Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16918653C>T	uc009vos.1	-	6	853	c.-35_splice	c.e6+1		NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																0.088889	1.063828	8.751171	4	41	KEEP	---	---	---	---	4	3	23	30	-1	capture	Splice_Site	SNP	16918653	16918653	NBPF1	1	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	10099	275
KLF17	128209	broad.mit.edu	37	1	44584644	44584644	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44584644C>T	uc001clp.2	+	1	123	c.65C>T	c.(64-66)GCG>GTG	p.A22V	KLF17_uc009vxf.1_Intron	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	22					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TGGCAGGCGGCGCACCAGGCT	0.577																0.214286	7.018757	8.073095	3	11	KEEP	---	---	---	---	3	1	3	11	-1	capture	Missense_Mutation	SNP	44584644	44584644	KLF17	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8266	275
CYP4A11	1579	broad.mit.edu	37	1	47395834	47395834	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47395834G>A	uc001cqp.3	-	12	1564	c.1513C>T	c.(1513-1515)CGT>TGT	p.R505C		NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	505			NGIHLRLRRLPNPCEDKDQL -> MESTCVSGGSLTLVKTR TSFEGLHLPSCLPDPRFCPLPVCPYPVFCLPTFPSSHLPAV PQSACPSLSHLSPGLPTCLSTCLLPTCISCWEKS (in CYP4A11V).		long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	CTCCTGAGACGCAGGTGGATT	0.443																0.203125	29.141424	34.377593	13	51	KEEP	---	---	---	---	6	8	36	22	-1	capture	Missense_Mutation	SNP	47395834	47395834	CYP4A11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4143	275
ELTD1	64123	broad.mit.edu	37	1	79404873	79404873	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79404873T>A	uc001diq.3	-	4	552	c.396A>T	c.(394-396)AAA>AAT	p.K132N		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	132	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TTCTACTTACTTTTGTTAAAG	0.254																0.304348	20.515972	21.301693	7	16	KEEP	---	---	---	---	5	4	6	12	-1	capture	Missense_Mutation	SNP	79404873	79404873	ELTD1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	5039	275
BRDT	676	broad.mit.edu	37	1	92442915	92442915	+	Missense_Mutation	SNP	G	A	A	rs142308966		TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92442915G>A	uc001dok.3	+	6	1283	c.934G>A	c.(934-936)GTT>ATT	p.V312I	BRDT_uc001dol.3_Missense_Mutation_p.V312I|BRDT_uc010osz.1_Missense_Mutation_p.V316I|BRDT_uc009wdf.2_Missense_Mutation_p.V239I|BRDT_uc010ota.1_Missense_Mutation_p.V266I|BRDT_uc010otb.1_Missense_Mutation_p.V266I|BRDT_uc001dom.3_Missense_Mutation_p.V312I	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	312	Bromo 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		CTACTATGACGTTGTCAAAAA	0.284					576											0.051852	-14.891647	13.796455	7	128	KEEP	---	---	---	---	4	7	57	92	-1	capture	Missense_Mutation	SNP	92442915	92442915	BRDT	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1496	275
MNDA	4332	broad.mit.edu	37	1	158815528	158815528	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158815528C>A	uc001fsz.1	+	5	922	c.722C>A	c.(721-723)GCC>GAC	p.A241D		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	241	HIN-200.				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					GCTACAGTGGCCAGTAAGACT	0.403																0.235294	29.67353	32.942108	12	39	KEEP	---	---	---	---	7	6	17	24	0.461538461538	capture	Missense_Mutation	SNP	158815528	158815528	MNDA	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	9588	275
TOMM40L	84134	broad.mit.edu	37	1	161197734	161197734	+	Missense_Mutation	SNP	A	C	C	rs146096318	by1000genomes	TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161197734A>C	uc001fzd.2	+	6	668	c.439A>C	c.(439-441)ACA>CCA	p.T147P	TOMM40L_uc010pkk.1_RNA|TOMM40L_uc010pkl.1_Missense_Mutation_p.T113P|TOMM40L_uc009wue.2_Missense_Mutation_p.T29P|TOMM40L_uc009wuf.1_RNA|TOMM40L_uc001fze.2_Missense_Mutation_p.T147P	NM_032174	NP_115550	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40	147					protein transport	mitochondrial outer membrane|pore complex	porin activity|voltage-gated anion channel activity			large_intestine(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGATGACTACACAGCCACTCT	0.522														OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.173913	4.083232	6.4115	4	19	KEEP	---	---	---	---	2	5	9	13	-1	capture	Missense_Mutation	SNP	161197734	161197734	TOMM40L	1	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	16242	275
ASPM	259266	broad.mit.edu	37	1	197060162	197060162	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197060162G>A	uc001gtu.2	-	23	9711	c.9454C>T	c.(9454-9456)CGA>TGA	p.R3152*	ASPM_uc001gtv.2_Nonsense_Mutation_p.R1567*|ASPM_uc001gtw.3_Nonsense_Mutation_p.R1000*	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3152					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						AATCTTGCTCGAAACCATCTC	0.289																0.375	53.836972	54.495843	18	30	KEEP	---	---	---	---	5	13	16	17	-1	capture	Nonsense_Mutation	SNP	197060162	197060162	ASPM	1	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	1047	275
LHX9	56956	broad.mit.edu	37	1	197890610	197890610	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197890610C>T	uc001guk.1	+	3	991	c.554C>T	c.(553-555)GCC>GTC	p.A185V	LHX9_uc001gui.1_Missense_Mutation_p.A176V|LHX9_uc001guj.1_Missense_Mutation_p.A191V	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	185	LIM zinc-binding 2.				motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						TACTGCCGCGCCCACTTCGAG	0.607																0.138889	7.148873	11.688897	5	31	KEEP	---	---	---	---	4	3	15	19	-1	capture	Missense_Mutation	SNP	197890610	197890610	LHX9	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8697	275
ITGA8	8516	broad.mit.edu	37	10	15649777	15649777	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:15649777G>A	uc001ioc.1	-	17	1663	c.1663C>T	c.(1663-1665)CGG>TGG	p.R555W	ITGA8_uc010qcb.1_Missense_Mutation_p.R540W	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	555	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						AAGAGCGTCCGTTTAATAGCT	0.433																0.377551	106.852267	108.141235	37	61	KEEP	---	---	---	---	14	25	30	33	-1	capture	Missense_Mutation	SNP	15649777	15649777	ITGA8	10	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7805	275
PTEN	5728	broad.mit.edu	37	10	89720650	89720650	+	Splice_Site	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720650G>A	uc001kfb.2	+	9	1833	c.802_splice	c.e9-1	p.D268_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.N212fs*1(2)|p.Y27fs*1(2)|p.M264fs*8(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		tttttttttAGGACAAAATGT	0.239			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.363636	12.498471	12.677823	4	7	KEEP	---	---	---	---	5	1	5	3	-1	capture	Splice_Site	SNP	89720650	89720650	PTEN	10	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	12633	275
TRIM21	6737	broad.mit.edu	37	11	4406616	4406616	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4406616G>A	uc001lyy.1	-	7	1440	c.1327C>T	c.(1327-1329)CGG>TGG	p.R443W		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	443	B30.2/SPRY.				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		AAGAAGGGCCGCAGAGGTCCT	0.488																0.090909	1.098717	6.667546	3	30	KEEP	---	---	---	---	0	3	23	11	-1	capture	Missense_Mutation	SNP	4406616	4406616	TRIM21	11	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16378	275
OR52E4	390081	broad.mit.edu	37	11	5906308	5906308	+	Silent	SNP	A	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5906308A>T	uc010qzs.1	+	1	786	c.786A>T	c.(784-786)ACA>ACT	p.T262T	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTTTATGACACATCGTTTTG	0.423																0.225352	77.121155	86.966605	32	110	KEEP	---	---	---	---	14	19	50	69	-1	capture	Silent	SNP	5906308	5906308	OR52E4	11	A	T	T	T	1	0	0	0	0	0	0	0	1	67	6	4	4	11020	275
BTBD10	84280	broad.mit.edu	37	11	13441120	13441120	+	Silent	SNP	T	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:13441120T>C	uc001mkz.2	-	4	728	c.471A>G	c.(469-471)AAA>AAG	p.K157K	BTBD10_uc010rcl.1_Silent_p.K165K|BTBD10_uc001mla.2_Silent_p.K141K|BTBD10_uc009ygn.2_RNA|BTBD10_uc010rcm.1_Silent_p.K109K|BTBD10_uc010rcn.1_Silent_p.K126K|BTBD10_uc009ygo.2_Silent_p.K109K	NM_032320	NP_115696	Q9BSF8	BTBDA_HUMAN	K+ channel tetramerization protein	157						nucleus					0				Epithelial(150;0.0214)		GAGCTCCTTCTTTTGCATTTT	0.418																0.289916	218.893917	228.297735	69	169	KEEP	---	---	---	---	27	52	86	107	-1	capture	Silent	SNP	13441120	13441120	BTBD10	11	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	1526	275
MMP7	4316	broad.mit.edu	37	11	102398591	102398591	+	Missense_Mutation	SNP	C	T	T	rs145006821	by1000genomes	TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102398591C>T	uc001phb.2	-	2	279	c.232G>A	c.(232-234)GTC>ATC	p.V78I	MMP7_uc009yxd.2_Missense_Mutation_p.V78I|MMP7_uc010rus.1_Missense_Mutation_p.V78I	NM_002423	NP_002414	P09237	MMP7_HUMAN	matrix metalloproteinase 7 preproprotein	78					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(1)	1	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)		ATTTCTATGACGCGGGAGTTT	0.408																0.232558	50.358139	55.988635	20	66	KEEP	---	---	---	---	6	14	34	36	-1	capture	Missense_Mutation	SNP	102398591	102398591	MMP7	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9579	275
TEAD4	7004	broad.mit.edu	37	12	3121377	3121377	+	Silent	SNP	C	T	T	rs112112805		TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3121377C>T	uc010sej.1	+	5	607	c.330C>T	c.(328-330)CGC>CGT	p.R110R	TEAD4_uc010sek.1_Silent_p.R110R|TEAD4_uc001qln.2_5'UTR	NM_003213	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4 isoform 1	111					hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			GCAAAGCTCGCGAGATCCAGG	0.597																0.153846	6.384608	9.36392	4	22	KEEP	---	---	---	---	2	2	15	14	-1	capture	Silent	SNP	3121377	3121377	TEAD4	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15626	275
PLEKHA5	54477	broad.mit.edu	37	12	19436297	19436297	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:19436297C>G	uc001reb.2	+	11	1465	c.1379C>G	c.(1378-1380)ACA>AGA	p.T460R	PLEKHA5_uc010sie.1_Missense_Mutation_p.T466R|PLEKHA5_uc001rea.2_Missense_Mutation_p.T460R|PLEKHA5_uc009zin.2_Missense_Mutation_p.T218R|PLEKHA5_uc010sif.1_Missense_Mutation_p.T352R|PLEKHA5_uc010sig.1_Missense_Mutation_p.T352R|PLEKHA5_uc010sih.1_Missense_Mutation_p.T352R|PLEKHA5_uc001rec.1_Missense_Mutation_p.T148R	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	460							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GGTTATAGAACACTCCCAAGA	0.438	Pancreas(196;329 2193 11246 14234 19524)				873											0.347826	53.496381	54.431857	16	30	KEEP	---	---	---	---	8	10	8	24	-1	capture	Missense_Mutation	SNP	19436297	19436297	PLEKHA5	12	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	11962	275
CYP27B1	1594	broad.mit.edu	37	12	58158677	58158677	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58158677C>T	uc001spz.1	-	5	975	c.823G>A	c.(823-825)GCA>ACA	p.A275T	CYP27B1_uc001sqa.1_Missense_Mutation_p.A40T|CYP27B1_uc001sqb.1_Missense_Mutation_p.G155D|CYP27B1_uc001sqc.1_Missense_Mutation_p.G155D	NM_000785	NP_000776	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B,	275					bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding			central_nervous_system(3)	3	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)	CTCATGGCTGCCTCTGCCTCT	0.617					101											0.223684	37.334278	42.671067	17	59	KEEP	---	---	---	---	8	12	24	49	-1	capture	Missense_Mutation	SNP	58158677	58158677	CYP27B1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4119	275
ATP8A2	51761	broad.mit.edu	37	13	26343355	26343355	+	Silent	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:26343355C>T	uc001uqk.2	+	26	2698	c.2556C>T	c.(2554-2556)TAC>TAT	p.Y852Y	ATP8A2_uc010tdi.1_Silent_p.Y812Y|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Silent_p.Y402Y	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	812	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACTCGGATTACGCCATCGCAC	0.582																0.283784	56.239817	59.351695	21	53	KEEP	---	---	---	---	10	13	21	37	-1	capture	Silent	SNP	26343355	26343355	ATP8A2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1184	275
SFRS5	6430	broad.mit.edu	37	14	70234973	70234973	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70234973G>T	uc001xll.2	+	3	1551	c.100G>T	c.(100-102)GAT>TAT	p.D34Y	SFRS5_uc001xlm.2_RNA|SFRS5_uc001xln.1_Missense_Mutation_p.D34Y|SFRS5_uc001xlo.2_Missense_Mutation_p.D34Y|SFRS5_uc001xlp.2_Missense_Mutation_p.D34Y|SFRS5_uc001xlq.2_Missense_Mutation_p.D34Y	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5	34	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		AAGAGATATTGATCTGAAAAG	0.428																0.265116	147.928952	158.692428	57	158	KEEP	---	---	---	---	34	31	97	93	0.523076923077	capture	Missense_Mutation	SNP	70234973	70234973	SFRS5	14	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	14073	275
SEMA6D	80031	broad.mit.edu	37	15	48053911	48053911	+	Silent	SNP	A	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48053911A>G	uc010bek.2	+	7	861	c.501A>G	c.(499-501)CCA>CCG	p.P167P	SEMA6D_uc001zvw.2_Silent_p.P167P|SEMA6D_uc001zvx.1_Silent_p.P167P|SEMA6D_uc001zvy.2_Silent_p.P167P|SEMA6D_uc001zvz.2_Silent_p.P167P|SEMA6D_uc001zwa.2_Silent_p.P167P|SEMA6D_uc001zwb.2_Silent_p.P167P|SEMA6D_uc001zwc.2_Silent_p.P167P	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	167	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CAAGATGCCCATTTGATGCCA	0.373																0.268908	93.186995	98.89721	32	87	KEEP	---	---	---	---	24	14	46	54	-1	capture	Silent	SNP	48053911	48053911	SEMA6D	15	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	13935	275
CSNK1G1	53944	broad.mit.edu	37	15	64472574	64472574	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:64472574G>A	uc002anf.2	-	11	1667	c.1187C>T	c.(1186-1188)GCC>GTC	p.A396V	CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Missense_Mutation_p.A396V|CSNK1G1_uc002anh.1_Missense_Mutation_p.A433V	NM_022048	NP_071331	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	396					Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0						CTCCACCTCGGCATGAGCTGT	0.483					222											0.056604	-4.42128	6.52731	3	50	KEEP	---	---	---	---	3	0	29	27	-1	capture	Missense_Mutation	SNP	64472574	64472574	CSNK1G1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3919	275
ATXN2L	11273	broad.mit.edu	37	16	28842292	28842292	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28842292G>C	uc002drc.2	+	10	1388	c.1220G>C	c.(1219-1221)CGC>CCC	p.R407P	uc010vct.1_Intron|ATXN2L_uc010byl.1_Missense_Mutation_p.R407P|ATXN2L_uc002drb.2_Missense_Mutation_p.R407P|ATXN2L_uc002dqy.2_Missense_Mutation_p.R407P|ATXN2L_uc002dra.2_Missense_Mutation_p.R407P|ATXN2L_uc002dqz.2_Missense_Mutation_p.R407P|ATXN2L_uc010vdb.1_Missense_Mutation_p.R407P|ATXN2L_uc002dre.2_Missense_Mutation_p.R407P|ATXN2L_uc002drf.2_Intron	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	407						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GGCCCTTCCCGCATGTCCCCA	0.493																0.263158	5.860962	6.920819	5	14	KEEP	---	---	---	---	1	4	7	10	-1	capture	Missense_Mutation	SNP	28842292	28842292	ATXN2L	16	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	1203	275
ITGAX	3687	broad.mit.edu	37	16	31383748	31383748	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31383748C>T	uc002ebu.1	+	18	2277	c.2210C>T	c.(2209-2211)ACG>ATG	p.T737M	ITGAX_uc002ebt.2_Missense_Mutation_p.T737M	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	737	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CTGAACTTCACGCTGGTGGGC	0.642																0.305263	79.469238	82.666133	29	66	KEEP	---	---	---	---	15	17	36	40	-1	capture	Missense_Mutation	SNP	31383748	31383748	ITGAX	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7812	275
SPAG5	10615	broad.mit.edu	37	17	26919636	26919636	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26919636G>A	uc002hbq.2	-	3	718	c.626C>T	c.(625-627)CCC>CTC	p.P209L	SGK494_uc010waq.1_Intron	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	209					cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					TTCAGAACAGGGATTTGGTGG	0.483																0.144737	19.569894	28.808668	11	65	KEEP	---	---	---	---	7	4	25	45	-1	capture	Missense_Mutation	SNP	26919636	26919636	SPAG5	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14873	275
ADAMTS10	81794	broad.mit.edu	37	19	8661947	8661947	+	Missense_Mutation	SNP	C	T	T	rs141147742		TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8661947C>T	uc002mkj.1	-	8	1238	c.964G>A	c.(964-966)GTG>ATG	p.V322M	ADAMTS10_uc002mkk.1_Translation_Start_Site	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	322	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						CTGTGGTTCACGATGGATTTC	0.572																0.225806	47.624333	54.048644	21	72	KEEP	---	---	---	---	10	11	46	35	-1	capture	Missense_Mutation	SNP	8661947	8661947	ADAMTS10	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	256	275
SLC1A6	6511	broad.mit.edu	37	19	15073138	15073138	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15073138G>A	uc002naa.1	-	5	619	c.611C>T	c.(610-612)ACG>ATG	p.T204M	SLC1A6_uc010dzu.1_Missense_Mutation_p.T204M|SLC1A6_uc010xod.1_Missense_Mutation_p.T140M|SLC1A6_uc002nab.2_Missense_Mutation_p.T204M|SLC1A6_uc002nac.2_Missense_Mutation_p.T204M	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	204	Extracellular (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	TACCACCCTCGTGCTGTACTG	0.413																0.221053	47.008384	53.831877	21	74	KEEP	---	---	---	---	14	8	31	49	-1	capture	Missense_Mutation	SNP	15073138	15073138	SLC1A6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14329	275
HIF3A	64344	broad.mit.edu	37	19	46807322	46807322	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46807322G>A	uc002peh.2	+	2	223	c.194G>A	c.(193-195)CGC>CAC	p.R65H	HIF3A_uc002pef.1_Missense_Mutation_p.R65H|HIF3A_uc002peg.3_Missense_Mutation_p.R65H|HIF3A_uc010xxx.1_RNA|HIF3A_uc002pei.3_Missense_Mutation_p.R9H|HIF3A_uc002pej.1_Missense_Mutation_p.A45T|HIF3A_uc002pek.2_Missense_Mutation_p.R9H|HIF3A_uc010xxy.1_Missense_Mutation_p.A45T|HIF3A_uc002pel.2_Missense_Mutation_p.R63H|HIF3A_uc010xxz.1_Missense_Mutation_p.A63T	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	65	Helix-loop-helix motif.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGCTACCTGCGCATGCACCGC	0.672																0.666667	6.651415	6.724624	2	1	KEEP	---	---	---	---	1	1	1	0	-1	capture	Missense_Mutation	SNP	46807322	46807322	HIF3A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7030	275
SIGLEC14	100049587	broad.mit.edu	37	19	52149086	52149086	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52149086G>A	uc002pxf.3	-	3	769	c.649C>T	c.(649-651)CGC>TGC	p.R217C		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	217	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GCTCCTTGGCGTTTCACCTGA	0.642																0.222222	18.880701	21.43633	8	28	KEEP	---	---	---	---	5	5	17	18	-1	capture	Missense_Mutation	SNP	52149086	52149086	SIGLEC14	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14202	275
NLRP5	126206	broad.mit.edu	37	19	56552352	56552352	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56552352C>T	uc002qmj.2	+	11	2851	c.2851C>T	c.(2851-2853)CGG>TGG	p.R951W	NLRP5_uc002qmi.2_Missense_Mutation_p.R932W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	951	LRR 8.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CGTCAGCAACCGGAGCTTGAC	0.562																0.315217	86.542713	89.336624	29	63	KEEP	---	---	---	---	20	16	30	39	-1	capture	Missense_Mutation	SNP	56552352	56552352	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	10387	275
PQLC3	130814	broad.mit.edu	37	2	11300636	11300636	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11300636C>T	uc002rbc.2	+	2	321	c.188C>T	c.(187-189)CCG>CTG	p.P63L	PQLC3_uc010yjk.1_Missense_Mutation_p.P63L	NM_152391	NP_689604	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3 precursor	63						integral to membrane					0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		GGGTATCCGCCGCTGACCTAC	0.617																0.181034	44.641496	55.706144	21	95	KEEP	---	---	---	---	9	13	53	51	-1	capture	Missense_Mutation	SNP	11300636	11300636	PQLC3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12321	275
THSD7B	80731	broad.mit.edu	37	2	137814211	137814211	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137814211C>T	uc002tva.1	+	2	268	c.268C>T	c.(268-270)CGC>TGC	p.R90C	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCTTACGCTCGCGGTGAAGT	0.542																0.302326	36.059903	37.559215	13	30	KEEP	---	---	---	---	5	8	11	22	-1	capture	Missense_Mutation	SNP	137814211	137814211	THSD7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15765	275
SCN7A	6332	broad.mit.edu	37	2	167262867	167262867	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167262867C>A	uc002udu.1	-	25	4399	c.4272G>T	c.(4270-4272)ATG>ATT	p.M1424I		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1424					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						AAAGACAGAGCATACTGTTGC	0.348																0.135593	38.103935	60.85616	24	153	KEEP	---	---	---	---	11	18	89	87	0.620689655172	capture	Missense_Mutation	SNP	167262867	167262867	SCN7A	2	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	13816	275
PLEKHA3	65977	broad.mit.edu	37	2	179365815	179365815	+	Silent	SNP	A	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179365815A>T	uc002umn.2	+	7	1085	c.687A>T	c.(685-687)GTA>GTT	p.V229V		NM_019091	NP_061964	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A	229						cytoplasm|membrane				ovary(1)|kidney(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			AAGAACCAGTATCTACACTTC	0.378																0.278481	61.123192	64.605873	22	57	KEEP	---	---	---	---	12	16	33	32	-1	capture	Silent	SNP	179365815	179365815	PLEKHA3	2	A	T	T	T	1	0	0	0	0	0	0	0	1	197	16	4	4	11960	275
SPATS2L	26010	broad.mit.edu	37	2	201303921	201303921	+	Silent	SNP	A	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201303921A>C	uc002uvn.3	+	7	874	c.522A>C	c.(520-522)TCA>TCC	p.S174S	SPATS2L_uc010fst.2_Silent_p.S174S|SPATS2L_uc002uvo.3_Silent_p.S114S|SPATS2L_uc002uvp.3_Silent_p.S174S|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Silent_p.S174S|SPATS2L_uc010zhc.1_Silent_p.S204S	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	174						cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						CAGAGAGGTCAGATGGCCTAC	0.448																0.186441	22.98145	28.429467	11	48	KEEP	---	---	---	---	7	5	33	20	-1	capture	Silent	SNP	201303921	201303921	SPATS2L	2	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	14912	275
UGT1A6	54578	broad.mit.edu	37	2	234602327	234602327	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234602327T>G	uc002vuv.3	+	1	816	c.677T>G	c.(676-678)TTT>TGT	p.F226C	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Missense_Mutation_p.F226C	NM_001072	NP_001063	P19224	UD16_HUMAN	UDP glycosyltransferase 1 family, polypeptide A6	226					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity				0		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)		TATTGTCTGTTTTCAAAGTAT	0.398																0.205128	110.292799	126.016352	40	155	KEEP	---	---	---	---	19	24	87	75	-1	capture	Missense_Mutation	SNP	234602327	234602327	UGT1A6	2	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	16831	275
PER2	8864	broad.mit.edu	37	2	239157720	239157720	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239157720C>T	uc002vyc.2	-	22	3838	c.3601G>A	c.(3601-3603)GCA>ACA	p.A1201T	PER2_uc010znv.1_Missense_Mutation_p.A1201T	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	1201	CRY binding domain (By similarity).				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCGATGGCTGCGGGCAGGCCG	0.493																0.035714	-34.163511	11.664519	7	189	KEEP	---	---	---	---	3	4	95	124	-1	capture	Missense_Mutation	SNP	239157720	239157720	PER2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11633	275
SEL1L2	80343	broad.mit.edu	37	20	13830889	13830889	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13830889G>A	uc010gcf.2	-	19	1977	c.1895C>T	c.(1894-1896)GCC>GTC	p.A632V	SEL1L2_uc002woq.3_Missense_Mutation_p.A493V|SEL1L2_uc010zrl.1_Missense_Mutation_p.A519V|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	632	Extracellular (Potential).					integral to membrane	binding			ovary(2)	2						TTTCATGACGGCAAAGAGCAC	0.458																0.053333	-9.241872	6.609564	4	71	KEEP	---	---	---	---	4	1	34	42	-1	capture	Missense_Mutation	SNP	13830889	13830889	SEL1L2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13904	275
TSHZ2	128553	broad.mit.edu	37	20	51870967	51870967	+	Missense_Mutation	SNP	G	A	A	rs138844500	byFrequency	TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870967G>A	uc002xwo.2	+	2	1926	c.970G>A	c.(970-972)GTT>ATT	p.V324I		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	324					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TAAGAAACGCGTTTTTGATGT	0.458																0.19403	28.446196	34.290912	13	54	KEEP	---	---	---	---	4	11	32	28	-1	capture	Missense_Mutation	SNP	51870967	51870967	TSHZ2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16507	275
SIM2	6493	broad.mit.edu	37	21	38092132	38092132	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:38092132C>T	uc002yvr.2	+	4	415	c.359C>T	c.(358-360)ACG>ATG	p.T120M	SIM2_uc002yvq.2_Missense_Mutation_p.T120M	NM_005069	NP_005060	Q14190	SIM2_HUMAN	single-minded homolog 2 long isoform	120	PAS 1.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1						GTGGAGCTCACGGGCAACAGT	0.602																0.266667	40.373829	43.324122	16	44	KEEP	---	---	---	---	8	12	22	23	-1	capture	Missense_Mutation	SNP	38092132	38092132	SIM2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14217	275
GCAT	23464	broad.mit.edu	37	22	38211153	38211153	+	Silent	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38211153G>A	uc003atz.2	+	5	617	c.597G>A	c.(595-597)GTG>GTA	p.V199V	GCAT_uc003aua.1_Silent_p.V225V	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor	199					biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TGCGCCTGGTGGCCACTGATG	0.577																0.146341	9.313858	14.263941	6	35	KEEP	---	---	---	---	4	7	19	22	-1	capture	Silent	SNP	38211153	38211153	GCAT	22	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	6224	275
CLSTN2	64084	broad.mit.edu	37	3	140275468	140275468	+	Silent	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140275468G>A	uc003etn.2	+	11	1978	c.1788G>A	c.(1786-1788)GCG>GCA	p.A596A	CLSTN2_uc003etm.2_Silent_p.A596A	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	596	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TCCCAACGGCGGGTGTGCGGC	0.577	GBM(45;858 913 3709 36904 37282)												HNSCC(16;0.037)			0.314815	50.355987	52.003244	17	37	KEEP	---	---	---	---	7	10	18	30	-1	capture	Silent	SNP	140275468	140275468	CLSTN2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3527	275
ZBTB38	253461	broad.mit.edu	37	3	141163945	141163945	+	Silent	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:141163945C>T	uc003etw.2	+	8	3697	c.2715C>T	c.(2713-2715)GAC>GAT	p.D905D	ZBTB38_uc010hun.2_Silent_p.D902D|ZBTB38_uc010huo.2_Silent_p.D905D|ZBTB38_uc003ety.2_Silent_p.D905D|ZBTB38_uc010hup.2_Silent_p.D906D	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	905					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TGTTCGATGACGCAAGTGACC	0.498																0.069767	-1.508576	6.708434	3	40	KEEP	---	---	---	---	2	1	17	29	-1	capture	Silent	SNP	141163945	141163945	ZBTB38	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17419	275
GRK7	131890	broad.mit.edu	37	3	141499458	141499458	+	Silent	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:141499458G>A	uc011bnd.1	+	2	939	c.855G>A	c.(853-855)ACG>ACA	p.T285T		NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor	285	Protein kinase.				visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						ACGTGGGCACGCGTGGCCTGG	0.557					174											0.236364	30.04524	33.54173	13	42	KEEP	---	---	---	---	3	12	19	26	-1	capture	Silent	SNP	141499458	141499458	GRK7	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6727	275
TPRG1	285386	broad.mit.edu	37	3	189038544	189038544	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189038544A>T	uc003frv.1	+	11	1990	c.763A>T	c.(763-765)ATG>TTG	p.M255L	TPRG1_uc003frw.1_Missense_Mutation_p.M255L	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	255											0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CACAGGGCTGATGTCATTCAT	0.433																0.131579	7.448199	12.462476	5	33	KEEP	---	---	---	---	3	2	22	13	-1	capture	Missense_Mutation	SNP	189038544	189038544	TPRG1	3	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	16301	275
GAK	2580	broad.mit.edu	37	4	860238	860238	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:860238T>C	uc003gbm.3	-	22	3156	c.2957A>G	c.(2956-2958)AAT>AGT	p.N986S	GAK_uc003gbn.3_Missense_Mutation_p.N907S|GAK_uc010ibi.2_Missense_Mutation_p.N167S|GAK_uc010ibj.2_RNA|GAK_uc003gbl.3_Missense_Mutation_p.N839S	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	986					cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		AGAGTCCGAATTGAGAAATTC	0.622					679											0.32	52.511227	53.935424	16	34	KEEP	---	---	---	---	4	12	18	18	-1	capture	Missense_Mutation	SNP	860238	860238	GAK	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	6135	275
HTRA3	94031	broad.mit.edu	37	4	8307709	8307709	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8307709A>G	uc003gla.2	+	9	1412	c.1208A>G	c.(1207-1209)CAA>CGA	p.Q403R		NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor	403	PDZ.				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						GGCGGCATCCAAGATGGTGAC	0.647																0.033333	-14.653181	6.723243	3	87	KEEP	---	---	---	---	1	5	53	51	-1	capture	Missense_Mutation	SNP	8307709	8307709	HTRA3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	7380	275
RASSF6	166824	broad.mit.edu	37	4	74477540	74477540	+	Silent	SNP	G	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74477540G>T	uc003hhd.1	-	2	192	c.69C>A	c.(67-69)TCC>TCA	p.S23S	RASSF6_uc003hhc.1_5'UTR|RASSF6_uc010iik.1_5'UTR|RASSF6_uc010iil.1_Intron	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	23					apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GATGGTCTGAGGATATCCTAA	0.343																0.214286	59.046998	67.483004	24	88	KEEP	---	---	---	---	13	12	37	58	0.52	capture	Silent	SNP	74477540	74477540	RASSF6	4	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	12985	275
FRAS1	80144	broad.mit.edu	37	4	79343100	79343100	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79343100C>T	uc003hlb.2	+	34	5064	c.4624C>T	c.(4624-4626)CGC>TGC	p.R1542C	FRAS1_uc003hkw.2_Missense_Mutation_p.R1542C|FRAS1_uc010ijj.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1541	CSPG 4.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AGTCATGTACCGCCCTCCCCC	0.567																0.285714	135.692407	142.894714	50	125	KEEP	---	---	---	---	18	36	64	72	-1	capture	Missense_Mutation	SNP	79343100	79343100	FRAS1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5986	275
AGXT2L1	64850	broad.mit.edu	37	4	109667592	109667592	+	Silent	SNP	T	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:109667592T>C	uc003hzc.2	-	11	1447	c.1266A>G	c.(1264-1266)GCA>GCG	p.A422A	AGXT2L1_uc010imc.2_Silent_p.A416A|AGXT2L1_uc011cfm.1_Silent_p.A382A|AGXT2L1_uc011cfn.1_Silent_p.A349A|AGXT2L1_uc011cfo.1_Silent_p.A364A	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1	422					cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)		CCATGAACTTTGCATCTTCTT	0.423																0.230769	32.172245	35.627627	12	40	KEEP	---	---	---	---	6	7	16	28	-1	capture	Silent	SNP	109667592	109667592	AGXT2L1	4	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	406	275
TRIO	7204	broad.mit.edu	37	5	14389446	14389446	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:14389446A>G	uc003jff.2	+	25	4003	c.3997A>G	c.(3997-3999)ATT>GTT	p.I1333V	TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.I1284V|TRIO_uc003jfh.1_Missense_Mutation_p.I982V	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1333	DH 1.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TCCACCTGGCATTGTAAACAA	0.408					1300											0.210526	20.178416	23.124614	8	30	KEEP	---	---	---	---	4	5	14	24	-1	capture	Missense_Mutation	SNP	14389446	14389446	TRIO	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	16435	275
AP3B1	8546	broad.mit.edu	37	5	77477403	77477403	+	Silent	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77477403C>T	uc003kfj.2	-	8	995	c.870G>A	c.(868-870)CCG>CCA	p.P290P		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	290					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		CCATAGTATACGGCTTCTTCT	0.343												Hermansky-Pudlak_syndrome				0.25	40.669855	44.305406	16	48	KEEP	---	---	---	---	11	5	22	32	-1	capture	Silent	SNP	77477403	77477403	AP3B1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	737	275
RGMB	285704	broad.mit.edu	37	5	98128833	98128833	+	Silent	SNP	A	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:98128833A>G	uc003knc.2	+	5	1215	c.813A>G	c.(811-813)AAA>AAG	p.K271K		NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN	RGM domain family, member B	230					axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding				0		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		CAGATCAGAAAGTCTACCAAG	0.527																0.15	11.222471	15.92172	6	34	KEEP	---	---	---	---	3	3	24	16	-1	capture	Silent	SNP	98128833	98128833	RGMB	5	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	13176	275
PCDHA13	56136	broad.mit.edu	37	5	140263481	140263481	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263481C>T	uc003lif.2	+	1	1628	c.1628C>T	c.(1627-1629)CCG>CTG	p.P543L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.P543L|PCDHA13_uc003lid.2_Missense_Mutation_p.P543L	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	543	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGGCGTGCCGCCTCTGGGC	0.692	Melanoma(147;1739 1852 5500 27947 37288)															0.211009	52.879759	61.289593	23	86	KEEP	---	---	---	---	12	14	43	55	-1	capture	Missense_Mutation	SNP	140263481	140263481	PCDHA13	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11426	275
PCDHGA3	56112	broad.mit.edu	37	5	140725753	140725753	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140725753G>A	uc003ljm.1	+	1	2153	c.2153G>A	c.(2152-2154)CGC>CAC	p.R718H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.R478H|PCDHGA3_uc011dap.1_Missense_Mutation_p.R718H	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	718	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCTGCGGCGCTGGCACAAG	0.677																0.22549	50.832145	57.85184	23	79	KEEP	---	---	---	---	12	13	40	45	-1	capture	Missense_Mutation	SNP	140725753	140725753	PCDHGA3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11458	275
CCDC99	54908	broad.mit.edu	37	5	169028402	169028402	+	Silent	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169028402G>A	uc003mae.3	+	11	1722	c.1443G>A	c.(1441-1443)CCG>CCA	p.P481P	CCDC99_uc010jjj.2_Silent_p.P410P|CCDC99_uc011deq.1_Silent_p.P298P|CCDC99_uc010jjk.2_Silent_p.P207P	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99	481					cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCGATTACCGCCTCAGAAAG	0.438																0.304348	54.451973	56.807229	21	48	KEEP	---	---	---	---	10	13	23	28	-1	capture	Silent	SNP	169028402	169028402	CCDC99	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2849	275
ZNF323	64288	broad.mit.edu	37	6	28297413	28297413	+	Silent	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28297413C>T	uc003nla.2	-	2	448	c.48G>A	c.(46-48)GAG>GAA	p.E16E	ZNF323_uc003nld.2_Silent_p.E16E|ZNF323_uc010jra.2_Silent_p.E16E|ZNF323_uc003nlb.2_Intron|ZNF323_uc010jrb.2_Intron|ZNF323_uc003nlc.2_Silent_p.E16E	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	16					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TAGGGTCTTCCTCCACTTTCA	0.448	Colon(115;1052 1587 16954 47314 53012)															0.232759	70.282629	77.855912	27	89	KEEP	---	---	---	---	12	17	41	55	-1	capture	Silent	SNP	28297413	28297413	ZNF323	6	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	17723	275
EHMT2	10919	broad.mit.edu	37	6	31856011	31856011	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31856011G>A	uc003nxz.1	-	13	1562	c.1552C>T	c.(1552-1554)CGC>TGC	p.R518C	EHMT2_uc003nxx.1_5'Flank|EHMT2_uc003nxy.1_Missense_Mutation_p.R309C|EHMT2_uc011don.1_Missense_Mutation_p.R541C|EHMT2_uc003nya.1_Missense_Mutation_p.R484C	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	518					DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						TTGTGGAAGCGGTGGGCCACA	0.622																0.309091	50.454808	52.240834	17	38	KEEP	---	---	---	---	13	6	21	28	-1	capture	Missense_Mutation	SNP	31856011	31856011	EHMT2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4939	275
SLC26A8	116369	broad.mit.edu	37	6	35980127	35980127	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35980127G>A	uc003olm.2	-	3	322	c.211C>T	c.(211-213)CGA>TGA	p.R71*	SLC26A8_uc003oln.2_Nonsense_Mutation_p.R71*|SLC26A8_uc003oll.2_Nonsense_Mutation_p.R71*	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	71	Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						AGCACGCATCGTAGGAACCTG	0.468																0.288	91.414333	96.477466	36	89	KEEP	---	---	---	---	25	17	41	53	-1	capture	Nonsense_Mutation	SNP	35980127	35980127	SLC26A8	6	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	14415	275
RAPGEF5	9771	broad.mit.edu	37	7	22202112	22202112	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:22202112G>A	uc003svg.2	-	13	1185	c.872C>T	c.(871-873)CCG>CTG	p.P291L	RAPGEF5_uc011jyl.1_5'UTR	NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	141	N-terminal Ras-GEF.				nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						TTTCCTACGCGGAACGTCTGA	0.343																0.060606	-3.832152	9.459381	4	62	KEEP	---	---	---	---	2	2	24	46	-1	capture	Missense_Mutation	SNP	22202112	22202112	RAPGEF5	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12942	275
ANLN	54443	broad.mit.edu	37	7	36478889	36478889	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36478889G>C	uc003tff.2	+	21	3164	c.2960G>C	c.(2959-2961)AGA>ACA	p.R987T	ANLN_uc011kaz.1_Missense_Mutation_p.R899T|ANLN_uc003tfg.2_Missense_Mutation_p.R950T|ANLN_uc010kxe.2_Missense_Mutation_p.R949T	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	987	PH.|Localization to the cleavage furrow.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						GTTGAAGAAAGAGGTTTTCTA	0.303																0.318182	24.717319	25.363674	7	15	KEEP	---	---	---	---	5	2	8	7	-1	capture	Missense_Mutation	SNP	36478889	36478889	ANLN	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	688	275
TNS3	64759	broad.mit.edu	37	7	47336762	47336762	+	Silent	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47336762G>A	uc003tnv.2	-	24	3961	c.3594C>T	c.(3592-3594)GAC>GAT	p.D1198D	TNS3_uc003tnw.2_Silent_p.D1198D	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	1198	SH2.					focal adhesion	protein binding			ovary(4)	4						AGGAATGGCTGTCTCGAACAA	0.567																0.188119	36.488117	45.670474	19	82	KEEP	---	---	---	---	7	13	39	53	-1	capture	Silent	SNP	47336762	47336762	TNS3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	16227	275
PCLO	27445	broad.mit.edu	37	7	82764222	82764222	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82764222G>A	uc003uhx.2	-	3	2933	c.2644C>T	c.(2644-2646)CGA>TGA	p.R882*	PCLO_uc003uhv.2_Nonsense_Mutation_p.R882*	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	828	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GCGGTAGGTCGTGGGCCAGGG	0.517																0.223881	211.909705	240.046747	90	312	KEEP	---	---	---	---	51	56	191	186	-1	capture	Nonsense_Mutation	SNP	82764222	82764222	PCLO	7	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	11486	275
MUC17	140453	broad.mit.edu	37	7	100674926	100674926	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100674926G>A	uc003uxp.1	+	3	282	c.229G>A	c.(229-231)GTG>ATG	p.V77M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	77	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACAAATGTCGTGGAGCCAAG	0.448																0.191176	27.94172	33.999175	13	55	KEEP	---	---	---	---	5	8	23	37	-1	capture	Missense_Mutation	SNP	100674926	100674926	MUC17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9884	275
ASB10	136371	broad.mit.edu	37	7	150878052	150878052	+	Missense_Mutation	SNP	G	A	A	rs104886484		TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150878052G>A	uc003wjm.1	-	3	1339	c.1213C>T	c.(1213-1215)CGT>TGT	p.R405C	ASB10_uc003wjl.1_Missense_Mutation_p.R405C|ASB10_uc003wjn.1_Missense_Mutation_p.R345C	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10	360	ANK 7.				intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCAGACACGGACGGCGCCA	0.701																0.25	15.641957	17.003071	6	18	KEEP	---	---	---	---	4	2	9	10	-1	capture	Missense_Mutation	SNP	150878052	150878052	ASB10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1005	275
MLL3	58508	broad.mit.edu	37	7	151921652	151921652	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151921652A>C	uc003wla.2	-	19	3245	c.3026T>G	c.(3025-3027)GTG>GGG	p.V1009G	MLL3_uc003wkz.2_Missense_Mutation_p.V70G	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1009	PHD-type 5.|PHD-type 4.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GGCCTCACACACAGTGCACTC	0.448	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.133333	8.57994	12.493027	4	26	KEEP	---	---	---	---	2	3	10	29	-1	capture	Missense_Mutation	SNP	151921652	151921652	MLL3	7	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	9534	275
NFIB	4781	broad.mit.edu	37	9	14307176	14307176	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14307176T>C	uc003zle.2	-	2	809	c.374A>G	c.(373-375)GAC>GGC	p.D125G	NFIB_uc003zlf.2_Missense_Mutation_p.D125G|NFIB_uc011lmo.1_Missense_Mutation_p.D125G	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B	125	CTF/NF-I.				anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		CCAGACTTTGTCTGCCTGTCG	0.522	Esophageal Squamous(132;921 1730 14828 40753 46471)					T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								0.366667	111.356827	112.7615	33	57	KEEP	---	---	---	---	20	17	21	42	-1	capture	Missense_Mutation	SNP	14307176	14307176	NFIB	9	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	10278	275
FAM75A6	389730	broad.mit.edu	37	9	43627272	43627272	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:43627272A>G	uc011lrb.1	-	4	1444	c.1415T>C	c.(1414-1416)CTG>CCG	p.L472P		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	472						integral to membrane					0						GCGGTGGGACAGGGGCTGGGC	0.522																0.020958	-78.043866	8.481131	7	327	KEEP	---	---	---	---	7	1	229	138	-1	capture	Missense_Mutation	SNP	43627272	43627272	FAM75A6	9	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5568	275
TMC1	117531	broad.mit.edu	37	9	75445373	75445373	+	Silent	SNP	C	T	T			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75445373C>T	uc004aiz.1	+	22	2676	c.2136C>T	c.(2134-2136)GCC>GCT	p.A712A	TMC1_uc010moz.1_Silent_p.A670A|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Silent_p.A566A|TMC1_uc010mpa.1_Silent_p.A566A	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	712	Helical; (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						TTAGTTTGGCCATCTATTATC	0.284	Pancreas(75;173 1345 14232 34245 43413)															0.14	12.890369	19.147661	7	43	KEEP	---	---	---	---	0	7	19	27	-1	capture	Silent	SNP	75445373	75445373	TMC1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	15869	275
PMPCA	23203	broad.mit.edu	37	9	139311437	139311437	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139311437G>A	uc004chl.2	+	7	673	c.668G>A	c.(667-669)CGT>CAT	p.R223H	PMPCA_uc010nbl.2_Missense_Mutation_p.R123H|PMPCA_uc011mdz.1_Missense_Mutation_p.R92H|PMPCA_uc004chm.1_5'UTR|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	223					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GGCCTCCACCGTTTCTGCCCC	0.562																0.2	9.189413	10.86284	4	16	KEEP	---	---	---	---	0	4	15	3	-1	capture	Missense_Mutation	SNP	139311437	139311437	PMPCA	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12043	275
LUZP4	51213	broad.mit.edu	37	X	114541268	114541268	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6192-01	TCGA-76-6192-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:114541268G>A	uc004eqa.2	+	4	875	c.841G>A	c.(841-843)GTG>ATG	p.V281M	LUZP4_uc004eqb.2_Missense_Mutation_p.V199M	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	281						nucleus				ovary(2)	2						GAGAGATCTCGTGGCCACTGA	0.428																0.610169	115.414634	116.043943	36	23	KEEP	---	---	---	---	16	21	6	17	-1	capture	Missense_Mutation	SNP	114541268	114541268	LUZP4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9003	275
