Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CD101	9398	broad.mit.edu	37	1	117564261	117564261	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117564261T>C	uc010oxb.1	+	7	2142	c.2084T>C	c.(2083-2085)ATA>ACA	p.I695T	CD101_uc009whd.2_Missense_Mutation_p.I695T|CD101_uc010oxc.1_Missense_Mutation_p.I695T|CD101_uc010oxd.1_Missense_Mutation_p.I633T	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	695	Ig-like C2-type 6.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						AACACTGATATAGAATGTAGC	0.383													25	42	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612034	120612034	+	5'UTR	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612034T>G	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCGGTCGCCTCCTCCTccgc	0.622			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				2	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142714007	142714007	+	Intron	SNP	T	C	C	rs1694635	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142714007T>C	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		GATATCCAACTGGAGAAAAAG	0.289													5	25	---	---	---	---	PASS
C1orf156	92342	broad.mit.edu	37	1	169762230	169762230	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169762230T>G	uc001ggn.2	-	2	885	c.607A>C	c.(607-609)ATA>CTA	p.I203L	C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggo.2_5'Flank|uc010plt.1_5'Flank|C1orf112_uc001ggp.2_5'Flank|C1orf112_uc001ggq.2_5'Flank|C1orf112_uc009wvt.2_5'Flank	NM_033418	NP_219486	O95568	MET18_HUMAN	hypothetical protein MGC9084	203						cytoplasm	protein methyltransferase activity				0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AATGCAGTTATACCTAGTAAA	0.393													117	265	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212538685	212538685	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212538685G>T	uc001hjc.3	-	8	1093	c.925C>A	c.(925-927)CTT>ATT	p.L309I	TMEM206_uc010pte.1_Missense_Mutation_p.L370I	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206	309	Helical; (Potential).					integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CCACAGAGAAGAGCAATTGTG	0.353													57	161	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40342426	40342426	+	Silent	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40342426G>A	uc002rrx.2	-	10	2913	c.2889C>T	c.(2887-2889)TCC>TCT	p.S963S	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Silent_p.S958S|SLC8A1_uc002rrz.2_Silent_p.S950S|SLC8A1_uc002rsa.2_Silent_p.S927S|SLC8A1_uc002rsd.3_Silent_p.S927S	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	963	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGGCCTCCAGGGAGGAGAAGA	0.408													26	54	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63169917	63169917	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63169917G>A	uc002sby.2	+	12	1837	c.1355G>A	c.(1354-1356)TGG>TAG	p.W452*	EHBP1_uc010fcp.2_Nonsense_Mutation_p.W417*|EHBP1_uc002sbz.2_Nonsense_Mutation_p.W417*|EHBP1_uc002scb.2_Nonsense_Mutation_p.W417*	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	452	CH.					cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTGCTTGTATGGTGTAAAGAA	0.363									Hereditary_Prostate_Cancer				57	131	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96568655	96568655	+	Intron	SNP	A	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96568655A>T	uc002sva.1	-						uc002suz.1_5'UTR|uc002svb.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		TTTTCTCCATACTTTTTTCCT	0.279													5	22	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149227852	149227852	+	Silent	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149227852T>G	uc002twm.3	+	9	3328	c.2340T>G	c.(2338-2340)CTT>CTG	p.L780L	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Silent_p.L780L|MBD5_uc002twn.1_Silent_p.L221L	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	780						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ACCACCATCTTGCAGGTTTAA	0.473													69	193	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160294710	160294710	+	Intron	SNP	A	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160294710A>C	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uas.1_Intron|BAZ2B_uc002uau.1_3'UTR|BAZ2B_uc002uaq.1_Intron|BAZ2B_uc002uat.3_3'UTR	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						AGAAAGTATAAAAATGAAGGT	0.244													10	17	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166898839	166898839	+	Silent	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166898839T>C	uc010zcz.1	-	12	2124	c.2106A>G	c.(2104-2106)GCA>GCG	p.A702A	SCN1A_uc002udo.3_Silent_p.A582A|SCN1A_uc010fpk.2_Silent_p.A554A	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	713						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CTATACTCATTGCTCGTTGCC	0.363													44	173	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210561004	210561004	+	Silent	SNP	C	T	T	rs147926728		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210561004C>T	uc002vde.1	+	7	4358	c.4110C>T	c.(4108-4110)GAC>GAT	p.D1370D	MAP2_uc002vdc.1_Silent_p.D1370D|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.D1366D	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1370					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	AAACCTATGACGATTACAAAG	0.458													32	124	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183794	10183794	+	Nonsense_Mutation	SNP	G	A	A	rs119103277		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183794G>A	uc003bvc.2	+	1	476	c.263G>A	c.(262-264)TGG>TAG	p.W88*	VHL_uc003bvd.2_Nonsense_Mutation_p.W88*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	88			W -> R (in VHLD; type I).|W -> S (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.W88R(5)|p.W88*(4)|p.V87_W88del(2)|p.W88C(2)|p.W88fs*71(2)|p.W88S(2)|p.W88L(1)|p.V87_W88>G(1)|p.R60fs*35(1)|p.V84_E94>E(1)|p.W88fs*43(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CTGCCCGTATGGCTCAACTTC	0.726		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				10	6	---	---	---	---	PASS
CYP8B1	1582	broad.mit.edu	37	3	42917124	42917124	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42917124G>C	uc003cmh.2	-	1	510	c.185C>G	c.(184-186)ACC>AGC	p.T62S	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.T62S	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B,	62					bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCCATGCTTGGTCCTCATGCG	0.562													48	66	---	---	---	---	PASS
SLC25A20	788	broad.mit.edu	37	3	48900024	48900024	+	Silent	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48900024C>T	uc003cva.3	-	5	661	c.486G>A	c.(484-486)GAG>GAA	p.E162E	SLC25A20_uc011bbw.1_Silent_p.E112E|SLC25A20_uc010hkj.2_Silent_p.E89E	NM_000387	NP_000378	O43772	MCAT_HUMAN	carnitine/acylcarnitine translocase	162	Solcar 2.|Mitochondrial matrix (Potential).				carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)	GGATCCCAAACTCCTGGTACA	0.517													33	50	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52682446	52682446	+	Nonsense_Mutation	SNP	T	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52682446T>A	uc003des.2	-	7	739	c.727A>T	c.(727-729)AAA>TAA	p.K243*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.K243*|PBRM1_uc003der.2_Nonsense_Mutation_p.K243*|PBRM1_uc003det.2_Nonsense_Mutation_p.K243*|PBRM1_uc003deu.2_Nonsense_Mutation_p.K243*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.K243*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.K243*|PBRM1_uc003dey.2_Nonsense_Mutation_p.K243*|PBRM1_uc003dez.1_Nonsense_Mutation_p.K243*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.K141*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	243	Bromo 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGAATACTTTTGTAGCTTCCA	0.318			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								60	96	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56667576	56667576	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56667576C>A	uc003did.3	-	17	3161	c.3060G>T	c.(3058-3060)TTG>TTT	p.L1020F	C3orf63_uc003dib.3_Missense_Mutation_p.L139F|C3orf63_uc003dic.3_Missense_Mutation_p.L644F|C3orf63_uc003die.3_Missense_Mutation_p.L1081F	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	1081										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		GCTTCTCATGCAAACCATCTA	0.413													49	88	---	---	---	---	PASS
SLC15A2	6565	broad.mit.edu	37	3	121647359	121647359	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121647359A>C	uc003eep.2	+	15	1451	c.1298A>C	c.(1297-1299)AAT>ACT	p.N433T	SLC15A2_uc011bjn.1_Missense_Mutation_p.N402T	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	433					protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	GTGGTGGGAAATGAAAACAAT	0.438													62	182	---	---	---	---	PASS
TFDP2	7029	broad.mit.edu	37	3	141697381	141697381	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141697381T>G	uc003eun.3	-	7	879	c.500A>C	c.(499-501)AAC>ACC	p.N167T	TFDP2_uc003euk.3_Missense_Mutation_p.N80T|TFDP2_uc010hur.2_Missense_Mutation_p.N106T|TFDP2_uc003eul.3_Missense_Mutation_p.N106T|TFDP2_uc011bnf.1_Missense_Mutation_p.N70T|TFDP2_uc011bng.1_Missense_Mutation_p.N31T|TFDP2_uc003eum.3_Missense_Mutation_p.N106T	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	167	Potential.				cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						AGCCAAATGGTTATTTGAATT	0.368													67	146	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194149610	194149610	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194149610T>A	uc003fty.3	-	27	3313	c.2911A>T	c.(2911-2913)ATT>TTT	p.I971F		NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	971	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		GCCAGATCAATGAAGAGAAAC	0.294													24	75	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8224578	8224578	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8224578C>T	uc003gkv.3	+	10	1225	c.1124C>T	c.(1123-1125)GCG>GTG	p.A375V	SH3TC1_uc003gkw.3_Missense_Mutation_p.A299V|SH3TC1_uc003gkx.3_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	375							binding			large_intestine(2)|pancreas(1)	3						TTGGAAAGTGCGATTTTTCTC	0.433													17	80	---	---	---	---	PASS
UGT2B11	10720	broad.mit.edu	37	4	70066177	70066177	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70066177T>G	uc003heh.2	-	6	1580	c.1571A>C	c.(1570-1572)AAG>ACG	p.K524T	uc003hei.1_RNA	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,	524					estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						TTTTCCCTTCTTCCCTTTTCT	0.368													39	99	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143348592	143348592	+	Intron	SNP	A	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143348592A>C	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc003iiz.2_RNA	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					TTATGAATAAATTCTTGCAGC	0.244													4	30	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159750366	159750366	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159750366C>G	uc003iqe.3	+	3	553	c.370C>G	c.(370-372)CCA>GCA	p.P124A	FNIP2_uc003iqd.2_Missense_Mutation_p.P124A	NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	124					DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GGAACAGCTTCCAAAGTACCA	0.398													10	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	17354457	17354457	+	RNA	SNP	T	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17354457T>A	uc003jfy.2	-	1		c.272A>T			uc003jfz.2_RNA					full-length cDNA clone CS0DC022YF01 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																		GAGCTCCAGGTTGATCTGGCG	0.552													24	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	28927394	28927394	+	RNA	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28927394C>T	uc003jgz.1	+	1		c.418C>T								Homo sapiens similar to Striatin, mRNA (cDNA clone MGC:150339 IMAGE:40119616), complete cds.																		ACTCAGGCAGCGTCATGATAA	0.433													39	93	---	---	---	---	PASS
TARS	6897	broad.mit.edu	37	5	33467768	33467768	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33467768G>T	uc003jhy.2	+	19	2422	c.2127G>T	c.(2125-2127)CAG>CAT	p.Q709H	TARS_uc011cob.1_Missense_Mutation_p.Q697H|TARS_uc011coc.1_Missense_Mutation_p.Q730H|TARS_uc003jhz.2_Missense_Mutation_p.Q605H|TARS_uc011cod.1_Missense_Mutation_p.Q588H	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	709					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	AGCGGCTACAGCAGCTCAAAG	0.438													21	40	---	---	---	---	PASS
SLC38A9	153129	broad.mit.edu	37	5	54965131	54965131	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54965131T>G	uc003jqf.2	-	7	652	c.451A>C	c.(451-453)ATG>CTG	p.M151L	SLC38A9_uc003jqd.2_Missense_Mutation_p.M88L|SLC38A9_uc010ivx.2_Missense_Mutation_p.M124L|SLC38A9_uc003jqe.2_RNA|SLC38A9_uc010ivy.2_Missense_Mutation_p.M22L	NM_173514	NP_775785	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	151	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				ATGACACACATTCCAGTAGTA	0.323													86	207	---	---	---	---	PASS
ELOVL2	54898	broad.mit.edu	37	6	11005769	11005769	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11005769T>G	uc003mzp.3	-	3	252	c.91A>C	c.(91-93)ATG>CTG	p.M31L		NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	elongation of very long chain fatty acids-like	31				M -> T (in Ref. 1; BAA91096).	fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			GAGTCCAACATGAACCACCCT	0.413													21	40	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97702455	97702455	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97702455C>A	uc003ppb.2	-	10	1363	c.1097G>T	c.(1096-1098)CGC>CTC	p.R366L	C6orf167_uc011eaf.1_Missense_Mutation_p.R366L|C6orf167_uc010kcn.1_Missense_Mutation_p.R140L|C6orf167_uc010kco.1_Missense_Mutation_p.R102L|C6orf167_uc003ppc.2_Missense_Mutation_p.R366L	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	366					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TACTCCATGGCGATCAAACTT	0.328													26	73	---	---	---	---	PASS
CTGF	1490	broad.mit.edu	37	6	132270523	132270523	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132270523C>T	uc003qcz.2	-	5	1137	c.931G>A	c.(931-933)GAG>AAG	p.E311K		NM_001901	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor precursor	311	CTCK.|Heparin-binding.				cellular lipid metabolic process|DNA replication|epidermis development|regulation of cell growth|response to wounding	plasma membrane|proteinaceous extracellular matrix	heparin binding|insulin-like growth factor binding				0	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		TTCATGACCTCGCCGTCAGGG	0.522													48	184	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144806603	144806603	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144806603A>G	uc003qkt.2	+	27	3862	c.3770A>G	c.(3769-3771)AAG>AGG	p.K1257R		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1257	Spectrin 9.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAGCGGATGAAGAGCACAGAG	0.478													68	210	---	---	---	---	PASS
POM121C	100101267	broad.mit.edu	37	7	75066894	75066894	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75066894A>G	uc010lde.1	-	5	1105	c.1105T>C	c.(1105-1107)TCT>CCT	p.S369P	POM121C_uc003udk.3_Missense_Mutation_p.S127P			A8CG34	P121C_HUMAN	Homo sapiens POM121-2 mRNA for nuclear pore membrane protein 121-2, partial cds.	369	Required for targeting to the nucleus and nuclear pore complex.|Pore side (Potential).|Ser-rich.				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						CTCATGGAAGAGCTTCGGGAT	0.498													84	213	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8749927	8749927	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8749927G>C	uc003wsj.1	-	1	1205	c.642C>G	c.(640-642)AAC>AAG	p.N214K		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	214	LRR 7.										0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCCGCAGCCGGTTGCTGGACA	0.692													7	9	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32630069	32630069	+	3'UTR	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32630069G>A	uc003zrg.1	-	1						NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like						male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCTCCCCACCGTCTCCCTCAT	0.498													12	35	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385532	33385532	+	Intron	SNP	T	C	C	rs115950431	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385532T>C	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTCCCCAGGCTACCTGGGGGC	0.592													5	25	---	---	---	---	PASS
NTRK2	4915	broad.mit.edu	37	9	87285540	87285540	+	5'UTR	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87285540G>A	uc004aoa.1	+	4					NTRK2_uc004anv.1_5'UTR|NTRK2_uc004any.1_5'UTR|NTRK2_uc004anz.1_5'UTR|NTRK2_uc011lsz.1_5'UTR|NTRK2_uc011lta.1_5'UTR|NTRK2_uc004aob.1_5'UTR|NTRK2_uc011ltb.1_5'Flank	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						GACTCGGCACGCCCGCAACAA	0.667										TSP Lung(25;0.17)			7	22	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119460981	119460981	+	Silent	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119460981T>C	uc004bjx.2	+	2	1118	c.960T>C	c.(958-960)GTT>GTC	p.V320V	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Silent_p.V320V	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	320					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						CTACCTCTGTTACTTTTAGAG	0.572									Bardet-Biedl_syndrome				22	62	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120476405	120476405	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120476405T>A	uc004bjz.2	+	3	2290	c.1999T>A	c.(1999-2001)TAT>AAT	p.Y667N	TLR4_uc004bka.2_Missense_Mutation_p.Y627N|TLR4_uc004bkb.2_Missense_Mutation_p.Y467N	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	667	Cytoplasmic (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CTGCATAAAGTATGGTAGAGG	0.423													45	104	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136642527	136642527	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136642527C>T	uc004ces.2	-	23	1995	c.1949G>A	c.(1948-1950)TGC>TAC	p.C650Y	VAV2_uc004cer.2_Missense_Mutation_p.C640Y|VAV2_uc004cet.1_Missense_Mutation_p.C189Y	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	650	SH3 1.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ATCCACAGGGCAGGGCTTCAC	0.582													53	127	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801706	120801706	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801706G>A	uc001ldu.2	-	19	3472	c.3326C>T	c.(3325-3327)CCC>CTC	p.P1109L	EIF3A_uc010qsu.1_Missense_Mutation_p.P1075L|EIF3A_uc009xzg.1_Missense_Mutation_p.P148L	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1109	Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].|19.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCCTCGCCTGGGACCCCGGTC	0.627													71	175	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801712	120801712	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801712C>T	uc001ldu.2	-	19	3466	c.3320G>A	c.(3319-3321)CGG>CAG	p.R1107Q	EIF3A_uc010qsu.1_Missense_Mutation_p.R1073Q|EIF3A_uc009xzg.1_Missense_Mutation_p.R146Q	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1107	Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].|19.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CCTGGGACCCCGGTCATCATC	0.627													77	175	---	---	---	---	PASS
RNF141	50862	broad.mit.edu	37	11	10536408	10536408	+	3'UTR	SNP	C	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10536408C>A	uc001mis.1	-	6					RNF141_uc009yga.1_RNA	NM_016422	NP_057506	Q8WVD5	RN141_HUMAN	ring finger protein 141								zinc ion binding				0				all cancers(16;4.63e-08)|Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.064)		TACATTCTTCCCCCATGACCA	0.438													13	45	---	---	---	---	PASS
SYT7	9066	broad.mit.edu	37	11	61323583	61323583	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61323583C>G	uc001nrv.2	-	2	134	c.128G>C	c.(127-129)CGC>CCC	p.R43P	SYT7_uc009ynr.2_Missense_Mutation_p.R43P|SYT7_uc001nrx.1_RNA	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	43	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						CACCAGTTTGCGCTGACACCA	0.642													5	17	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9571406	9571406	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9571406C>T	uc010sgs.1	-	26	2851	c.2656G>A	c.(2656-2658)GCT>ACT	p.A886T	DDX12_uc001qvx.3_Missense_Mutation_p.A108T|DDX12_uc001qvy.1_3'UTR	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CCAAAGGTAGCTTTGACCTCC	0.592													29	75	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14578241	14578241	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14578241T>G	uc001rbw.2	+	2	1550	c.1392T>G	c.(1390-1392)AAT>AAG	p.N464K	ATF7IP_uc010shs.1_Missense_Mutation_p.N464K|ATF7IP_uc001rbu.2_Missense_Mutation_p.N464K|ATF7IP_uc001rbv.1_Missense_Mutation_p.N464K|ATF7IP_uc001rbx.2_Missense_Mutation_p.N464K|ATF7IP_uc010sht.1_Missense_Mutation_p.N464K|ATF7IP_uc001rby.3_Missense_Mutation_p.N464K|ATF7IP_uc001rbz.1_Missense_Mutation_p.N464K|ATF7IP_uc001rca.2_Missense_Mutation_p.N464K|ATF7IP_uc001rcb.2_Missense_Mutation_p.N75K	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	464	Glu-rich.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						ATGAGACAAATCCAGATTTGG	0.383													51	94	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46328263	46328263	+	Silent	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46328263T>C	uc001rox.2	-	7	776	c.489A>G	c.(487-489)GGA>GGG	p.G163G	SFRS2IP_uc001roy.1_Silent_p.G237G	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	163					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTTTCTTTCCTCCTGTTTCAC	0.299													37	106	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64536075	64536075	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64536075G>C	uc010ssp.1	+	22	2937	c.2881G>C	c.(2881-2883)GAT>CAT	p.D961H	SRGAP1_uc001srv.2_Missense_Mutation_p.D898H	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	961	Potential.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TCTTCAATAGGATATTGAAGA	0.423													48	122	---	---	---	---	PASS
EEA1	8411	broad.mit.edu	37	12	93210026	93210026	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93210026T>G	uc001tck.2	-	15	2144	c.1879A>C	c.(1879-1881)AAT>CAT	p.N627H		NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD	627	Gln/Glu/Lys-rich.|Potential.				early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						AATTGACTATTTAATTCATTG	0.398													74	155	---	---	---	---	PASS
TPTE2P1	646405	broad.mit.edu	37	13	25507452	25507452	+	3'UTR	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25507452G>A	uc010tdh.1	-	5					TPTE2P1_uc001upw.2_RNA|TPTE2P1_uc001upx.3_RNA	NR_026730				RecName: Full=C2 tensin-type domain-containing protein ENSP00000371290;												0						GGCAGAGGAGGACCAGCCCTG	0.527													4	4	---	---	---	---	PASS
SLC46A3	283537	broad.mit.edu	37	13	29287320	29287320	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29287320G>A	uc001usi.2	-	2	1527	c.557C>T	c.(556-558)TCA>TTA	p.S186L	SLC46A3_uc001usg.2_Missense_Mutation_p.S111L|SLC46A3_uc001usj.2_Missense_Mutation_p.S186L|SLC46A3_uc001ush.2_Missense_Mutation_p.S186L|SLC46A3_uc001usk.2_Missense_Mutation_p.S111L	NM_181785	NP_861450	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3 isoform a	186	Helical; (Potential).				transmembrane transport	integral to membrane				central_nervous_system(1)|skin(1)	2		Lung SC(185;0.0367)		all cancers(112;0.159)		ATAGCCAGATGACAGTCCTGT	0.338													19	81	---	---	---	---	PASS
C14orf126	112487	broad.mit.edu	37	14	31917639	31917639	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31917639T>A	uc001wrj.2	-	3	284	c.203A>T	c.(202-204)AAA>ATA	p.K68I	HEATR5A_uc010tpk.1_Intron|uc001wri.2_Intron	NM_080664	NP_542395	Q96FN9	DTD2_HUMAN	hypothetical protein LOC112487	68					D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds				0	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0113)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00888)		CTCACTTAATTTCACATTTAA	0.353													58	135	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59835514	59835514	+	Silent	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59835514A>G	uc001xdz.1	+	26	3299	c.3174A>G	c.(3172-3174)AAA>AAG	p.K1058K	DAAM1_uc001xea.1_Silent_p.K1048K|DAAM1_uc001xec.1_RNA	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	1058	DAD.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GGAATCGCAAACGTATTACCA	0.373													25	79	---	---	---	---	PASS
KIF26A	26153	broad.mit.edu	37	14	104643367	104643367	+	Silent	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104643367G>A	uc001yos.3	+	12	4242	c.4242G>A	c.(4240-4242)AGG>AGA	p.R1414R		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1414					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CTGTCCCCAGGGCCACGTCCA	0.692													5	10	---	---	---	---	PASS
KIAA0125	9834	broad.mit.edu	37	14	106357576	106357576	+	Intron	SNP	C	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106357576C>G	uc001ysq.2	+						ADAM6_uc010tyt.1_RNA|KIAA0125_uc001ysr.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						ACTGCTATACCCCACTGTGAT	0.567													7	35	---	---	---	---	PASS
AQP9	366	broad.mit.edu	37	15	58471498	58471498	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58471498C>T	uc002aez.2	+	5	1024	c.667C>T	c.(667-669)CCC>TCC	p.P223S	ALDH1A2_uc010ugw.1_Intron|AQP9_uc010ugx.1_Missense_Mutation_p.P158S	NM_020980	NP_066190	O43315	AQP9_HUMAN	aquaporin 9	223	Extracellular (Potential).				cellular response to cAMP|excretion|immune response|metabolic process|response to mercury ion|response to osmotic stress|water homeostasis	integral to plasma membrane|intracellular membrane-bounded organelle	amine transmembrane transporter activity|carboxylic acid transmembrane transporter activity|glycerol channel activity|porin activity|purine base transmembrane transporter activity|pyrimidine base transmembrane transporter activity|water channel activity			ovary(1)	1				GBM - Glioblastoma multiforme(80;0.16)		AGACCTGAGTCCCAGACTTTT	0.552													14	41	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1793404	1793404	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1793404G>A	uc002cmk.2	+	5	791	c.671G>A	c.(670-672)GGC>GAC	p.G224D	MAPK8IP3_uc002cmi.1_Missense_Mutation_p.G224D|MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Missense_Mutation_p.G224D|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.G225D	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	224					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CAGATCGGGGGCAAGCTCGTG	0.652													24	73	---	---	---	---	PASS
TUFM	7284	broad.mit.edu	37	16	28857318	28857318	+	Silent	SNP	G	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28857318G>A	uc002drh.2	-	2	301	c.162C>T	c.(160-162)TAC>TAT	p.Y54Y	uc010vct.1_Intron|SH2B1_uc002dri.2_5'Flank	NM_003321	NP_003312	P49411	EFTU_HUMAN	Tu translation elongation factor, mitochondrial	51						mitochondrial nucleoid	GTP binding|GTPase activity|protein binding|translation elongation factor activity			ovary(1)	1						TGTCGCGCACGTAAGTCTTCT	0.632													10	49	---	---	---	---	PASS
COX6A2	1339	broad.mit.edu	37	16	31439650	31439650	+	5'UTR	SNP	G	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31439650G>T	uc002ebx.1	-	1						NM_005205	NP_005196	Q02221	CX6A2_HUMAN	cytochrome c oxidase subunit VIa polypeptide 2						generation of precursor metabolites and energy	mitochondrial respiratory chain complex IV	cytochrome-c oxidase activity				0						AAGCCATGATGGTGCGGGGAG	0.677													5	13	---	---	---	---	PASS
CIRH1A	84916	broad.mit.edu	37	16	69200939	69200939	+	Intron	SNP	A	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69200939A>T	uc002ews.3	+						CIRH1A_uc002ewr.2_3'UTR|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GAAGCCCAATAAAAGTAACCA	0.373													35	77	---	---	---	---	PASS
EIF5A	1984	broad.mit.edu	37	17	7214802	7214802	+	Splice_Site	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7214802T>C	uc010vtv.1	+	4	639	c.402_splice	c.e4+2	p.L134_splice	EIF5A_uc002gfr.2_Splice_Site_p.L164_splice|EIF5A_uc002gft.2_Splice_Site_p.L134_splice|EIF5A_uc002gfu.2_Splice_Site_p.L134_splice	NM_001970	NP_001961	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A						induction of apoptosis|mRNA export from nucleus|peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein export from nucleus|translational frameshifting|transmembrane transport	annulate lamellae|cytosol|endoplasmic reticulum membrane|nuclear pore	protein N-terminus binding|ribosome binding|translation elongation factor activity|U6 snRNA binding				0						GAGATCCTGGTATGGTGCCTC	0.547													54	140	---	---	---	---	PASS
CHAF1A	10036	broad.mit.edu	37	19	4408962	4408962	+	Missense_Mutation	SNP	G	T	T	rs61729782		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4408962G>T	uc002mal.2	+	3	266	c.166G>T	c.(166-168)GAT>TAT	p.D56Y		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	56	Binds to CBX1 chromo shadow domain.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGTCAGACGATCAGGGTAC	0.473								Chromatin_Structure					83	266	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6190476	6190476	+	Intron	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6190476A>G	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron|uc002mej.1_RNA	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						CTGAAAGTCAATGGCACAGCC	0.483													8	13	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35551239	35551239	+	Intron	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35551239C>T	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Missense_Mutation_p.P32L|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CCTGCTGACCCTTGTCCCACA	0.697													17	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	35862414	35862414	+	Silent	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35862414C>T	uc002nze.2	+	1	158	c.153C>T	c.(151-153)GAC>GAT	p.D51D		NM_005304	NP_005295			free fatty acid receptor 3																		TGGCCGTGGACGTGCTCCTGC	0.662													34	191	---	---	---	---	PASS
NAPSB	256236	broad.mit.edu	37	19	50838347	50838347	+	5'UTR	SNP	C	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50838347C>T	uc002prw.2	-	6					NR1H2_uc002prv.3_Intron	NR_002798				Homo sapiens napsin B pseudogene, mRNA sequence.											central_nervous_system(1)	1						TAGGCGGGGACTGTGACTGGC	0.637													14	43	---	---	---	---	PASS
JOSD2	126119	broad.mit.edu	37	19	51010902	51010902	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51010902G>T	uc002psn.1	-	3	232	c.201C>A	c.(199-201)AAC>AAA	p.N67K	JOSD2_uc002pso.1_Missense_Mutation_p.N67K|JOSD2_uc002psp.1_Missense_Mutation_p.N67K|JOSD2_uc002psq.1_Intron	NM_138334	NP_612207	Q8TAC2	JOS2_HUMAN	Josephin domain containing 2	67	Josephin.				protein deubiquitination		ubiquitin-specific protease activity				0		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0364)		TGACATCATAGTTGCCGGTGC	0.657													54	124	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54625914	54625914	+	Silent	SNP	A	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54625914A>C	uc002qdh.2	+	5	757	c.361A>C	c.(361-363)AGA>CGA	p.R121R	PRPF31_uc010yek.1_Silent_p.R121R	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	121					assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GTACTCAAAGAGATTCCCTGA	0.473													103	275	---	---	---	---	PASS
SIRPD	128646	broad.mit.edu	37	20	1532510	1532510	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1532510A>G	uc002wfi.2	-	2	292	c.248T>C	c.(247-249)TTT>TCT	p.F83S		NM_178460	NP_848555	Q9H106	SIRPD_HUMAN	signal-regulatory protein delta precursor	83	Ig-like V-type.					extracellular region				ovary(1)|kidney(1)|skin(1)	3						TACTCTGGGAAAGTTACCTTG	0.463													31	110	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34242653	34242653	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34242653A>G	uc002xdq.2	-	3	824	c.592T>C	c.(592-594)TCT>CCT	p.S198P	CPNE1_uc010zvj.1_5'Flank|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Missense_Mutation_p.S198P|RBM12_uc002xds.2_Missense_Mutation_p.S198P	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	198	Pro-rich.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGTGGCAGAGATGGCATCGCT	0.557													16	54	---	---	---	---	PASS
R3HDML	140902	broad.mit.edu	37	20	42965937	42965937	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42965937T>C	uc002xls.1	+	1	312	c.140T>C	c.(139-141)CTG>CCG	p.L47P		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	47						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CTGAGTGGCCTGGAGGTGCCC	0.607													23	60	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46256718	46256718	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46256718A>T	uc002xtk.2	+	8	979	c.774A>T	c.(772-774)AGA>AGT	p.R258S	NCOA3_uc010ght.1_Missense_Mutation_p.R258S|NCOA3_uc002xtl.2_Missense_Mutation_p.R258S|NCOA3_uc002xtm.2_Missense_Mutation_p.R258S|NCOA3_uc002xtn.2_Missense_Mutation_p.R258S|NCOA3_uc010zyc.1_Missense_Mutation_p.R60S	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	258					androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						CAGGAGAAAGAACATTTCCAT	0.358													56	181	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32862975	32862975	+	Silent	SNP	T	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32862975T>C	uc004dda.1	-	4	433	c.189A>G	c.(187-189)CCA>CCG	p.P63P	DMD_uc004dcz.2_5'UTR|DMD_uc004dcy.1_Silent_p.P59P|DMD_uc004ddb.1_Silent_p.P55P|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Silent_p.P55P|DMD_uc010ngq.1_RNA|DMD_uc010ngr.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	63	CH 1.|Actin-binding.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTTTTCTTTTGGCTGAGAAC	0.388													40	94	---	---	---	---	PASS
DIAPH2	1730	broad.mit.edu	37	X	96369939	96369939	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96369939G>C	uc004efu.3	+	21	2960	c.2564G>C	c.(2563-2565)GGA>GCA	p.G855A	DIAPH2_uc004eft.3_Missense_Mutation_p.G855A	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	855	FH2.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						CAGTCTTTGGGATTTAAGATC	0.333													31	143	---	---	---	---	PASS
TP73	7161	broad.mit.edu	37	1	3607454	3607454	+	Intron	DEL	C	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3607454delC	uc001akp.2	+						TP73_uc001akq.2_Intron|TP73_uc010nzj.1_5'UTR|TP73_uc001akr.2_5'UTR|TP73_uc009vlk.1_5'UTR|TP73_uc001aks.2_5'UTR	NM_005427	NP_005418	O15350	P73_HUMAN	tumor protein p73 isoform a						cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mismatch repair|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of JUN kinase activity|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|protein tetramerization|response to gamma radiation|response to X-ray	chromatin|cytosol|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|metal ion binding|p53 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|transcription repressor activity			ovary(1)|lung(1)	2	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CGTGTGCAGACCCCCCGGCGC	0.692													4	2	---	---	---	---	
MTOR	2475	broad.mit.edu	37	1	11189746	11189753	+	Intron	DEL	TTGCCATT	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11189746_11189753delTTGCCATT	uc001asd.2	-						MTOR_uc001asc.2_Intron	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CTTCTAGGTCTTGCCATTAACATGGCCT	0.486													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32423928	32423931	+	IGR	DEL	TTCT	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32423928_32423931delTTCT								PTP4A2 (19940 upstream) : KHDRBS1 (55560 downstream)																							ccttccttccttctttctttcttt	0.000													4	2	---	---	---	---	
ZFYVE9	9372	broad.mit.edu	37	1	52627783	52627783	+	Intron	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52627783delA	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						ATCCAGAATTaaaaaaaaaaa	0.254													5	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62237397	62237397	+	Intron	DEL	T	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62237397delT	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						Ctttctttccttttttttttt	0.134													4	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62443869	62443872	+	Intron	DEL	CTTC	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62443869_62443872delCTTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						ATCTTCATATcttccttccttcct	0.147													4	2	---	---	---	---	
TPR	7175	broad.mit.edu	37	1	186344191	186344191	+	5'UTR	DEL	G	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186344191delG	uc001grv.2	-	1					C1orf27_uc001grw.2_5'Flank|C1orf27_uc010poq.1_5'Flank|C1orf27_uc010por.1_5'Flank|TPR_uc010pop.1_Frame_Shift_Del_p.A66fs	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CAGTGGCAGCGGCCGACGGGG	0.682			T	NTRK1	papillary thyroid								32	17	---	---	---	---	
ZBTB41	360023	broad.mit.edu	37	1	197141236	197141237	+	Intron	DEL	TA	-	-	rs10572836		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197141236_197141237delTA	uc001gtx.1	-						ZBTB41_uc009wyz.1_Intron	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGATTACACTATATATATCTC	0.267													5	3	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10811743	10811743	+	Frame_Shift_Del	DEL	G	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10811743delG	uc002raq.2	-	6	526	c.401delC	c.(400-402)CCAfs	p.P134fs	NOL10_uc010yje.1_Frame_Shift_Del_p.P108fs|NOL10_uc010yjf.1_Frame_Shift_Del_p.P84fs|NOL10_uc002rap.2_Frame_Shift_Del_p.P134fs|NOL10_uc002rar.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	134						nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		CCCAAACTTTGGTATTCTGGT	0.343													15	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	28688998	28689001	+	IGR	DEL	CTCC	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28688998_28689001delCTCC								FOSL2 (51484 upstream) : PLB1 (29981 downstream)																							ccctccctctctccctccctccct	0.044													3	3	---	---	---	---	
PTCD3	55037	broad.mit.edu	37	2	86359746	86359747	+	Intron	DEL	TT	-	-	rs67035952		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86359746_86359747delTT	uc002sqw.2	+						PTCD3_uc002sqx.1_Intron	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1						CCTTTAAGGGTTTTTTTTTTTT	0.347													6	3	---	---	---	---	
IMMT	10989	broad.mit.edu	37	2	86372188	86372189	+	Intron	INS	-	AGGCAGT	AGGCAGT	rs150124116	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86372188_86372189insAGGCAGT	uc002sqz.3	-						IMMT_uc002sqy.3_Intron|IMMT_uc002srb.3_Intron|IMMT_uc002sra.3_Intron|IMMT_uc010ytd.1_Intron|IMMT_uc010yte.1_Intron	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1							integral to mitochondrial inner membrane	protein binding			skin(1)	1						CTCTTCATATCAAAGTCAGAAG	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	140092799	140092802	+	IGR	DEL	CTTT	-	-	rs72300724		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140092799_140092802delCTTT								NXPH2 (554988 upstream) : LRP1B (896194 downstream)																							tttctctctccttttctttctttc	0.015													4	3	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159992561	159992566	+	Intron	DEL	GCGCGC	-	-	rs35231270		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992561_159992566delGCGCGC	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						gtgtgtgtgtgCGCGCGCGCGCGTTT	0.398													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174602567	174602568	+	IGR	INS	-	GCAA	GCAA	rs137972030	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174602567_174602568insGCAA								CDCA7 (368849 upstream) : SP3 (170691 downstream)																							aaggaaataaggaagataggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	76845663	76845666	+	IGR	DEL	GAAG	-	-	rs28367457		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76845663_76845666delGAAG								None (None upstream) : ROBO2 (243628 downstream)																							aagaaggaaagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95397858	95397861	+	Intron	DEL	AGAG	-	-	rs67408904		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95397858_95397861delAGAG	uc003dro.1	-											Homo sapiens cDNA FLJ34909 fis, clone NT2RI2009301, moderately similar to BIFUNCTIONAL METHYLENETETRAHYDROFOLATE DEHYDROGENASE/CYCLOHYDROLASE, MITOCHONDRIAL PRECURSOR.																		aaagaaagaaagagagagagaaag	0.000													4	2	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160958626	160958626	+	Intron	DEL	T	-	-	rs141601797		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160958626delT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tcagccAGGATTTTTTTTTTT	0.134													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189218913	189218913	+	IGR	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189218913delA								TPRG1 (177643 upstream) : TP63 (130303 downstream)																							tccttccttcacttccttcct	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189295726	189295729	+	IGR	DEL	TTCC	-	-	rs148151112		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295726_189295729delTTCC								TPRG1 (254456 upstream) : TP63 (53487 downstream)																							cttccttcttttccttccttcctt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45326724	45326724	+	IGR	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45326724delA								GNPDA2 (598112 upstream) : GABRG1 (711065 downstream)																							TCTCCAACACAAGTGGGCACT	0.323													4	4	---	---	---	---	
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TACATCACCCAAAAAAAAAAA	0.308													10	6	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19747498	19747499	+	Intron	INS	-	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747498_19747499insT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTTTCTGCAGTTTTTTTTTTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44688706	44688713	+	IGR	DEL	AGGAAAGG	-	-	rs11279833		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44688706_44688713delAGGAAAGG								FGF10 (299922 upstream) : MRPS30 (120314 downstream)																							gaaggaaggaaggaaaggaaggaaggaa	0.000													3	3	---	---	---	---	
DDX4	54514	broad.mit.edu	37	5	55112499	55112499	+	3'UTR	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55112499delA	uc003jqg.3	+	22					DDX4_uc003jqh.3_3'UTR|DDX4_uc003jqj.2_3'UTR	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TCCTACACTTAAAAAAAAAAT	0.308													8	4	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59109272	59109273	+	Intron	DEL	AC	-	-	rs145294654		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59109272_59109273delAC	uc003jsa.2	-						PDE4D_uc003jsb.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	ATACACTTGTacacacacacac	0.287													4	2	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237915	112237915	+	Intron	DEL	G	-	-	rs141436136		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237915delG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		gcATTtttttgtttttgtttt	0.104													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157372715	157372718	+	IGR	DEL	CCTT	-	-	rs6875336	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157372715_157372718delCCTT								CLINT1 (86547 upstream) : EBF1 (750206 downstream)																							gtgcatgaaaccttccttccttcc	0.000													4	2	---	---	---	---	
GABRB2	2561	broad.mit.edu	37	5	160890324	160890325	+	Intron	DEL	CA	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160890324_160890325delCA	uc003lys.1	-						GABRB2_uc011deh.1_Intron|GABRB2_uc003lyr.1_Intron|GABRB2_uc003lyt.1_Intron|GABRB2_uc010jiu.1_Intron|GABRB2_uc011dei.1_Intron	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	acacacacaccacacacacaca	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15125363	15125374	+	IGR	DEL	AAGGAAGGAAGG	-	-	rs72365415	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15125363_15125374delAAGGAAGGAAGG								CD83 (988217 upstream) : JARID2 (120360 downstream)																							aaaagaaagaaaggaaggaaggaaggaaggaa	0.000													5	3	---	---	---	---	
SYNGAP1	8831	broad.mit.edu	37	6	33406897	33406897	+	Intron	DEL	A	-	-	rs72093601		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33406897delA	uc011dri.1	+						SYNGAP1_uc010juy.2_Intron|SYNGAP1_uc010juz.2_Intron	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						aaattagaagaaaaaaaaaaa	0.154													4	2	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51893317	51893318	+	Intron	INS	-	T	T	rs5876250		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51893317_51893318insT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTAACAACTAttttttttttt	0.153													4	2	---	---	---	---	
ZNF804B	219578	broad.mit.edu	37	7	88483827	88483827	+	Intron	DEL	T	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88483827delT	uc011khi.1	+							NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			tttcctttcctttcctttcct	0.050										HNSCC(36;0.09)			4	2	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17739342	17739343	+	Intron	INS	-	A	A	rs113353024		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17739342_17739343insA	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Intron|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		gactccgcctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
SH2D4A	63898	broad.mit.edu	37	8	19218625	19218626	+	Intron	INS	-	T	T	rs72575532		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19218625_19218626insT	uc003wzb.2	+						SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Intron	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		CCGGGTACCCCGTCCTTCAGGA	0.272													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30181786	30181789	+	IGR	DEL	AAGA	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30181786_30181789delAAGA								DCTN6 (140727 upstream) : RBPMS (60155 downstream)																							ggaaggaaggaagaaagaaagaaa	0.083													5	3	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79828414	79828415	+	Intron	DEL	TT	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79828414_79828415delTT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						CCCCCATATCtttttttttttt	0.173													5	3	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140968697	140968697	+	Intron	DEL	T	-	-	rs78547363		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140968697delT	uc004cog.2	+						CACNA1B_uc004coi.2_Intron|CACNA1B_uc004cok.1_5'Flank|CACNA1B_uc010ncp.1_5'Flank	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	tttcttactcttttttttttt	0.020													4	3	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112363206	112363207	+	Intron	INS	-	T	T	rs142390885	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112363206_112363207insT	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TAACTATGAAGTTTAGCAGTAT	0.297													4	3	---	---	---	---	
MRVI1	10335	broad.mit.edu	37	11	10653738	10653738	+	Intron	DEL	T	-	-	rs72349102		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10653738delT	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		tctttctttcttttttttttt	0.070													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48486667	48486668	+	IGR	INS	-	T	T	rs138127835	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48486667_48486668insT								OR4C45 (112668 upstream) : OR4A47 (23677 downstream)																							TGATATGATGATTTTTTCTGAG	0.297													4	2	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73796187	73796188	+	Intron	INS	-	T	T	rs74787473		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73796187_73796188insT	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					GAATGCCTTCAttttttttttt	0.198													4	2	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178448	134178450	+	Intron	DEL	CAT	-	-	rs140914654	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178448_134178450delCAT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		tcaccatcaccatcaccaccacc	0.000													4	2	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	271387	271387	+	Intron	DEL	T	-	-	rs66703624		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:271387delT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		actgCATCTCTTTTTTTTTTT	0.189													4	4	---	---	---	---	
FGD6	55785	broad.mit.edu	37	12	95475461	95475462	+	Intron	INS	-	T	T			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95475461_95475462insT	uc001tdp.3	-						FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						ATATATATGTAttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95730869	95730870	+	IGR	DEL	TG	-	-	rs113052348		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95730869_95730870delTG								MIR331 (28580 upstream) : METAP2 (136952 downstream)																							TGAAAATAGAtgtgtgtgtgtg	0.282													4	3	---	---	---	---	
SSH1	54434	broad.mit.edu	37	12	109203233	109203233	+	Intron	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109203233delA	uc001tnm.2	-						SSH1_uc010sxg.1_Intron|SSH1_uc001tnn.3_Intron|SSH1_uc001tno.1_Intron	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1						actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						accctgtctcaaaaaaaaaaa	0.045													3	3	---	---	---	---	
LOC284232	284232	broad.mit.edu	37	13	19420047	19420053	+	RNA	DEL	TTCGTAT	-	-	rs117180361	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19420047_19420053delTTCGTAT	uc010tcj.1	-	1		c.26057_26063delATACGAA				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ATAACATTTCTTCGTATTTTATATTTT	0.246													5	4	---	---	---	---	
CPB2	1361	broad.mit.edu	37	13	46641325	46641325	+	Intron	DEL	A	-	-	rs66903637		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46641325delA	uc001vaw.2	-						uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Intron	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		aataaaagttaaaaaaaatta	0.159													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	54361739	54361742	+	IGR	DEL	TCCC	-	-	rs35844241		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54361739_54361742delTCCC								DDHD1 (741693 upstream) : BMP4 (54715 downstream)																							ctttcttccttccctccctccctc	0.093													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56017468	56017469	+	IGR	INS	-	AC	AC	rs142833757	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56017468_56017469insAC								TBPL2 (110205 upstream) : C14orf33 (7221 downstream)																							ccttgtctcaaacacacacaca	0.000													4	3	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66042300	66042301	+	Intron	INS	-	C	C	rs141738567	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66042300_66042301insC	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		cttccttccttcttccttcctt	0.124													4	3	---	---	---	---	
BCL11B	64919	broad.mit.edu	37	14	99641544	99641546	+	In_Frame_Del	DEL	CTC	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99641544_99641546delCTC	uc001yga.2	-	4	1894_1896	c.1627_1629delGAG	c.(1627-1629)GAGdel	p.E543del	BCL11B_uc001ygb.2_In_Frame_Del_p.E472del	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	543	Glu-rich.					nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCAGTAGCAGctcctcctcctcc	0.517			T	TLX3	T-ALL								4	2	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102431128	102431132	+	Frame_Shift_Del	DEL	CTGCG	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102431128_102431132delCTGCG	uc001yks.2	+	1	264_268	c.100_104delCTGCG	c.(100-105)CTGCGCfs	p.L34fs		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	34_35					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCAGAAGCACCTGCGCAAGCTGGTG	0.722													7	4	---	---	---	---	
MARK3	4140	broad.mit.edu	37	14	103925003	103925003	+	Intron	DEL	A	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103925003delA	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			GCCTACATTGAAATGGAATTA	0.289													6	3	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40921669	40921670	+	Intron	INS	-	T	T	rs146526741		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40921669_40921670insT	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGAGAGttttcttttttttttt	0.153													8	4	---	---	---	---	
PARP16	54956	broad.mit.edu	37	15	65563598	65563598	+	Intron	DEL	T	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65563598delT	uc002aoo.2	-						PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Intron	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16							integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						atctgaaaggttttttttttg	0.095													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73723923	73723924	+	IGR	DEL	TC	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73723923_73723924delTC								HCN4 (62318 upstream) : C15orf60 (11575 downstream)																							tctctccctgtctctctctctc	0.000													4	3	---	---	---	---	
CAMTA2	23125	broad.mit.edu	37	17	4882803	4882804	+	Intron	INS	-	A	A	rs5819002		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4882803_4882804insA	uc002gah.1	-						CAMTA2_uc010cku.1_Intron|CAMTA2_uc002gag.1_Intron|CAMTA2_uc002gai.1_Intron|CAMTA2_uc010ckv.1_Intron	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2						cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						gaaactgtctcaaaaaaaaaaa	0.168													4	3	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7980190	7980200	+	Intron	DEL	CCCCAGATGCC	-	-	rs72152877		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7980190_7980200delCCCCAGATGCC	uc002gjy.1	-						uc010cnq.1_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CTCTTGTGGTCCCCAGATGCCCCCCAGGCTG	0.616										Multiple Myeloma(8;0.094)			2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20746999	20746999	+	Intron	DEL	G	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20746999delG	uc010crb.1	+											Homo sapiens cDNA clone IMAGE:6269068, partial cds.																		AGCTGGGCCCGGGGACGCCCG	0.726													3	3	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30773823	30773823	+	Intron	DEL	T	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30773823delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGGCTTAGAGTTTTTTTTTTT	0.274													12	6	---	---	---	---	
LASP1	3927	broad.mit.edu	37	17	37070931	37070936	+	Intron	DEL	ACACAC	-	-	rs68023823		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37070931_37070936delACACAC	uc002hra.2	+						LASP1_uc010cvq.2_Intron|LASP1_uc010wdz.1_Intron	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1							cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						CGAGAGacagacacacacacacacac	0.427			T	MLL	AML								4	3	---	---	---	---	
KRT13	3860	broad.mit.edu	37	17	39658558	39658558	+	Intron	DEL	C	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39658558delC	uc002hwu.1	-						KRT13_uc002hwv.1_Intron|KRT13_uc002hww.2_Intron|KRT13_uc010wfr.1_3'UTR|KRT13_uc010cxo.2_3'UTR	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a						epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				atctctaaggccctgcctgct	0.418													80	35	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43807913	43807914	+	Intron	INS	-	A	A	rs111610904		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43807913_43807914insA	uc002ijp.2	+						CRHR1_uc010wjx.1_Intron			P34998	CRFR1_HUMAN	SubName: Full=cDNA FLJ60308, highly similar to Corticotropin-releasing factor receptor 1;						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		aggaaggaaggaaggaaggaag	0.262													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													4	4	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991061	39991061	+	Intron	DEL	C	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991061delC	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			gtgagattctCCCCCCCCCCC	0.303													5	4	---	---	---	---	
ZNF83	55769	broad.mit.edu	37	19	53183858	53183863	+	Intron	DEL	TATTTT	-	-	rs8102386		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53183858_53183863delTATTTT	uc010epz.2	-						ZNF83_uc010eqb.1_Intron	NM_001105554	NP_001099024	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TTCCACAAAATAtttttttttttttt	0.165													6	3	---	---	---	---	
ACSS2	55902	broad.mit.edu	37	20	33470425	33470426	+	Intron	INS	-	A	A			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33470425_33470426insA	uc002xbd.2	+						ACSS2_uc002xbc.2_Intron|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Intron|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	cctccatctccaaaaaaaaaaa	0.213													4	2	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40120102	40120103	+	Intron	INS	-	G	G			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40120102_40120103insG	uc002xka.1	-						CHD6_uc002xkd.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TTGGTGTGGCTGGCCAAAAAAA	0.337													7	4	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45220863	45220866	+	Intron	DEL	CATA	-	-	rs113698989		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45220863_45220866delCATA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	aaactaaatgcatacatacataca	0.054													4	2	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	30616071	30616072	+	IGR	INS	-	TC	TC	rs139192726	by1000genomes	TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30616071_30616072insTC								HORMAD2 (43013 upstream) : LIF (20370 downstream)																							ctgtctgtctgtctctctctct	0.000													5	4	---	---	---	---	
NR0B1	190	broad.mit.edu	37	X	30328948	30328948	+	5'Flank	DEL	T	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30328948delT	uc004dcf.3	-							NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	ccttccttcctttccttcctt	0.060													6	4	---	---	---	---	
SSX4	6759	broad.mit.edu	37	X	48243340	48243341	+	Intron	DEL	AA	-	-			TCGA-A3-3373-01A-02D-1421-08	TCGA-A3-3373-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48243340_48243341delAA	uc004djf.1	+						SSX4_uc004djg.1_Intron	NM_005636	NP_005627	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding		SS18/SSX4(12)	soft_tissue(12)	12						accctgtctcaaaaaaaaaaaa	0.045			T	SS18	synovial sarcoma								4	2	---	---	---	---	
