Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ATAD3B	83858	broad.mit.edu	37	1	1412700	1412700	+	Silent	SNP	G	A	A	rs142559400	byFrequency	TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1412700G>A	uc001afv.2	+	2	353	c.252G>A	c.(250-252)ACG>ACA	p.T84T	ATAD3B_uc001afw.2_5'Flank|ATAD3B_uc001afx.2_5'Flank	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN	AAA-ATPase  TOB3	84	Potential.						ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGGAGCAGACGCTGCAGTTGG	0.617																0.342466	64.248388	65.851065	25	48	KEEP	---	---	---	---	16	17	25	32	-1	capture	Silent	SNP	1412700	1412700	ATAD3B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1065	266
MMEL1	79258	broad.mit.edu	37	1	2524281	2524281	+	Silent	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2524281G>A	uc001ajy.2	-	20	2206	c.1992C>T	c.(1990-1992)GAC>GAT	p.D664D	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	664	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CGTTCTGTTCGTCTGCCAGGT	0.637																0.504854	145.509317	145.511717	52	51	KEEP	---	---	---	---	25	30	30	26	-1	capture	Silent	SNP	2524281	2524281	MMEL1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9558	266
PLEKHM2	23207	broad.mit.edu	37	1	16044415	16044415	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16044415A>G	uc010obo.1	+	4	532	c.305A>G	c.(304-306)AAC>AGC	p.N102S		NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M	102	RUN.|Interaction with KIF5B.				Golgi organization	cytoplasm	kinesin binding			ovary(1)	1		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTGGCCCTCAACGAGAACTCC	0.572																0.304348	22.318	23.10256	7	16	KEEP	---	---	---	---	5	3	6	11	-1	capture	Missense_Mutation	SNP	16044415	16044415	PLEKHM2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	11984	266
ZSWIM5	57643	broad.mit.edu	37	1	45508897	45508897	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45508897A>G	uc001cnd.2	-	6	1831	c.1603T>C	c.(1603-1605)TGG>CGG	p.W535R		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	535							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TTACCAAGCCACAGTGGCTGG	0.488																0.218009	115.450043	130.90617	46	165	KEEP	---	---	---	---	37	40	142	130	-1	capture	Missense_Mutation	SNP	45508897	45508897	ZSWIM5	1	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	18120	266
VPS45	11311	broad.mit.edu	37	1	150049176	150049176	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150049176G>A	uc001etp.2	+	6	1016	c.443G>A	c.(442-444)CGA>CAA	p.R148Q	VPS45_uc010pbp.1_Intron|VPS45_uc010pbq.1_Missense_Mutation_p.R112Q|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_5'Flank|VPS45_uc009wlm.1_Intron|VPS45_uc010pbr.1_Missense_Mutation_p.R112Q	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A	148					blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAAAGGGTCGAAATTGGGAT	0.353																0.38764	187.828437	189.799025	69	109	KEEP	---	---	---	---	36	42	63	59	-1	capture	Missense_Mutation	SNP	150049176	150049176	VPS45	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17093	266
KPRP	448834	broad.mit.edu	37	1	152733551	152733551	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152733551G>A	uc001fal.1	+	2	1545	c.1487G>A	c.(1486-1488)CGC>CAC	p.R496H		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	496	Pro-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGACTTGGCGCAGCCCCAGC	0.647																0.398496	136.658385	137.852493	53	80	KEEP	---	---	---	---	23	35	39	47	-1	capture	Missense_Mutation	SNP	152733551	152733551	KPRP	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8356	266
KIF26B	55083	broad.mit.edu	37	1	245862232	245862232	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:245862232G>A	uc001ibf.1	+	14	6511	c.6071G>A	c.(6070-6072)CGC>CAC	p.R2024H		NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2024					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	p.R2024H(1)		ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTGGAACACCGCCAGCAGAGG	0.572																0.325	63.015314	65.19317	26	54	KEEP	---	---	---	---	16	18	30	35	-1	capture	Missense_Mutation	SNP	245862232	245862232	KIF26B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8217	266
OR2W3	343171	broad.mit.edu	37	1	248059267	248059267	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248059267T>G	uc001idp.1	+	3	648	c.379T>G	c.(379-381)TGC>GGC	p.C127G	OR2W3_uc010pzb.1_Missense_Mutation_p.C127G	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGTGGCTATCTGCAAGCCCCT	0.607																0.301282	129.222697	134.75407	47	109	KEEP	---	---	---	---	26	28	67	54	-1	capture	Missense_Mutation	SNP	248059267	248059267	OR2W3	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	10937	266
ARHGAP21	57584	broad.mit.edu	37	10	24893240	24893240	+	Splice_Site	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24893240C>T	uc001isb.2	-	12	3208	c.2721_splice	c.e12+1	p.K907_splice	ARHGAP21_uc010qdb.1_Splice_Site|ARHGAP21_uc009xkl.1_Splice_Site_p.K907_splice|ARHGAP21_uc010qdc.1_Splice_Site_p.K742_splice	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21						signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CTAATACCAACCTTGATTCCC	0.274																0.591549	128.75458	129.272767	42	29	KEEP	---	---	---	---	28	26	18	25	-1	capture	Splice_Site	SNP	24893240	24893240	ARHGAP21	10	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	864	266
ARHGAP21	57584	broad.mit.edu	37	10	24893252	24893252	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24893252T>C	uc001isb.2	-	12	3197	c.2710A>G	c.(2710-2712)AAG>GAG	p.K904E	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.K904E|ARHGAP21_uc010qdc.1_Missense_Mutation_p.K739E	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	903					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						TTGATTCCCTTCAGACTAGAT	0.279																0.589041	159.839782	160.345788	43	30	KEEP	---	---	---	---	27	25	15	25	-1	capture	Missense_Mutation	SNP	24893252	24893252	ARHGAP21	10	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	864	266
OR52N2	390077	broad.mit.edu	37	11	5842404	5842404	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5842404C>G	uc010qzp.1	+	1	839	c.839C>G	c.(838-840)GCC>GGC	p.A280G	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCATCGTGGCCAACCTTTAT	0.398																0.3379	233.106063	238.183997	74	145	KEEP	---	---	---	---	41	46	86	92	-1	capture	Missense_Mutation	SNP	5842404	5842404	OR52N2	11	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	11032	266
TPH1	7166	broad.mit.edu	37	11	18051095	18051095	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18051095C>T	uc001mnp.2	-	4	460	c.434G>A	c.(433-435)CGA>CAA	p.R145Q	TPH1_uc009yhe.2_RNA	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	145					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AAAATACTTTCGACGTTTACG	0.264				p.R145Q(TCCPAN2-Tumor)	206											0.206767	116.363323	137.576028	55	211	KEEP	---	---	---	---	33	38	121	141	-1	capture	Missense_Mutation	SNP	18051095	18051095	TPH1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16284	266
C11orf9	745	broad.mit.edu	37	11	61541579	61541579	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61541579C>G	uc001nsc.1	+	8	1352	c.1256C>G	c.(1255-1257)ACG>AGG	p.T419R	C11orf9_uc001nse.1_Missense_Mutation_p.T410R	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	419	NDT80.				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						TACGTCAAGACGCCCGAGGGC	0.587																0.363636	50.497156	51.213143	16	28	KEEP	---	---	---	---	10	9	18	16	-1	capture	Missense_Mutation	SNP	61541579	61541579	C11orf9	11	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	1657	266
GPR137	56834	broad.mit.edu	37	11	64056613	64056613	+	Splice_Site	SNP	A	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64056613A>C	uc001nzg.1	+	8	1340	c.1032_splice	c.e8-2	p.R344_splice	GPR137_uc010rni.1_Splice_Site_p.R402_splice|GPR137_uc001nzf.2_Missense_Mutation_p.Q329P|GPR137_uc001nzi.2_Missense_Mutation_p.Q379P|GPR137_uc010rnj.1_3'UTR|KCNK4_uc009ypl.1_5'Flank|KCNK4_uc001nzj.1_5'Flank|KCNK4_uc001nzk.1_5'Flank|KCNK4_uc010rnk.1_5'Flank|KCNK4_uc001nzl.1_5'Flank|KCNK4_uc001nzm.3_5'Flank|KCNK4_uc001nzn.1_5'Flank	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137							integral to membrane				central_nervous_system(1)	1						CTCTTCTCCCAGGTGCCAGGA	0.657					60											0.387597	147.741919	149.161572	50	79	KEEP	---	---	---	---	34	26	46	44	-1	capture	Splice_Site	SNP	64056613	64056613	GPR137	11	A	C	C	C	1	0	0	0	0	0	0	1	0	91	7	5	4	6579	266
SCN4B	6330	broad.mit.edu	37	11	118014756	118014756	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118014756C>T	uc001pse.2	-	3	497	c.255G>A	c.(253-255)AAG>AAA	p.K85K	SCN4B_uc010rxu.1_5'UTR|SCN4B_uc010rxv.1_Intron	NM_174934	NP_777594	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta	85	Ig-like C2-type.|Extracellular (Potential).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)		ACTTCTCATTCTTCACAGTCC	0.507																0.271812	223.136344	237.130436	81	217	KEEP	---	---	---	---	54	42	129	117	-1	capture	Silent	SNP	118014756	118014756	SCN4B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13814	266
TMEM25	84866	broad.mit.edu	37	11	118404798	118404798	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118404798C>T	uc010rye.1	+	7	1065	c.891C>T	c.(889-891)TCC>TCT	p.S297S	TMEM25_uc001ptk.3_Silent_p.S297S|TMEM25_uc001pth.2_Silent_p.S253S|TMEM25_uc009zad.2_Silent_p.S253S|TMEM25_uc001pti.2_Silent_p.S149S|TMEM25_uc010ryf.1_Silent_p.S200S|TMEM25_uc001ptl.2_Silent_p.S297S|TMEM25_uc001ptm.2_Silent_p.S253S|TMEM25_uc001ptn.2_Silent_p.S253S	NM_032780	NP_116169	Q86YD3	TMM25_HUMAN	transmembrane protein 25 isoform 1	297	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		AGAACATGTCCCTCCCGTCCA	0.532																0.207317	40.045671	46.542154	17	65	KEEP	---	---	---	---	10	14	50	47	-1	capture	Silent	SNP	118404798	118404798	TMEM25	11	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16033	266
ADAMTS8	11095	broad.mit.edu	37	11	130284455	130284455	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130284455G>C	uc001qgg.3	-	5	1895	c.1537C>G	c.(1537-1539)CTA>GTA	p.L513V	ADAMTS8_uc001qgf.2_5'Flank	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	513	Disintegrin.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TCCTCAGGTAGACAGCTGCCT	0.637																0.017857	-37.631343	6.399728	3	165	KEEP	---	---	---	---	3	0	94	95	-1	capture	Missense_Mutation	SNP	130284455	130284455	ADAMTS8	11	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	272	266
ARNTL2	56938	broad.mit.edu	37	12	27540171	27540171	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27540171G>A	uc001rht.1	+	7	593	c.575G>A	c.(574-576)GGC>GAC	p.G192D	ARNTL2_uc001rhw.2_Missense_Mutation_p.G155D|ARNTL2_uc010sjp.1_Missense_Mutation_p.G155D|ARNTL2_uc001rhu.1_Missense_Mutation_p.G178D|ARNTL2_uc009zji.1_Missense_Mutation_p.G158D|ARNTL2_uc001rhv.1_Missense_Mutation_p.G144D	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	192	PAS 1.				circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					ACTGCAGAAGGCTTCTTATTT	0.274																0.406417	220.037553	221.474518	76	111	KEEP	---	---	---	---	45	37	63	58	-1	capture	Missense_Mutation	SNP	27540171	27540171	ARNTL2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	961	266
ESPL1	9700	broad.mit.edu	37	12	53663689	53663689	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53663689C>T	uc001sck.2	+	3	1054	c.963C>T	c.(961-963)GTC>GTT	p.V321V	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	321					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						CATCAGCTGTCCTGAGCAAGA	0.577	Colon(53;1069 1201 2587 5382)															0.297101	104.61423	109.698387	41	97	KEEP	---	---	---	---	24	19	57	53	-1	capture	Silent	SNP	53663689	53663689	ESPL1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	5208	266
TXNRD1	7296	broad.mit.edu	37	12	104705084	104705084	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104705084G>A	uc010swk.1	+	5	453	c.431G>A	c.(430-432)AGA>AAA	p.R144K	TXNRD1_uc010swl.1_5'UTR|TXNRD1_uc010swm.1_Missense_Mutation_p.R46K|TXNRD1_uc010swn.1_5'UTR|TXNRD1_uc010swo.1_5'UTR|TXNRD1_uc010swp.1_Intron|TXNRD1_uc010swq.1_Missense_Mutation_p.R44K|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Missense_Mutation_p.R60K|TXNRD1_uc001tko.1_RNA|TXNRD1_uc001tkp.1_RNA|TXNRD1_uc001tkv.1_RNA	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	144	Glutaredoxin.				cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						CAGGAGGGCAGACTTCAAAAG	0.373	Ovarian(139;555 1836 9186 9946 10884)															0.342105	40.163094	41.000361	13	25	KEEP	---	---	---	---	7	6	8	18	-1	capture	Missense_Mutation	SNP	104705084	104705084	TXNRD1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16689	266
LRRC57	255252	broad.mit.edu	37	15	42836285	42836285	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42836285G>A	uc001zqd.1	-	5	1084	c.716C>T	c.(715-717)GCG>GTG	p.A239V	LRRC57_uc001zqc.2_Missense_Mutation_p.A239V	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	239											0		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		AGAACTTCACGCAAACTTCTT	0.408																0.24507	187.731112	208.765721	87	268	KEEP	---	---	---	---	42	58	146	168	-1	capture	Missense_Mutation	SNP	42836285	42836285	LRRC57	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8928	266
HMG20A	10363	broad.mit.edu	37	15	77771653	77771653	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:77771653G>A	uc002bcr.2	+	10	1241	c.1040G>A	c.(1039-1041)CGT>CAT	p.R347H	HMG20A_uc002bcs.2_Missense_Mutation_p.R347H	NM_018200	NP_060670	Q9NP66	HM20A_HUMAN	high-mobility group 20A	347					chromatin modification	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						AGACTCGATCGTTAGGGAATG	0.368																0.04321	-24.218254	12.035501	7	155	KEEP	---	---	---	---	5	2	80	94	-1	capture	Missense_Mutation	SNP	77771653	77771653	HMG20A	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7146	266
TMC3	342125	broad.mit.edu	37	15	81627093	81627093	+	Silent	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81627093G>A	uc002bgo.1	-	21	2427	c.2427C>T	c.(2425-2427)GTC>GTT	p.V809V	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	809	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						TGGATTTGGGGACCCCAGGGA	0.572																0.378049	87.600329	88.672084	31	51	KEEP	---	---	---	---	12	19	26	27	-1	capture	Silent	SNP	81627093	81627093	TMC3	15	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	15871	266
OTOA	146183	broad.mit.edu	37	16	21716537	21716537	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21716537C>T	uc002djh.2	+	11	1029	c.1028C>T	c.(1027-1029)GCC>GTC	p.A343V	uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.A264V|OTOA_uc002dji.2_Missense_Mutation_p.A19V|OTOA_uc010vbk.1_5'UTR	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	357					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		TTGCTGGATGCCACTGTGGCT	0.512																0.415094	300.793705	302.462019	110	155	KEEP	---	---	---	---	63	59	79	97	-1	capture	Missense_Mutation	SNP	21716537	21716537	OTOA	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11206	266
GDPD3	79153	broad.mit.edu	37	16	30123709	30123709	+	Missense_Mutation	SNP	C	T	T	rs76435425		TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30123709C>T	uc002dwp.2	-	5	480	c.401G>A	c.(400-402)CGT>CAT	p.R134H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_Missense_Mutation_p.R72H|LOC100271831_uc010vei.1_5'Flank	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain	134	Extracellular (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						GTCCTCCAGACGAACCATGCG	0.602														OREG0023731	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.342246	162.237341	166.351772	64	123	KEEP	---	---	---	---	36	43	72	69	-1	capture	Missense_Mutation	SNP	30123709	30123709	GDPD3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6265	266
IRF8	3394	broad.mit.edu	37	16	85952071	85952071	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:85952071G>A	uc002fjh.2	+	7	707	c.650G>A	c.(649-651)GGC>GAC	p.G217D	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	217					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				AAGCTGGTGGGCCAGGCCACC	0.662																0.360759	135.307954	138.012644	57	101	KEEP	---	---	---	---	39	31	67	54	-1	capture	Missense_Mutation	SNP	85952071	85952071	IRF8	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7759	266
MYO18A	399687	broad.mit.edu	37	17	27424907	27424907	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27424907T>C	uc002hdt.1	-	26	4159	c.4001A>G	c.(4000-4002)GAT>GGT	p.D1334G	MYO18A_uc010wbc.1_Missense_Mutation_p.D876G|MYO18A_uc002hds.2_Missense_Mutation_p.D876G|MYO18A_uc010csa.1_Missense_Mutation_p.D1334G|MYO18A_uc002hdu.1_Missense_Mutation_p.D1334G|MYO18A_uc010wbd.1_Missense_Mutation_p.D1003G	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1334	Potential.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CTTCAGTGCATCGTACTGGGT	0.542	Esophageal Squamous(182;472 2015 7001 15270 22562)															0.015152	-46.148935	6.682872	3	195	KEEP	---	---	---	---	3	0	110	111	-1	capture	Missense_Mutation	SNP	27424907	27424907	MYO18A	17	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	9975	266
ACE	1636	broad.mit.edu	37	17	61571327	61571327	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61571327G>A	uc002jau.1	+	21	3203	c.3181G>A	c.(3181-3183)GCC>ACC	p.A1061T	ACE_uc002jav.1_Missense_Mutation_p.A487T|ACE_uc010ddv.1_Missense_Mutation_p.A288T|ACE_uc010wpj.1_Missense_Mutation_p.A487T|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Missense_Mutation_p.A307T	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	1061	Extracellular (Potential).|Peptidase M2 2.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TGACAAGATCGCCTTTATCCC	0.552																0.094737	2.34943	17.981233	9	86	KEEP	---	---	---	---	4	7	54	44	-1	capture	Missense_Mutation	SNP	61571327	61571327	ACE	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	136	266
PHLPP1	23239	broad.mit.edu	37	18	60645528	60645528	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60645528C>T	uc002lis.2	+	18	2660	c.2482C>T	c.(2482-2484)CGC>TGC	p.R828C		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	1340	PP2C-like.				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						TGAGTCCACGCGCATCCTGGG	0.582																0.368421	35.836527	36.416097	14	24	KEEP	---	---	---	---	9	6	10	18	-1	capture	Missense_Mutation	SNP	60645528	60645528	PHLPP1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11757	266
ATP8B3	148229	broad.mit.edu	37	19	1795945	1795945	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1795945C>T	uc002ltw.2	-	18	2218	c.1984G>A	c.(1984-1986)GCC>ACC	p.A662T	ATP8B3_uc002ltv.2_Missense_Mutation_p.A615T|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	662	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGTGTCGGCGCCCTTGGTG	0.627														OREG0025127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.039106	-29.715617	11.332875	7	172	KEEP	---	---	---	---	5	4	107	99	-1	capture	Missense_Mutation	SNP	1795945	1795945	ATP8B3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1187	266
MYO9B	4650	broad.mit.edu	37	19	17320489	17320489	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17320489C>T	uc010eak.2	+	36	5871	c.5719C>T	c.(5719-5721)CGC>TGC	p.R1907C	MYO9B_uc002nfi.2_Missense_Mutation_p.R1907C|MYO9B_uc002nfj.1_Missense_Mutation_p.R1907C|MYO9B_uc002nfm.1_Missense_Mutation_p.R67C	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1907	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						TATCGCCTTCCGCAGGCTTTC	0.587																0.34375	30.8146	31.505008	11	21	KEEP	---	---	---	---	6	9	13	13	-1	capture	Missense_Mutation	SNP	17320489	17320489	MYO9B	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9995	266
CRTC1	23373	broad.mit.edu	37	19	18870986	18870986	+	Silent	SNP	C	T	T	rs140237275	byFrequency	TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18870986C>T	uc002nkb.3	+	8	922	c.834C>T	c.(832-834)ACC>ACT	p.T278T	CRTC1_uc010ebv.2_Silent_p.T294T|CRTC1_uc010ebw.2_Silent_p.T143T|CRTC1_uc002nkc.3_Silent_p.T143T	NM_015321	NP_056136	Q6UUV9	CRTC1_HUMAN	mucoepidermoid carcinoma translocated 1 isoform	278					interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519						CCAGCAGCACCGGCAACCTCG	0.697					173											0.25	23.209231	25.706388	11	33	KEEP	---	---	---	---	4	9	20	15	-1	capture	Silent	SNP	18870986	18870986	CRTC1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3864	266
CD177	57126	broad.mit.edu	37	19	43859911	43859911	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43859911G>C	uc002owi.2	+	4	520	c.478G>C	c.(478-480)GAT>CAT	p.D160H	CD177_uc010eis.2_RNA|CD177_uc002owj.2_RNA	NM_020406	NP_065139	Q8N6Q3	CD177_HUMAN	CD177 molecule precursor	160	UPAR/Ly6 1.				blood coagulation|leukocyte migration	anchored to membrane|plasma membrane				central_nervous_system(1)	1		Prostate(69;0.00682)				ACACTGTTATGATGGCCTCCT	0.582																0.398305	166.70367	167.770601	47	71	KEEP	---	---	---	---	24	26	46	57	-1	capture	Missense_Mutation	SNP	43859911	43859911	CD177	19	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	2942	266
TPO	7173	broad.mit.edu	37	2	1457495	1457495	+	Missense_Mutation	SNP	C	T	T	rs139312937		TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1457495C>T	uc002qww.2	+	6	603	c.512C>T	c.(511-513)ACG>ATG	p.T171M	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.T171M|TPO_uc002qwr.2_Missense_Mutation_p.T171M|TPO_uc002qwx.2_Missense_Mutation_p.T171M|TPO_uc010yio.1_Missense_Mutation_p.T171M|TPO_uc010yip.1_Missense_Mutation_p.T171M	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	171	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCCTCCAACACGGCCCTGGCA	0.587					723											0.371336	292.954656	297.424483	114	193	KEEP	---	---	---	---	67	61	95	129	-1	capture	Missense_Mutation	SNP	1457495	1457495	TPO	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16293	266
TTN	7273	broad.mit.edu	37	2	179438088	179438088	+	Silent	SNP	A	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179438088A>G	uc010zfg.1	-	275	65291	c.65067T>C	c.(65065-65067)TAT>TAC	p.Y21689Y	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.Y15384Y|TTN_uc010zfi.1_Silent_p.Y15317Y|TTN_uc010zfj.1_Silent_p.Y15192Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22616							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTCCACAATATAATTGATGA	0.408					8722											0.148148	57.411256	76.64389	24	138	KEEP	---	---	---	---	12	13	73	69	-1	capture	Silent	SNP	179438088	179438088	TTN	2	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	16617	266
JAG1	182	broad.mit.edu	37	20	10630946	10630946	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:10630946C>T	uc002wnw.2	-	9	1699	c.1183G>A	c.(1183-1185)GGA>AGA	p.G395R	JAG1_uc010gcd.1_5'UTR	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	395	Extracellular (Potential).|EGF-like 5; calcium-binding (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						CACTTAAATCCGTTAACCAGG	0.463					587							Alagille_Syndrome				0.340909	88.430235	90.395304	30	58	KEEP	---	---	---	---	15	23	32	30	-1	capture	Missense_Mutation	SNP	10630946	10630946	JAG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7857	266
CEP250	11190	broad.mit.edu	37	20	34067060	34067060	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34067060G>A	uc002xcm.2	+	19	2770	c.2099G>A	c.(2098-2100)CGT>CAT	p.R700H	CEP250_uc010zve.1_Missense_Mutation_p.R68H	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	700	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CCTCAGTCACGTCACCAGCAG	0.592																0.369748	112.567445	114.341725	44	75	KEEP	---	---	---	---	17	28	30	50	-1	capture	Missense_Mutation	SNP	34067060	34067060	CEP250	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3220	266
PANX2	56666	broad.mit.edu	37	22	50615939	50615939	+	Silent	SNP	C	T	T	rs35622534		TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50615939C>T	uc003bjn.3	+	2	798	c.798C>T	c.(796-798)GAC>GAT	p.D266D	PANX2_uc003bjp.3_Silent_p.D132D|PANX2_uc003bjo.3_Silent_p.D266D	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2 isoform 1	266	Extracellular (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CGTCCCCGGACGGGGCGGCAG	0.692																0.129032	4.076675	8.235059	4	27	KEEP	---	---	---	---	1	4	15	18	-1	capture	Silent	SNP	50615939	50615939	PANX2	22	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11325	266
CELSR3	1951	broad.mit.edu	37	3	48694272	48694272	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48694272G>A	uc003cul.2	-	2	4539	c.4258C>T	c.(4258-4260)CGC>TGC	p.R1420C	CELSR3_uc003cuf.1_Missense_Mutation_p.R1490C	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	1420	Extracellular (Potential).|EGF-like 1; calcium-binding.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CAGCGGCAGCGCAGGCCAGCG	0.672																0.3	6.820563	7.178337	3	7	KEEP	---	---	---	---	1	5	6	4	-1	capture	Missense_Mutation	SNP	48694272	48694272	CELSR3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3191	266
LRRC66	339977	broad.mit.edu	37	4	52862310	52862310	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:52862310C>A	uc003gzi.2	-	4	891	c.878G>T	c.(877-879)GGC>GTC	p.G293V		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	293						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						CTGGGGAGTGCCCCCGTTGGC	0.483																0.135135	21.88611	41.006709	20	128	KEEP	---	---	---	---	10	11	66	87	0.52380952381	capture	Missense_Mutation	SNP	52862310	52862310	LRRC66	4	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8933	266
FRAS1	80144	broad.mit.edu	37	4	79421050	79421050	+	Silent	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79421050G>A	uc003hlb.2	+	61	9731	c.9291G>A	c.(9289-9291)AAG>AAA	p.K3097K	FRAS1_uc003hlc.1_Silent_p.K99K	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3092	Calx-beta 5.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ATTACCCAAAGAGCCGAGTCT	0.388																0.22619	130.507107	147.894114	57	195	KEEP	---	---	---	---	35	36	95	132	-1	capture	Silent	SNP	79421050	79421050	FRAS1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	5986	266
PRKG2	5593	broad.mit.edu	37	4	82126062	82126062	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82126062C>T	uc003hmh.2	-	1	154	c.140G>A	c.(139-141)CGG>CAG	p.R47Q	PRKG2_uc011cch.1_Missense_Mutation_p.R47Q	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	47					platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						ATGGTACTCCCGCTCCTGGAT	0.557				p.R47L(NCIH1793-Tumor)	728											0.337079	156.434051	160.618449	60	118	KEEP	---	---	---	---	33	41	71	73	-1	capture	Missense_Mutation	SNP	82126062	82126062	PRKG2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12419	266
RXFP1	59350	broad.mit.edu	37	4	159533468	159533468	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159533468C>T	uc003ipz.2	+	8	716	c.634C>T	c.(634-636)CGA>TGA	p.R212*	RXFP1_uc010iqj.1_Nonsense_Mutation_p.R41*|RXFP1_uc011cja.1_Nonsense_Mutation_p.R131*|RXFP1_uc010iqo.2_Nonsense_Mutation_p.R212*|RXFP1_uc011cjb.1_Nonsense_Mutation_p.R158*|RXFP1_uc010iqk.2_Nonsense_Mutation_p.R80*|RXFP1_uc011cjc.1_Nonsense_Mutation_p.R131*|RXFP1_uc011cjd.1_Nonsense_Mutation_p.R131*|RXFP1_uc010iql.2_Nonsense_Mutation_p.R80*|RXFP1_uc011cje.1_Nonsense_Mutation_p.R239*|RXFP1_uc010iqm.2_Nonsense_Mutation_p.R179*|RXFP1_uc011cjf.1_Nonsense_Mutation_p.R82*|RXFP1_uc010iqn.2_Nonsense_Mutation_p.R158*	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	212	LRR 3.|Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TCACCTCAGTCGAATTTCCCC	0.294																0.036697	-18.794294	6.575558	4	105	KEEP	---	---	---	---	4	1	79	45	-1	capture	Nonsense_Mutation	SNP	159533468	159533468	RXFP1	4	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	13651	266
SLC6A18	348932	broad.mit.edu	37	5	1244838	1244838	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1244838C>T	uc003jby.1	+	11	1735	c.1612C>T	c.(1612-1614)CTG>TTG	p.L538L		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	538	Helical; Name=11; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CATCATCCTCCTGTTCTGGAA	0.617																0.387387	122.143057	123.393323	43	68	KEEP	---	---	---	---	27	19	39	36	-1	capture	Silent	SNP	1244838	1244838	SLC6A18	5	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	14573	266
NSUN2	54888	broad.mit.edu	37	5	6622137	6622137	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:6622137G>A	uc003jdu.2	-	6	679	c.614C>T	c.(613-615)CCC>CTC	p.P205L	NSUN2_uc003jdt.2_5'Flank|NSUN2_uc011cmk.1_Missense_Mutation_p.P170L|NSUN2_uc003jdv.2_Intron	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	205						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						ACCTGGAAAGGGGACATTCAT	0.413																0.430556	285.335312	286.245102	93	123	KEEP	---	---	---	---	51	54	62	86	-1	capture	Missense_Mutation	SNP	6622137	6622137	NSUN2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10585	266
UTP15	84135	broad.mit.edu	37	5	72866479	72866480	+	Nonsense_Mutation	DNP	GG	TA	TA			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72866479_72866480GG>TA	uc003kcw.1	+	6	839_840	c.616_617GG>TA	c.(616-618)GGG>TAG	p.G206*	UTP15_uc011cso.1_Nonsense_Mutation_p.G187*|UTP15_uc011csp.1_Nonsense_Mutation_p.G16*|UTP15_uc010ize.1_Nonsense_Mutation_p.G206*	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,	206	WD 5.				rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		CGTTGAGCATGGGCAGCCAGTG	0.401																0.412766	264.377121	265.950922	97	138	KEEP	---	---	---	---	0	0	0	0	-1	capture	Nonsense_Mutation	DNP	72866479	72866480	UTP15	5	GG	TA	TA	TA	1	0	0	0	0	0	1	0	0	611	47	5	4	16979	266
CMYA5	202333	broad.mit.edu	37	5	79026182	79026182	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79026182G>A	uc003kgc.2	+	2	1666	c.1594G>A	c.(1594-1596)GTA>ATA	p.V532I		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	532	Glu-rich.					perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGAAGAGATCGTAGAACTTGA	0.418																0.396154	273.956592	276.413191	103	157	KEEP	---	---	---	---	57	52	68	90	-1	capture	Missense_Mutation	SNP	79026182	79026182	CMYA5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3555	266
PCDHGA1	56114	broad.mit.edu	37	5	140712004	140712004	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140712004G>A	uc003lji.1	+	1	1753	c.1753G>A	c.(1753-1755)GGC>AGC	p.G585S	PCDHGA1_uc011dan.1_Missense_Mutation_p.G585S	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	585	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGAGCCCGGCTACCTGGT	0.677																0.364078	212.753661	216.107701	75	131	KEEP	---	---	---	---	37	42	77	83	-1	capture	Missense_Mutation	SNP	140712004	140712004	PCDHGA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11453	266
BTN1A1	696	broad.mit.edu	37	6	26508920	26508920	+	Silent	SNP	A	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26508920A>C	uc003nif.3	+	7	1119	c.1099A>C	c.(1099-1101)AGG>CGG	p.R367R		NM_001732	NP_001723	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1 precursor	367	B30.2/SPRY.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						GGTGGGAGACAGGACTGACTG	0.532																0.041667	-44.282166	26.160522	13	299	KEEP	---	---	---	---	6	8	165	174	-1	capture	Silent	SNP	26508920	26508920	BTN1A1	6	A	C	C	C	1	0	0	0	0	0	0	0	1	88	7	4	4	1547	266
KCTD20	222658	broad.mit.edu	37	6	36437942	36437942	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36437942A>G	uc003ome.2	+	2	459	c.68A>G	c.(67-69)GAT>GGT	p.D23G	KCTD20_uc011dtm.1_5'UTR|KCTD20_uc011dtn.1_5'UTR|KCTD20_uc010jwk.2_Missense_Mutation_p.D23G|KCTD20_uc011dto.1_Intron	NM_173562	NP_775833	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerisation domain	23						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2						TTAGTGGATGATACTTTAGCT	0.473																0.370629	174.045325	176.145388	53	90	KEEP	---	---	---	---	24	35	45	52	-1	capture	Missense_Mutation	SNP	36437942	36437942	KCTD20	6	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8030	266
TFAP2D	83741	broad.mit.edu	37	6	50740520	50740520	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:50740520C>T	uc003paf.2	+	8	1814	c.1302C>T	c.(1300-1302)CCC>CCT	p.P434P	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	434							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					AGAAAGCTCCCCTGCGGAAAA	0.483																0.328947	63.83389	65.813225	25	51	KEEP	---	---	---	---	14	14	21	40	-1	capture	Silent	SNP	50740520	50740520	TFAP2D	6	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	15675	266
HDAC9	9734	broad.mit.edu	37	7	18624954	18624954	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18624954G>A	uc003suh.2	+	2	114	c.73G>A	c.(73-75)GAC>AAC	p.D25N	HDAC9_uc003sue.2_Missense_Mutation_p.D25N|HDAC9_uc011jyd.1_Missense_Mutation_p.D25N|HDAC9_uc003sui.2_Missense_Mutation_p.D25N|HDAC9_uc003suj.2_Missense_Mutation_p.D25N|HDAC9_uc011jya.1_Missense_Mutation_p.D66N|HDAC9_uc003sua.1_Missense_Mutation_p.D44N|HDAC9_uc011jyb.1_Missense_Mutation_p.D25N|HDAC9_uc003sud.1_Missense_Mutation_p.D25N|HDAC9_uc011jyc.1_Missense_Mutation_p.D25N|HDAC9_uc003suf.1_Missense_Mutation_p.D53N|HDAC9_uc010kud.1_Missense_Mutation_p.D25N|HDAC9_uc011jye.1_5'UTR|HDAC9_uc011jyf.1_5'UTR	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	25	Interaction with CTBP1 (By similarity).				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	CTCACCTTTAGACCTAAGGAC	0.498																0.258912	340.17894	368.260319	138	395	KEEP	---	---	---	---	75	73	211	204	-1	capture	Missense_Mutation	SNP	18624954	18624954	HDAC9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	6941	266
BMPER	168667	broad.mit.edu	37	7	34118619	34118619	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:34118619G>A	uc011kap.1	+	12	1343	c.1229G>A	c.(1228-1230)CGC>CAC	p.R410H		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	410	VWFD.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						AACGACGCCCGCCGGACACGC	0.622																0.280802	223.765954	238.804605	98	251	KEEP	---	---	---	---	57	53	161	157	-1	capture	Missense_Mutation	SNP	34118619	34118619	BMPER	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1456	266
EGFR	1956	broad.mit.edu	37	7	55220274	55220274	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220274C>T	uc003tqk.2	+	6	910	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.2_Missense_Mutation_p.R222C|EGFR_uc003tqi.2_Missense_Mutation_p.R222C|EGFR_uc003tqj.2_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc011kco.1_Missense_Mutation_p.R169C|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R222C(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCTCCGGGCGCTGCCGTGG	0.597			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.040865	-69.588326	24.76504	17	399	KEEP	---	---	---	---	9	13	280	334	-1	capture	Missense_Mutation	SNP	55220274	55220274	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4922	266
NSUN5	55695	broad.mit.edu	37	7	72722785	72722785	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72722785C>T	uc003txw.2	-	1	39	c.3G>A	c.(1-3)ATG>ATA	p.M1I	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Missense_Mutation_p.M1I|NSUN5_uc003txx.2_Missense_Mutation_p.M1I|NSUN5_uc011kev.1_Missense_Mutation_p.M1I	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	1							methyltransferase activity				0		Lung NSC(55;0.163)				CATACAGCCCCATGTTCCCGC	0.657																0.308411	74.814884	78.327755	33	74	KEEP	---	---	---	---	20	15	42	51	-1	capture	Missense_Mutation	SNP	72722785	72722785	NSUN5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10588	266
NEFM	4741	broad.mit.edu	37	8	24775980	24775980	+	Missense_Mutation	SNP	A	G	G	rs145571992		TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24775980A>G	uc003xed.3	+	3	2645	c.2612A>G	c.(2611-2613)AAA>AGA	p.K871R	NEFM_uc011lac.1_Missense_Mutation_p.K653R|NEFM_uc010lue.2_Missense_Mutation_p.K495R	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	871	Tail.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GGTGCTACCAAATACATCACT	0.428																0.016667	-40.534804	7.007446	3	177	KEEP	---	---	---	---	1	2	94	94	-1	capture	Missense_Mutation	SNP	24775980	24775980	NEFM	8	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	10223	266
RB1CC1	9821	broad.mit.edu	37	8	53570293	53570293	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53570293G>A	uc003xre.3	-	15	2654	c.2096C>T	c.(2095-2097)ACG>ATG	p.T699M	RB1CC1_uc003xrf.3_Missense_Mutation_p.T699M	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	699					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AAAATCAAACGTATGTGCATC	0.398	GBM(180;1701 2102 13475 42023 52570)															0.391837	259.333978	261.847183	96	149	KEEP	---	---	---	---	50	54	91	88	-1	capture	Missense_Mutation	SNP	53570293	53570293	RB1CC1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12994	266
RIMS2	9699	broad.mit.edu	37	8	104898339	104898339	+	Silent	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104898339C>T	uc003yls.2	+	2	1087	c.846C>T	c.(844-846)GGC>GGT	p.G282G	RIMS2_uc003ylp.2_Silent_p.G504G|RIMS2_uc003ylw.2_Silent_p.G312G|RIMS2_uc003ylq.2_Silent_p.G312G|RIMS2_uc003ylr.2_Silent_p.G312G	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	535					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAAAGAAAGGCGGTAAAATGC	0.433				p.G282G(HEC251-Tumor)	728								HNSCC(12;0.0054)			0.40367	115.469005	116.355475	44	65	KEEP	---	---	---	---	23	26	34	32	-1	capture	Silent	SNP	104898339	104898339	RIMS2	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13260	266
RIMS2	9699	broad.mit.edu	37	8	105257209	105257209	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105257209A>T	uc003yls.2	+	24	3695	c.3454A>T	c.(3454-3456)ATG>TTG	p.M1152L	RIMS2_uc003ylp.2_Missense_Mutation_p.M1134L|RIMS2_uc003ylw.2_Missense_Mutation_p.M1141L|RIMS2_uc003ylq.2_Missense_Mutation_p.M948L|RIMS2_uc003ylr.2_Missense_Mutation_p.M973L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1196					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGCCGTGGAAATGAGGAACTG	0.473					728								HNSCC(12;0.0054)			0.36214	240.04609	244.10447	88	155	KEEP	---	---	---	---	42	52	95	74	-1	capture	Missense_Mutation	SNP	105257209	105257209	RIMS2	8	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	13260	266
TG	7038	broad.mit.edu	37	8	134107297	134107297	+	Missense_Mutation	SNP	G	A	A	rs139465983	byFrequency	TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134107297G>A	uc003ytw.2	+	42	7290	c.7249G>A	c.(7249-7251)GCA>ACA	p.A2417T	TG_uc010mdw.2_Missense_Mutation_p.A1176T|TG_uc011ljb.1_Missense_Mutation_p.A786T|TG_uc011ljc.1_Missense_Mutation_p.A550T|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2417					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGGAGGCTCCGCACTCTCCCC	0.587				p.A2417T(42MGBA-Tumor)	1778											0.363636	222.577191	226.517091	88	154	KEEP	---	---	---	---	39	55	85	80	-1	capture	Missense_Mutation	SNP	134107297	134107297	TG	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15698	266
CYP11B2	1585	broad.mit.edu	37	8	143999226	143999226	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143999226C>T	uc003yxk.1	-	1	34	c.31G>A	c.(31-33)GTG>ATG	p.V11M		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	11					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	GGCGCTGCCACGCACACCTCT	0.612												Familial_Hyperaldosteronism_type_I				0.391447	308.409422	311.55948	119	185	KEEP	---	---	---	---	65	72	107	95	-1	capture	Missense_Mutation	SNP	143999226	143999226	CYP11B2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4106	266
RECQL4	9401	broad.mit.edu	37	8	145737371	145737371	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145737371G>A	uc003zdj.2	-	20	3348	c.3316C>T	c.(3316-3318)CGC>TGC	p.R1106C		NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	1106					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TCAAAGTAGCGGCCGAGCAGG	0.677					474	N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				0.272727	22.257072	23.796154	9	24	KEEP	---	---	---	---	5	6	13	13	-1	capture	Missense_Mutation	SNP	145737371	145737371	RECQL4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13097	266
BNC2	54796	broad.mit.edu	37	9	16435843	16435843	+	Silent	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16435843G>A	uc003zml.2	-	6	2489	c.2349C>T	c.(2347-2349)TAC>TAT	p.Y783Y	BNC2_uc011lmw.1_Silent_p.Y688Y|BNC2_uc003zmm.2_Silent_p.Y741Y|BNC2_uc003zmq.1_Silent_p.Y797Y|BNC2_uc003zmr.1_Silent_p.Y820Y|BNC2_uc003zmp.1_Silent_p.Y811Y|BNC2_uc010mij.1_Silent_p.Y705Y|BNC2_uc011lmv.1_Silent_p.Y609Y|BNC2_uc003zmo.1_Silent_p.Y705Y|BNC2_uc003zmj.2_Silent_p.Y548Y|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Silent_p.Y548Y|BNC2_uc003zmn.1_Silent_p.Y548Y	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	783					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		AAAACATGTCGTAAGTGGGGT	0.493																0.438272	195.688913	196.228869	71	91	KEEP	---	---	---	---	46	33	53	56	-1	capture	Silent	SNP	16435843	16435843	BNC2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1463	266
PGM5	5239	broad.mit.edu	37	9	71098902	71098902	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71098902G>A	uc004agr.2	+	9	1646	c.1417G>A	c.(1417-1419)GTG>ATG	p.V473M		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	473					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						TGTCTACAGCGTGGCGAAGAC	0.502																0.363636	136.455604	138.79706	52	91	KEEP	---	---	---	---	25	30	55	52	-1	capture	Missense_Mutation	SNP	71098902	71098902	PGM5	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11704	266
NACC2	138151	broad.mit.edu	37	9	138903727	138903727	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138903727G>A	uc004cgw.2	-	6	1555	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	NACC2_uc010nbh.2_Missense_Mutation_p.R106C|uc004cgv.3_5'Flank	NM_144653	NP_653254	Q96BF6	NACC2_HUMAN	BTB (POZ) domain containing 14A	467					negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0						ATGACCGTGCGGTACATCTCC	0.697																0.428571	7.322731	7.35404	3	4	KEEP	---	---	---	---	3	1	3	1	-1	capture	Missense_Mutation	SNP	138903727	138903727	NACC2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10046	266
CACNA1B	774	broad.mit.edu	37	9	141012523	141012523	+	Nonsense_Mutation	SNP	C	G	G			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:141012523C>G	uc004cog.2	+	42	6048	c.5903C>G	c.(5902-5904)TCA>TGA	p.S1968*	CACNA1B_uc004coi.2_Nonsense_Mutation_p.S1180*	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1968	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	GTGGGGCGGTCAGGAGCACTG	0.637																0.318182	22.817405	23.46372	7	15	KEEP	---	---	---	---	4	3	8	7	-1	capture	Nonsense_Mutation	SNP	141012523	141012523	CACNA1B	9	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	2515	266
MXRA5	25878	broad.mit.edu	37	X	3235282	3235282	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3235282C>T	uc004crg.3	-	6	6597	c.6440G>A	c.(6439-6441)CGC>CAC	p.R2147H		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2147	Ig-like C2-type 6.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCCCGTGATGCGCGCGTTGGC	0.706																0.73913	49.780395	50.970769	17	6	KEEP	---	---	---	---	16	6	7	2	-1	capture	Missense_Mutation	SNP	3235282	3235282	MXRA5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9913	266
ATP11C	286410	broad.mit.edu	37	X	138908934	138908934	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138908934T>C	uc004faz.2	-	2	184	c.85A>G	c.(85-87)AAT>GAT	p.N29D	ATP11C_uc004fba.2_Missense_Mutation_p.N29D	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	29	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					ACTGGATGATTGCCAACAAAC	0.373																0.813559	341.568622	352.443933	96	22	KEEP	---	---	---	---	55	50	11	14	-1	capture	Missense_Mutation	SNP	138908934	138908934	ATP11C	23	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	1112	266
AACS	65985	broad.mit.edu	37	12	125609456	125609457	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125609456_125609457delCA	uc001uhc.2	+	12	1401_1402	c.1195_1196delCA	c.(1195-1197)CACfs	p.H399fs	AACS_uc001uhd.2_Frame_Shift_Del_p.H399fs|AACS_uc009zyh.2_Intron|AACS_uc009zyi.2_5'UTR	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	399					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		AGTGGAAACCCACAGTCTCCAG	0.505																0.33			46	92		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	125609456	125609457	AACS	12	CA	-	-	-	1	0	1	0	1	0	0	0	0	273	21	5	5	9	266
SPAG5	10615	broad.mit.edu	37	17	26907060	26907064	+	Frame_Shift_Del	DEL	GGAAG	-	-			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26907060_26907064delGGAAG	uc002hbq.2	-	16	2852_2856	c.2760_2764delCTTCC	c.(2758-2766)ACCTTCCTGfs	p.T920fs	SGK494_uc010waq.1_Frame_Shift_Del_p.T325fs	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	920_922					cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					ATGCTTCCCAGGAAGGTCCTGTCAT	0.507																0.29			34	85		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	26907060	26907064	SPAG5	17	GGAAG	-	-	-	1	0	1	0	1	0	0	0	0	451	35	5	5	14873	266
IBTK	25998	broad.mit.edu	37	6	82924063	82924066	+	Frame_Shift_Del	DEL	ACTA	-	-			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:82924063_82924066delACTA	uc003pjl.1	-	12	2609_2612	c.2082_2085delTAGT	c.(2080-2085)GTTAGTfs	p.V694fs	IBTK_uc011dyv.1_Frame_Shift_Del_p.V694fs|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Frame_Shift_Del_p.V388fs|IBTK_uc003pjm.2_Frame_Shift_Del_p.V694fs	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	694_695					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TCTGCCTCTCACTAACTGTTTGAG	0.338																0.31			87	196		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	82924063	82924066	IBTK	6	ACTA	-	-	-	1	0	1	0	1	0	0	0	0	76	6	5	5	7401	266
OR2A5	393046	broad.mit.edu	37	7	143748358	143748359	+	Frame_Shift_Ins	INS	-	A	A			TCGA-76-4926-01	TCGA-76-4926-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143748358_143748359insA	uc011ktw.1	+	1	864_865	c.864_865insA	c.(862-867)TTGATCfs	p.L288fs		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	288_289	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					TGAACCCCTTGATCTATAGCCT	0.525																0.32			118	253		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	143748358	143748359	OR2A5	7	-	A	A	A	1	0	1	1	0	0	0	0	0	581	45	5	5	10885	266
