	+	4	381	c.306G>A	c.(304-306)TGG>TGA	p.W102*	COX4I2_uc002wwi.2_Nonsense_Mutation_p.W102*	NM_032609	NP_115998	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2	102					cellular respiration		cytochrome-c oxidase activity			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			CCAATGAGTGGAAGACAGTGA	0.567													55	143	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19715859	19715859	+	Silent	SNP	A	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19715859A>G	uc002ykw.2	-	12	1423	c.1392T>C	c.(1390-1392)TAT>TAC	p.Y464Y		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	464	Extracellular (Potential).|MAM.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTACTTGTCCATAATTCCAAT	0.279													40	50	---	---	---	---	PASS
BCR	613	broad.mit.edu	37	22	23596177	23596177	+	Intron	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23596177C>T	uc002zww.2	+						BCR_uc002zwx.2_Intron|BCR_uc011aiy.1_Intron|BCR_uc010gtx.1_Intron	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						GGTGAGTCCCCATGGTGTACG	0.647			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								19	31	---	---	---	---	PASS
ADORA2A	135	broad.mit.edu	37	22	24837011	24837011	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24837011G>A	uc002zzx.2	+	5	1556	c.793G>A	c.(793-795)GCC>ACC	p.A265T	ADORA2A_uc002zzy.3_Missense_Mutation_p.A265T|ADORA2A_uc011ajs.1_Missense_Mutation_p.A126T|ADORA2A_uc010gup.2_Missense_Mutation_p.A265T|ADORA2A_uc010guq.2_Missense_Mutation_p.A265T|ADORA2A_uc003aab.2_Missense_Mutation_p.A265T|ADORA2A_uc003aac.2_Missense_Mutation_p.A126T|C22orf45_uc003aad.1_Intron	NM_000675	NP_000666	P29274	AA2AR_HUMAN	adenosine A2a receptor	265	Agonist binding.|Extracellular.				apoptosis|blood coagulation|cAMP biosynthetic process|cellular defense response|inflammatory response|nerve growth factor receptor signaling pathway|phagocytosis|sensory perception	integral to plasma membrane|membrane fraction	enzyme binding				0	Colorectal(2;0.196)				Caffeine(DB00201)|Defibrotide(DB04932)|Pegademase bovine(DB00061)|Theophylline(DB00277)	CTGCAGCCACGCCCCTCTCTG	0.577													16	99	---	---	---	---	PASS
TTC38	55020	broad.mit.edu	37	22	46674532	46674532	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46674532G>A	uc003bhi.2	+	6	665	c.589G>A	c.(589-591)GAC>AAC	p.D197N	TTC38_uc011aqx.1_Missense_Mutation_p.D139N	NM_017931	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	197	TPR 2.						binding			ovary(1)	1						CAACTTCTACGACCAGGCAGA	0.473													6	200	---	---	---	---	PASS
CPT1B	1375	broad.mit.edu	37	22	51011971	51011971	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51011971C>T	uc003bmk.3	-	9	1306	c.1144G>A	c.(1144-1146)GCA>ACA	p.A382T	CPT1B_uc003bml.2_Missense_Mutation_p.A382T|CPT1B_uc003bmm.2_Missense_Mutation_p.A382T|CPT1B_uc003bmo.2_Missense_Mutation_p.A382T|CPT1B_uc011asa.1_Missense_Mutation_p.A348T|CPT1B_uc003bmn.2_Missense_Mutation_p.A382T|CPT1B_uc011asb.1_Intron|CHKB-CPT1B_uc003bmp.2_Missense_Mutation_p.A179T	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	382	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GTGAGGGCTGCCAGCTTCTCC	0.637													39	118	---	---	---	---	PASS
PCYT1B	9468	broad.mit.edu	37	X	24597532	24597532	+	Silent	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24597532C>A	uc004dbi.2	-	6	842	c.609G>T	c.(607-609)TCG>TCT	p.S203S	PCYT1B_uc004dbk.3_Silent_p.S203S|PCYT1B_uc004dbj.2_Silent_p.S185S	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta	203	Catalytic (Potential).					endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	TAATGATGTCCGATGTTGAGA	0.433													46	81	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30237095	30237095	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30237095C>A	uc004dbz.2	+	2	501	c.398C>A	c.(397-399)ACA>AAA	p.T133K		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	133	MAGE.						protein binding			ovary(1)	1						AAGTCCGTTACAAAGGGAGAA	0.458													5	22	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47104414	47104414	+	Splice_Site	SNP	G	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104414G>C	uc004dhp.2	+	16	2216	c.2216_splice	c.e16-1	p.A739_splice	USP11_uc004dhq.2_Splice_Site_p.A465_splice	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CTCACCCCCAGCCCAGCCGTA	0.567													3	10	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76855029	76855029	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76855029T>G	uc004ecp.3	-	25	6039	c.5807A>C	c.(5806-5808)AAG>ACG	p.K1936T	ATRX_uc004ecq.3_Missense_Mutation_p.K1898T|ATRX_uc004eco.3_Missense_Mutation_p.K1721T	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1936	Poly-Lys.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTTTTTCCCCTTTTTCCCTTT	0.318			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						81	323	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91873392	91873392	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91873392C>T	uc004efk.1	+	7	4342	c.3497C>T	c.(3496-3498)GCA>GTA	p.A1166V	PCDH11X_uc004efl.1_Missense_Mutation_p.A1156V|PCDH11X_uc004efo.1_Missense_Mutation_p.A1129V|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.A1158V|PCDH11X_uc004efn.1_Missense_Mutation_p.A1148V	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1166	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TCTTCGCAAGCACAGGCCTCT	0.562													32	29	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91873712	91873712	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91873712C>A	uc004efk.1	+	7	4662	c.3817C>A	c.(3817-3819)CAA>AAA	p.Q1273K	PCDH11X_uc004efl.1_Missense_Mutation_p.Q1263K|PCDH11X_uc004efo.1_Missense_Mutation_p.Q1236K|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.Q1265K|PCDH11X_uc004efn.1_Missense_Mutation_p.Q1255K	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1273	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TAGTCAGGCCCAATCATCAGT	0.542													111	110	---	---	---	---	PASS
NOX1	27035	broad.mit.edu	37	X	100118222	100118222	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100118222C>T	uc004egj.2	-	4	469	c.263G>A	c.(262-264)CGC>CAC	p.R88H	uc010nnf.2_Intron|NOX1_uc004egl.3_Missense_Mutation_p.R88H|NOX1_uc010nne.2_Missense_Mutation_p.R51H	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	88	Cytoplasmic (Potential).|Ferric oxidoreductase.				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						TCTCAGTGTGCGGCTGCAAAA	0.433													4	158	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118147105	118147105	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118147105C>T	uc004eqw.2	+	9	1946	c.1915C>T	c.(1915-1917)CAT>TAT	p.H639Y	LONRF3_uc004eqx.2_Missense_Mutation_p.H598Y|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_Missense_Mutation_p.H383Y	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	639	Lon.				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						CAGGGTGCTCCATCAGAGCCA	0.507													57	51	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135430461	135430461	+	Silent	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135430461C>A	uc004ezu.1	+	6	4887	c.4596C>A	c.(4594-4596)CCC>CCA	p.P1532P	GPR112_uc010nsb.1_Silent_p.P1327P|GPR112_uc010nsc.1_Silent_p.P1299P	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1532	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CTGACACTCCCCCAATAGTGA	0.428													4	170	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150912664	150912664	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150912664C>A	uc004fey.1	+	7	1913	c.1689C>A	c.(1687-1689)TAC>TAA	p.Y563*		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	563	cAMP (By similarity).|Cytoplasmic (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGACTGAGTACCCTGATGCCA	0.522													4	133	---	---	---	---	PASS
CA6	765	broad.mit.edu	37	1	9028022	9028023	+	Intron	INS	-	TT	TT	rs34107058		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9028022_9028023insTT	uc001apm.2	+						CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor						one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)		TCTAGCCAACCttttttttttt	0.257													4	2	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114241230	114241233	+	Intron	DEL	TATA	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114241230_114241233delTATA	uc009wgp.1	-						PHTF1_uc001edm.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGTAGTTTTATATATATATATa	0.230													4	2	---	---	---	---	
NLRP3	114548	broad.mit.edu	37	1	247589095	247589096	+	Intron	INS	-	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247589095_247589096insA	uc001icr.2	+						NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Intron|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Intron	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ATGGGATGAGGAAAAAAAAAAT	0.371													4	2	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11725179	11725180	+	Intron	INS	-	A	A	rs78338846		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11725179_11725180insA	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTGTGATTAGAAAAAAAAAAA	0.302													4	3	---	---	---	---	
PKDCC	91461	broad.mit.edu	37	2	42275911	42275912	+	Frame_Shift_Ins	INS	-	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42275911_42275912insG	uc002rsg.2	+	1	751_752	c.572_573insG	c.(571-573)CTGfs	p.L191fs		NM_138370	NP_612379	Q504Y2	PKDCC_HUMAN	protein kinase-like protein SgK493	191	Protein kinase.				cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity			breast(1)	1						TGCTATCGGCTGGCGGCCCACA	0.693													11	10	---	---	---	---	
GFPT1	2673	broad.mit.edu	37	2	69581850	69581851	+	Intron	INS	-	A	A	rs150887587	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69581850_69581851insA	uc002sfh.2	-						GFPT1_uc002sfi.1_Intron	NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						AAGAATTTTTTAAAAAAATCAG	0.158													5	4	---	---	---	---	
PLGLB2	5342	broad.mit.edu	37	2	87238032	87238032	+	3'UTR	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87238032delA	uc002ssd.2	-	4					RMND5A_uc002srs.3_Intron|RGPD1_uc010fgv.2_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_002665	NP_002656	Q02325	PLGB_HUMAN	plasminogen-like B2 precursor							extracellular region					0						tctgtctcagaaaaaaaaaaa	0.179													4	2	---	---	---	---	
LYG2	254773	broad.mit.edu	37	2	99861575	99861575	+	Intron	DEL	A	-	-	rs5832869		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99861575delA	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Intron|LYG2_uc002szx.1_Intron	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						actccatctcaaaaaaaaaaa	0.199													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																							TGGGCGGGGTGGTGGGGGGTGC	0.530													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	167615546	167615547	+	IGR	INS	-	GGG	GGG	rs13409043		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167615546_167615547insGGG								SCN7A (264829 upstream) : XIRP2 (129450 downstream)																							ggaaggaaggaaggaaggaagg	0.114													4	3	---	---	---	---	
PECR	55825	broad.mit.edu	37	2	216916005	216916005	+	Intron	DEL	A	-	-	rs34924412		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216916005delA	uc002vft.2	-						PECR_uc010zjq.1_Intron|PECR_uc002vfr.2_Intron|PECR_uc002vfs.2_Intron	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	actccatctcaaaaaaaaaaa	0.100													5	5	---	---	---	---	
RAD54L2	23132	broad.mit.edu	37	3	51689951	51689951	+	Intron	DEL	C	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51689951delC	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron|RAD54L2_uc011bdu.1_Intron|RAD54L2_uc003dbj.2_Intron	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		AGTTGTTCTGCCAAACTCTTT	0.483													85	47	---	---	---	---	
ZNF639	51193	broad.mit.edu	37	3	179047698	179047705	+	Intron	DEL	TTTTTTTT	-	-	rs72000562		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179047698_179047705delTTTTTTTT	uc003fjq.1	+						ZNF639_uc003fjr.1_Intron	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639						initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TTAACTAttctttttttttttttttttt	0.115													9	4	---	---	---	---	
ALB	213	broad.mit.edu	37	4	74270303	74270303	+	Intron	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74270303delA	uc003hgs.3	+						ALB_uc003hgw.3_Intron|ALB_uc011cbe.1_Intron|ALB_uc003hgt.3_Intron|ALB_uc010iii.2_Intron|ALB_uc003hgu.3_Intron|ALB_uc003hgv.3_Intron|ALB_uc011cbf.1_5'Flank	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein						bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	CATCCTAGGTAAAAAAAAAAA	0.279													6	3	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166198901	166198902	+	Intron	DEL	AC	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166198901_166198902delAC	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GATGTTAAAAacacacacacac	0.337													4	2	---	---	---	---	
HMGCS1	3157	broad.mit.edu	37	5	43297941	43297941	+	Intron	DEL	A	-	-	rs75413713		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43297941delA	uc003jnr.3	-						HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						actcggtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108133721	108133721	+	Intron	DEL	T	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108133721delT	uc003kop.1	+						FER_uc011cve.1_Intron|FER_uc011cvf.1_Intron|FER_uc003koq.2_Intron|FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ttcagtTGTGTTTTTTTTTTT	0.114													6	3	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134140864	134140864	+	Intron	DEL	T	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134140864delT	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGAACTGTAttttttttttt	0.204													3	3	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180058912	180058926	+	Intron	DEL	CGCGTGGCCTGGCCT	-	-	rs140253537	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180058912_180058926delCGCGTGGCCTGGCCT	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_5'Flank|FLT4_uc011dgy.1_Intron|FLT4_uc011dgz.1_Intron|FLT4_uc011dha.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCAGCACCGCGTGGCCTGGCCTCACCATGTGC	0.670									Congenital_Hereditary_Lymphedema				5	3	---	---	---	---	
MAP3K7	6885	broad.mit.edu	37	6	91246268	91246268	+	Intron	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91246268delA	uc003pnz.1	-						MAP3K7_uc003pny.1_5'UTR|MAP3K7_uc003poa.1_Intron|MAP3K7_uc003pob.1_Intron|MAP3K7_uc003poc.1_Intron	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TATTGCTaagaaaaaaaaaaa	0.299													6	3	---	---	---	---	
KPNA5	3841	broad.mit.edu	37	6	117047224	117047225	+	Intron	INS	-	GT	GT	rs146744205	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117047224_117047225insGT	uc003pxh.2	+							NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		AAGAACATCAAgtgtgtgtgtg	0.252													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747283	134747286	+	IGR	DEL	TCTT	-	-	rs67886112		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747283_134747286delTCTT								SGK1 (108087 upstream) : ALDH8A1 (491243 downstream)																							tccctctccctctttctttctttc	0.034													4	2	---	---	---	---	
SASH1	23328	broad.mit.edu	37	6	148835682	148835683	+	Intron	INS	-	AGGGAT	AGGGAT	rs145773399	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148835682_148835683insAGGGAT	uc003qme.1	+						SASH1_uc011eeb.1_Intron	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CTCAGCAGAAAAGGGATACGAT	0.411													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	7218128	7218128	+	IGR	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7218128delA								C7orf28B (352267 upstream) : C1GALT1 (4118 downstream)																							ttaaaaaattaaaaaaaattG	0.343													3	3	---	---	---	---	
DPY19L2P1	554236	broad.mit.edu	37	7	35209314	35209315	+	Intron	INS	-	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35209314_35209315insA	uc003teq.1	-											RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						TTTAAAACATGAAAAaaaaagt	0.238													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157396542	157396543	+	Intron	INS	-	G	G			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157396542_157396543insG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGGGGAGTGGCGGGAGCCCAAT	0.634													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14010582	14010583	+	IGR	INS	-	TTTC	TTTC			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14010582_14010583insTTTC								MPDZ (731019 upstream) : NFIB (71265 downstream)																							accagtaCCATtttctttcttt	0.010													4	2	---	---	---	---	
ZNF169	169841	broad.mit.edu	37	9	97062558	97062558	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97062558delG	uc004aum.1	+	5	823	c.718delG	c.(718-720)GGGfs	p.G240fs		NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169	240	C2H2-type 1.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CCCTGAATGCGGGAGAGGCTT	0.517													59	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102150493	102150494	+	IGR	INS	-	CTTCCTTC	CTTCCTTC			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102150493_102150494insCTTCCTTC								SEC61B (157593 upstream) : NR4A3 (433643 downstream)																							ATTTGCCCTGTcttccttcctt	0.050													6	3	---	---	---	---	
PITRM1	10531	broad.mit.edu	37	10	3206216	3206216	+	Intron	DEL	A	-	-	rs68085518		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3206216delA	uc010qah.1	-						PITRM1_uc001igr.1_Intron|PITRM1_uc001igt.1_Intron|PITRM1_uc001igu.1_Intron|PITRM1_uc010qai.1_Intron|PITRM1_uc001igw.1_Intron|uc001igx.1_5'Flank			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						CTAATGGTTTAAAAAAAAAAA	0.348													3	4	---	---	---	---	
CCDC7	221016	broad.mit.edu	37	10	32800192	32800198	+	Intron	DEL	GGGGGGC	-	-	rs1977606		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32800192_32800198delGGGGGGC	uc001iwj.2	+						CCDC7_uc009xlu.1_Intron|CCDC7_uc001iwk.2_Intron|CCDC7_uc009xlv.2_Intron|CCDC7_uc009xlw.1_Intron|CCDC7_uc009xlx.1_Intron|CCDC7_uc009xly.1_Intron	NM_145023	NP_659460	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7												0		Breast(68;0.000207)|Prostate(175;0.0107)				TGGGGGGCGGGGGGGGCGGGGAAATGT	0.353													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34021905	34021908	+	IGR	DEL	GGAA	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34021905_34021908delGGAA								NRP1 (397899 upstream) : PARD3 (378190 downstream)																							atggaagtagggaaggaaggaagg	0.108													4	2	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73405973	73405974	+	Intron	INS	-	A	A	rs143606744	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73405973_73405974insA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jry.2_Intron|CDH23_uc001jrz.2_Intron	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CTCCCATCAGGAGCCTCTGCAA	0.564													3	7	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16071258	16071258	+	Intron	DEL	C	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16071258delC	uc001mme.2	-						SOX6_uc001mmd.2_Splice_Site_p.D455_splice|SOX6_uc001mmf.2_Splice_Site_p.D452_splice|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CTTTCTTTTACCTAATTCGTA	0.393													176	90	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33451591	33451592	+	IGR	INS	-	CCTT	CCTT	rs61887171	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33451591_33451592insCCTT								HIPK3 (75652 upstream) : C11orf41 (112285 downstream)																							cttccttccttcctcccttccc	0.030													4	2	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47189417	47189417	+	Intron	DEL	A	-	-	rs34204386		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189417delA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						CAGCTTGTTTaaaaaaaaaaa	0.244													4	2	---	---	---	---	
C11orf85	283129	broad.mit.edu	37	11	64708307	64708307	+	Intron	DEL	C	-	-	rs56019033		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708307delC	uc001ocb.1	-						C11orf85_uc001occ.1_Intron|C11orf85_uc001ocd.1_Intron	NM_001037225	NP_001032302	Q3KP22	CK085_HUMAN	hypothetical protein LOC283129												0						ttttttctttctttttttttt	0.174													3	6	---	---	---	---	
PDZD3	79849	broad.mit.edu	37	11	119057868	119057868	+	Intron	DEL	G	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119057868delG	uc001pwb.2	+						PDZD3_uc001pvy.2_Intron|PDZD3_uc001pvz.2_Intron|PDZD3_uc010rzd.1_Intron|PDZD3_uc001pwa.2_Intron			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;						cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		aaaaaaaaaagaaaaagaaaa	0.254													5	3	---	---	---	---	
TMTC1	83857	broad.mit.edu	37	12	29920640	29920643	+	Intron	DEL	AATA	-	-	rs139022526		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29920640_29920643delAATA	uc001rjb.2	-						TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TAAACACTTTAATAGAGTGAACTC	0.216													6	3	---	---	---	---	
KRT85	3891	broad.mit.edu	37	12	52760532	52760533	+	Intron	DEL	AC	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52760532_52760533delAC	uc001sag.2	-							NM_002283	NP_002274	P78386	KRT85_HUMAN	keratin 85						epidermis development	keratin filament	protein binding|structural molecule activity			ovary(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		acacacatgtacacacacacac	0.188													4	2	---	---	---	---	
PAWR	5074	broad.mit.edu	37	12	79988481	79988482	+	Intron	DEL	GT	-	-	rs111229471		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79988481_79988482delGT	uc001syx.2	-							NM_002583	NP_002574	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator						actin filament bundle assembly|apoptosis|induction of apoptosis|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	actin binding|enzyme binding|leucine zipper domain binding|transcription corepressor activity				0						ATTTAACCTCgtgtgtgtgtgt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																							aacagagcaagaTggatggatgga	0.000													6	7	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													4	2	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	94129223	94129224	+	Intron	INS	-	AC	AC	rs35000706		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94129223_94129224insAC	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AAACACTTTAAacacacacaca	0.287													2	5	---	---	---	---	
C15orf29	79768	broad.mit.edu	37	15	34456098	34456098	+	Intron	DEL	T	-	-	rs5811822		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34456098delT	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989	Q9H079	CO029_HUMAN	hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)		GTCCTCAttcttttttttttt	0.169													4	3	---	---	---	---	
SPPL2A	84888	broad.mit.edu	37	15	51029104	51029105	+	Intron	INS	-	T	T	rs148322685	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51029104_51029105insT	uc001zyv.2	-							NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A							integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		AGATCGTGAGGttttttgtttt	0.153													3	3	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102316025	102316025	+	5'Flank	DEL	G	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102316025delG	uc002ccz.2	+											DQ576545																		CCACCTCTCTGGGGCATTCTA	0.443													67	56	---	---	---	---	
MPRIP	23164	broad.mit.edu	37	17	16981067	16981067	+	Intron	DEL	A	-	-	rs10560581		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16981067delA	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0						TCCAAGTGttaaaaaaaaaaa	0.403													4	2	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43908477	43908477	+	Intron	DEL	T	-	-	rs56396707		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43908477delT	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron	NM_001145146	NP_001138618	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		tccctgcctgtgctctgCCTG	0.199													4	4	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													2	5	---	---	---	---	
C17orf70	80233	broad.mit.edu	37	17	79513892	79513893	+	Intron	INS	-	G	G	rs80282500		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79513892_79513893insG	uc002kaq.2	-						C17orf70_uc002kao.1_Intron|C17orf70_uc010wuq.1_Intron|C17orf70_uc002kap.2_Intron	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit						DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			aaaaaaaaaaaaaaaaTCCCCA	0.292													3	3	---	---	---	---	
ZCCHC2	54877	broad.mit.edu	37	18	60207036	60207036	+	Intron	DEL	T	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60207036delT	uc002lip.3	+						ZCCHC2_uc002lio.2_Intron	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2						cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						GTATGCTCTCTTTTTTGTAAA	0.403													6	5	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17263263	17263263	+	Intron	DEL	C	-	-	rs34703734		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17263263delC	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						caaccaaccactgtgggggcc	0.000													6	4	---	---	---	---	
ZNF737	100129842	broad.mit.edu	37	19	20735139	20735139	+	Intron	DEL	A	-	-	rs146002311		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20735139delA	uc002npa.2	-							NM_001159293	NP_001152765	C9JHM3	C9JHM3_HUMAN	zinc finger protein 737						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TTTaaaaaagaaaaaaaaaaa	0.284													6	4	---	---	---	---	
KIAA0355	9710	broad.mit.edu	37	19	34787057	34787058	+	Intron	INS	-	T	T	rs5827899		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34787057_34787058insT	uc002nvd.3	+						KIAA0355_uc010edk.1_Intron	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)					ggatccctcgcttttTTTTTTT	0.262													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39477045	39477060	+	IGR	DEL	TCTTTCCTTCTTTCTC	-	-	rs76176945		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39477045_39477060delTCTTTCCTTCTTTCTC								FBXO17 (10665 upstream) : FBXO27 (37604 downstream)																							ttcttttctttctttccttctttctctctttccttc	0.028													3	4	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991060	39991061	+	Intron	INS	-	C	C			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991060_39991061insC	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			agtgagattctCCCCCCCCCCC	0.302													7	4	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													4	2	---	---	---	---	
AURKC	6795	broad.mit.edu	37	19	57745122	57745123	+	Intron	INS	-	T	T	rs113522041		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57745122_57745123insT	uc002qoe.2	+						AURKC_uc002qoc.2_Intron|AURKC_uc002qod.2_Intron|AURKC_uc010etv.2_Intron	NM_001015878	NP_001015878	Q9UQB9	AURKC_HUMAN	aurora kinase C isoform 1						cell cycle|cytokinesis	condensed chromosome|cytoplasm|midbody|spindle midzone	ATP binding|protein serine/threonine kinase activity			lung(4)|ovary(2)	6		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		cttttcttttcttttttttttt	0.153													4	2	---	---	---	---	
DSN1	79980	broad.mit.edu	37	20	35396635	35396636	+	Intron	INS	-	A	A			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35396635_35396636insA	uc010gfr.2	-						DSN1_uc002xfz.2_Intron|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Intron|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Intron|DSN1_uc002xgb.2_Intron	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				CATCTAAACTTAAAAAAAAAAA	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48574697	48574698	+	IGR	INS	-	C	C	rs143909127		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48574697_48574698insC								RNF114 (4277 upstream) : SNAI1 (24829 downstream)																							ttttttttttttcgagatggag	0.099													4	5	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074331	62074333	+	Intron	DEL	CAC	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074331_62074333delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccaccatcaccaccattacc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114442	11114442	+	IGR	DEL	A	-	-	rs5842456		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114442delA								BAGE (15505 upstream) : None (None downstream)																							TGCTTAGGTTAAATTTTTTTT	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30274401	30274401	+	IGR	DEL	C	-	-	rs79176097	byFrequency	TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30274401delC								N6AMT1 (16708 upstream) : RNF160 (26065 downstream)																							ttttttttttcctaatgctct	0.164													3	3	---	---	---	---	
C21orf63	59271	broad.mit.edu	37	21	33867092	33867092	+	Intron	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33867092delA	uc002ypr.1	+						C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron|C21orf63_uc002ypu.1_Intron|C21orf63_uc011adq.1_5'Flank	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						aatcagtttcaaaaaaaaaaa	0.080													4	3	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38462768	38462768	+	Intron	DEL	T	-	-	rs138757481		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38462768delT	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc011aed.1_Intron|TTC3_uc010gne.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				ATTTTCTCTCTTTTTTTTTTT	0.318													3	5	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657422	22657422	+	Intron	DEL	T	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657422delT	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						AAATACTAACTGTTTTACGAA	0.403													6	4	---	---	---	---	
DRG1	4733	broad.mit.edu	37	22	31796930	31796930	+	Intron	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31796930delA	uc003aku.2	+							NM_004147	NP_004138	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1						multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1						cccccatctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
ACRC	93953	broad.mit.edu	37	X	70832133	70832134	+	Intron	INS	-	A	A	rs28503727		TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70832133_70832134insA	uc004eae.2	+						BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein							nucleus				ovary(3)	3	Renal(35;0.156)					ctcaaaaaaggaaaaaaaaaaa	0.149													4	2	---	---	---	---	
ALG13	79868	broad.mit.edu	37	X	111000722	111000722	+	Intron	DEL	T	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111000722delT	uc011msy.1	+						ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_Intron|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_Intron			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);						dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						CCAATTCTTATTTTTTTTTTT	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	150162649	150162649	+	IGR	DEL	A	-	-			TCGA-66-2781-01A-01D-1522-08	TCGA-66-2781-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150162649delA								HMGB3 (3403 upstream) : GPR50 (182410 downstream)																							TCTGCTTGCCAAAAAAAAAAA	0.204													4	4	---	---	---	---	
