Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RPL22	6146	broad.mit.edu	37	1	6246862	6246862	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6246862A>G	uc001amd.2	-	4	303	c.257T>C	c.(256-258)CTC>CCC	p.L86P	RPL22_uc001ame.2_Silent_p.S80S	NM_000983	NP_000974	P35268	RL22_HUMAN	ribosomal protein L22 proprotein	86					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	heparin binding|RNA binding|structural constituent of ribosome				0	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		TTTTTTGGTGAGATATTTCAA	0.368			T	RUNX1	AML|CML								21	117	---	---	---	---	PASS
EPHA2	1969	broad.mit.edu	37	1	16458586	16458586	+	Silent	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16458586G>A	uc001aya.1	-	13	2435	c.2298C>T	c.(2296-2298)GAC>GAT	p.D766D		NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor	766	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase.|Cytoplasmic (Potential).				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	CCTCGGGGTCGTCCTCCAGCA	0.612													15	115	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19401274	19401274	+	3'UTR	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19401274G>C	uc001bbi.2	-	106					UBR4_uc001bbe.1_RNA|UBR4_uc001bbf.2_3'UTR|UBR4_uc010ocv.1_3'UTR|UBR4_uc009vph.2_3'UTR|UBR4_uc010ocw.1_3'UTR|UBR4_uc001bbg.2_3'UTR|UBR4_uc001bbh.2_3'UTR	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGAGAACAGAGGGTGGAAGGC	0.572													7	11	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22927292	22927292	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22927292A>G	uc001bfx.1	+	14	2652	c.2527A>G	c.(2527-2529)ACC>GCC	p.T843A		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	843	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CTGGAACATGACCAACCGGGA	0.677													3	130	---	---	---	---	PASS
TTC4	7268	broad.mit.edu	37	1	55182358	55182358	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55182358C>T	uc001cxx.3	+	2	250	c.197C>T	c.(196-198)TCA>TTA	p.S66L	C1orf175_uc001cxq.2_RNA|TTC4_uc001cxw.3_Missense_Mutation_p.S66L|TTC4_uc001cxv.2_Missense_Mutation_p.S77L	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	66							binding				0						TGTCTCCAGTCAATTATTTTT	0.398													7	134	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78162869	78162869	+	3'UTR	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78162869T>C	uc001dht.2	-	25					USP33_uc009wca.1_RNA|USP33_uc001dhs.2_3'UTR|USP33_uc001dhu.2_3'UTR	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TAATGCCCACTAAGAAGAAAT	0.284													15	23	---	---	---	---	PASS
SNX7	51375	broad.mit.edu	37	1	99156689	99156689	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99156689T>A	uc010ouc.1	+	3	474	c.422T>A	c.(421-423)TTC>TAC	p.F141Y	SNX7_uc001dsa.2_Missense_Mutation_p.F77Y|SNX7_uc010oud.1_Missense_Mutation_p.F141Y	NM_015976	NP_057060	Q9UNH6	SNX7_HUMAN	sorting nexin 7 isoform a	77	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TATCAAGATTTCCTTTGGTTG	0.358													12	122	---	---	---	---	PASS
SLC16A1	6566	broad.mit.edu	37	1	113456771	113456771	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113456771C>G	uc001ecx.2	-	5	2077	c.1245G>C	c.(1243-1245)ATG>ATC	p.M415I	SLC16A1_uc001ecy.2_Missense_Mutation_p.M415I	NM_003051	NP_003042	P53985	MOT1_HUMAN	solute carrier family 16, member 1	415	Extracellular (Potential).				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Pyruvic acid(DB00119)	AGTCTCCATACATGTCATTGA	0.383													9	244	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803746	142803746	+	Intron	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803746A>G	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		actatggattagagctgatta	0.000													3	23	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144930835	144930835	+	Intron	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144930835G>C	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.L292V|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATCATGCTAAGAGCTAATTCC	0.502			T	PDGFRB	MPD								6	400	---	---	---	---	PASS
LOC728855	728855	broad.mit.edu	37	1	149649002	149649002	+	Intron	SNP	G	A	A	rs116783842		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149649002G>A	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0						TTGGAATTCCGCTGTTCAGTT	0.428													5	154	---	---	---	---	PASS
VHLL	391104	broad.mit.edu	37	1	156268547	156268547	+	3'UTR	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156268547G>C	uc001fok.2	-	1						NM_001004319	NP_001004319	Q6RSH7	VHLL_HUMAN	von Hippel-Lindau tumor suppressor-like						protein ubiquitination	nucleus				ovary(1)	1	Hepatocellular(266;0.158)					CGACAACCTGGAGGCATTGCT	0.438													42	82	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160262334	160262334	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160262334C>T	uc009wti.2	-	28	3294	c.2900G>A	c.(2899-2901)CGC>CAC	p.R967H	COPA_uc001fvv.3_Missense_Mutation_p.R976H	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	967					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATAGGTTGTGCGGCCTCGGGC	0.498													5	192	---	---	---	---	PASS
UAP1	6675	broad.mit.edu	37	1	162557359	162557359	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162557359C>A	uc001gce.3	+	6	1258	c.929C>A	c.(928-930)GCA>GAA	p.A310E		NM_003115	NP_003106	Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	310					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|nucleus|plasma membrane	UDP-N-acetylglucosamine diphosphorylase activity			ovary(2)|skin(2)|kidney(1)	5	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			ATTTCCCTGGCAACAGCTCAA	0.478													5	322	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168274312	168274312	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168274312C>T	uc001gfl.2	+	6	845	c.794C>T	c.(793-795)GCC>GTC	p.A265V	TBX19_uc001gfj.3_Intron|TBX19_uc001gfm.2_5'UTR	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	265					anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					TACCAGTATGCCGCTCCTCTG	0.547													4	195	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196879578	196879578	+	Intron	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196879578G>T	uc001gto.2	+						CFHR4_uc009wyy.2_Missense_Mutation_p.D322Y|CFHR4_uc001gtp.2_Missense_Mutation_p.D323Y	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor							extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						CTGCACACAAGATGGGTGGTT	0.403													49	110	---	---	---	---	PASS
SRP9	6726	broad.mit.edu	37	1	225971002	225971002	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225971002G>A	uc001hpg.2	+	2	201	c.73G>A	c.(73-75)GCA>ACA	p.A25T	SRP9_uc001hpf.3_RNA|SRP9_uc001hph.2_Missense_Mutation_p.A25T|SRP9_uc001hpi.3_RNA|SRP9_uc001hpj.1_Intron	NM_003133	NP_003124	P49458	SRP09_HUMAN	signal recognition particle 9kDa isoform 2	25					negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0						TTTGTTTCAGGCACGTGTGGT	0.294													68	129	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238048491	238048491	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238048491C>A	uc001hym.2	-	9	1285	c.1285G>T	c.(1285-1287)GTG>TTG	p.V429L	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	429	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGTTTCTCCACTGTAGGGTTC	0.532													27	56	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11772090	11772090	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11772090A>G	uc002rbk.1	+	27	4967	c.4667A>G	c.(4666-4668)CAT>CGT	p.H1556R	GREB1_uc002rbp.1_Missense_Mutation_p.H554R	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1556						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CGTCACGAACATGGGCTCTTT	0.403													35	63	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													2	2	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175614794	175614794	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175614794A>G	uc002ujd.2	-	8	1035	c.957T>C	c.(955-957)ATT>ATC	p.I319I	uc002uiw.2_Intron|CHRNA1_uc002uje.2_Silent_p.I294I	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	319					muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TGTATTTTCCAATCAAGGGCA	0.502													39	71	---	---	---	---	PASS
HNRNPA3	220988	broad.mit.edu	37	2	178081256	178081256	+	Silent	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178081256G>A	uc002ulb.1	+	5	685	c.579G>A	c.(577-579)GGG>GGA	p.G193G	HNRNPA3_uc002ulc.1_Silent_p.G193G|HNRNPA3_uc002uld.2_Silent_p.G171G|HNRNPA3_uc002ule.2_5'Flank	NM_194247	NP_919223	P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	193	RRM 2.					catalytic step 2 spliceosome|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(2)	2						CTATTAATGGGCATAATTGTG	0.348													4	183	---	---	---	---	PASS
RNF25	64320	broad.mit.edu	37	2	219532916	219532916	+	Intron	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219532916G>T	uc002vit.2	-						RNF25_uc010fvw.2_5'UTR	NM_022453	NP_071898	Q96BH1	RNF25_HUMAN	ring finger protein 25						positive regulation of NF-kappaB transcription factor activity	cytosol|nucleus	NF-kappaB binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCACCCCAGGGACTCTCCCC	0.547													53	143	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238249699	238249699	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238249699C>T	uc002vwl.2	-	38	8145	c.7860G>A	c.(7858-7860)ATG>ATA	p.M2620I	COL6A3_uc002vwo.2_Missense_Mutation_p.M2414I|COL6A3_uc010znj.1_Missense_Mutation_p.M2013I|COL6A3_uc002vwj.2_Missense_Mutation_p.M1I	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2620	VWFA 12.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGATGAAAGCCATGTCGATGT	0.527													30	249	---	---	---	---	PASS
CXCR6	10663	broad.mit.edu	37	3	45988808	45988808	+	Silent	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45988808C>T	uc003cpc.1	+	2	916	c.835C>T	c.(835-837)CTG>TTG	p.L279L	FYCO1_uc003cpb.3_Intron|FYCO1_uc011bal.1_Intron|CXCR6_uc010hix.1_Silent_p.L279L	NM_006564	NP_006555	O00574	CXCR6_HUMAN	G protein-coupled receptor TYMSTR	279	Helical; Name=7; (Potential).				viral genome replication	integral to plasma membrane	coreceptor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CATCGCATACCTGAGGGCCTG	0.502													34	37	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52651339	52651339	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651339A>G	uc003des.2	-	14	1769	c.1757T>C	c.(1756-1758)ATG>ACG	p.M586T	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.M586T|PBRM1_uc003der.2_Missense_Mutation_p.M554T|PBRM1_uc003det.2_Missense_Mutation_p.M601T|PBRM1_uc003deu.2_Missense_Mutation_p.M601T|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.M586T|PBRM1_uc010hmk.1_Missense_Mutation_p.M586T|PBRM1_uc003dey.2_Missense_Mutation_p.M586T|PBRM1_uc003dez.1_Missense_Mutation_p.M586T|PBRM1_uc003dfb.1_Missense_Mutation_p.M499T|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	586	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTCTTCTATCATTCCCTCTTC	0.443			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								49	40	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130377533	130377533	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130377533G>A	uc010htl.2	+	33	5778	c.5747G>A	c.(5746-5748)GGC>GAC	p.G1916D	COL6A6_uc003eni.3_Missense_Mutation_p.G15D	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1916	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GACGACACTGGCACATTTCAA	0.483													3	50	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154862150	154862150	+	Silent	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154862150C>A	uc010hvr.1	+	14	1531	c.1320C>A	c.(1318-1320)GTC>GTA	p.V440V	MME_uc003fab.1_Silent_p.V440V|MME_uc003fac.1_Silent_p.V440V|MME_uc003fad.1_Silent_p.V440V|MME_uc003fae.1_Silent_p.V440V	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	440	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	GATTTGAGGTCGAGGATTTGA	0.343													61	128	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178917490	178917490	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178917490G>A	uc003fjk.2	+	3	522	c.365G>A	c.(364-366)GGC>GAC	p.G122D		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	122					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.G122D(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TTTGCTATCGGCATGCCAGTG	0.343		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			4	198	---	---	---	---	PASS
TCTEX1D2	255758	broad.mit.edu	37	3	196018166	196018166	+	3'UTR	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196018166T>C	uc003fwi.2	-	5						NM_152773	NP_689986	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2								protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TTCTTCATGGTCATGTCTTTT	0.303													3	101	---	---	---	---	PASS
ADRA2C	152	broad.mit.edu	37	4	3769608	3769608	+	Silent	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3769608C>A	uc003ghm.2	+	1	1313	c.1275C>A	c.(1273-1275)ATC>ATA	p.I425I	ADRA2C_uc010icx.2_Intron	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	425	Helical; Name=7; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	TCTTCTGGATCGGCTACTGCA	0.582													3	40	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8229227	8229227	+	Silent	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8229227T>A	uc003gkv.3	+	12	1907	c.1806T>A	c.(1804-1806)GCT>GCA	p.A602A	SH3TC1_uc003gkw.3_Silent_p.A526A|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	602	TPR 2.						binding			large_intestine(2)|pancreas(1)	3						TAGTGGTGGCTGTGTACGCCA	0.637													4	173	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69817503	69817503	+	5'UTR	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69817503T>A	uc003hef.2	-	1					UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,							integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CACACACTGATCTGCAATGGT	0.408													10	19	---	---	---	---	PASS
BTC	685	broad.mit.edu	37	4	75695313	75695313	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75695313C>A	uc003hig.2	-	2	465	c.118G>T	c.(118-120)GAA>TAA	p.E40*		NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor	40	Extracellular (Potential).				positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			CCATTAGTTTCAGGACTTCTG	0.363													16	192	---	---	---	---	PASS
NUDT6	11162	broad.mit.edu	37	4	123843511	123843511	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123843511C>T	uc003iew.2	-	1	249	c.217G>A	c.(217-219)GCC>ACC	p.A73T	SPATA5_uc003iey.2_5'Flank|SPATA5_uc003iez.3_5'Flank|NUDT6_uc003iex.2_Intron	NM_007083	NP_009014	P53370	NUDT6_HUMAN	nudix-type motif 6 isoform a	73						mitochondrion|nucleus	growth factor activity|hydrolase activity				0						TTCTGGAAGGCGGCAGCGTCC	0.667													3	8	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35991189	35991189	+	Intron	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35991189C>T	uc003jjv.1	-						UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Intron|UGT3A1_uc011cor.1_Intron|UGT3A1_uc003jjy.1_Intron	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTCGCTGGAGCCCTGGCAGTG	0.607													42	74	---	---	---	---	PASS
RASA1	5921	broad.mit.edu	37	5	86564517	86564517	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86564517A>G	uc003kiw.2	+	1	367	c.249A>G	c.(247-249)GGA>GGG	p.G83G	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_5'Flank|RASA1_uc011ctv.1_5'Flank|RASA1_uc011ctw.1_5'Flank|RASA1_uc010jaw.2_5'Flank|RASA1_uc011ctu.1_Silent_p.G83G	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	83					cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CACTGGGGGGAGCTGGACTGA	0.478													3	5	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96514766	96514766	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96514766A>G	uc003kmz.2	-	2	308	c.198T>C	c.(196-198)CGT>CGC	p.R66R	RIOK2_uc003kna.3_Silent_p.R66R	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	66							ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TACTTTTGGTACGCTCCCAAG	0.294													3	160	---	---	---	---	PASS
IL3	3562	broad.mit.edu	37	5	131396700	131396700	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131396700T>A	uc003kwe.1	+	2	256	c.203T>A	c.(202-204)ATG>AAG	p.M68K		NM_000588	NP_000579	P08700	IL3_HUMAN	interleukin 3 precursor	68					cell-cell signaling|immune response|nervous system development|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of survival gene product expression|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|growth factor activity|interleukin-3 receptor binding			ovary(2)|central_nervous_system(1)	3		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	GACATTCTGATGGTAAGAGCT	0.358													29	78	---	---	---	---	PASS
TGFBI	7045	broad.mit.edu	37	5	135392403	135392403	+	Silent	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135392403C>A	uc003lbf.3	+	12	1758	c.1597C>A	c.(1597-1599)CGG>AGG	p.R533R	TGFBI_uc003lbg.3_Silent_p.R266R|TGFBI_uc003lbh.3_Silent_p.R359R|TGFBI_uc011cyb.1_Silent_p.R359R|TGFBI_uc010jed.2_Silent_p.R266R	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	533	FAS1 4.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GACCCTCAACCGGGAAGGAGT	0.498													3	88	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137506184	137506184	+	Intron	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137506184C>T	uc003lcf.1	-						BRD8_uc003lcc.1_Intron|BRD8_uc003lcg.2_Intron|BRD8_uc003lci.2_Intron|BRD8_uc003lch.2_Intron|BRD8_uc011cym.1_Intron|BRD8_uc010jer.1_Intron|BRD8_uc011cyn.1_Intron|BRD8_uc010jes.1_Intron	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATTTTTTTTGCCAGGCCAGCA	0.443													4	154	---	---	---	---	PASS
TAF7	6879	broad.mit.edu	37	5	140699694	140699694	+	5'UTR	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140699694G>C	uc003ljg.2	-	1						NM_005642	NP_005633	Q15545	TAF7_HUMAN	TATA box-binding protein-associated factor 2F						negative regulation of histone acetylation|negative regulation of protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|spermine transport|transcription initiation from RNA polymerase II promoter	Golgi apparatus|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	histone acetyltransferase binding|thyroid hormone receptor binding|transcription coactivator activity|transcription regulatory region DNA binding|vitamin D receptor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAAACACCAGTTTGCTATGA	0.323											OREG0016852	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	14	---	---	---	---	PASS
PPP2R2B	5521	broad.mit.edu	37	5	146236091	146236091	+	Intron	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146236091T>A	uc003loe.2	-						PPP2R2B_uc010jgm.2_Missense_Mutation_p.Y3F|PPP2R2B_uc003log.3_Intron|PPP2R2B_uc003lof.3_Intron|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Missense_Mutation_p.Y3F|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCATCTGGATAATTCATGCT	0.383													44	96	---	---	---	---	PASS
GM2A	2760	broad.mit.edu	37	5	150646946	150646946	+	Silent	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150646946C>T	uc003ltr.3	+	4	681	c.516C>T	c.(514-516)AGC>AGT	p.S172S	GM2A_uc011dcs.1_RNA|GM2A_uc011dcr.1_Intron|GM2A_uc003ltu.1_5'Flank	NM_000405	NP_000396	P17900	SAP3_HUMAN	GM2 ganglioside activator precursor	172						lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCATAGAGAGCGTCCTGAGCA	0.577													4	45	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36294388	36294388	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36294388C>T	uc003oly.2	-	5	1113	c.935G>A	c.(934-936)GGG>GAG	p.G312E		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	312										skin(2)|ovary(1)|breast(1)	4						ATCTGCAGCCCCCCTCTTGGC	0.557													32	330	---	---	---	---	PASS
TTK	7272	broad.mit.edu	37	6	80751910	80751910	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80751910A>G	uc003pjc.2	+	22	2639	c.2565A>G	c.(2563-2565)GGA>GGG	p.G855G	TTK_uc003pjb.3_Silent_p.G854G	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	855					mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AAAAAAGGGGAAAAAAATGAT	0.308													4	193	---	---	---	---	PASS
BACH2	60468	broad.mit.edu	37	6	90660625	90660625	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90660625C>A	uc011eab.1	-	7	2009	c.1200G>T	c.(1198-1200)AAG>AAT	p.K400N	BACH2_uc003pnw.2_Missense_Mutation_p.K400N|BACH2_uc010kch.2_Missense_Mutation_p.K400N	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	400						nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		TGGACACCTCCTTCTGGCCCA	0.582													6	64	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100395756	100395756	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100395756G>T	uc003pqh.1	-	3	589	c.274C>A	c.(274-276)CAA>AAA	p.Q92K	MCHR2_uc003pqi.1_Missense_Mutation_p.Q92K	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	92	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CGGGCCCATTGGTGAATAAGA	0.493													71	116	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41729122	41729122	+	3'UTR	SNP	T	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41729122T>G	uc003thq.2	-	2					INHBA_uc003thr.2_3'UTR	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor						cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						tttttttttgttttttttttt	0.274										TSP Lung(11;0.080)			2	6	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77649068	77649068	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77649068C>A	uc003ugx.2	-	22	4186	c.3932G>T	c.(3931-3933)GGG>GTG	p.G1311V	MAGI2_uc003ugy.2_Missense_Mutation_p.G1297V	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	1311						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCTCTGCTCCCCGAGGCGCTG	0.502													3	58	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82595160	82595160	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82595160T>C	uc003uhx.2	-	4	4233	c.3944A>G	c.(3943-3945)AAA>AGA	p.K1315R	PCLO_uc003uhv.2_Missense_Mutation_p.K1315R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1254					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTTATTGTTTTGGTTGTCTT	0.413													3	182	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123594376	123594376	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594376G>T	uc003vld.2	+	4	1154	c.752G>T	c.(751-753)TGG>TTG	p.W251L	SPAM1_uc003vle.2_Missense_Mutation_p.W251L|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.W251L|SPAM1_uc010lku.2_Missense_Mutation_p.W251L	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	251					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	GATCTCAGCTGGTTGTGGAAT	0.398													6	332	---	---	---	---	PASS
ZC3HC1	51530	broad.mit.edu	37	7	129666085	129666085	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129666085T>G	uc003vpi.2	-	6	716	c.689A>C	c.(688-690)GAT>GCT	p.D230A	ZC3HC1_uc003vph.2_Missense_Mutation_p.D117A|ZC3HC1_uc010lma.2_Missense_Mutation_p.D117A	NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1	230					cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					TTTTCTCTCATCAGTTCGGTG	0.448													3	157	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144062338	144062338	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144062338G>T	uc003wel.2	+	2	2694	c.2576G>T	c.(2575-2577)AGG>ATG	p.R859M	ARHGEF5_uc003wek.2_Missense_Mutation_p.R859M|ARHGEF5_uc003wem.2_5'Flank	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	859					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CCAAAGTCCAGGGGGAGGAGC	0.587													12	153	---	---	---	---	PASS
GIMAP4	55303	broad.mit.edu	37	7	150270155	150270155	+	3'UTR	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150270155T>C	uc003whl.2	+	3					GIMAP4_uc011kuu.1_3'UTR|GIMAP4_uc011kuv.1_3'UTR	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4								GTP binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTAAACTTAATGAAAATCTGT	0.393													42	60	---	---	---	---	PASS
FBXO25	26260	broad.mit.edu	37	8	401396	401396	+	Silent	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:401396C>T	uc003wox.2	+	7	869	c.603C>T	c.(601-603)TGC>TGT	p.C201C	FBXO25_uc003woy.2_Silent_p.C201C|FBXO25_uc003woz.2_Silent_p.C134C|FBXO25_uc003wpa.2_5'UTR	NM_183421	NP_904357	Q8TCJ0	FBX25_HUMAN	F-box only protein 25 isoform 1	201						nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TTTGGATTTGCCGATTAGAAA	0.378													4	156	---	---	---	---	PASS
MTUS1	57509	broad.mit.edu	37	8	17612685	17612685	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17612685G>T	uc003wxv.2	-	2	1106	c.632C>A	c.(631-633)TCC>TAC	p.S211Y	MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.S211Y|MTUS1_uc010lsz.2_Missense_Mutation_p.S211Y	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	211						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		ATCAGAATGGGAAGATGTCCA	0.438													85	167	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212689	62212689	+	Silent	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212689C>T	uc003xuh.2	+	2	627	c.303C>T	c.(301-303)CGC>CGT	p.R101R	CLVS1_uc003xug.2_Silent_p.R101R|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Silent_p.R101R	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	101					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TCCAGTACCGCCAGCTAAACC	0.507													42	65	---	---	---	---	PASS
GDAP1	54332	broad.mit.edu	37	8	75263599	75263599	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75263599C>T	uc003yah.2	+	2	287	c.208C>T	c.(208-210)CGT>TGT	p.R70C	GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Missense_Mutation_p.R2C	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated	70	GST N-terminal.					cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			TTGGTTTATGCGTTTGAACTC	0.453													7	523	---	---	---	---	PASS
FAM82B	51115	broad.mit.edu	37	8	87500826	87500826	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87500826C>G	uc003ydu.2	-	3	450	c.290G>C	c.(289-291)GGA>GCA	p.G97A	FAM82B_uc011lfz.1_Missense_Mutation_p.G97A|FAM82B_uc011lga.1_Missense_Mutation_p.G97A	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	97						microtubule|spindle pole	binding			ovary(1)	1						TTCTGTTTCTCCGCTTTCATA	0.348													110	257	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124664647	124664647	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124664647C>G	uc003yqs.1	-	1	544	c.520G>C	c.(520-522)GAG>CAG	p.E174Q		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	174	BACK.										0						GCACAGAGCTCCTTCAGGTCG	0.557													50	100	---	---	---	---	PASS
PUF60	22827	broad.mit.edu	37	8	144898893	144898893	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144898893C>T	uc003yzs.2	-	12	1541	c.1477G>A	c.(1477-1479)GTG>ATG	p.V493M	SCRIB_uc003yzo.1_5'Flank|SCRIB_uc003yzp.1_5'Flank|PUF60_uc003yzr.2_Missense_Mutation_p.V433M|PUF60_uc003yzt.2_Missense_Mutation_p.V476M|PUF60_uc003yzq.2_Missense_Mutation_p.V450M	NM_078480	NP_510965	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa isoform a	493	RRM 3; atypical.|Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptosis|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleus|ribonucleoprotein complex	DNA binding|nucleotide binding|protein binding|RNA binding				0	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACGCGGTTCACGGCCCCGAAC	0.517													5	348	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43627074	43627074	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43627074T>C	uc011lrb.1	-	4	1642	c.1613A>G	c.(1612-1614)CAC>CGC	p.H538R		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	538						integral to membrane					0						CCATTCAGGGTGCTGAGTTTC	0.478													179	372	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115936792	115936792	+	Silent	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115936792G>T	uc004bgs.2	-	22	2413	c.2295C>A	c.(2293-2295)CGC>CGA	p.R765R	FKBP15_uc004bgr.2_Silent_p.R202R|FKBP15_uc011lxc.1_Silent_p.R346R|FKBP15_uc011lxd.1_Silent_p.R697R	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	765	Potential.				endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						GGTATGACTTGCGAATTTCAT	0.468													7	305	---	---	---	---	PASS
GBGT1	26301	broad.mit.edu	37	9	136029294	136029294	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136029294C>G	uc004ccw.2	-	7	995	c.714G>C	c.(712-714)CAG>CAC	p.Q238H	RALGDS_uc011mcw.1_Intron|GBGT1_uc004ccx.2_Missense_Mutation_p.Q191H|GBGT1_uc010nab.2_3'UTR|GBGT1_uc011mcx.1_Missense_Mutation_p.Q221H|GBGT1_uc010nac.1_Missense_Mutation_p.Q102H|GBGT1_uc004ccy.1_3'UTR	NM_021996	NP_068836	Q8N5D6	GBGT1_HUMAN	globoside	238	Lumenal (Potential).				carbohydrate metabolic process|glycolipid biosynthetic process	Golgi membrane|integral to membrane	metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		CATAGGGGAACTGCTGGCGGG	0.612													37	66	---	---	---	---	PASS
ATP5C1	509	broad.mit.edu	37	10	7839091	7839091	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7839091G>T	uc001iju.2	+	3	251	c.173G>T	c.(172-174)CGA>CTA	p.R58L	ATP5C1_uc010qbb.1_Missense_Mutation_p.R58L|ATP5C1_uc009xiq.1_Missense_Mutation_p.R58L|ATP5C1_uc010qbc.1_Missense_Mutation_p.R9L|ATP5C1_uc001ijv.2_Missense_Mutation_p.R58L	NM_001001973	NP_001001973	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	58					oxidative phosphorylation|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						AAATATGCCCGAGCTGAGAGA	0.403													19	54	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28233812	28233812	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28233812G>T	uc009xky.2	-	11	1564	c.1466C>A	c.(1465-1467)GCC>GAC	p.A489D	ARMC4_uc010qds.1_Missense_Mutation_p.A14D|ARMC4_uc010qdt.1_Missense_Mutation_p.A181D|ARMC4_uc001itz.2_Missense_Mutation_p.A489D|ARMC4_uc010qdu.1_Missense_Mutation_p.A181D	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	489	ARM 1.						binding			ovary(4)|skin(2)	6						ATCTCTGATGGCCAACTGGCA	0.463													33	119	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64936178	64936178	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64936178T>A	uc001jmn.2	-	24	7580	c.7280A>T	c.(7279-7281)CAA>CTA	p.Q2427L	JMJD1C_uc001jml.2_Missense_Mutation_p.Q2190L|JMJD1C_uc001jmm.2_Missense_Mutation_p.Q2139L|JMJD1C_uc010qiq.1_Missense_Mutation_p.Q2245L|JMJD1C_uc009xpi.2_Missense_Mutation_p.Q2245L|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmk.2_RNA	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2427	JmjC.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATACCAACTTTGGTCACGTAT	0.363													60	171	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73544690	73544690	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73544690C>T	uc001jrx.3	+	41	5922	c.5545C>T	c.(5545-5547)CCT>TCT	p.P1849S		NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1849	Cadherin 17.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CGACAACGACCCTGTGCTGCT	0.597													19	34	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17418564	17418564	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17418564C>G	uc001mnc.2	-	33	4144	c.4018G>C	c.(4018-4020)GAC>CAC	p.D1340H		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	1340	Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	TTCCCTTGGTCTGGCCAGTTC	0.622													41	97	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62396249	62396249	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62396249A>G	uc001nub.2	-	17	2205	c.2172T>C	c.(2170-2172)CCT>CCC	p.P724P	GANAB_uc001ntz.2_5'Flank|GANAB_uc001nua.2_Silent_p.P746P|GANAB_uc001nuc.2_Silent_p.P627P|GANAB_uc010rma.1_Silent_p.P632P|GANAB_uc010rmb.1_Silent_p.P610P	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	724					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						ACCTCATGACAGGAATGCCTT	0.527													15	179	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62621293	62621293	+	5'Flank	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62621293T>C	uc001nwd.2	+						SLC3A2_uc001nwb.2_5'Flank|SLC3A2_uc001nwc.2_5'Flank|SLC3A2_uc001nwe.2_5'Flank|SLC3A2_uc001nwf.2_5'Flank|SNHG1_uc001nvp.2_RNA|SNHG1_uc001nvo.2_RNA|SNHG1_uc001nvq.2_RNA|SNHG1_uc001nvs.2_RNA|SNHG1_uc001nvr.2_RNA|SNHG1_uc001nvt.2_RNA|SNHG1_uc001nvu.2_RNA|SNORD22_uc001nvv.2_5'Flank|SNORD31_uc009yoj.1_5'Flank|SNORD30_uc001nvw.1_5'Flank	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c						blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						AGCAGGTTATTGGTTAGTAGT	0.443													43	76	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	70017113	70017113	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70017113G>A	uc001opj.2	+	22	2623	c.2318G>A	c.(2317-2319)CGA>CAA	p.R773Q	ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.R482Q|ANO1_uc010rql.1_5'UTR	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	773	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						ACTGAGCTCCGAAGGCCGGTA	0.612													6	20	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	70031793	70031793	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70031793G>A	uc001opj.2	+	25	2991	c.2686G>A	c.(2686-2688)GTC>ATC	p.V896I	ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.V605I|ANO1_uc010rql.1_Missense_Mutation_p.V70I	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	896	Helical; (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						GTTTGTCATCGTCTTCCAGGT	0.557													22	62	---	---	---	---	PASS
MAP6	4135	broad.mit.edu	37	11	75298336	75298336	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75298336T>C	uc001owu.2	-	4	2275	c.2210A>G	c.(2209-2211)AAT>AGT	p.N737S		NM_033063	NP_149052	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6 isoform 1	737	Pro-rich.					Golgi apparatus|microtubule|perinuclear region of cytoplasm	calmodulin binding				0	Ovarian(111;0.11)					ACGACCTTGATTCTTTGGAGG	0.502													138	250	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92430574	92430574	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92430574A>C	uc001pdj.3	+	3	3649	c.3632A>C	c.(3631-3633)AAA>ACA	p.K1211T		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1211	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTTCAAGGAAATTGGATCGA	0.388										TCGA Ovarian(4;0.039)			3	98	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108381263	108381263	+	Silent	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108381263G>A	uc001pkk.2	-	6	5082	c.4971C>T	c.(4969-4971)AGC>AGT	p.S1657S	EXPH5_uc010rvy.1_Silent_p.S1469S|EXPH5_uc010rvz.1_Silent_p.S1501S|EXPH5_uc010rwa.1_Silent_p.S1581S	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1657					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CACTCAACCTGCTTTCGCCAA	0.488													115	213	---	---	---	---	PASS
LAYN	143903	broad.mit.edu	37	11	111431066	111431066	+	Silent	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111431066G>A	uc001plr.1	+	8	1368	c.1032G>A	c.(1030-1032)GTG>GTA	p.V344V	LAYN_uc001plp.1_Silent_p.V336V|LAYN_uc001plq.1_3'UTR|LAYN_uc001pls.1_3'UTR|LAYN_uc010rwg.1_Silent_p.V191V|LAYN_uc010rwh.1_Silent_p.V192V	NM_178834	NP_849156	Q6UX15	LAYN_HUMAN	layilin	344	Cytoplasmic (Potential).|3 X 5 AA repeats of E-S-G-X-V.|Interaction with NF2 (By similarity).|Interaction with TLN1 (By similarity).|1-1.			V -> M (in Ref. 5; AAH25407).		cell surface|integral to membrane|ruffle	hyaluronic acid binding|sugar binding				0		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)		GTGGGTTTGTGACTCTGGTGA	0.478													45	91	---	---	---	---	PASS
TMPRSS12	283471	broad.mit.edu	37	12	51281383	51281383	+	3'UTR	SNP	A	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51281383A>C	uc001rwx.3	+	5					TMPRSS12_uc001rwy.2_3'UTR	NM_182559	NP_872365	Q86WS5	TMPSC_HUMAN	transmembrane protease, serine 12 precursor						proteolysis	integral to membrane	serine-type endopeptidase activity				0						TCTTCTAGCAATTAATTGCCT	0.303													47	74	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59307770	59307770	+	Missense_Mutation	SNP	G	T	T	rs141989740		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59307770G>T	uc001sqr.2	-	3	622	c.376C>A	c.(376-378)CTC>ATC	p.L126I	LRIG3_uc009zqh.2_Missense_Mutation_p.L66I|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	126	LRR 3.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TACAAGGAGAGAAGTGTAATA	0.373													4	175	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46584591	46584591	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46584591C>G	uc010tfw.1	-	6	644	c.638G>C	c.(637-639)AGA>ACA	p.R213T	ZC3H13_uc001vas.1_Missense_Mutation_p.R213T|ZC3H13_uc001vat.1_Missense_Mutation_p.R213T	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	213	Ser-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		GCTAGACTTTCTTAGAGAAGG	0.413													7	287	---	---	---	---	PASS
HTR2A	3356	broad.mit.edu	37	13	47409096	47409096	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47409096T>C	uc001vbq.2	-	3	1426	c.1292A>G	c.(1291-1293)AAT>AGT	p.N431S	HTR2A_uc001vbr.2_Missense_Mutation_p.N331S|HTR2A_uc010acr.2_Missense_Mutation_p.N431S	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	431	Cytoplasmic (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	TTGCTTTGAATTCTTTTTTTG	0.403													11	341	---	---	---	---	PASS
SLC7A7	9056	broad.mit.edu	37	14	23249248	23249248	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23249248A>G	uc001wgr.3	-	3	650	c.512T>C	c.(511-513)TTC>TCC	p.F171S	SLC7A7_uc001wgs.3_Missense_Mutation_p.F171S|SLC7A7_uc001wgt.3_Missense_Mutation_p.F171S|SLC7A7_uc001wgu.3_Missense_Mutation_p.F171S|SLC7A7_uc001wgv.3_Missense_Mutation_p.F171S	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7	171	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		ACAGTTAATGAAGGTTAAGAG	0.433													3	222	---	---	---	---	PASS
OTX2	5015	broad.mit.edu	37	14	57268648	57268648	+	Silent	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57268648A>G	uc001xcp.2	-	3	846	c.675T>C	c.(673-675)AAT>AAC	p.N225N	OTX2_uc010aou.2_Silent_p.N225N|OTX2_uc001xcq.2_Silent_p.N233N	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	225					axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TGGTGACTGCATTGGTACCCA	0.517													4	161	---	---	---	---	PASS
PGF	5228	broad.mit.edu	37	14	75416059	75416059	+	Splice_Site	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75416059C>T	uc010ase.1	-	3	661	c.315_splice	c.e3+1	p.Q105_splice	PGF_uc001xqz.2_Splice_Site_p.Q105_splice|PGF_uc001xra.2_Splice_Site_p.Q104_splice|PGF_uc001xrb.2_Splice_Site_p.Q105_splice|PGF_uc010asf.1_Splice_Site_p.S91_splice	NM_002632	NP_002623	P49763	PLGF_HUMAN	placental growth factor, vascular endothelial						angiogenesis|cell differentiation|cell-cell signaling|positive regulation of cell division|positive regulation of cell proliferation|vascular endothelial growth factor receptor signaling pathway	extracellular region|membrane	growth factor activity|heparin binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00668)		TATGGACCTACCTGCATGGTG	0.627													40	77	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53081592	53081592	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53081592G>T	uc002aci.1	-	1	618	c.490C>A	c.(490-492)CTC>ATC	p.L164I		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	164					endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		GGGGTATAGAGGTTATTCATG	0.567													40	66	---	---	---	---	PASS
SH2D7	646892	broad.mit.edu	37	15	78393441	78393441	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78393441G>T	uc010blb.1	+	5	846	c.846G>T	c.(844-846)AGG>AGT	p.R282S		NM_001101404	NP_001094874	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	282											0						AGGCCCAAAGGAGACTCTCAG	0.647													4	35	---	---	---	---	PASS
NMRAL1	57407	broad.mit.edu	37	16	4511892	4511892	+	Silent	SNP	G	A	A	rs1043380		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4511892G>A	uc002cwm.2	-	6	945	c.789C>T	c.(787-789)TTC>TTT	p.F263F	NMRAL1_uc002cwn.2_Silent_p.F263F|NMRAL1_uc002cwo.2_Silent_p.F263F|NMRAL1_uc002cwp.2_Silent_p.F299F	NM_020677	NP_065728	Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	263						nucleus|perinuclear region of cytoplasm	binding			kidney(1)	1						TCAGGGCATAGAAACGGAACA	0.602													81	186	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21147728	21147728	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21147728G>A	uc010vbe.1	-	6	803	c.803C>T	c.(802-804)ACG>ATG	p.T268M	DNAH3_uc002die.2_Missense_Mutation_p.T239M	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	268	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GAAGGGACTCGTCAGCAGCGT	0.493													62	203	---	---	---	---	PASS
PDXDC2	283970	broad.mit.edu	37	16	70016326	70016326	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70016326G>A	uc010vlq.1	-	4	554	c.376C>T	c.(376-378)CGT>TGT	p.R126C	CLEC18C_uc002exy.2_Intron|PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA					SubName: Full=Putative uncharacterized protein;												0						TTCATCTTACGGATTTTAGCT	0.383													4	158	---	---	---	---	PASS
ALOX15B	247	broad.mit.edu	37	17	7942501	7942501	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7942501A>G	uc002gju.2	+	1	144	c.28A>G	c.(28-30)ACC>GCC	p.T10A	ALOX15B_uc002gjv.2_Missense_Mutation_p.T10A|ALOX15B_uc002gjw.2_Missense_Mutation_p.T10A|ALOX15B_uc010vun.1_Missense_Mutation_p.T10A|ALOX15B_uc010cnp.2_5'UTR	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	10	PLAT.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						CAGGGTGTCCACCGGAGAAGC	0.667													33	88	---	---	---	---	PASS
PIRT	644139	broad.mit.edu	37	17	10728814	10728814	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10728814T>A	uc010col.2	-	2	444	c.149A>T	c.(148-150)GAA>GTA	p.E50V		NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of	50						integral to membrane				ovary(1)	1						GCGGTAGATTTCCCAGTTACT	0.597													10	18	---	---	---	---	PASS
ATPAF2	91647	broad.mit.edu	37	17	17929601	17929601	+	Intron	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17929601C>A	uc002gse.1	-						ATPAF2_uc002gsd.1_Intron|ATPAF2_uc002gsf.1_Intron|ATPAF2_uc010cps.1_RNA	NM_145691	NP_663729	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly						proton-transporting ATP synthase complex assembly	mitochondrion|nuclear speck	protein binding				0	all_neural(463;0.228)					TAGCCTCAATCCAAGGGGAAT	0.488													51	82	---	---	---	---	PASS
CCDC144C	348254	broad.mit.edu	37	17	20242870	20242870	+	RNA	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20242870G>A	uc010cqy.1	+	5		c.959G>A				NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						TTCCTCATGTGCAAAAATCTG	0.368													4	185	---	---	---	---	PASS
AOC3	8639	broad.mit.edu	37	17	41004871	41004871	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41004871C>A	uc002ibv.2	+	1	1671	c.1511C>A	c.(1510-1512)ACT>AAT	p.T504N		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	504	Extracellular (Potential).				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	TTTGGTGCTACTGGGAAGTAC	0.537													44	92	---	---	---	---	PASS
DBF4B	80174	broad.mit.edu	37	17	42828502	42828502	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42828502G>A	uc002ihf.2	+	14	1942	c.1729G>A	c.(1729-1731)GCC>ACC	p.A577T	DBF4B_uc010wjc.1_Intron	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1	577					cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)				GTGTACCCTTGCCTTCCCCTC	0.562													94	181	---	---	---	---	PASS
SPOP	8405	broad.mit.edu	37	17	47679332	47679332	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47679332G>A	uc010dbk.2	-	10	1507	c.875C>T	c.(874-876)GCC>GTC	p.A292V	SPOP_uc002ipb.2_Missense_Mutation_p.A292V|SPOP_uc002ipc.2_Missense_Mutation_p.A292V|SPOP_uc002ipd.2_Missense_Mutation_p.A292V|SPOP_uc002ipe.2_Missense_Mutation_p.A292V|SPOP_uc002ipf.2_Missense_Mutation_p.A292V|SPOP_uc002ipg.2_Missense_Mutation_p.A292V	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein	292	BTB.				mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						ACTGCAGAGGGCATCCTCACA	0.507										Prostate(2;0.17)			5	211	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78326796	78326796	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78326796G>T	uc002jyh.1	+	8	4802	c.4579G>T	c.(4579-4581)GAT>TAT	p.D1527Y	uc002jyi.1_RNA|RNF213_uc010dhw.1_5'Flank	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CATGGTTTCTGATGTGACCAG	0.602													4	118	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18549140	18549140	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18549140T>G	uc002kte.2	-	24	3791	c.2850A>C	c.(2848-2850)AAA>AAC	p.K950N		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	950	Glu-rich.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TTTCAATATCTTTGGTTAGCA	0.338													61	97	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28898303	28898303	+	Missense_Mutation	SNP	A	G	G	rs141269991	byFrequency	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28898303A>G	uc002kwp.2	+	1	252	c.40A>G	c.(40-42)ATT>GTT	p.I14V		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	14					calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AATGCTGTTCATTTTTCTGGT	0.378													108	176	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50432461	50432461	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50432461G>T	uc002lfe.1	+	3	1047	c.460G>T	c.(460-462)GGA>TGA	p.G154*	DCC_uc010xdr.1_Nonsense_Mutation_p.G2*	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	154	Extracellular (Potential).|Ig-like C2-type 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGCCTTCATGGGAGACACAGT	0.458													4	154	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63547734	63547734	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63547734T>A	uc002ljz.2	+	12	2287	c.1962T>A	c.(1960-1962)GAT>GAA	p.D654E	CDH7_uc002lkb.2_Missense_Mutation_p.D654E	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	654	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				TGAGATACGATGACGAGGGCG	0.493													47	70	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1074198	1074198	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1074198A>T	uc002lqz.1	+	7	1117	c.886A>T	c.(886-888)ATG>TTG	p.M296L	HMHA1_uc010xgd.1_Missense_Mutation_p.M312L|HMHA1_uc010xge.1_Missense_Mutation_p.M136L|HMHA1_uc002lra.1_Missense_Mutation_p.M136L|HMHA1_uc002lrb.1_Missense_Mutation_p.M179L	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	296					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCAAGTACATGAAGGACCT	0.642													41	62	---	---	---	---	PASS
FDX1L	112812	broad.mit.edu	37	19	10421114	10421114	+	3'UTR	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10421114A>G	uc002mny.1	-	5					ZGLP1_uc002mnw.3_5'Flank|FDX1L_uc002mnx.1_RNA	NM_001031734	NP_001026904	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like precursor						electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TATTCCCTCAATCTGGGCCCT	0.607													3	32	---	---	---	---	PASS
ZNF333	84449	broad.mit.edu	37	19	14829357	14829357	+	Silent	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14829357C>T	uc002mzn.2	+	12	1352	c.1218C>T	c.(1216-1218)TCC>TCT	p.S406S	ZNF333_uc002mzk.3_Silent_p.S297S	NM_032433	NP_115809	Q96JL9	ZN333_HUMAN	zinc finger protein 333	406	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TCAAATATTCCTCGAATCTCC	0.453													35	59	---	---	---	---	PASS
NDUFA13	51079	broad.mit.edu	37	19	19627139	19627139	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19627139C>T	uc010xqy.1	+	1	600	c.341C>T	c.(340-342)TCG>TTG	p.S114L	TSSK6_uc002nmq.2_5'Flank|TSSK6_uc002nmr.2_5'Flank|NDUFA13_uc002nms.2_Missense_Mutation_p.S114L|NDUFA13_uc010xqx.1_Missense_Mutation_p.S114L	NM_015965	NP_057049	Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	31	Helical; (Potential).				apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	CGAGGACTGTCGGGTCAGTAT	0.667													23	46	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21910580	21910580	+	Silent	SNP	T	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910580T>C	uc002nqi.2	-	5	733	c.534A>G	c.(532-534)CAA>CAG	p.Q178Q	ZNF100_uc002nqh.2_Silent_p.Q114Q	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	178	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATGGATCACATTGAAATATGT	0.308													6	410	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23545331	23545331	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23545331C>G	uc002nre.2	-	4	563	c.450G>C	c.(448-450)CAG>CAC	p.Q150H	ZNF91_uc010xrj.1_Missense_Mutation_p.Q118H	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	150						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ATACTTTGCTCTGGGCAGTTG	0.318													107	174	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53912142	53912142	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53912142A>G	uc010ydx.1	+	6	1661	c.1334A>G	c.(1333-1335)AAA>AGA	p.K445R	ZNF765_uc002qbm.2_Missense_Mutation_p.K445R|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	445	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		GAATGTGACAAAGCCTACAGT	0.388													7	147	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56244059	56244059	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56244059T>A	uc002qly.2	-	2	1166	c.1138A>T	c.(1138-1140)AGT>TGT	p.S380C		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	380	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AAACTCTGACTTCCTGCTTTG	0.418													82	199	---	---	---	---	PASS
ZNF417	147687	broad.mit.edu	37	19	58419716	58419716	+	3'UTR	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58419716G>C	uc002qqq.2	-	3					ZNF417_uc010yhm.1_3'UTR|ZNF417_uc002qqr.2_3'UTR	NM_152475	NP_689688	Q8TAU3	ZN417_HUMAN	zinc finger protein 417						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		aagttgcagtgagccaagatt	0.104													3	10	---	---	---	---	PASS
ZNF584	201514	broad.mit.edu	37	19	58921394	58921394	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58921394T>G	uc002qsp.2	+	2	557	c.105T>G	c.(103-105)AAT>AAG	p.N35K	ZNF584_uc010yia.1_RNA|ZNF584_uc002qsr.2_5'UTR|ZNF584_uc010yib.1_Missense_Mutation_p.N27K	NM_173548	NP_775819	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	35	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		GGCTCCTTAATGTGACCCAGA	0.522													42	82	---	---	---	---	PASS
RASSF2	9770	broad.mit.edu	37	20	4771138	4771138	+	Missense_Mutation	SNP	G	A	A	rs147789166	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4771138G>A	uc002wld.2	-	6	550	c.496C>T	c.(496-498)CGC>TGC	p.R166C	RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.R166C	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	166				R -> C (in Ref. 4; BAD96370).	cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						AAGCGGTGGCGTCTGATTCGC	0.607													5	36	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32379290	32379290	+	Silent	SNP	C	T	T	rs148919836		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32379290C>T	uc002wzy.2	+	15	2552	c.2532C>T	c.(2530-2532)CTC>CTT	p.L844L	ZNF341_uc002wzx.2_Silent_p.L837L|ZNF341_uc010geq.2_Silent_p.L754L|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Silent_p.L271L	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	844					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GTGCCATGCTCGCTGTGCCCG	0.672													5	48	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50408719	50408719	+	Silent	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50408719G>A	uc002xwh.3	-	2	404	c.303C>T	c.(301-303)CTC>CTT	p.L101L	SALL4_uc010gii.2_Silent_p.L101L|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	101					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CATTCATGATGAGGACAGGTG	0.532													5	194	---	---	---	---	PASS
MYT1	4661	broad.mit.edu	37	20	62850364	62850364	+	Silent	SNP	G	A	A	rs142303893		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62850364G>A	uc002yii.2	+	12	2311	c.1947G>A	c.(1945-1947)ACG>ACA	p.T649T	MYT1_uc002yih.2_Silent_p.T351T|MYT1_uc002yij.2_Silent_p.T308T	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	649					cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACCTCAGCACGAAGCCACAGG	0.587													9	32	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19775868	19775868	+	Silent	SNP	G	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19775868G>C	uc002ykw.2	-	1	103	c.72C>G	c.(70-72)CTC>CTG	p.L24L		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	24	Helical; Signal-anchor for type II membrane protein; (Potential).				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						ATATGGCAAAGAGAGCTGCAA	0.433													5	245	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41457529	41457529	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41457529C>A	uc002yyq.1	-	23	4584	c.4132G>T	c.(4132-4134)GTT>TTT	p.V1378F	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1378	Fibronectin type-III 5.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AATGTTGTACCTTGTACTTGT	0.343													4	225	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17489072	17489072	+	5'UTR	SNP	A	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17489072A>C	uc002zlw.2	-	1					GAB4_uc010gqs.1_5'UTR	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member											large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GTGGGGTGTGAGGGACGGCTT	0.687													4	8	---	---	---	---	PASS
GNB1L	54584	broad.mit.edu	37	22	19776236	19776236	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19776236G>T	uc002zqe.1	-	7	1374	c.980C>A	c.(979-981)GCA>GAA	p.A327E	GNB1L_uc002zqd.1_Missense_Mutation_p.A183E|GNB1L_uc002zqf.1_Missense_Mutation_p.A327E	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein	327					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					GGTGAGTCATGCGCGTGGGTA	0.677													26	65	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663087	22663087	+	RNA	SNP	A	G	G	rs1054158		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663087A>G	uc011aim.1	+	29		c.1860A>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						GCTGCCACATAAGTTGTCCTT	0.303													3	62	---	---	---	---	PASS
MORC2	22880	broad.mit.edu	37	22	31322795	31322795	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31322795C>A	uc003aje.1	-	27	4272	c.2908G>T	c.(2908-2910)GAC>TAC	p.D970Y		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	1032							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2						TGCCTTCAGTCCCCCTTGGTG	0.582													4	104	---	---	---	---	PASS
TEF	7008	broad.mit.edu	37	22	41783471	41783471	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41783471G>A	uc003azy.2	+	2	360	c.274G>A	c.(274-276)GAA>AAA	p.E92K	TEF_uc003azx.2_Missense_Mutation_p.E62K|TEF_uc011apa.1_Missense_Mutation_p.E97K	NM_003216	NP_003207	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 1	92					rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATATGATGGCGAATCTTTCCA	0.612													4	173	---	---	---	---	PASS
FBLN1	2192	broad.mit.edu	37	22	45959178	45959178	+	Intron	SNP	T	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45959178T>A	uc003bgj.1	+						FBLN1_uc003bgh.2_3'UTR|FBLN1_uc010gzz.2_3'UTR|FBLN1_uc003bgi.1_Intron	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GTCTCCCTCCTGTTGCTTTCC	0.572													11	47	---	---	---	---	PASS
SHANK3	85358	broad.mit.edu	37	22	51117747	51117747	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51117747G>A	uc003bne.1	+	7	776	c.776G>A	c.(775-777)CGC>CAC	p.R259H		NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	259										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CAGGCCTGCCGCTTTGGGCAC	0.657													3	38	---	---	---	---	PASS
KLHL15	80311	broad.mit.edu	37	X	24006422	24006422	+	Silent	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24006422C>A	uc004dba.3	-	4	1687	c.1431G>T	c.(1429-1431)GCG>GCT	p.A477A		NM_030624	NP_085127	Q96M94	KLH15_HUMAN	kelch-like 15	477										ovary(1)|breast(1)	2						GAAAGCATCTCGCGTAATTCA	0.468													30	144	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122536944	122536944	+	Silent	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122536944C>A	uc004etq.3	+	9	1473	c.1180C>A	c.(1180-1182)CGA>AGA	p.R394R	GRIA3_uc004etr.3_Silent_p.R394R|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Silent_p.R378R	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	394	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	CAGTGGCTCTCGAAAAGTAAG	0.328													4	177	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131234681	131234681	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131234681C>A	uc004ewn.2	-	2	299	c.121G>T	c.(121-123)GAA>TAA	p.E41*	FRMD7_uc011muy.1_Nonsense_Mutation_p.E41*	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	41	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CCAAAATATTCCTTTTCAGCA	0.358													24	106	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													4	3	---	---	---	---	
SASS6	163786	broad.mit.edu	37	1	100590779	100590780	+	Intron	DEL	GT	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100590779_100590780delGT	uc001dsu.2	-						SASS6_uc009wdz.2_Intron	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CAAGGCAGCAgtgtgtgtgtgt	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151730137	151730138	+	IGR	DEL	TC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151730137_151730138delTC								C1orf230 (28055 upstream) : MRPL9 (1987 downstream)																							TTCAGGAAGTTCTGTTAAATCC	0.436													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	434847	434847	+	IGR	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:434847delT								FAM150B (146539 upstream) : TMEM18 (233128 downstream)																							ctttccttcctttccttactt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293358	12293358	+	Intron	DEL	C	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293358delC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		tcccttccttcccttccttcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293377	12293378	+	Intron	INS	-	TCCT	TCCT	rs67700339		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293377_12293378insTCCT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ccttccttccctccttccttcc	0.000													5	3	---	---	---	---	
DNAJC27	51277	broad.mit.edu	37	2	25180474	25180475	+	Intron	INS	-	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180474_25180475insA	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						TATGGCACCAGAAAAAAAAAAA	0.381													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30274436	30274436	+	IGR	DEL	C	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30274436delC								ALK (130004 upstream) : YPEL5 (95314 downstream)																							TACTACTCCACCAGGGCAGCG	0.398													4	2	---	---	---	---	
COL3A1	1281	broad.mit.edu	37	2	189861741	189861770	+	Intron	DEL	ATATATATATGAGACATATATATATGAGAC	-	-	rs68087349		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189861741_189861770delATATATATATGAGACATATATATATGAGAC	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	gtgtgtgtatatatatatatgagacatatatatatgagacatatatatat	0.057													5	3	---	---	---	---	
PSMD1	5707	broad.mit.edu	37	2	232011261	232011262	+	Intron	INS	-	AC	AC	rs3835946		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232011261_232011262insAC	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	ATGTATTTTTTAGACTTAATGG	0.193													2	6	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188262	10188263	+	Frame_Shift_Ins	INS	-	TTTT	TTTT	rs119103278		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188262_10188263insTTTT	uc003bvc.2	+	2	618_619	c.405_406insTTTT	c.(403-408)TTATTTfs	p.L135fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	135_136	Involved in binding to CCT complex.		F -> S (in VHLD).|F -> Y (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L135fs*24(6)|p.V137fs*7(4)|p.F136V(3)|p.L135*(2)|p.L135F(1)|p.F136I(1)|p.F136del(1)|p.?fs(1)|p.L135fs*7(1)|p.F136fs*23(1)|p.L135fs*9(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AAACTGAATTATTTGTGCCATC	0.431		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				199	115	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41831052	41831053	+	Intron	INS	-	AAA	AAA			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41831052_41831053insAAA	uc003ckv.3	-						ULK4_uc003ckw.2_3'UTR	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CCTCTTGGGATAAAAAATGAAT	0.322													10	5	---	---	---	---	
SACM1L	22908	broad.mit.edu	37	3	45755732	45755733	+	Intron	DEL	TG	-	-	rs139094720	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45755732_45755733delTG	uc003cos.2	+						SACM1L_uc011bag.1_Intron|SACM1L_uc011bah.1_Intron	NM_014016	NP_054735	Q9NTJ5	SAC1_HUMAN	suppressor of actin 1							Golgi apparatus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		CTATTTTGTTTGTTTTTTTTTT	0.302													4	2	---	---	---	---	
CELSR3	1951	broad.mit.edu	37	3	48664533	48664534	+	Intron	INS	-	G	G			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48664533_48664534insG	uc003cuf.1	-						SLC26A6_uc003cug.2_Intron|SLC26A6_uc003cuh.2_Intron|SLC26A6_uc010hke.2_Intron|SLC26A6_uc003cuk.2_Intron|SLC26A6_uc003cui.2_Intron|SLC26A6_uc003cuj.2_Intron|SLC26A6_uc011bbp.1_Intron	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3						homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGAGAGTGAAGGCAGGACTGG	0.559													47	31	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183440065	183440073	+	Intron	DEL	TCTTTTTTT	-	-	rs151175192		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183440065_183440073delTCTTTTTTT	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ggaaaccaaatcttttttttttttttttt	0.053													4	3	---	---	---	---	
MAGEF1	64110	broad.mit.edu	37	3	184430794	184430797	+	5'Flank	DEL	TTCT	-	-	rs9683253	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184430794_184430797delTTCT	uc003fpa.2	-							NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1											ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			ccttccttccttctttccttcctt	0.000													4	2	---	---	---	---	
ADIPOQ	9370	broad.mit.edu	37	3	186565976	186565977	+	Intron	INS	-	AAG	AAG	rs150789289	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186565976_186565977insAAG	uc003fra.2	+						ADIPOQ_uc010hyy.2_Intron	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	adiponectin precursor						brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity			ovary(1)	1	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		acaaaaaaaaaaGAGAGAGaga	0.020													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189295775	189295776	+	IGR	INS	-	TTCC	TTCC			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295775_189295776insTTCC								TPRG1 (254505 upstream) : TP63 (53440 downstream)																							ccttctttcttttccttccttc	0.084													5	3	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147704	190147704	+	Intron	DEL	A	-	-	rs67899321		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147704delA	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		CACAGGGGGGAAAAAAAAAAT	0.353													5	3	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937314	195937315	+	Intron	INS	-	TAAAGAAAAG	TAAAGAAAAG	rs59406858		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937314_195937315insTAAAGAAAAG	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		agagaaagaaagaaagaaaaga	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49298595	49298595	+	IGR	DEL	C	-	-	rs113481334		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49298595delC								CWH43 (234502 upstream) : None (None downstream)																							ggaGAAAACACCCGGTGTTAC	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53614272	53614272	+	Intron	DEL	A	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53614272delA	uc003gzr.2	-						uc003gzs.2_Intron					RecName: Full=Uncharacterized protein LP9056; Flags: Precursor;																		CAAACCCTGTAAAAAAAAAAA	0.328													6	3	---	---	---	---	
C4orf36	132989	broad.mit.edu	37	4	87812446	87812447	+	Intron	INS	-	AA	AA	rs34250498		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87812446_87812447insAA	uc003hqe.3	-							NM_144645	NP_653246	Q96KX1	CD036_HUMAN	hypothetical protein LOC132989												0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		AAGCAGTTGCCaaaaaaaaaaa	0.252													10	5	---	---	---	---	
SNCA	6622	broad.mit.edu	37	4	90730646	90730647	+	Intron	INS	-	AC	AC	rs144619030	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90730646_90730647insAC	uc003hsq.2	-						SNCA_uc010ikt.2_Intron|SNCA_uc003hso.2_Intron|SNCA_uc003hsp.2_Intron|SNCA_uc003hsr.2_Intron	NM_001146054	NP_001139526	P37840	SYUA_HUMAN	alpha-synuclein isoform NACP140						activation of caspase activity|anti-apoptosis|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	Melatonin(DB01065)	cacacacagctacacacacaca	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97569639	97569640	+	IGR	INS	-	GAAA	GAAA	rs139420746	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97569639_97569640insGAAA								PDHA2 (807015 upstream) : C4orf37 (910394 downstream)																							aaggaaggaaggaaagaaagaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	153018828	153018831	+	IGR	DEL	AGGA	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153018828_153018831delAGGA								PET112L (336682 upstream) : FBXW7 (223580 downstream)														p.?(1)									agattgagagaggaaggaaggaag	0.015													4	2	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7869456	7869456	+	Intron	DEL	C	-	-	rs34828626		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7869456delC	uc003jed.2	+						FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CCTTCGGCCTCCGGGGGTCGC	0.746													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17340670	17340671	+	IGR	DEL	TG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17340670_17340671delTG								BASP1 (63735 upstream) : None (None downstream)																							GTCATCTGCAtgtgtgtgtgtg	0.267													4	2	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55462026	55462027	+	Intron	INS	-	TC	TC	rs71602943		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55462026_55462027insTC	uc003jqu.2	-							NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				ccttccttccttctctctctct	0.000													5	3	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170668309	170668309	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170668309delT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTATAGTGGCTTTTTTTTTTT	0.338			T	TRD@	ALL								4	2	---	---	---	---	
GFPT2	9945	broad.mit.edu	37	5	179729286	179729287	+	Intron	INS	-	A	A	rs34163399		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179729286_179729287insA	uc003mlw.1	-							NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	gactcaatctcaaaaaaaaaaa	0.124													5	3	---	---	---	---	
ZFP57	346171	broad.mit.edu	37	6	29642978	29642979	+	Intron	INS	-	AACTTGAA	AACTTGAA	rs143499124	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29642978_29642979insAACTTGAA	uc011dlw.1	-						ZFP57_uc003nnl.3_Intron	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog						DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CTTGGATCTTCAACTTGAAGTC	0.292													5	4	---	---	---	---	
ATG5	9474	broad.mit.edu	37	6	106727356	106727357	+	Intron	INS	-	G	G	rs146277372	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106727356_106727357insG	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CCATGAACAGAGGACACCAAAA	0.396													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116058648	116058649	+	IGR	DEL	CA	-	-	rs112275057		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116058648_116058649delCA								None (None upstream) : FRK (204044 downstream)																							cacgcacgcgcacacacacaca	0.084													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130465437	130465438	+	IGR	INS	-	ACTC	ACTC	rs139426227	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130465437_130465438insACTC								L3MBTL3 (2853 upstream) : SAMD3 (25 downstream)																							AATTTCTAAAAACTCAAAATAA	0.312													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140008375	140008376	+	IGR	DEL	TG	-	-	rs112742922		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140008375_140008376delTG								CITED2 (312590 upstream) : None (None downstream)																							tatgtatgtatgtgtgtgtgtg	0.228													2	4	---	---	---	---	
TAB2	23118	broad.mit.edu	37	6	149679777	149679780	+	Intron	DEL	TGTG	-	-	rs66629777		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149679777_149679780delTGTG	uc003qmj.2	+						TAB2_uc011eec.1_Intron|TAB2_uc010kia.1_Intron|TAB2_uc010kib.1_Intron|TAB2_uc003qmk.3_Intron	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						ttcagaactctgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
NUDT1	4521	broad.mit.edu	37	7	2290259	2290260	+	Intron	INS	-	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2290259_2290260insT	uc003slp.1	+						NUDT1_uc003slq.1_Intron|NUDT1_uc003slr.1_Intron|NUDT1_uc003sls.1_Intron|NUDT1_uc003slt.1_Intron|NUDT1_uc003slu.1_Intron|NUDT1_uc003slv.1_Intron	NM_198949	NP_945187	P36639	8ODP_HUMAN	nudix-type motif 1 isoform p22						DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		cgcccggctaatttttttgtat	0.000								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					10	10	---	---	---	---	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20824941_20824943delGCC	uc003suy.2	-	3	680_682	c.439_441delGGC	c.(439-441)GGCdel	p.G147del	SP8_uc003suz.2_In_Frame_Del_p.G165del	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor isoform 2	147					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						GCGCGGAGGAgccgccgccgccg	0.493													4	2	---	---	---	---	
STAG3L2	442582	broad.mit.edu	37	7	74299903	74299903	+	Frame_Shift_Del	DEL	C	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74299903delC	uc003ubj.3	-	7	768	c.386delG	c.(385-387)AGCfs	p.S129fs	STAG3L2_uc011kfj.1_RNA	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like	129						nucleus	binding				0						GGGGTAGACGCTCTCACAGTC	0.502													16	8	---	---	---	---	
GTF2IRD2B	389524	broad.mit.edu	37	7	74536840	74536840	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74536840delT	uc003ubt.2	+						GTF2IRD2B_uc003ubs.3_Intron|GTF2IRD2B_uc011kfl.1_Intron|GTF2IRD2B_uc010lcd.2_Intron|GTF2IRD2B_uc011kfm.1_Intron	NM_001003795	NP_001003795	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATTAATTCTAttttttttttt	0.219													10	5	---	---	---	---	
SRRM3	222183	broad.mit.edu	37	7	75912537	75912537	+	Intron	DEL	G	-	-	rs3839766		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75912537delG	uc010ldi.2	+						SRRM3_uc003uet.1_Intron	NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						GCACGGGGATGGGGGGGGGTG	0.677													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79686453	79686454	+	IGR	DEL	AC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79686453_79686454delAC								MAGI2 (603563 upstream) : GNAI1 (77686 downstream)																							ttaaaaatttacacacacacac	0.000													6	3	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83056488	83056489	+	Intron	INS	-	TTTC	TTTC	rs139926228	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83056488_83056489insTTTC	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				CCCATATGACTtttctttcttc	0.233													4	5	---	---	---	---	
PUS7	54517	broad.mit.edu	37	7	105146875	105146876	+	Intron	INS	-	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105146875_105146876insT	uc003vcx.2	-						PUS7_uc010lji.2_Intron|PUS7_uc003vcy.2_Intron|PUS7_uc003vcz.1_Intron	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1						ttttttttttcttttttttttt	0.129													4	2	---	---	---	---	
CHPF2	54480	broad.mit.edu	37	7	150931964	150931965	+	Intron	INS	-	CA	CA	rs72573487	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150931964_150931965insCA	uc003wjr.1	+						CHPF2_uc003wjq.1_Intron	NM_019015	NP_061888	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2							Golgi cisterna membrane|integral to membrane	N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(1)	1						CAAATCAATTCGTGTCAGCTAC	0.426													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	22099018	22099019	+	IGR	INS	-	TG	TG	rs142376170	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22099018_22099019insTG								PHYHIP (9167 upstream) : MIR320A (3456 downstream)																							ACCTCTCTCTCtgtgtgtgtgt	0.089													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53922743	53922743	+	IGR	DEL	T	-	-	rs151008077		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53922743delT								NPBWR1 (69290 upstream) : OPRK1 (215533 downstream)																							tttcttcttcttttttttttt	0.000													8	5	---	---	---	---	
ATP6V1H	51606	broad.mit.edu	37	8	54723697	54723697	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54723697delT	uc003xrl.2	-						ATP6V1H_uc003xrk.2_Intron|ATP6V1H_uc003xrm.2_Intron|ATP6V1H_uc003xrn.2_Intron|ATP6V1H_uc011ldv.1_Intron|ATP6V1H_uc010lyd.2_Intron	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			TTTGGGGATGTTTAGGCCAGT	0.358													158	76	---	---	---	---	
ZBTB10	65986	broad.mit.edu	37	8	81422875	81422876	+	Intron	DEL	GT	-	-	rs144657712	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81422875_81422876delGT	uc003ybx.3	+						ZBTB10_uc003ybv.3_Intron|ZBTB10_uc003ybw.3_Intron|ZBTB10_uc010lzt.2_Intron	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TGTGAAACCAgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84526647	84526648	+	IGR	DEL	TC	-	-	rs144135500	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84526647_84526648delTC								None (None upstream) : RALYL (568805 downstream)																							tttctttctttctctctctttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	86078106	86078115	+	IGR	DEL	TCCTTCCTTC	-	-	rs57785527	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86078106_86078115delTCCTTCCTTC								LRRCC1 (19794 upstream) : E2F5 (11504 downstream)																							cttccttccttccttccttcctCTCTCTCT	0.086													4	2	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	105261141	105261144	+	Intron	DEL	TTCC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105261141_105261144delTTCC	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ctctctctctttccctctctctct	0.103										HNSCC(12;0.0054)			4	3	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317126	126317126	+	Intron	DEL	A	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317126delA	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			ccagactctgaaaaaaaaaaa	0.000													5	3	---	---	---	---	
B4GALT1	2683	broad.mit.edu	37	9	33157062	33157063	+	Intron	DEL	AC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33157062_33157063delAC	uc003zsg.2	-							NM_001497	NP_001488	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-						oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	basolateral plasma membrane|brush border membrane|desmosome|external side of plasma membrane|extracellular region|glycocalyx|Golgi cisterna membrane|Golgi trans cisterna|integral to membrane	alpha-tubulin binding|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|beta-tubulin binding|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity|protein binding|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	ATAGggaactacacacacacac	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44084401	44084402	+	IGR	INS	-	ATCTT	ATCTT			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44084401_44084402insATCTT								FAM75A6 (453671 upstream) : FAM27C (905834 downstream)																							TAAAGACTATATATAAAAATAA	0.277													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430364	68430365	+	IGR	INS	-	A	A	rs140332329		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430364_68430365insA								FAM27B (636175 upstream) : MIR1299 (571874 downstream)																							TTATGCAGAAGAAAAAATTAAC	0.322													5	3	---	---	---	---	
RABGAP1	23637	broad.mit.edu	37	9	125860144	125860144	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125860144delT	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzj.1_Intron	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						CTCTCCCACATTCCTCTGTCT	0.463													39	20	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127360948	127360949	+	Intron	DEL	AC	-	-	rs71372977		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127360948_127360949delAC	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						aaaaaaaaaaacaaggaaggga	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9034645	9034650	+	IGR	DEL	TGTGTG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9034645_9034650delTGTGTG								GATA3 (917483 upstream) : None (None downstream)																							AATAAAACTCtgtgtgtgtgtgtgtg	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71193238	71193239	+	IGR	INS	-	AC	AC	rs139709581	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71193238_71193239insAC								TACR2 (16564 upstream) : TSPAN15 (17987 downstream)																							TATCTATATCTACACACACACA	0.262													2	4	---	---	---	---	
COL17A1	1308	broad.mit.edu	37	10	105800349	105800360	+	Intron	DEL	TGGATGGATAGG	-	-	rs71993640		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105800349_105800360delTGGATGGATAGG	uc001kxr.2	-							NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		gatggatggatggatggataggtggatggatg	0.080													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206096	134206098	+	IGR	DEL	TGG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206096_134206098delTGG								LRRC27 (11086 upstream) : PWWP2B (4604 downstream)																							atgatggtgatggtggtgatgat	0.000													4	2	---	---	---	---	
E2F8	79733	broad.mit.edu	37	11	19246016	19246017	+	3'UTR	INS	-	TG	TG	rs141034351	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19246016_19246017insTG	uc001mpm.2	-	13					E2F8_uc009yhv.2_RNA|E2F8_uc001mpn.3_3'UTR	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ATACAAATATAtgtgtgtgtgt	0.203													6	5	---	---	---	---	
RPS6KA4	8986	broad.mit.edu	37	11	64138574	64138583	+	Intron	DEL	AAAAAAAAAA	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64138574_64138583delAAAAAAAAAA	uc001oae.2	+						RPS6KA4_uc001oad.2_Intron|RPS6KA4_uc010rnl.1_Intron|RPS6KA4_uc001oaf.2_Intron|RPS6KA4_uc009ypp.2_Intron	NM_003942	NP_003933	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|histone phosphorylation|interleukin-1-mediated signaling pathway|intracellular protein kinase cascade|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|magnesium ion binding|mitogen-activated protein kinase p38 binding|ribosomal protein S6 kinase activity			lung(3)|ovary(1)|breast(1)	5						agactccgtcaaaaaaaaaaaaaaaaaaaa	0.267													9	4	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70445967	70445970	+	Intron	DEL	AAAA	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70445967_70445970delAAAA	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			agaaagaaataaaaagaaagaaag	0.000													4	4	---	---	---	---	
RDX	5962	broad.mit.edu	37	11	110108395	110108396	+	Intron	INS	-	C	C			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110108395_110108396insC	uc001pku.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc001pks.2_5'Flank|RDX_uc001pkt.2_Frame_Shift_Ins_p.E12fs|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		ATATGTGTATTCCCCCCAACAG	0.347													285	126	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134086631	134086631	+	Intron	DEL	A	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134086631delA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ACTTCGGATGAAAAAAAAAAG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76082490	76082491	+	IGR	INS	-	T	T	rs141632958		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76082490_76082491insT								KRR1 (177072 upstream) : PHLDA1 (336737 downstream)																							cattctTTTTCTTTTTTTTTTT	0.218													9	4	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76462515	76462516	+	Intron	INS	-	ACAC	ACAC	rs35120003		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76462515_76462516insACAC	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				ACCCGCCCCTTacacacacaca	0.342													9	6	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77243103	77243104	+	Intron	INS	-	AAA	AAA	rs34062414		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77243103_77243104insAAA	uc001syk.1	+							NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						ggtcctgtctcaaaaaaaaaaa	0.119													5	4	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													4	3	---	---	---	---	
LOC100128554	100128554	broad.mit.edu	37	12	126944158	126944161	+	Intron	DEL	AAGG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126944158_126944161delAAGG	uc010tbf.1	+						LOC100128554_uc009zyj.1_Intron|LOC100128554_uc010tbg.1_Intron|LOC100128554_uc001uhj.2_Intron					Homo sapiens hypothetical protein LOC144678, mRNA (cDNA clone IMAGE:4837867).												0						ggaaggaagaaaggaaggaaggaa	0.069													12	8	---	---	---	---	
C1QTNF9	338872	broad.mit.edu	37	13	24889990	24889990	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24889990delT	uc001upj.2	+						C1QTNF9_uc001upe.2_Intron	NM_178540	NP_848635	P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen	hormone activity				0		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GAGCCTTCTGTCCAAGTTTGT	0.537													5	3	---	---	---	---	
DHRS12	79758	broad.mit.edu	37	13	52343499	52343500	+	Intron	INS	-	A	A	rs11374211		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52343499_52343500insA	uc001vfq.2	-						DHRS12_uc001vfr.1_Intron			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;								binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCCCttaatttaaaaaaaaaaa	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59156751	59156752	+	IGR	DEL	CT	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59156751_59156752delCT								PCDH17 (853686 upstream) : None (None downstream)																							ctctccctccctCTCTCTCTCT	0.178													5	4	---	---	---	---	
PCDH9	5101	broad.mit.edu	37	13	67518950	67518951	+	Intron	DEL	TG	-	-	rs141473039		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67518950_67518951delTG	uc001vik.2	-						PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		taatcGTCTCtgtgtgtgtgtg	0.119													4	2	---	---	---	---	
F7	2155	broad.mit.edu	37	13	113771240	113771240	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113771240delT	uc001vsv.2	+						F7_uc010agp.1_Frame_Shift_Del_p.P237fs|F7_uc001vsw.2_Intron|F7_uc010tjt.1_Intron	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor						anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	TCTTGAAGCCTTTTGAATGTG	0.592													38	18	---	---	---	---	
PRKD1	5587	broad.mit.edu	37	14	30091618	30091618	+	Intron	DEL	T	-	-	rs71437917		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30091618delT	uc001wqh.2	-							NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1						cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		Gtttttattattttttttttt	0.080													5	6	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89151224	89151224	+	Intron	DEL	T	-	-	rs66754813		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89151224delT	uc001xxg.2	-						EML5_uc001xxh.1_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						ATACATTAAATTTTTTTTCTG	0.189													9	5	---	---	---	---	
GOLGA5	9950	broad.mit.edu	37	14	93303941	93303942	+	Intron	DEL	CT	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93303941_93303942delCT	uc001yaz.1	+						GOLGA5_uc001yba.1_Intron	NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5						Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		cagggtctggctcttttgctga	0.054			T	RET	papillary thyroid								11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23114369	23114370	+	Intron	INS	-	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23114369_23114370insA	uc001yvf.2	-											Homo sapiens cDNA clone IMAGE:5275816.																		GTTTAATGCAGAAAAAAAACAA	0.218													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26714312	26714328	+	IGR	DEL	AAGGAAGGAAAGAAGGA	-	-	rs146213792	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26714312_26714328delAAGGAAGGAAAGAAGGA								ATP10A (603995 upstream) : GABRB3 (74367 downstream)																							ggaaggaaggaaggaaggaaagaaggaaaggaaggaa	0.000													2	5	---	---	---	---	
SPINT1	6692	broad.mit.edu	37	15	41145072	41145073	+	Intron	INS	-	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145072_41145073insA	uc001zna.2	+						SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Intron	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1							extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ccatctctaataaaaaaaaaaa	0.139													9	4	---	---	---	---	
CASC4	113201	broad.mit.edu	37	15	44672864	44672864	+	Intron	DEL	A	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44672864delA	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		ATAAACCTTTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600733	600734	+	Intron	INS	-	T	T	rs145905062	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600733_600734insT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TGAGGGTCCCCGTCGGTGAGGG	0.738													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7239555	7239556	+	Intron	INS	-	AC	AC	rs77551263		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7239555_7239556insAC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TGTCCCCCAAAacacacacaca	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25300771	25300774	+	IGR	DEL	TTCT	-	-	rs8044599		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25300771_25300774delTTCT								ZKSCAN2 (31916 upstream) : HS3ST4 (402573 downstream)																							ccttccttccttctttccttcctt	0.113													4	3	---	---	---	---	
TEPP	374739	broad.mit.edu	37	16	58011490	58011491	+	Intron	DEL	TA	-	-	rs66913328		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58011490_58011491delTA	uc002emw.3	+						TEPP_uc002emv.3_Intron	NM_199456	NP_955535	Q6URK8	TEPP_HUMAN	testis/prostate/placenta-expressed protein							extracellular region				kidney(1)|central_nervous_system(1)|skin(1)	3						tgtgtgtgtgtatgtgtgtgtT	0.277													5	3	---	---	---	---	
NCRNA00188	125144	broad.mit.edu	37	17	16344166	16344167	+	Intron	INS	-	A	A	rs79350206		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16344166_16344167insA	uc002gqc.2	+						NCRNA00188_uc010vwf.1_Intron|NCRNA00188_uc010vwg.1_Intron|NCRNA00188_uc010vwh.1_Intron|NCRNA00188_uc010cpd.2_Intron|NCRNA00188_uc002gqb.3_Intron|NCRNA00188_uc010vwi.1_Intron|NCRNA00188_uc010vwj.1_Intron|NCRNA00188_uc002gqa.3_Intron|NCRNA00188_uc010vwk.1_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|SNORD65_uc002gqf.1_5'Flank	NR_027667				RecName: Full=Putative uncharacterized protein C17orf45, mitochondrial; Flags: Precursor;												0						gactccatctcaaaaaaaaaaa	0.114													3	8	---	---	---	---	
CCDC144B	284047	broad.mit.edu	37	17	18498497	18498498	+	Intron	INS	-	A	A	rs71844421		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18498497_18498498insA	uc002gub.1	-						CCDC144B_uc002gua.3_Intron|CCDC144B_uc010vyc.1_Intron	NM_182568	NP_872374			coiled-coil domain containing 144B											ovary(1)|skin(1)	2						CTGCAGGCCTGAAAAAAAAAAA	0.243													7	7	---	---	---	---	
CCDC55	84081	broad.mit.edu	37	17	28505003	28505003	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28505003delT	uc002heu.2	+						CCDC55_uc002hev.2_Intron|CCDC55_uc010wbl.1_Intron|CCDC55_uc010wbm.1_Intron|CCDC55_uc002hex.2_Intron	NM_032141	NP_115517	Q9H0G5	NSRP1_HUMAN	coiled-coil domain containing 55 isoform 1						developmental process|nucleocytoplasmic transport|regulation of alternative nuclear mRNA splicing, via spliceosome	nuclear speck|ribonucleoprotein complex	mRNA binding|protein binding				0						ATATTTTCAATTTATGAACCA	0.189													34	23	---	---	---	---	
SKAP1	8631	broad.mit.edu	37	17	46267040	46267040	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46267040delT	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						ttgctttttcttttttttttt	0.124													4	2	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49350959	49350960	+	Intron	INS	-	T	T	rs71355748		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49350959_49350960insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTATGTTATTGTTTTTTTTTTT	0.238													4	4	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79419160	79419185	+	Intron	DEL	GGGAGGGTCGCAGCACCCCCACCCCC	-	-	rs67000403		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79419160_79419185delGGGAGGGTCGCAGCACCCCCACCCCC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GGGGGGGCCTGGGAGGGTCGCAGCACCCCCACCCCCGGGAGGCGCC	0.726													9	4	---	---	---	---	
SMCHD1	23347	broad.mit.edu	37	18	2751166	2751167	+	Intron	INS	-	AT	AT	rs148373283	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2751166_2751167insAT	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0						ATTTAAATAACGTGTGCTTTAA	0.267													2	4	---	---	---	---	
PIAS2	9063	broad.mit.edu	37	18	44426447	44426447	+	Intron	DEL	T	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44426447delT	uc002lck.2	-						PIAS2_uc010dnp.2_Intron|PIAS2_uc002lcl.2_Intron|PIAS2_uc010xda.1_Intron|PIAS2_uc002lcm.2_Intron|PIAS2_uc002lcn.1_Intron	NM_004671	NP_004662	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT X isoform						androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						AATATGCATATTTCCTTTCCA	0.279													4	6	---	---	---	---	
TCF4	6925	broad.mit.edu	37	18	53029570	53029571	+	Intron	INS	-	AGGA	AGGA	rs140159677		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53029570_53029571insAGGA	uc002lfz.2	-						TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		aaaaaaaAAAGaggaaggaagg	0.005													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63352574	63352575	+	IGR	DEL	GA	-	-	rs13313621	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63352574_63352575delGA								None (None upstream) : CDH7 (64913 downstream)																							ggaaggaagggagagagagaga	0.134													4	2	---	---	---	---	
DOT1L	84444	broad.mit.edu	37	19	2206521	2206523	+	Intron	DEL	AAA	-	-	rs150155214		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2206521_2206523delAAA	uc002lvb.3	+							NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase							nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgtctcaaaaaaaaaaaaa	0.197													4	2	---	---	---	---	
LPPR2	64748	broad.mit.edu	37	19	11468706	11468707	+	Intron	DEL	TG	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11468706_11468707delTG	uc002mre.1	+						LPPR2_uc002mrf.1_Intron|LPPR2_uc010dxy.1_5'Flank	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type							integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1						ggctgttctctgtgtgtgtgtg	0.000													3	3	---	---	---	---	
USHBP1	83878	broad.mit.edu	37	19	17362169	17362171	+	Intron	DEL	CAC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17362169_17362171delCAC	uc002nfs.1	-						USHBP1_uc002nfr.1_Intron|USHBP1_uc002nft.1_Intron|USHBP1_uc010xpk.1_Intron	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1								PDZ domain binding			ovary(1)	1						gatggggtttcaccacgttggcc	0.000													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29642665	29642672	+	IGR	DEL	AAAAGAAA	-	-	rs79645581		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29642665_29642672delAAAAGAAA								LOC148145 (182610 upstream) : UQCRFS1 (55495 downstream)																							agaaagaaagaaaagaaagaaagaaagg	0.010													3	3	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938473	41938474	+	Intron	INS	-	GTGT	GTGT	rs149102482	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938473_41938474insGTGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						ACAgtgtgtgcgtgtgtgtgtg	0.416													5	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074331	62074333	+	Intron	DEL	CAC	-	-			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074331_62074333delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccaccatcaccaccattacc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28797454	28797455	+	Intron	INS	-	C	C	rs148233703	by1000genomes	TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28797454_28797455insC	uc002ymh.2	-											Homo sapiens, clone IMAGE:5227164, mRNA.																		cttccttccttctttcttcctt	0.089													9	6	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36723503	36723504	+	Splice_Site	INS	-	A	A			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36723503_36723504insA	uc003apg.2	-	4	749	c.518_splice	c.e4+1	p.T173_splice	MYH9_uc003aph.1_Splice_Site_p.T37_splice|MYH9_uc003api.1_Splice_Site_p.T173_splice	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAGAAATACTTACGTGCACAAG	0.495			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				52	27	---	---	---	---	
NR0B1	190	broad.mit.edu	37	X	30328902	30328903	+	5'Flank	INS	-	T	T			TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30328902_30328903insT	uc004dcf.3	-							NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	tccttccttccttccttccttc	0.144													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	89458543	89458544	+	IGR	INS	-	TTCC	TTCC	rs72206424		TCGA-A3-3367-01A-02D-1421-08	TCGA-A3-3367-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89458543_89458544insTTCC								TGIF2LX (280663 upstream) : None (None downstream)																							tctttcttcctttccttccttc	0.094													5	4	---	---	---	---	
