Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GJA5	2702	broad.mit.edu	37	1	147230396	147230396	+	Silent	SNP	A	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147230396A>G	uc001eps.1	-	2	1092	c.951T>C	c.(949-951)TAT>TAC	p.Y317Y	GJA5_uc001ept.1_Silent_p.Y317Y	NM_181703	NP_859054	P36382	CXA5_HUMAN	connexin 40	317	Cytoplasmic (Potential).				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane				ovary(1)	1	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			GCTTCTGGCCATAACGAACCT	0.542																0.391667	136.758562	138.00315	47	73	KEEP	---	---	---	---	31	21	32	46	-1	capture	Silent	SNP	147230396	147230396	GJA5	1	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	6341	274
KPRP	448834	broad.mit.edu	37	1	152732251	152732251	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152732251G>A	uc001fal.1	+	2	245	c.187G>A	c.(187-189)GCT>ACT	p.A63T		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	63	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCAGACCAGGCTCCATGCCA	0.552																0.4	144.487614	145.527704	50	75	KEEP	---	---	---	---	24	27	34	42	-1	capture	Missense_Mutation	SNP	152732251	152732251	KPRP	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8356	274
METTL13	51603	broad.mit.edu	37	1	171765699	171765699	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:171765699C>A	uc001ghz.2	+	8	2250	c.1903C>A	c.(1903-1905)CCC>ACC	p.P635T	METTL13_uc001gia.2_Missense_Mutation_p.P549T|METTL13_uc001gib.2_Missense_Mutation_p.P479T|METTL13_uc010pml.1_Missense_Mutation_p.P634T|METTL13_uc001gic.1_RNA	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	635							methyltransferase activity|protein binding			kidney(1)	1						GGCAGTGTTCCCCCTCCTATA	0.498																0.387931	115.507822	116.796048	45	71	KEEP	---	---	---	---	22	26	29	52	0.541666666667	capture	Missense_Mutation	SNP	171765699	171765699	METTL13	1	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9409	274
TPR	7175	broad.mit.edu	37	1	186289465	186289465	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186289465C>T	uc001grv.2	-	46	6844	c.6547G>A	c.(6547-6549)GGC>AGC	p.G2183S		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2183					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCAAGCTGGCCAAGATCAGAG	0.418					1949	T	NTRK1	papillary thyroid								0.25	8.719017	9.400813	3	9	KEEP	---	---	---	---	2	1	7	4	-1	capture	Missense_Mutation	SNP	186289465	186289465	TPR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	16299	274
PTEN	5728	broad.mit.edu	37	10	89624299	89624299	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89624299T>G	uc001kfb.2	+	2	1104	c.73T>G	c.(73-75)TTG>GTG	p.L25V	KILLIN_uc009xti.2_5'Flank	NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	25	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(13)|p.0?(12)|p.L25F(2)|p.D24_L25del(1)|p.L25fs*28(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CGACTTAGACTTGACCTGTAT	0.463			31	p.L25L(COLO684-Tumor)|p.L25Q(SUPHD1-Tumor)|p.L25L(COLO704-Tumor)|p.L25V(OVK18-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.775	110.245735	113.024274	31	9	KEEP	---	---	---	---	14	18	7	4	-1	capture	Missense_Mutation	SNP	89624299	89624299	PTEN	10	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	12633	274
TSPAN32	10077	broad.mit.edu	37	11	2334954	2334954	+	Missense_Mutation	SNP	G	A	A	rs138129469		TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2334954G>A	uc001lvy.1	+	5	562	c.425G>A	c.(424-426)CGG>CAG	p.R142Q	TSPAN32_uc001lvx.1_Intron|TSPAN32_uc009ydk.1_Missense_Mutation_p.R152Q|TSPAN32_uc010qxk.1_Missense_Mutation_p.R177Q|TSPAN32_uc009ydl.1_RNA|TSPAN32_uc001lvz.1_Missense_Mutation_p.R112Q|TSPAN32_uc001lwb.1_Missense_Mutation_p.R112Q|TSPAN32_uc001lwc.1_Missense_Mutation_p.R87Q|TSPAN32_uc001lwd.1_5'Flank	NM_139022	NP_620591	Q96QS1	TSN32_HUMAN	tumor-suppressing subtransferable candidate 6	142					cell-cell signaling	integral to membrane				central_nervous_system(1)	1		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TCCCACGTCCGGCGGCAGGAG	0.647																0.357143	14.672181	14.92336	5	9	KEEP	---	---	---	---	5	0	5	6	-1	capture	Missense_Mutation	SNP	2334954	2334954	TSPAN32	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16530	274
OR52R1	119695	broad.mit.edu	37	11	4825512	4825512	+	Silent	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4825512C>T	uc010qym.1	-	1	336	c.336G>A	c.(334-336)CCG>CCA	p.P112P		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCACAGAACGGAAAGGCAA	0.512																0.433333	36.868622	36.984812	13	17	KEEP	---	---	---	---	10	5	7	11	-1	capture	Silent	SNP	4825512	4825512	OR52R1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11035	274
OR5D14	219436	broad.mit.edu	37	11	55563722	55563722	+	Missense_Mutation	SNP	C	T	T	rs143761060		TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55563722C>T	uc010rim.1	+	1	691	c.691C>T	c.(691-693)CGT>TGT	p.R231C		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				ACTAAAAATCCGTTCTGTTAG	0.473																0.423077	140.789516	141.324825	44	60	KEEP	---	---	---	---	24	21	24	39	-1	capture	Missense_Mutation	SNP	55563722	55563722	OR5D14	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11059	274
MS4A6E	245802	broad.mit.edu	37	11	60102450	60102450	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60102450G>A	uc001npd.2	+	1	96	c.82G>A	c.(82-84)GAA>AAA	p.E28K		NM_139249	NP_640342	Q96DS6	M4A6E_HUMAN	membrane-spanning 4-domains, subfamily A, member	28	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						AGAGAAACCCGAACCCACCAA	0.443																0.40678	142.959429	143.858875	48	70	KEEP	---	---	---	---	20	30	39	37	-1	capture	Missense_Mutation	SNP	60102450	60102450	MS4A6E	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9775	274
MS4A14	84689	broad.mit.edu	37	11	60183031	60183031	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60183031C>T	uc001npj.2	+	5	1155	c.590C>T	c.(589-591)GCA>GTA	p.A197V	MS4A14_uc001npi.2_Missense_Mutation_p.A85V|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.A180V|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	197						integral to membrane	receptor activity			breast(1)	1						ACAACAAATGCACAATCTGTT	0.378																0.397849	105.033739	105.888651	37	56	KEEP	---	---	---	---	28	14	32	30	-1	capture	Missense_Mutation	SNP	60183031	60183031	MS4A14	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9768	274
MS4A12	54860	broad.mit.edu	37	11	60271232	60271232	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60271232T>C	uc001npr.2	+	5	587	c.530T>C	c.(529-531)ATT>ACT	p.I177T		NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	177	Helical; (Potential).					integral to membrane	receptor activity				0						ATTGGAGTGATTCTGCTGCTG	0.458																0.378378	91.265732	92.231499	28	46	KEEP	---	---	---	---	17	14	19	29	-1	capture	Missense_Mutation	SNP	60271232	60271232	MS4A12	11	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	9766	274
PPFIA1	8500	broad.mit.edu	37	11	70181755	70181755	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70181755G>A	uc001opo.2	+	11	1581	c.1383G>A	c.(1381-1383)AGG>AGA	p.R461R	PPFIA1_uc001opn.1_Silent_p.R461R|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	461	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CTAATGAGAGGCTTCAACTTC	0.403																0.418919	92.612739	93.037172	31	43	KEEP	---	---	---	---	18	14	22	25	-1	capture	Silent	SNP	70181755	70181755	PPFIA1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	12210	274
CADM1	23705	broad.mit.edu	37	11	115111056	115111056	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:115111056T>A	uc001ppi.3	-	2	338	c.209A>T	c.(208-210)GAC>GTC	p.D70V	CADM1_uc001ppf.3_Missense_Mutation_p.D70V|CADM1_uc001ppk.3_Missense_Mutation_p.D70V|CADM1_uc001ppj.3_Missense_Mutation_p.D70V|CADM1_uc001ppl.2_Missense_Mutation_p.D70V	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	70	Ig-like V-type.|Extracellular (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CACAGAGTCGTCACTCTTATT	0.443																0.288889	33.264301	35.058093	13	32	KEEP	---	---	---	---	9	6	10	24	-1	capture	Missense_Mutation	SNP	115111056	115111056	CADM1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	2542	274
CHEK1	1111	broad.mit.edu	37	11	125503132	125503132	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125503132A>T	uc009zbo.2	+	6	1391	c.499A>T	c.(499-501)ATG>TTG	p.M167L	CHEK1_uc010sbh.1_Missense_Mutation_p.M183L|CHEK1_uc010sbi.1_Missense_Mutation_p.M167L|CHEK1_uc001qcf.3_Missense_Mutation_p.M167L|CHEK1_uc009zbp.2_Missense_Mutation_p.M167L|CHEK1_uc001qcg.3_Missense_Mutation_p.M167L|CHEK1_uc009zbq.2_Missense_Mutation_p.M167L|CHEK1_uc001qci.1_RNA	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	167	Protein kinase.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GTTGAACAAGATGTGTGGTAC	0.378					124						Other_conserved_DNA_damage_response_genes					0.467532	111.893415	111.964049	36	41	KEEP	---	---	---	---	22	17	26	18	-1	capture	Missense_Mutation	SNP	125503132	125503132	CHEK1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	3300	274
PLCZ1	89869	broad.mit.edu	37	12	18836249	18836249	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18836249C>T	uc010sid.1	-	15	1942	c.1751G>A	c.(1750-1752)CGT>CAT	p.R584H	PLCZ1_uc001rdv.3_Missense_Mutation_p.R480H|PLCZ1_uc001rdw.3_Missense_Mutation_p.R325H|PLCZ1_uc001rdu.1_Missense_Mutation_p.R366H|PLCZ1_uc009zil.1_RNA	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1	584					intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	p.R584C(1)		ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					CAGAGGAATACGACGATAACC	0.378																0.447368	52.671204	52.762468	17	21	KEEP	---	---	---	---	11	7	6	15	-1	capture	Missense_Mutation	SNP	18836249	18836249	PLCZ1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11947	274
EP400	57634	broad.mit.edu	37	12	132491424	132491424	+	Splice_Site	SNP	T	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132491424T>C	uc001ujn.2	+	14	3339	c.3304_splice	c.e14+2	p.G1102_splice	EP400_uc001ujl.2_Splice_Site_p.G1101_splice|EP400_uc001ujm.2_Splice_Site_p.G1102_splice	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400						histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GTAACGAAGGTAAGAGTTTGC	0.413																0.422535	104.237124	104.60884	30	41	KEEP	---	---	---	---	19	17	17	28	-1	capture	Splice_Site	SNP	132491424	132491424	EP400	12	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	5104	274
EFHA1	221154	broad.mit.edu	37	13	22067477	22067477	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:22067477T>G	uc001uof.2	-	12	1238	c.1216A>C	c.(1216-1218)AGT>CGT	p.S406R	EFHA1_uc010tct.1_Missense_Mutation_p.S196R	NM_152726	NP_689939	Q8IYU8	EFHA1_HUMAN	EF-hand domain family, member A1	406							calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)		TCTTGTATACTCTGATGTTGT	0.318	Melanoma(62;324 1254 9816 15680 25767)															0.342466	79.816631	81.434326	25	48	KEEP	---	---	---	---	14	18	28	24	-1	capture	Missense_Mutation	SNP	22067477	22067477	EFHA1	13	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	4898	274
MCF2L	23263	broad.mit.edu	37	13	113729315	113729315	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113729315G>T	uc001vsu.2	+	11	1313	c.1291G>T	c.(1291-1293)GCC>TCC	p.A431S	MCF2L_uc001vsq.2_Missense_Mutation_p.A431S|MCF2L_uc010tjr.1_Missense_Mutation_p.A374S|MCF2L_uc001vsr.2_Missense_Mutation_p.A378S|MCF2L_uc001vss.3_Missense_Mutation_p.A372S|MCF2L_uc010tjs.1_Missense_Mutation_p.A372S|MCF2L_uc001vst.1_Missense_Mutation_p.A336S	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	404	Spectrin.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TCCACAGGTGGCCGTGGAGAG	0.647																0.357143	110.364181	112.379216	40	72	KEEP	---	---	---	---	16	28	56	31	0.363636363636	capture	Missense_Mutation	SNP	113729315	113729315	MCF2L	13	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	9292	274
KCNK10	54207	broad.mit.edu	37	14	88651963	88651963	+	Silent	SNP	G	A	A	rs75132782	byFrequency;by1000genomes	TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88651963G>A	uc001xwo.2	-	7	1990	c.1533C>T	c.(1531-1533)CAC>CAT	p.H511H	KCNK10_uc001xwm.2_Silent_p.H516H|KCNK10_uc001xwn.2_Silent_p.H516H	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	511	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CCAACTCAGCGTGCTGCTGGA	0.498																0.477273	127.719666	127.759957	42	46	KEEP	---	---	---	---	15	30	27	28	-1	capture	Silent	SNP	88651963	88651963	KCNK10	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7981	274
FMN1	342184	broad.mit.edu	37	15	33359812	33359812	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33359812C>T	uc001zhf.3	-	1	274	c.274G>A	c.(274-276)GGA>AGA	p.G92R	FMN1_uc001zhg.2_Missense_Mutation_p.G92R	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:Variant_position_missing_in_Q68DA7_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TCATCATTTCCGAGGTCAGGT	0.493																0.15	18.447411	25.483103	9	51	KEEP	---	---	---	---	4	7	20	35	-1	capture	Missense_Mutation	SNP	33359812	33359812	FMN1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5893	274
TGM5	9333	broad.mit.edu	37	15	43544994	43544994	+	Silent	SNP	G	A	A	rs138771869		TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43544994G>A	uc001zrd.1	-	6	833	c.825C>T	c.(823-825)TAC>TAT	p.Y275Y	TGM5_uc001zre.1_Silent_p.Y193Y	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	275					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	AGCATTGCCCGTAGCGCACGG	0.587																0.613636	86.332084	86.829591	27	17	KEEP	---	---	---	---	17	15	13	8	-1	capture	Silent	SNP	43544994	43544994	TGM5	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15718	274
LDHAL6B	92483	broad.mit.edu	37	15	59499582	59499582	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59499582G>T	uc002agb.2	+	1	541	c.443G>T	c.(442-444)CGC>CTC	p.R148L	MYO1E_uc002aga.2_Intron	NM_033195	NP_149972	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	148		NAD (By similarity).			glycolysis	cytoplasm	L-lactate dehydrogenase activity|protein binding				0					NADH(DB00157)	GCAGGTGCACGCCAAGAAAAG	0.438																0.625	188.203106	189.44841	55	33	KEEP	---	---	---	---	27	34	14	24	0.44262295082	capture	Missense_Mutation	SNP	59499582	59499582	LDHAL6B	15	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	8620	274
ZNF710	374655	broad.mit.edu	37	15	90610585	90610585	+	Silent	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90610585C>T	uc002bov.1	+	2	339	c.216C>T	c.(214-216)AAC>AAT	p.N72N		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	72					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			TGGCCTGCAACGGGAGGGCCT	0.711																1	7.67697	7.453751	2	0	KEEP	---	---	---	---	0	3	0	0	-1	capture	Silent	SNP	90610585	90610585	ZNF710	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17991	274
C16orf59	80178	broad.mit.edu	37	16	2511144	2511144	+	Missense_Mutation	SNP	C	G	G	rs34653281		TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2511144C>G	uc002cqh.2	+	4	555	c.524C>G	c.(523-525)CCT>CGT	p.P175R	C16orf59_uc002cqf.1_Missense_Mutation_p.P175R|C16orf59_uc002cqg.1_Missense_Mutation_p.P8R|C16orf59_uc002cqi.2_Missense_Mutation_p.P8R|C16orf59_uc010uwb.1_Missense_Mutation_p.P8R	NM_025108	NP_079384	Q7L2K0	CP059_HUMAN	hypothetical protein LOC80178	175											0		Ovarian(90;0.17)				ACCCCCAGGCCTGGGGCGGGC	0.687																0.466667	45.747635	45.776653	14	16	KEEP	---	---	---	---	6	9	7	10	-1	capture	Missense_Mutation	SNP	2511144	2511144	C16orf59	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	1809	274
GRIN2A	2903	broad.mit.edu	37	16	9858638	9858638	+	Silent	SNP	A	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9858638A>T	uc002czo.3	-	13	3311	c.2763T>A	c.(2761-2763)GCT>GCA	p.A921A	GRIN2A_uc010uym.1_Silent_p.A921A|GRIN2A_uc010uyn.1_Silent_p.A764A|GRIN2A_uc002czr.3_Silent_p.A921A	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	921	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGAAGTCAGCAGCTCTTTTGG	0.468					324											0.402655	288.004903	289.869653	91	135	KEEP	---	---	---	---	44	53	68	79	-1	capture	Silent	SNP	9858638	9858638	GRIN2A	16	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	6712	274
LRRC48	83450	broad.mit.edu	37	17	17910458	17910458	+	Silent	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17910458C>T	uc010vxd.1	+	13	1702	c.1323C>T	c.(1321-1323)CGC>CGT	p.R441R	LRRC48_uc002gsa.2_Silent_p.R441R|LRRC48_uc010vxc.1_Silent_p.R441R|LRRC48_uc002gsb.2_Silent_p.R441R	NM_001130090	NP_001123562	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48 isoform a	441						cytoplasm				pancreas(1)	1	all_neural(463;0.228)					ACGACCTGCGCGCGGTAGGCG	0.348																0.75	19.65352	20.108029	6	2	KEEP	---	---	---	---	3	4	2	4	-1	capture	Silent	SNP	17910458	17910458	LRRC48	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8920	274
CD79B	974	broad.mit.edu	37	17	62007651	62007651	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62007651G>A	uc002jdq.1	-	3	296	c.213C>T	c.(211-213)TCC>TCT	p.S71S	CD79B_uc002jdo.1_Silent_p.S45S|CD79B_uc002jdp.1_Silent_p.S72S|CD79B_uc002jdr.1_Intron	NM_000626	NP_000617	P40259	CD79B_HUMAN	CD79B antigen isoform 1 precursor	71	Extracellular (Potential).|Ig-like V-type.				cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity				0						TCACATTGCCGGAGGCGCTGT	0.567					62	Mis|O		DLBCL								0.372549	57.79457	58.528287	19	32	KEEP	---	---	---	---	9	11	11	22	-1	capture	Silent	SNP	62007651	62007651	CD79B	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3008	274
THEG	51298	broad.mit.edu	37	19	362356	362356	+	Silent	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:362356C>T	uc002lol.2	-	8	1023	c.984G>A	c.(982-984)AAG>AAA	p.K328K	THEG_uc002lom.2_Silent_p.K304K	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	328	THEG 6.				cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCACCTTCTTGGTGACAT	0.617																0.45082	174.214556	174.470964	55	67	KEEP	---	---	---	---	22	43	40	33	-1	capture	Silent	SNP	362356	362356	THEG	19	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	15742	274
COL5A3	50509	broad.mit.edu	37	19	10104318	10104318	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10104318G>T	uc002mmq.1	-	18	1758	c.1672C>A	c.(1672-1674)CTG>ATG	p.L558M		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	558	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TCACCAGGCAGCCCAGGGAGG	0.587																0.44	65.151479	65.306285	22	28	KEEP	---	---	---	---	6	20	20	16	0.230769230769	capture	Missense_Mutation	SNP	10104318	10104318	COL5A3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	3663	274
RYR1	6261	broad.mit.edu	37	19	39001381	39001381	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39001381G>A	uc002oit.2	+	60	9212	c.9082G>A	c.(9082-9084)GGT>AGT	p.G3028S	RYR1_uc002oiu.2_Missense_Mutation_p.G3028S|RYR1_uc002oiv.1_5'UTR|RYR1_uc010xuf.1_5'Flank	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3028	Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCTGGGCAGCGGTGGCCACGC	0.572																0.512195	138.551629	138.562357	42	40	KEEP	---	---	---	---	23	21	19	24	-1	capture	Missense_Mutation	SNP	39001381	39001381	RYR1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13660	274
PRX	57716	broad.mit.edu	37	19	40902416	40902416	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40902416C>T	uc002onr.2	-	7	2112	c.1843G>A	c.(1843-1845)GAT>AAT	p.D615N	PRX_uc002onq.2_Missense_Mutation_p.D476N|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	615	29.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGGTGCACATCGGGCACGGCC	0.552																0.443478	316.099782	316.742465	102	128	KEEP	---	---	---	---	61	46	84	58	-1	capture	Missense_Mutation	SNP	40902416	40902416	PRX	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12537	274
KCNJ3	3760	broad.mit.edu	37	2	155711520	155711520	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:155711520T>A	uc002tyv.1	+	3	1396	c.1201T>A	c.(1201-1203)TCT>ACT	p.S401T	KCNJ3_uc010zce.1_3'UTR	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	401	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	AAAACTACCATCTAAGCTGCA	0.398																0.447368	267.146735	267.605644	85	105	KEEP	---	---	---	---	50	44	52	66	-1	capture	Missense_Mutation	SNP	155711520	155711520	KCNJ3	2	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	7974	274
LRP2	4036	broad.mit.edu	37	2	170003375	170003375	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170003375C>A	uc002ues.2	-	69	12898	c.12685G>T	c.(12685-12687)GGT>TGT	p.G4229C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4229	LDL-receptor class B 36.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GTTGGCCAACCAAGGTCCTCG	0.448					2055											0.432836	87.761273	88.025228	29	38	KEEP	---	---	---	---	14	15	21	18	0.51724137931	capture	Missense_Mutation	SNP	170003375	170003375	LRP2	2	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	8872	274
TTC30A	92104	broad.mit.edu	37	2	178482747	178482747	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178482747C>T	uc002ulo.2	-	1	948	c.683G>A	c.(682-684)GGC>GAC	p.G228D		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	228					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			GGTGGTCATGCCCACACCTAG	0.527																0.0625	-4.251127	8.5146	4	60	KEEP	---	---	---	---	1	3	34	27	-1	capture	Missense_Mutation	SNP	178482747	178482747	TTC30A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16580	274
MATN4	8785	broad.mit.edu	37	20	43926658	43926658	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43926658G>A	uc002xnn.2	-	8	1666	c.1479C>T	c.(1477-1479)CGC>CGT	p.R493R	MATN4_uc002xno.2_Silent_p.R452R|MATN4_uc002xnp.2_Silent_p.R411R|MATN4_uc010zwr.1_Silent_p.R441R|MATN4_uc002xnr.1_Silent_p.R493R	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	534	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				AGGCGATCTCGCGCAGCTCCG	0.672																0.431818	50.234711	50.408124	19	25	KEEP	---	---	---	---	13	7	13	13	-1	capture	Silent	SNP	43926658	43926658	MATN4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9249	274
NCOA5	57727	broad.mit.edu	37	20	44693706	44693706	+	Missense_Mutation	SNP	C	T	T	rs150367556		TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44693706C>T	uc002xrd.2	-	5	1319	c.791G>A	c.(790-792)CGC>CAC	p.R264H	NCOA5_uc002xrc.2_Missense_Mutation_p.R152H|NCOA5_uc002xre.2_Missense_Mutation_p.R264H	NM_020967	NP_066018	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	264					regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				TGTGCAGGAGCGGTGAATCTG	0.473																0.403361	138.674586	139.646573	48	71	KEEP	---	---	---	---	30	23	38	40	-1	capture	Missense_Mutation	SNP	44693706	44693706	NCOA5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10139	274
COL6A1	1291	broad.mit.edu	37	21	47410308	47410308	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47410308G>A	uc002zhu.1	+	13	1076	c.974G>A	c.(973-975)CGT>CAT	p.R325H		NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	325	Triple-helical region.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	AAGGGCAAGCGTGGCATCGAC	0.478																0.515152	52.074023	52.080544	17	16	KEEP	---	---	---	---	10	8	14	10	-1	capture	Missense_Mutation	SNP	47410308	47410308	COL6A1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3664	274
TCF20	6942	broad.mit.edu	37	22	42609517	42609517	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42609517C>A	uc003bcj.1	-	1	1929	c.1795G>T	c.(1795-1797)GTT>TTT	p.V599F	TCF20_uc003bck.1_Missense_Mutation_p.V599F|TCF20_uc003bnt.2_Missense_Mutation_p.V599F	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	599					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TTCTCATTAACCTTTGGGTTC	0.542																0.371901	133.644422	135.388491	45	76	KEEP	---	---	---	---	37	17	42	44	0.314814814815	capture	Missense_Mutation	SNP	42609517	42609517	TCF20	22	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	15575	274
PLCL2	23228	broad.mit.edu	37	3	17053527	17053527	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:17053527A>G	uc011awc.1	+	5	2770	c.2665A>G	c.(2665-2667)AGA>GGA	p.R889G	PLCL2_uc011awd.1_Missense_Mutation_p.R771G	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	897					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						CCTTTCTGTGAGAAAAGGGAA	0.463																0.068966	-1.481103	20.779815	8	108	KEEP	---	---	---	---	4	4	59	57	-1	capture	Missense_Mutation	SNP	17053527	17053527	PLCL2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	11943	274
TRAK1	22906	broad.mit.edu	37	3	42167078	42167078	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42167078G>A	uc003cky.2	+	2	474	c.258G>A	c.(256-258)GAG>GAA	p.E86E	TRAK1_uc011azh.1_Silent_p.E86E|TRAK1_uc011azi.1_Silent_p.E86E	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	86	HAP1 N-terminal.				endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						TCACAACCGAGCAAATTGAAG	0.443	GBM(44;195 884 22595 31865 41850)															0.44086	124.653571	124.938234	41	52	KEEP	---	---	---	---	17	30	20	38	-1	capture	Silent	SNP	42167078	42167078	TRAK1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	16332	274
OR5H1	26341	broad.mit.edu	37	3	97852415	97852415	+	Silent	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97852415C>T	uc011bgt.1	+	1	874	c.874C>T	c.(874-876)CTG>TTG	p.L292L		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	292	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CATCTACAGTCTGAGAAATAA	0.348																0.301887	95.9827	99.684383	32	74	KEEP	---	---	---	---	15	19	47	35	-1	capture	Silent	SNP	97852415	97852415	OR5H1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	11063	274
OR5K1	26339	broad.mit.edu	37	3	98189045	98189045	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98189045T>A	uc003dsm.2	+	1	625	c.625T>A	c.(625-627)TTT>ATT	p.F209I		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						AGTTCAAGTCTTTACCATAGG	0.353																0.387597	146.943997	148.363591	50	79	KEEP	---	---	---	---	25	28	36	52	-1	capture	Missense_Mutation	SNP	98189045	98189045	OR5K1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	11070	274
EHHADH	1962	broad.mit.edu	37	3	184910535	184910535	+	Nonsense_Mutation	SNP	G	A	A	rs138388673	byFrequency	TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184910535G>A	uc003fpf.2	-	7	1678	c.1651C>T	c.(1651-1653)CGA>TGA	p.R551*	EHHADH_uc011brs.1_Nonsense_Mutation_p.R455*	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	551	3-hydroxyacyl-CoA dehydrogenase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	CCCCTTTTTCGGGCAGGAGTT	0.473																0.44898	73.745801	73.856713	22	27	KEEP	---	---	---	---	12	12	16	13	-1	capture	Nonsense_Mutation	SNP	184910535	184910535	EHHADH	3	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	4937	274
MUC4	4585	broad.mit.edu	37	3	195515435	195515435	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195515435C>T	uc011bto.1	-	2	3476	c.3016G>A	c.(3016-3018)GCC>ACC	p.A1006T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.582																0.75	10.533793	10.754597	3	1	KEEP	---	---	---	---	3	0	2	0	-1	capture	Missense_Mutation	SNP	195515435	195515435	MUC4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9888	274
RGS12	6002	broad.mit.edu	37	4	3319669	3319669	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3319669C>T	uc003ggw.2	+	2	2676	c.1772C>T	c.(1771-1773)GCG>GTG	p.A591V	RGS12_uc003ggu.2_Missense_Mutation_p.A591V|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Missense_Mutation_p.A591V|RGS12_uc003ggx.1_Missense_Mutation_p.A591V	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	591						condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGCAGCTTCGCGCAGCCCCCG	0.577																0.433735	211.814554	212.439945	72	94	KEEP	---	---	---	---	37	44	44	61	-1	capture	Missense_Mutation	SNP	3319669	3319669	RGS12	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13187	274
AFM	173	broad.mit.edu	37	4	74367504	74367504	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74367504G>C	uc003hhb.2	+	13	1678	c.1647G>C	c.(1645-1647)AGG>AGC	p.R549S		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	549	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTGGCCACAGGTTTCTTGTCA	0.388																0.40625	47.069464	47.315207	13	19	KEEP	---	---	---	---	7	6	11	8	-1	capture	Missense_Mutation	SNP	74367504	74367504	AFM	4	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	361	274
RXFP1	59350	broad.mit.edu	37	4	159554592	159554592	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159554592C>T	uc003ipz.2	+	12	1017	c.935C>T	c.(934-936)CCG>CTG	p.P312L	RXFP1_uc010iqj.1_Missense_Mutation_p.P141L|RXFP1_uc011cja.1_Missense_Mutation_p.P207L|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Missense_Mutation_p.P180L|RXFP1_uc011cjc.1_Missense_Mutation_p.P231L|RXFP1_uc011cjd.1_Missense_Mutation_p.P231L|RXFP1_uc010iql.2_Missense_Mutation_p.P156L|RXFP1_uc011cje.1_Missense_Mutation_p.P339L|RXFP1_uc010iqm.2_Missense_Mutation_p.P279L|RXFP1_uc011cjf.1_Missense_Mutation_p.P182L|RXFP1_uc010iqn.2_Missense_Mutation_p.P258L	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	312	Extracellular (Potential).|LRR 7.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AATCTTCCACCGCTTATATTC	0.284																0.352113	78.057751	79.425506	25	46	KEEP	---	---	---	---	14	16	28	29	-1	capture	Missense_Mutation	SNP	159554592	159554592	RXFP1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13651	274
SPOCK3	50859	broad.mit.edu	37	4	167663205	167663205	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:167663205G>T	uc003iri.1	-	10	1087	c.946C>A	c.(946-948)CCT>ACT	p.P316T	SPOCK3_uc011cjp.1_Missense_Mutation_p.P273T|SPOCK3_uc011cjq.1_Missense_Mutation_p.P325T|SPOCK3_uc011cjr.1_Missense_Mutation_p.P196T|SPOCK3_uc003irj.1_Missense_Mutation_p.P313T|SPOCK3_uc011cjs.1_Missense_Mutation_p.P265T|SPOCK3_uc011cjt.1_Missense_Mutation_p.P224T|SPOCK3_uc011cju.1_Missense_Mutation_p.P209T|SPOCK3_uc011cjv.1_Missense_Mutation_p.P218T	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	316	Thyroglobulin type-1.				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		GTCTGGCAAGGTGGGTCTGCA	0.373																0.448598	154.289919	154.535389	48	59	KEEP	---	---	---	---	24	27	22	43	0.470588235294	capture	Missense_Mutation	SNP	167663205	167663205	SPOCK3	4	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14973	274
NMUR2	56923	broad.mit.edu	37	5	151775094	151775094	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:151775094C>T	uc003luv.2	-	3	1029	c.863G>A	c.(862-864)CGA>CAA	p.R288Q		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	288	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GAAGAAGAGTCGGTCAATGTG	0.483																0.377778	51.06825	51.65653	17	28	KEEP	---	---	---	---	10	7	14	16	-1	capture	Missense_Mutation	SNP	151775094	151775094	NMUR2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10414	274
DDAH2	23564	broad.mit.edu	37	6	31696723	31696723	+	Silent	SNP	T	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31696723T>C	uc003nwp.2	-	1	847	c.216A>G	c.(214-216)GGA>GGG	p.G72G	DDAH2_uc003nwq.2_Silent_p.G72G	NM_013974	NP_039268	O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	72					anti-apoptosis|arginine catabolic process|citrulline metabolic process|nitric oxide biosynthetic process|nitric oxide mediated signal transduction	cytoplasm	dimethylargininase activity|protein binding				0					L-Citrulline(DB00155)	CAAGCAGCGGTCCCAGCGGCA	0.662																0.075472	-3.803301	6.304423	4	49	KEEP	---	---	---	---	1	3	26	31	-1	capture	Silent	SNP	31696723	31696723	DDAH2	6	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	4281	274
LPA	4018	broad.mit.edu	37	6	161007524	161007524	+	Silent	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161007524G>T	uc003qtl.2	-	26	4206	c.4086C>A	c.(4084-4086)CCC>CCA	p.P1362P		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3870	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGACCACCGTGGGAGTTGTGA	0.498																0.19403	27.430592	33.28929	13	54	KEEP	---	---	---	---	10	20	20	38	0.333333333333	capture	Silent	SNP	161007524	161007524	LPA	6	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8819	274
CCR6	1235	broad.mit.edu	37	6	167549965	167549965	+	Missense_Mutation	SNP	G	A	A	rs76452893	by1000genomes	TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167549965G>A	uc003qvl.2	+	13	2723	c.247G>A	c.(247-249)GTC>ATC	p.V83I	CCR6_uc010kkm.2_Missense_Mutation_p.V83I|CCR6_uc003qvn.3_Missense_Mutation_p.V83I|CCR6_uc003qvm.3_Missense_Mutation_p.V83I	NM_031409	NP_113597	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	83	Cytoplasmic (Potential).				cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity			ovary(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		TATGACAGACGTCTATCTCTT	0.488					4											0.478632	175.311552	175.356269	56	61	KEEP	---	---	---	---	28	36	26	46	-1	capture	Missense_Mutation	SNP	167549965	167549965	CCR6	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2916	274
USP42	84132	broad.mit.edu	37	7	6189342	6189342	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6189342G>T	uc011jwo.1	+	13	1638	c.1515G>T	c.(1513-1515)TGG>TGT	p.W505C	USP42_uc010kth.1_Missense_Mutation_p.W438C|USP42_uc011jwp.1_Missense_Mutation_p.W505C|USP42_uc011jwq.1_Missense_Mutation_p.W312C|USP42_uc011jwr.1_Missense_Mutation_p.W350C	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	505					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TCCAAAACTGGTCAGTTAATA	0.443																0.323529	123.807964	127.594717	44	92	KEEP	---	---	---	---	20	26	35	65	0.434782608696	capture	Missense_Mutation	SNP	6189342	6189342	USP42	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	16955	274
SKAP2	8935	broad.mit.edu	37	7	26779515	26779515	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:26779515G>A	uc003syc.2	-	5	669	c.376C>T	c.(376-378)CGC>TGC	p.R126C	SKAP2_uc011jzi.1_Translation_Start_Site|SKAP2_uc011jzj.1_Missense_Mutation_p.R111C	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	126	PH.				B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						CCTTTTCTGCGTTTTTCAAGG	0.373																0.333333	38.269141	39.225005	13	26	KEEP	---	---	---	---	9	6	13	14	-1	capture	Missense_Mutation	SNP	26779515	26779515	SKAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14249	274
EGFR	1956	broad.mit.edu	37	7	55233110	55233110	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233110C>G	uc003tqk.2	+	15	2106	c.1860C>G	c.(1858-1860)TGC>TGG	p.C620W	EGFR_uc003tqi.2_Missense_Mutation_p.C620W|EGFR_uc003tqj.2_Missense_Mutation_p.C620W|EGFR_uc010kzg.1_Missense_Mutation_p.C575W|EGFR_uc011kco.1_Missense_Mutation_p.C567W|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	620	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.C620Y(1)|p.C620W(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GCCACCTGTGCCATCCAAACT	0.542			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.211268	35.626225	41.181464	15	56	KEEP	---	---	---	---	10	9	29	32	-1	capture	Missense_Mutation	SNP	55233110	55233110	EGFR	7	C	G	G	G	1	0	0	0	0	1	0	0	0	337	26	4	4	4922	274
CCDC132	55610	broad.mit.edu	37	7	92932809	92932809	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92932809G>C	uc003umo.2	+	17	1527	c.1399G>C	c.(1399-1401)GAG>CAG	p.E467Q	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.E437Q|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.E187Q	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	467											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTAGAGAATGAGACTTGGGA	0.343																0.220126	98.312912	109.826122	35	124	KEEP	---	---	---	---	21	24	83	64	-1	capture	Missense_Mutation	SNP	92932809	92932809	CCDC132	7	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	2741	274
TRRAP	8295	broad.mit.edu	37	7	98547126	98547126	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98547126G>A	uc003upp.2	+	35	5063	c.4854G>A	c.(4852-4854)GGG>GGA	p.G1618G	TRRAP_uc011kis.1_Silent_p.G1600G|TRRAP_uc003upr.2_Silent_p.G1317G	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1618					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGCTGCCGGGGGGTGCCCAGA	0.617					1847											0.227273	34.960495	39.501742	15	51	KEEP	---	---	---	---	5	12	30	24	-1	capture	Silent	SNP	98547126	98547126	TRRAP	7	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	16484	274
SOX7	83595	broad.mit.edu	37	8	10583718	10583718	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10583718G>A	uc003wtf.2	-	2	776	c.697C>T	c.(697-699)CGC>TGC	p.R233C	SOX7_uc011kwz.1_Missense_Mutation_p.R285C	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	233					endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)		TGGGGGATGCGGCGGGGATGG	0.692																0.653846	113.563518	114.649657	34	18	KEEP	---	---	---	---	20	21	15	14	-1	capture	Missense_Mutation	SNP	10583718	10583718	SOX7	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14848	274
DOK2	9046	broad.mit.edu	37	8	21767417	21767417	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:21767417C>T	uc003wzy.1	-	5	737	c.644G>A	c.(643-645)CGT>CAT	p.R215H	DOK2_uc003wzx.1_Missense_Mutation_p.R215H|DOK2_uc003wzz.1_Missense_Mutation_p.R61H|DOK2_uc010lth.1_Missense_Mutation_p.R61H	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2	215	IRS-type PTB.				blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GACGCAGCGACGGCCTGCCTC	0.502																0.385965	62.114624	62.770856	22	35	KEEP	---	---	---	---	13	12	14	25	-1	capture	Missense_Mutation	SNP	21767417	21767417	DOK2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4653	274
KCNU1	157855	broad.mit.edu	37	8	36642023	36642023	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36642023T>C	uc010lvw.2	+	1	182	c.95T>C	c.(94-96)TTT>TCT	p.F32S	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	32	Helical; Name=Segment S0; (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CTCTCTTCCTTTGTGACCTTC	0.413																0.490566	95.958316	95.962106	26	27	KEEP	---	---	---	---	11	18	15	14	-1	capture	Missense_Mutation	SNP	36642023	36642023	KCNU1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	8015	274
ZFAND1	79752	broad.mit.edu	37	8	82626245	82626245	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:82626245G>A	uc003ycj.1	-	6	402	c.388C>T	c.(388-390)CGA>TGA	p.R130*	ZFAND1_uc010lzx.1_Nonsense_Mutation_p.R130*|ZFAND1_uc003yck.1_Nonsense_Mutation_p.R23*	NM_024699	NP_078975	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	130							zinc ion binding	p.R130*(1)		ovary(1)	1						CCTTTCCATCGTTTACTTGCT	0.343																0.5	87.398522	87.398522	28	28	KEEP	---	---	---	---	18	12	13	20	-1	capture	Nonsense_Mutation	SNP	82626245	82626245	ZFAND1	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	17506	274
GRIN3A	116443	broad.mit.edu	37	9	104335628	104335628	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104335628C>T	uc004bbp.1	-	9	3777	c.3176G>A	c.(3175-3177)CGG>CAG	p.R1059Q	GRIN3A_uc004bbo.1_Missense_Mutation_p.R134Q	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	1059	Cytoplasmic (Potential).|Potential.				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	ATTGGTGGTCCGCAAGGCAGG	0.527					27											0.386555	141.638541	142.974953	46	73	KEEP	---	---	---	---	18	29	35	43	-1	capture	Missense_Mutation	SNP	104335628	104335628	GRIN3A	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6716	274
DBC1	1620	broad.mit.edu	37	9	122000991	122000991	+	Silent	SNP	A	G	G			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:122000991A>G	uc004bkc.2	-	5	1083	c.627T>C	c.(625-627)AAT>AAC	p.N209N	DBC1_uc004bkd.2_Silent_p.N209N	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	209	MACPF.				cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CAGAGTCCAGATTGTCATAGC	0.507																0.45283	84.098541	84.200617	24	29	KEEP	---	---	---	---	13	16	22	12	-1	capture	Silent	SNP	122000991	122000991	DBC1	9	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	4206	274
OCRL	4952	broad.mit.edu	37	X	128696660	128696660	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128696660G>A	uc004euq.2	+	12	1306	c.1141G>A	c.(1141-1143)GAG>AAG	p.E381K	OCRL_uc004eur.2_Missense_Mutation_p.E381K	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	381					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TGCACACGTGGAGGACTTTGA	0.438																0.047619	-7.231267	6.496306	3	60	KEEP	---	---	---	---	1	2	35	29	-1	capture	Missense_Mutation	SNP	128696660	128696660	OCRL	23	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10728	274
MAMLD1	10046	broad.mit.edu	37	X	149639327	149639327	+	Silent	SNP	G	A	A			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149639327G>A	uc004fee.1	+	3	1558	c.1482G>A	c.(1480-1482)CAG>CAA	p.Q494Q	MAMLD1_uc011mxt.1_Silent_p.Q456Q|MAMLD1_uc011mxu.1_Silent_p.Q469Q|MAMLD1_uc011mxv.1_Silent_p.Q469Q|MAMLD1_uc011mxw.1_Silent_p.Q421Q	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	494	Poly-Gln.				male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					GCcagcaacagcagcagcagc	0.433																0.083333	0.202093	6.550418	3	33	KEEP	---	---	---	---	1	2	19	18	-1	capture	Silent	SNP	149639327	149639327	MAMLD1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	9122	274
OR6C75	390323	broad.mit.edu	37	12	55758922	55758922	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55758922delT	uc010spk.1	+	1	28	c.28delT	c.(28-30)TTTfs	p.F10fs		NM_001005497	NP_001005497	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3						AGTAACAGACTTTATTCTTCT	0.353																0.37			88	148		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	55758922	55758922	OR6C75	12	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	11103	274
CDH19	28513	broad.mit.edu	37	18	64211976	64211978	+	In_Frame_Del	DEL	CTT	-	-			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:64211976_64211978delCTT	uc002lkc.1	-	6	1076_1078	c.938_940delAAG	c.(937-942)GAAGGA>GGA	p.E313del	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_In_Frame_Del_p.E313del|CDH19_uc002lkd.2_In_Frame_Del_p.E313del	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	313	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				ATAACTATTCCTTCTTGAGTTTC	0.300																0.45			18	22		---	---	---	---						capture_indel	In_Frame_Del	DEL	64211976	64211978	CDH19	18	CTT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	3075	274
CUL1	8454	broad.mit.edu	37	7	148495685	148495685	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148495685delC	uc010lpg.2	+	20	2578	c.2052delC	c.(2050-2052)ATCfs	p.I684fs	CUL1_uc003wey.2_Frame_Shift_Del_p.I684fs|CUL1_uc003wez.2_Frame_Shift_Del_p.I574fs|CUL1_uc003wfa.2_Frame_Shift_Del_p.I345fs	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	684					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGGTTAACATCAATGTGCCAA	0.373																0.27			33	89		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	148495685	148495685	CUL1	7	C	-	-	-	1	0	1	0	1	0	0	0	0	369	29	5	5	4014	274
ANKRD46	157567	broad.mit.edu	37	8	101541822	101541823	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-76-6191-01	TCGA-76-6191-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101541822_101541823delTG	uc003yjm.2	-	3	443_444	c.239_240delCA	c.(238-240)ACAfs	p.T80fs	ANKRD46_uc003yjn.1_Frame_Shift_Del_p.T80fs|ANKRD46_uc003yjo.1_Frame_Shift_Del_p.T80fs|ANKRD46_uc003yjp.1_Frame_Shift_Del_p.T80fs	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	80	ANK 3.					integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			GGTGAAGAGCTGTGTTTCCTTG	0.436																0.31			28	63		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	101541822	101541823	ANKRD46	8	TG	-	-	-	1	0	1	0	1	0	0	0	0	704	55	5	5	669	274
