Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MACF1	23499	broad.mit.edu	37	1	39788664	39788664	+	Missense_Mutation	SNP	G	A	A	rs148253091		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39788664G>A	uc010ois.1	+	34	4440	c.4235G>A	c.(4234-4236)CGT>CAT	p.R1412H	MACF1_uc001cda.1_Missense_Mutation_p.R1320H|MACF1_uc001cdc.1_Missense_Mutation_p.R499H|MACF1_uc009vvq.1_Missense_Mutation_p.R469H|MACF1_uc001cdb.1_Missense_Mutation_p.R499H	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1412					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCACTCCGGCGTCTGGAGGAG	0.398													61	165	---	---	---	---	PASS
PPIAL4G	644591	broad.mit.edu	37	1	143767882	143767882	+	5'Flank	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143767882G>A	uc001ejt.2	-							NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like						protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0						CGATGGCGGCGTCTGCAAAga	0.303													26	143	---	---	---	---	PASS
C1orf104	284618	broad.mit.edu	37	1	155290610	155290610	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155290610T>A	uc001fki.2	-	2	947	c.670A>T	c.(670-672)AGC>TGC	p.S224C	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank|RUSC1_uc009wqn.1_5'Flank|RUSC1_uc009wqo.1_5'Flank	NM_001039517	NP_001034606	Q66K80	RUAS1_HUMAN	hypothetical protein LOC284618	224											0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.32e-10)|all cancers(21;3.51e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CAAAAGACGCTAAACGCTGGG	0.637													22	46	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236891015	236891015	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236891015C>T	uc001hyf.2	+	6	778	c.574C>T	c.(574-576)CGA>TGA	p.R192*	ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Nonsense_Mutation_p.R192*	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	192	CH 2.|Actin-binding.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CCTCATCCACCGACACCGGCC	0.547													26	127	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116572463	116572463	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116572463T>A	uc002tla.1	+	20	2252	c.1795T>A	c.(1795-1797)TTT>ATT	p.F599I	DPP10_uc002tlb.1_Missense_Mutation_p.F549I|DPP10_uc002tlc.1_Missense_Mutation_p.F595I|DPP10_uc002tle.2_Missense_Mutation_p.F603I|DPP10_uc002tlf.1_Missense_Mutation_p.F592I	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	599	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGTAGCAAGATTTGATGGCAG	0.423													8	184	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170177379	170177379	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170177379T>C	uc002ues.2	-	2	308	c.95A>G	c.(94-96)CAT>CGT	p.H32R	LRP2_uc010zdf.1_Missense_Mutation_p.H32R	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	32	LDL-receptor class A 1.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACAGCGAAAATGCGCACTGTC	0.373													45	98	---	---	---	---	PASS
TMEFF2	23671	broad.mit.edu	37	2	192818523	192818523	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192818523C>G	uc002utc.2	-	9	1304	c.910G>C	c.(910-912)GAC>CAC	p.D304H		NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	304	Required for shedding.|Extracellular (Potential).					extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			ACACTGTAGTCCTTTTTTTCA	0.403													34	87	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52662984	52662984	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52662984C>A	uc003des.2	-	12	1381	c.1369G>T	c.(1369-1371)GAA>TAA	p.E457*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.E457*|PBRM1_uc003der.2_Nonsense_Mutation_p.E425*|PBRM1_uc003det.2_Nonsense_Mutation_p.E457*|PBRM1_uc003deu.2_Nonsense_Mutation_p.E457*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.E457*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.E457*|PBRM1_uc003dey.2_Nonsense_Mutation_p.E457*|PBRM1_uc003dez.1_Nonsense_Mutation_p.E457*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.E355*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	457	Bromo 3.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTGGCATTTTCAAACATTAAA	0.333			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								37	49	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	121097679	121097679	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121097679C>T	uc003eec.3	+	22	2505	c.2365C>T	c.(2365-2367)CGA>TGA	p.R789*	STXBP5L_uc011bji.1_Nonsense_Mutation_p.R765*	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	789					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		ACCACCATTTCGAAAGGCCCA	0.403													29	69	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180322346	180322346	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180322346G>C	uc003fkk.2	+	5	784	c.652G>C	c.(652-654)GGT>CGT	p.G218R	TTC14_uc003fkl.2_Missense_Mutation_p.G218R|TTC14_uc003fkm.2_Missense_Mutation_p.G218R	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	218	TPR 1.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ACACCTATCTGGTATTAAATT	0.343													28	84	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180322347	180322347	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180322347G>T	uc003fkk.2	+	5	785	c.653G>T	c.(652-654)GGT>GTT	p.G218V	TTC14_uc003fkl.2_Missense_Mutation_p.G218V|TTC14_uc003fkm.2_Missense_Mutation_p.G218V	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	218	TPR 1.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CACCTATCTGGTATTAAATTA	0.338													28	85	---	---	---	---	PASS
MXD4	10608	broad.mit.edu	37	4	2254186	2254186	+	Silent	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2254186G>A	uc003geu.1	-	4	290	c.258C>T	c.(256-258)AGC>AGT	p.S86S		NM_006454	NP_006445	Q14582	MAD4_HUMAN	MAD4	86	Helix-loop-helix motif.				negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|transcription corepressor activity				0						TGTGGCGGGTGCTGTCGGGGC	0.627													8	48	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106157368	106157368	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106157368C>G	uc003hxk.2	+	3	2655	c.2269C>G	c.(2269-2271)CTC>GTC	p.L757V	TET2_uc011cez.1_Missense_Mutation_p.L778V|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.L757V|TET2_uc003hxi.1_Missense_Mutation_p.L757V	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	757	Gln-rich.				cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AGAGGAAATACTCCAGACTTT	0.398			Mis N|F		MDS								26	68	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113360933	113360933	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113360933T>C	uc003iap.3	+	14	3722	c.3443T>C	c.(3442-3444)GTG>GCG	p.V1148A	ALPK1_uc003ian.3_Missense_Mutation_p.V1148A|ALPK1_uc011cfx.1_Missense_Mutation_p.V1070A|ALPK1_uc003iao.3_RNA|ALPK1_uc010imo.2_Missense_Mutation_p.V976A	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1148	Alpha-type protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ACGAAAGTGGTGAAAACAGAA	0.358													37	55	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5464188	5464188	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5464188A>T	uc003jdm.3	+	13	4963	c.4741A>T	c.(4741-4743)AGT>TGT	p.S1581C		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1581										ovary(1)|central_nervous_system(1)	2						AACTCATCAGAGTGAAGTTGC	0.383													27	69	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52363017	52363017	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52363017G>T	uc003joy.2	+	16	2156	c.2013G>T	c.(2011-2013)AAG>AAT	p.K671N	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.K595N|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	671	Extracellular (Potential).				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGGTCAACAAGAATGCTCAGA	0.368													55	43	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114499350	114499350	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114499350T>A	uc003kqs.2	-	2	672	c.163A>T	c.(163-165)AAA>TAA	p.K55*	TRIM36_uc011cwc.1_Nonsense_Mutation_p.K43*|TRIM36_uc003kqt.2_Intron	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	55	RING-type; degenerate.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTTACACATTTATGACAGATA	0.468													44	162	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147040551	147040551	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147040551G>A	uc003loq.1	-	3	969	c.587C>T	c.(586-588)TCG>TTG	p.S196L	JAKMIP2_uc011dbx.1_Missense_Mutation_p.S154L|JAKMIP2_uc003lor.1_Missense_Mutation_p.S196L|uc003lop.1_3'UTR|JAKMIP2_uc010jgo.1_Missense_Mutation_p.S196L	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	196						Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGATCTTCGAGATGGCTTC	0.517													85	256	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147444913	147444913	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147444913C>T	uc003lox.2	+	2	132	c.59C>T	c.(58-60)GCT>GTT	p.A20V	SPINK5_uc010jgq.1_RNA|SPINK5_uc010jgs.1_5'UTR|SPINK5_uc010jgr.2_Missense_Mutation_p.A20V|SPINK5_uc003low.2_Missense_Mutation_p.A20V|SPINK5_uc003loy.2_Missense_Mutation_p.A20V	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	20				DAASKNEDQ -> GQCEKDSLS (in Ref. 2; CAB96877).	anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCCAGATGCTGCCAGTAAG	0.328													31	95	---	---	---	---	PASS
MED7	9443	broad.mit.edu	37	5	156565914	156565914	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156565914G>T	uc010jik.2	-	2	921	c.529C>A	c.(529-531)CAT>AAT	p.H177N	MED7_uc003lwm.3_Missense_Mutation_p.H177N	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	177					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTTCTGAATGAGGCAAATCA	0.398													85	287	---	---	---	---	PASS
TRIM39	56658	broad.mit.edu	37	6	30308093	30308093	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30308093C>T	uc010jrz.2	+	7	1160	c.848C>T	c.(847-849)CCA>CTA	p.P283L	TRIM39_uc003npz.2_Intron|TRIM39_uc003nqb.2_Intron|TRIM39_uc003nqc.2_Intron|TRIM39_uc010jsa.1_Intron	NM_021253	NP_067076	Q9HCM9	TRI39_HUMAN	tripartite motif-containing 39 isoform 1	283					apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding			ovary(3)	3						ACGATCTGTCCACGGGATCAT	0.453													35	66	---	---	---	---	PASS
MICB	4277	broad.mit.edu	37	6	31475252	31475252	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31475252T>A	uc003ntn.3	+	5	1084	c.968T>A	c.(967-969)ATT>AAT	p.I323N	MICB_uc011dnm.1_Missense_Mutation_p.I291N|MICB_uc003nto.3_Missense_Mutation_p.I280N	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	323	Helical; (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						TTTGTTATTATTATTATTCTC	0.443													22	50	---	---	---	---	PASS
FKBPL	63943	broad.mit.edu	37	6	32097079	32097079	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32097079A>C	uc003nzr.2	-	2	749	c.479T>G	c.(478-480)ATA>AGA	p.I160R	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	160					response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						GCATTTCTCTATGAGCTCCCC	0.577													131	297	---	---	---	---	PASS
DAXX	1616	broad.mit.edu	37	6	33286892	33286892	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33286892G>C	uc003oec.2	-	7	2249	c.2045C>G	c.(2044-2046)TCC>TGC	p.S682C	ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Missense_Mutation_p.S607C|DAXX_uc011dre.1_Missense_Mutation_p.S694C|DAXX_uc003oed.2_Missense_Mutation_p.S682C	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	682	Interaction with SPOP.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding	p.S682fs*59(1)		pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						CCTCGTGGAGGAATCAGCAAC	0.592			Mis|F|N		Pancreatic neuroendocrine tumors								50	144	---	---	---	---	PASS
PGC	5225	broad.mit.edu	37	6	41712242	41712242	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41712242A>C	uc003ora.1	-	3	270	c.221T>G	c.(220-222)TTT>TGT	p.F74C		NM_002630	NP_002621	P20142	PEPC_HUMAN	progastricsin (pepsinogen C) precursor	74					digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GATCTCACCAAAGTAGGCAGC	0.607													21	44	---	---	---	---	PASS
IQCE	23288	broad.mit.edu	37	7	2645633	2645633	+	Splice_Site	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2645633T>A	uc003smo.3	+	20	2049	c.1865_splice	c.e20+2	p.S622_splice	IQCE_uc003sml.1_Splice_Site_p.S622_splice|IQCE_uc011jvy.1_Splice_Site_p.S606_splice|IQCE_uc011jvz.1_Splice_Site_p.S557_splice|IQCE_uc003smk.3_Splice_Site_p.S606_splice|IQCE_uc003smn.3_Splice_Site_p.S557_splice	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1												0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CAGGCACAGGTGAGTCAGGGT	0.697													12	40	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144077075	144077075	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144077075G>T	uc003wel.2	+	15	4838	c.4720G>T	c.(4720-4722)GTC>TTC	p.V1574F	ARHGEF5_uc003wem.2_Missense_Mutation_p.V375F	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	1574					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CAACCCAGAGGTCCGTGCACA	0.572													73	91	---	---	---	---	PASS
SORBS3	10174	broad.mit.edu	37	8	22423910	22423910	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22423910G>T	uc003xbv.2	+	13	1343	c.1003G>T	c.(1003-1005)GCC>TCC	p.A335S	SORBS3_uc011kzk.1_RNA|SORBS3_uc003xbw.3_5'UTR	NM_005775	NP_005766	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3 isoform 1	335					muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CCTGGGTTCCGCCCGGTCCCT	0.647													28	79	---	---	---	---	PASS
UBAP1	51271	broad.mit.edu	37	9	34241773	34241773	+	Silent	SNP	C	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34241773C>G	uc003ztx.2	+	4	985	c.750C>G	c.(748-750)TCC>TCG	p.S250S	UBAP1_uc010mka.1_Silent_p.S286S|UBAP1_uc003zty.2_Silent_p.S250S|UBAP1_uc011loi.1_Silent_p.S286S|UBAP1_uc011loj.1_Silent_p.S314S|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Silent_p.S250S	NM_016525	NP_057609	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	250						cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)			CACTGTCTTCCAAAGTGTCCC	0.468													14	50	---	---	---	---	PASS
ERLIN1	10613	broad.mit.edu	37	10	101923759	101923759	+	Splice_Site	SNP	A	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101923759A>G	uc001kqn.3	-	8	1006	c.655_splice	c.e8+1	p.E219_splice	ERLIN1_uc001kqo.3_Splice_Site_p.E219_splice|ERLIN1_uc010qpm.1_Splice_Site_p.E135_splice	NM_006459	NP_006450	O75477	ERLN1_HUMAN	ER lipid raft associated 1						ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding				0		Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		AAATCCAAGTACCTATAACTG	0.398													15	28	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117374716	117374716	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117374716A>T	uc001prh.1	-	11	2385	c.2383T>A	c.(2383-2385)TAC>AAC	p.Y795N		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	735	Extracellular (Potential).|Ig-like C2-type 8.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ACAGGGTGGTACTGCTGGGGG	0.632													26	83	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117374717	117374717	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117374717C>G	uc001prh.1	-	11	2384	c.2382G>C	c.(2380-2382)CAG>CAC	p.Q794H		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	734	Extracellular (Potential).|Ig-like C2-type 8.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CAGGGTGGTACTGCTGGGGGT	0.632													27	83	---	---	---	---	PASS
ST3GAL4	6484	broad.mit.edu	37	11	126284026	126284026	+	3'UTR	SNP	A	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126284026A>G	uc001qds.2	+	11					ST3GAL4_uc001qdt.2_3'UTR|ST3GAL4_uc009zcc.2_3'UTR|ST3GAL4_uc009zcd.2_3'UTR|ST3GAL4_uc001qdu.2_3'UTR|ST3GAL4_uc001qdv.2_3'UTR|ST3GAL4_uc009zce.2_3'UTR|ST3GAL4_uc001qdw.2_3'UTR|ST3GAL4_uc001qdx.1_Intron|ST3GAL4_uc001qdy.2_3'UTR|ST3GAL4_uc001qdz.2_3'UTR	NM_006278	NP_006269	Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		GGCTGGTGCCAGTATGACCCA	0.627													3	27	---	---	---	---	PASS
PRDM10	56980	broad.mit.edu	37	11	129817095	129817095	+	Silent	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129817095C>T	uc001qfm.2	-	5	697	c.465G>A	c.(463-465)ACG>ACA	p.T155T	PRDM10_uc001qfj.2_Silent_p.T69T|PRDM10_uc001qfk.2_Silent_p.T69T|PRDM10_uc001qfl.2_Silent_p.T69T|PRDM10_uc010sbx.1_Silent_p.T69T|PRDM10_uc001qfn.2_Silent_p.T155T|PRDM10_uc009zct.1_Silent_p.T187T	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1	155					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CATCCAGATCCGTGTCCTCAC	0.597													28	105	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6127588	6127588	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6127588G>C	uc001qnn.1	-	28	5246	c.4996C>G	c.(4996-4998)CTG>GTG	p.L1666V	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1666					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CACCTCTGCAGCACCAGGTCA	0.642													23	24	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7636081	7636081	+	Silent	SNP	C	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7636081C>G	uc001qsz.3	-	12	3098	c.2970G>C	c.(2968-2970)CCG>CCC	p.P990P	CD163_uc001qta.3_Silent_p.P990P|CD163_uc009zfw.2_Silent_p.P1023P	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	990	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TGAGCCATATCGGTCCAGTCC	0.522													49	84	---	---	---	---	PASS
WBP11	51729	broad.mit.edu	37	12	14943423	14943423	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14943423G>A	uc001rci.2	-	10	1437	c.1276C>T	c.(1276-1278)CCA>TCA	p.P426S		NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	426	Pro-rich.				mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						CCTGTAGGTGGCCCAGGAGGC	0.498													38	126	---	---	---	---	PASS
SART3	9733	broad.mit.edu	37	12	108920274	108920274	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108920274G>A	uc001tmz.1	-	16	2207	c.1972C>T	c.(1972-1974)CAA>TAA	p.Q658*	SART3_uc001tmy.1_Nonsense_Mutation_p.Q184*|SART3_uc009zux.1_Nonsense_Mutation_p.Q270*|SART3_uc010swx.1_Nonsense_Mutation_p.Q622*|SART3_uc010swy.1_Nonsense_Mutation_p.Q544*|SART3_uc010swz.1_Missense_Mutation_p.T656I	NM_014706	NP_055521	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T	658	Required for nuclear localization.				RNA processing	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding			pancreas(1)	1						TCTACATTTTGTGTTTCTCCA	0.517									Porokeratosis				53	107	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130649146	130649146	+	Silent	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130649146C>T	uc001uii.2	+	1	2115	c.1659C>T	c.(1657-1659)AGC>AGT	p.S553S	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	553	Cytoplasmic (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TGATCACCAGCGGTGGGATTT	0.562													12	36	---	---	---	---	PASS
SOHLH2	54937	broad.mit.edu	37	13	36776196	36776196	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36776196G>T	uc001uvj.2	-	2	172	c.83C>A	c.(82-84)ACT>AAT	p.T28N	SOHLH2_uc010tei.1_Missense_Mutation_p.T105N	NM_017826	NP_060296	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic	28					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GTAGCCCACAGTGACATCTCC	0.438													35	84	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2161786	2161786	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2161786A>T	uc002cos.1	-	15	3591	c.3382T>A	c.(3382-3384)TCC>ACC	p.S1128T	PKD1_uc002cot.1_Missense_Mutation_p.S1128T	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1128	PKD 5.|PKD 6.|Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						ACAGCCACGGAGGGCAGGGAG	0.672													3	17	---	---	---	---	PASS
LRRC36	55282	broad.mit.edu	37	16	67404969	67404969	+	Silent	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67404969C>T	uc002esv.2	+	9	1337	c.1318C>T	c.(1318-1320)CTG>TTG	p.L440L	LRRC36_uc002esw.2_RNA|LRRC36_uc010ceh.2_Silent_p.L172L|LRRC36_uc002esx.2_Silent_p.L319L|LRRC36_uc010vjk.1_Silent_p.L319L|LRRC36_uc010vjl.1_5'UTR|LRRC36_uc002esy.2_Intron	NM_018296	NP_060766	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36 isoform 1	440											0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		CAACGCTGTCCTGGGAAACAG	0.478													46	102	---	---	---	---	PASS
C16orf48	84080	broad.mit.edu	37	16	67697841	67697841	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67697841T>G	uc002etw.1	-	4	861	c.578A>C	c.(577-579)AAG>ACG	p.K193T	C16orf48_uc002etv.1_Missense_Mutation_p.K75T|C16orf48_uc010cem.1_Missense_Mutation_p.K193T|C16orf86_uc002etx.1_5'Flank|C16orf86_uc002ety.2_5'Flank|C16orf86_uc002etz.2_5'Flank	NM_032140	NP_115516	Q9H0I2	CP048_HUMAN	hypothetical protein LOC84080	193						microtubule cytoskeleton	protein binding				0		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		TCCTCTCACCTTAGCTTCGGG	0.647													4	10	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74530491	74530491	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74530491T>C	uc002fcy.3	-	5	876	c.826A>G	c.(826-828)AAA>GAA	p.K276E	GLG1_uc002fcx.2_Missense_Mutation_p.K276E|GLG1_uc002fcw.3_Missense_Mutation_p.K265E|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	276	Extracellular (Potential).|Cys-rich GLG1 3.					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						TCTGCTTCTTTCACCAGGCCT	0.413													121	271	---	---	---	---	PASS
FAM64A	54478	broad.mit.edu	37	17	6348680	6348680	+	Missense_Mutation	SNP	G	A	A	rs151147808		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6348680G>A	uc002gcw.1	+	2	299	c.250G>A	c.(250-252)GCT>ACT	p.A84T	FAM64A_uc002gct.1_Missense_Mutation_p.A84T|FAM64A_uc002gcu.1_Missense_Mutation_p.A84T|FAM64A_uc002gcv.1_Missense_Mutation_p.A84T|FAM64A_uc002gcx.1_Missense_Mutation_p.A84T|FAM64A_uc002gcy.1_RNA|FAM64A_uc002gcz.1_RNA|FAM64A_uc002gda.1_Missense_Mutation_p.A84T|FAM64A_uc002gdb.1_Missense_Mutation_p.A84T	NM_019013	NP_061886	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	84						nucleolus	protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		GGGCCTCCAGGCTGCAGCTCG	0.582													21	61	---	---	---	---	PASS
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45368211G>T	uc002lcy.2	-	11	1639	c.1391C>A	c.(1390-1392)TCA>TAA	p.S464*	SMAD2_uc002lcz.2_Nonsense_Mutation_p.S464*|SMAD2_uc010xdc.1_Nonsense_Mutation_p.S434*	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	464	MH2.			S->A: Loss of phosphorylation by TGFBR1; when associated with A-465 and A-467.	anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding	p.R462fs*>4(1)		large_intestine(3)|lung(1)|central_nervous_system(1)	5						TGACATGCTTGAGCAACGCAC	0.423													25	94	---	---	---	---	PASS
CCDC68	80323	broad.mit.edu	37	18	52575020	52575020	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52575020G>A	uc002lfs.2	-	11	1119	c.947C>T	c.(946-948)ACA>ATA	p.T316I	CCDC68_uc002lft.2_Missense_Mutation_p.T316I	NM_001143829	NP_001137301	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	316										skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		ACCTTACCTTGTAGAGACAGC	0.403													46	99	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1074667	1074667	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1074667T>A	uc002lqz.1	+	9	1279	c.1048T>A	c.(1048-1050)TTC>ATC	p.F350I	HMHA1_uc010xgd.1_Missense_Mutation_p.F366I|HMHA1_uc010xge.1_Missense_Mutation_p.F190I|HMHA1_uc002lra.1_Missense_Mutation_p.F190I|HMHA1_uc002lrb.1_Missense_Mutation_p.F233I|HMHA1_uc002lrc.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	350					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCTGGAGTTCGGCCACAG	0.701													3	14	---	---	---	---	PASS
ZNF20	7568	broad.mit.edu	37	19	12243969	12243969	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12243969A>T	uc002mtf.1	-	4	1175	c.1032T>A	c.(1030-1032)TGT>TGA	p.C344*	ZNF20_uc002mte.1_Nonsense_Mutation_p.C309*|ZNF20_uc002mtg.1_Nonsense_Mutation_p.C344*	NM_021143	NP_066966	P17024	ZNF20_HUMAN	zinc finger protein 20	344	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGGCTTTACCACATTGCCTAC	0.448													39	112	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22605105	22605105	+	5'UTR	SNP	C	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22605105C>T	uc002nqt.2	-	1						NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CACAGAAGGGCGAAGACGAGA	0.617													13	46	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38609984	38609984	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38609984G>C	uc002ohk.2	+	9	2839	c.2330G>C	c.(2329-2331)GGC>GCC	p.G777A		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	777	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCTTTCGGCCCCCCCATC	0.532													32	85	---	---	---	---	PASS
ZNF432	9668	broad.mit.edu	37	19	52538204	52538204	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52538204G>T	uc002pyk.2	-	5	1046	c.728C>A	c.(727-729)TCC>TAC	p.S243Y		NM_014650	NP_055465	O94892	ZN432_HUMAN	zinc finger protein 432	243	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|pancreas(1)	3		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GGACTTTCTGGAGAACACTTT	0.388													102	259	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53384724	53384724	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53384724A>C	uc002qag.2	-	4	846	c.655T>G	c.(655-657)TGT>GGT	p.C219G	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.C165G|ZNF320_uc002qai.2_Missense_Mutation_p.C219G	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	219	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		CATTCATTACATGTGTAATGT	0.383													58	111	---	---	---	---	PASS
PTPN1	5770	broad.mit.edu	37	20	49196426	49196426	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49196426G>T	uc002xvl.2	+	8	1225	c.1051G>T	c.(1051-1053)GGA>TGA	p.G351*	PTPN1_uc010zys.1_Nonsense_Mutation_p.G278*	NM_002827	NP_002818	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type	351					blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)	GGAAGAAAAAGGAAGCCCCTT	0.498											OREG0026029	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	43	---	---	---	---	PASS
PEX26	55670	broad.mit.edu	37	22	18566233	18566233	+	Silent	SNP	T	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18566233T>G	uc002znp.3	+	4	611	c.402T>G	c.(400-402)CCT>CCG	p.P134P	TUBA8_uc002znr.2_Intron|PEX26_uc002znq.3_Silent_p.P134P|PEX26_uc002znt.2_Silent_p.P134P	NM_017929	NP_060399	Q7Z412	PEX26_HUMAN	peroxisome biogenesis factor 26	134	Cytoplasmic (Potential).				protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding			skin(1)	1						TGCAAGAGCCTGGAGCTGTGC	0.493													25	331	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22662971	22662971	+	Intron	SNP	A	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22662971A>G	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						TGTAAGTAAAATTCACTTTGG	0.323													3	29	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22662995	22662995	+	Intron	SNP	C	T	T	rs79792109	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22662995C>T	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						TTTATTGTGTCACATAGAATT	0.348													3	28	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8616316	8616316	+	Intron	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8616316delA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTAAATTATCAAAAAAAAAAA	0.348													6	3	---	---	---	---	
OVGP1	5016	broad.mit.edu	37	1	111959289	111959290	+	Intron	INS	-	A	A	rs34687982		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111959289_111959290insA	uc001eba.2	-						OVGP1_uc001eaz.2_Intron|OVGP1_uc010owb.1_Intron	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		cctcatttgtgaaaaaaaaaaa	0.064													4	2	---	---	---	---	
C1orf9	51430	broad.mit.edu	37	1	172560415	172560415	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172560415delT	uc001giq.3	+						C1orf9_uc010pmm.1_Intron|C1orf9_uc009wwd.2_Intron|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein						multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		ATTTGTTTAAtttttttttta	0.159													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178587971	178587972	+	IGR	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178587971_178587972insGAAGGAAGGAAG								C1orf220 (69947 upstream) : RALGPS2 (106328 downstream)																							aaagagagagagaaggaaggaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199531842	199531850	+	IGR	DEL	GGAAGGAAG	-	-	rs71897082	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199531842_199531850delGGAAGGAAG								MIR181A1 (703560 upstream) : NR5A2 (464920 downstream)																							agagaaggaaggaaggaagggaaggaagg	0.043													3	3	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9583526	9583526	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9583526delT	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		ATTAGAATGATTTTGTGCGTA	0.264													25	15	---	---	---	---	
ADCY3	109	broad.mit.edu	37	2	25043917	25043917	+	Intron	DEL	C	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25043917delC	uc002rfs.3	-						ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TCAGCCGCCACCCCCCCCCCA	0.502													4	2	---	---	---	---	
PPM1G	5496	broad.mit.edu	37	2	27605696	27605697	+	Intron	INS	-	T	T	rs111310967		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27605696_27605697insT	uc002rkl.2	-						ZNF513_uc002rkj.2_5'Flank|ZNF513_uc002rkk.2_5'Flank|PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698	O15355	PPM1G_HUMAN	protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					agtcttttttgttttttttttt	0.025													5	3	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42760223	42760223	+	Intron	DEL	C	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42760223delC	uc002rso.1	+							NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						GTGGGGCAttctttttttttt	0.239													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764930	91764935	+	IGR	DEL	TGTGTA	-	-	rs4005278		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764930_91764935delTGTGTA								None (None upstream) : LOC654342 (40257 downstream)																							tgtgtgtgtgtgtgtatatatataca	0.015													6	3	---	---	---	---	
ZC3H8	84524	broad.mit.edu	37	2	112990804	112990805	+	Intron	INS	-	ATAAAGA	ATAAAGA	rs143473380	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112990804_112990805insATAAAGA	uc002thp.2	-							NM_032494	NP_115883	Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8						apoptosis|negative regulation of T cell differentiation in thymus|negative regulation of transcription, DNA-dependent|positive regulation of thymocyte apoptosis|response to antibiotic|T cell homeostasis	nucleus	RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TGTAAATATTTATAAAGTCACC	0.282													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045439	+	3'UTR	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439delT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaa	0.368													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237782185	237782186	+	IGR	INS	-	TCCTTCCC	TCCTTCCC	rs59599802	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237782185_237782186insTCCTTCCC								CXCR7 (291193 upstream) : COPS8 (211898 downstream)																							ccttccttcctccctcccttcc	0.030													12	7	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188227	10188227	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188227delA	uc003bvc.2	+	2	583	c.370delA	c.(370-372)ACAfs	p.T124fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	124	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T124fs*35(3)|p.T124_H125>H(1)|p.H125fs*6(1)|p.T124fs*10(1)|p.R120fs*34(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGATGCAGGGACACACGATGG	0.398		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				157	96	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75264910	75264910	+	IGR	DEL	A	-	-	rs35563675		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75264910delA								CNTN3 (694567 upstream) : FAM86D (205795 downstream)																							TGATGACCCCaaaaaaaaaaa	0.299													4	2	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189702118	189702121	+	Intron	DEL	AAAA	-	-	rs66715161		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189702118_189702121delAAAA	uc011bsk.1	-						LEPREL1_uc003fsg.2_Intron	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	tttttcctggaaaaaaaaaatgag	0.074													5	5	---	---	---	---	
ZDHHC19	131540	broad.mit.edu	37	3	195937314	195937315	+	Intron	INS	-	TAAAG	TAAAG	rs59406858		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937314_195937315insTAAAG	uc003fwc.2	-						ZDHHC19_uc010hzz.2_Intron|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_Intron	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19							integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		agagaaagaaagaaagaaaaga	0.233													4	3	---	---	---	---	
SMARCAD1	56916	broad.mit.edu	37	4	95202130	95202133	+	Intron	DEL	AGTT	-	-	rs34519004		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95202130_95202133delAGTT	uc003htc.3	+						SMARCAD1_uc003htb.3_Intron|SMARCAD1_uc003htd.3_Intron|SMARCAD1_uc010ila.2_Intron|SMARCAD1_uc011cdw.1_Intron	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated						chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AACAATAGAAAGTTAGTAGACTGT	0.304													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187300383	187300384	+	Intron	INS	-	AC	AC	rs142090780	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187300383_187300384insAC	uc003izb.1	-											Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		TTCAGACTGCAacacacacaca	0.124													3	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11346669	11346676	+	Frame_Shift_Del	DEL	GGCATTCT	-	-	rs140702980		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11346669_11346676delGGCATTCT	uc003jfa.1	-	9	1581_1588	c.1436_1443delAGAATGCC	c.(1435-1443)CAGAATGCCfs	p.Q479fs	CTNND2_uc010itt.2_Frame_Shift_Del_p.Q388fs|CTNND2_uc011cmy.1_Frame_Shift_Del_p.Q142fs|CTNND2_uc011cmz.1_Frame_Shift_Del_p.Q46fs|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Frame_Shift_Del_p.Q46fs	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	479_481					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGGCCGCGGCGGCATTCTGTGGGCCGTG	0.611													54	39	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	22995414	22995415	+	IGR	INS	-	TTCC	TTCC			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22995414_22995415insTTCC								CDH12 (141683 upstream) : PRDM9 (512309 downstream)																							tctggttgtttttccttccttc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51404202	51404205	+	IGR	DEL	CTTC	-	-	rs72287549		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51404202_51404205delCTTC								ISL1 (713645 upstream) : ITGA1 (679569 downstream)																							ttctttctttcttccttccttcct	0.142													7	6	---	---	---	---	
MRPS36	92259	broad.mit.edu	37	5	68524875	68524875	+	Intron	DEL	G	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68524875delG	uc003jvq.2	+						MRPS36_uc003jvr.2_Intron	NM_033281	NP_150597	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		aaaaaaaaaagaaTTGATATG	0.119													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475749	90475749	+	IGR	DEL	G	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475749delG								GPR98 (15717 upstream) : ARRDC3 (188792 downstream)																							aaggaaggaaggaaggaagga	0.030													12	6	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	170101134	170101137	+	Intron	DEL	AGGA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170101134_170101137delAGGA	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAAAGCAATGaggaaggaaggaag	0.049													5	3	---	---	---	---	
TAPBP	6892	broad.mit.edu	37	6	33280796	33280796	+	Intron	DEL	T	-	-	rs67868917		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33280796delT	uc003odx.1	-						TAPBP_uc010jus.1_Intron|TAPBP_uc003ody.2_Intron|TAPBP_uc003odz.2_Intron|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Intron	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						TTTTTTTTTGTTTTTTTTTTT	0.303													8	6	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43533306	43533306	+	Intron	DEL	A	-	-	rs113079021		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43533306delA	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			atctcaaaataaaaaaaaaaa	0.139													3	3	---	---	---	---	
DDX43	55510	broad.mit.edu	37	6	74122243	74122246	+	Intron	DEL	GTGT	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74122243_74122246delGTGT	uc003pgw.2	+							NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						gagagagagagtgtgtgtgtgtgt	0.132													4	2	---	---	---	---	
BACH2	60468	broad.mit.edu	37	6	90891048	90891049	+	Intron	DEL	GT	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90891048_90891049delGT	uc011eab.1	-						BACH2_uc003pnw.2_Intron|BACH2_uc010kch.2_Intron	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CCACtgtgtggtgtgtgtgtgt	0.257													4	2	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112463694	112463695	+	Intron	INS	-	A	A	rs141758766	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112463694_112463695insA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGAAAGAAAGCAAAAAAAAAGT	0.391													6	3	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35029716	35029718	+	Intron	DEL	ATC	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35029716_35029718delATC	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						CCTCCAAAAGATCATTAGTCAAA	0.266													4	4	---	---	---	---	
ASL	435	broad.mit.edu	37	7	65557449	65557449	+	Intron	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65557449delA	uc003tuo.2	+						ASL_uc003tup.2_Intron|ASL_uc003tur.2_Intron|ASL_uc003tuq.2_Intron	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1						arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)	tgtcaaaaagaaaaaaaaaaa	0.264													21	10	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83824113	83824113	+	5'UTR	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83824113delA	uc003uhz.2	-	1						NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						CTCCaaaaagaaaaaaaaaaa	0.373													5	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151834021	151834022	+	Intron	DEL	AA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151834021_151834022delAA	uc003wla.2	-						MLL3_uc003wkz.2_Intron|MLL3_uc003wkx.2_Intron|MLL3_uc003wky.2_3'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TGCCCACGGCAAAGACACAGGG	0.465			N		medulloblastoma								35	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	12746384	12746392	+	IGR	DEL	GGGAAGGGA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12746384_12746392delGGGAAGGGA								LOC340357 (77474 upstream) : C8orf79 (56759 downstream)																							agagacagaggggaagggagggagggaag	0.010													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84526578	84526579	+	IGR	DEL	TC	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84526578_84526579delTC								None (None upstream) : RALYL (568874 downstream)																							tctttctctttctctctctctc	0.000													8	4	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	6940023	6940023	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6940023delT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						ccttccttccttccttccttc	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45738032	45738033	+	IGR	DEL	GT	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45738032_45738033delGT								FAM27A (9750 upstream) : KGFLP1 (949533 downstream)																							TTCTGAAtgcgtgtgtgtgtgt	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	79645947	79645948	+	IGR	INS	-	T	T	rs145660569	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79645947_79645948insT								FOXB2 (10078 upstream) : VPS13A (146413 downstream)																							TGTCTGGAAGATTTGAGTTTAC	0.351													5	3	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131597418	131597418	+	Intron	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131597418delA	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	catctcaaccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29029168	29029171	+	IGR	DEL	CTCT	-	-	rs56300405		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29029168_29029171delCTCT								BAMBI (57300 upstream) : LYZL1 (548819 downstream)																							tccttccttcctctctctctttct	0.088													4	6	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88836153	88836153	+	Intron	DEL	A	-	-	rs5786757		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88836153delA	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCCCCCATGTAAAAAAAAAAG	0.259													3	4	---	---	---	---	
TNKS2	80351	broad.mit.edu	37	10	93582313	93582314	+	Intron	INS	-	TGTTT	TGTTT	rs139143201	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93582313_93582314insTGTTT	uc001khp.2	+							NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				GAGATACCATAtgttttgtttt	0.149													6	3	---	---	---	---	
ABCC8	6833	broad.mit.edu	37	11	17452095	17452095	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17452095delT	uc001mnc.2	-							NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	tcaacaCTGGTTTTTTTTTTT	0.244													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45765009	45765012	+	IGR	DEL	AGGA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45765009_45765012delAGGA								CHST1 (77837 upstream) : DKFZp779M0652 (27971 downstream)																							ggagggagggaggaaggaaggaag	0.000													3	3	---	---	---	---	
C11orf30	56946	broad.mit.edu	37	11	76169535	76169536	+	Intron	INS	-	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76169535_76169536insT	uc001oxl.2	+						C11orf30_uc001oxk.2_3'UTR|C11orf30_uc009yuj.1_Intron|C11orf30_uc010rsa.1_Intron|C11orf30_uc001oxm.2_Intron|C11orf30_uc010rsb.1_Intron|C11orf30_uc010rsc.1_Intron|C11orf30_uc001oxn.2_Intron|C11orf30_uc010rsd.1_Intron	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						GTAGGAAACTCTAATTCTGAAA	0.292													6	4	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89868965	89868965	+	Intron	DEL	T	-	-	rs34639551		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89868965delT	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Intron|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AGTCATCAACTTTTTTTTTTT	0.308													6	3	---	---	---	---	
C1S	716	broad.mit.edu	37	12	7171338	7171339	+	Intron	DEL	TT	-	-	rs16933078	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7171338_7171339delTT	uc001qsj.2	+						C1S_uc001qsk.2_Intron|C1S_uc001qsl.2_Intron|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_Intron	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	gctatgtcACTTACACACACAC	0.228													4	5	---	---	---	---	
C1RL	51279	broad.mit.edu	37	12	7249880	7249880	+	Intron	DEL	T	-	-	rs71743195		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7249880delT	uc001qsn.2	-						C1RL_uc009zft.2_Intron	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						GATCAGGACGttttttttttt	0.269													3	3	---	---	---	---	
OVCH1	341350	broad.mit.edu	37	12	29648546	29648547	+	Intron	INS	-	TT	TT			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29648546_29648547insTT	uc001rix.1	-							NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CAATGGTCATATTTTTTTTAAT	0.277													3	4	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31255056	31255056	+	Intron	DEL	C	-	-	rs145143657		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255056delC	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron|DDX11_uc009zjo.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGAGGATTTCCCCCAAAGTC	0.607										Multiple Myeloma(12;0.14)			8	4	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54967655	54967656	+	Intron	DEL	GT	-	-	rs56974446	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54967655_54967656delGT	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						GAGAGAGAGAgtgtgtgtgtgt	0.292													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59011806	59011807	+	Intron	INS	-	ACA	ACA	rs146794470	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59011806_59011807insACA	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																		GTGACACGTATacaacaacaac	0.035													5	4	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77208911	77208911	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77208911delT	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						ACTTTTTTTCTTTTTACTTTA	0.294													4	5	---	---	---	---	
TSPAN19	144448	broad.mit.edu	37	12	85423550	85423550	+	Frame_Shift_Del	DEL	A	-	-	rs59822389		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85423550delA	uc009zsj.2	-	3	187	c.86delT	c.(85-87)ATGfs	p.M29fs		NM_001100917	NP_001094387	P0C672	TSN19_HUMAN	tetraspanin 19	29	Helical; (Potential).					integral to membrane				ovary(1)	1						ACCAAATCCCATGAATAAAAG	0.264													4	4	---	---	---	---	
C12orf63	374467	broad.mit.edu	37	12	97073169	97073170	+	Intron	INS	-	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97073169_97073170insT	uc001tet.1	+							NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467											skin(6)|ovary(1)	7						GTTTTCCAAGCTTTTTTTTTTT	0.317													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101713543	101713543	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101713543delT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TATTAAAGCCTTTTTTTTTTT	0.294													9	4	---	---	---	---	
VPS33A	65082	broad.mit.edu	37	12	122748030	122748033	+	Intron	DEL	GAGT	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122748030_122748033delGAGT	uc001ucd.2	-						VPS33A_uc001ucc.2_Intron|VPS33A_uc001uce.2_Intron	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A						lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		GCACTGGCAAGAGTGAGGGTCTTC	0.309													40	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	75588839	75588840	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs9543833		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75588839_75588840insCTTCCTTC								KLF12 (880445 upstream) : LOC647288 (223050 downstream)																							tttctttctttcttccttcctt	0.139													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92487733	92487734	+	Intron	DEL	AA	-	-	rs35038594		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92487733_92487734delAA	uc001xzy.2	-							NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		attctgtctcaaaaaaaaaaaa	0.030			T	PDGFRB	AML								8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38043628	38043631	+	IGR	DEL	AGGA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38043628_38043631delAGGA								MEIS2 (650128 upstream) : TMCO5A (183196 downstream)																							aaggaaaaagaggaaggaaggaag	0.074													4	2	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43237806	43237806	+	Intron	DEL	T	-	-	rs11352938		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43237806delT	uc001zqq.2	-							NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AAAAGGGATATTTTCCCTTCA	0.393													7	4	---	---	---	---	
NARG2	79664	broad.mit.edu	37	15	60724317	60724318	+	Intron	INS	-	A	A	rs79241004		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60724317_60724318insA	uc002agp.2	-						NARG2_uc002ago.2_Intron	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a							nucleus				ovary(1)|lung(1)	2						ATACAAAAAATCTGAAACTTAT	0.198													5	5	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													9	5	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13267235	13267236	+	Intron	DEL	AC	-	-	rs66910345		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13267235_13267236delAC	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						GTGTGCATGTacacacacacac	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75226283	75226283	+	IGR	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75226283delT								ZFP1 (20152 upstream) : CTRB2 (11712 downstream)																							AAATCAGAACTTTTTTTTTTT	0.179													3	5	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	69293	69294	+	Intron	INS	-	TTTCT	TTTCT	rs146351269	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69293_69294insTTTCT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		cggccTAATAGTTTCATTTCTT	0.099													8	4	---	---	---	---	
NUP88	4927	broad.mit.edu	37	17	5320152	5320153	+	Intron	INS	-	T	T	rs11391160		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5320152_5320153insT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						TAACTCACAAAttttttttttt	0.158													5	3	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20297192	20297193	+	Intron	INS	-	T	T			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20297192_20297193insT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						TAGGCATGCTCTAACACATTTT	0.322													4	2	---	---	---	---	
GPATCH8	23131	broad.mit.edu	37	17	42483650	42483650	+	Intron	DEL	A	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42483650delA	uc002igw.1	-						GPATCH8_uc002igv.1_Intron|GPATCH8_uc010wiz.1_Intron	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8							intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TTTATTAGGCAAAATAAAATG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53285927	53285938	+	IGR	DEL	GGAGGGAGGGAA	-	-	rs55796427	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53285927_53285938delGGAGGGAGGGAA								STXBP4 (44478 upstream) : HLF (56383 downstream)																							aggaaggaagggagggagggaagaaggaagga	0.156													3	5	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55693642	55693643	+	Intron	INS	-	TG	TG	rs141665856	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55693642_55693643insTG	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		gtgtgcatgcatgtgtgtgtgt	0.134			T	HOXA9	CML								3	3	---	---	---	---	
ABCA9	10350	broad.mit.edu	37	17	67025160	67025161	+	Intron	INS	-	T	T	rs141967149	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67025160_67025161insT	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TGTTTTATGGGTTTTTTTTTTA	0.277													4	3	---	---	---	---	
C17orf80	55028	broad.mit.edu	37	17	71238649	71238650	+	Intron	INS	-	C	C	rs138492113	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71238649_71238650insC	uc002jjm.3	+						C17orf80_uc010wqu.1_Intron|C17orf80_uc010dfj.2_Intron|C17orf80_uc002jjk.1_Intron|C17orf80_uc002jjl.3_Intron	NM_017941	NP_060411	Q9BSJ5	CQ080_HUMAN	lung cancer-related protein 8 isoform a							integral to membrane				skin(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			ATTTTGGAGTTGGACATAATTG	0.376													5	6	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72439809	72439809	+	Intron	DEL	G	-	-	rs3840056		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72439809delG	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_Frame_Shift_Del_p.G57fs	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						CCCCCAAGTTGGCCACTCCTG	0.602													4	2	---	---	---	---	
SLMO1	10650	broad.mit.edu	37	18	12421454	12421456	+	Intron	DEL	TAA	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12421454_12421456delTAA	uc002kra.2	+						SLMO1_uc010wzu.1_Intron|SLMO1_uc010wzv.1_Intron	NM_001142405	NP_001135877	Q96N28	SLMO1_HUMAN	slowmo homolog 1 isoform 1												0						AATAGTGAACTAATTAGTAAATG	0.433													26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39758218	39758221	+	IGR	DEL	GAAG	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39758218_39758221delGAAG								PIK3C3 (96774 upstream) : RIT2 (564972 downstream)																							gagggagggagaaggaaggaagga	0.000													4	2	---	---	---	---	
MEX3C	51320	broad.mit.edu	37	18	48702651	48702651	+	3'UTR	DEL	G	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48702651delG	uc002lfc.3	-	2						NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2							cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		GAAGTTTACTGGGGGGTACCA	0.333													5	4	---	---	---	---	
TMPRSS9	360200	broad.mit.edu	37	19	2418276	2418276	+	Intron	DEL	T	-	-	rs112073170		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418276delT	uc010xgx.1	+							NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ccttccctccttttcctttcc	0.124													4	2	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2618341	2618342	+	Intron	DEL	GT	-	-	rs67734337		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2618341_2618342delGT	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tatgtgtgtggtgtgtgtgtgt	0.233													4	4	---	---	---	---	
UBXN6	80700	broad.mit.edu	37	19	4448485	4448486	+	Intron	DEL	AG	-	-	rs60087438		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4448485_4448486delAG	uc002man.1	-						UBXN6_uc010dty.1_Intron|UBXN6_uc002mam.1_Intron	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6							microtubule organizing center|nucleus	protein binding				0						CCCAGGTAACAGGGGCAGGAAA	0.653													3	5	---	---	---	---	
AP1M2	10053	broad.mit.edu	37	19	10689692	10689692	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10689692delT	uc002mpc.2	-						AP1M2_uc002mpd.2_Intron	NM_005498	NP_005489	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit						cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(2)	2			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GACTCTCttcttttttttttt	0.239													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17750846	17750846	+	Intron	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750846delT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TTCTATGGCAttttttttttt	0.254													9	6	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18531714	18531715	+	Intron	DEL	TC	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18531714_18531715delTC	uc002wqz.1	+						SEC23B_uc002wra.1_Intron|SEC23B_uc002wrb.1_Intron|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Intron	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						ATGCCATCTTTCTCTCTCTTTT	0.455													85	46	---	---	---	---	
OSBPL2	9885	broad.mit.edu	37	20	60866681	60866686	+	Intron	DEL	GAGATC	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60866681_60866686delGAGATC	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			ATGCCAACTAGAGATCTAGGTGCATA	0.563													15	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10437122	10437122	+	IGR	DEL	C	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10437122delC								None (None upstream) : TPTE (469621 downstream)																							tcaaaattttctattctttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23605003	23605003	+	IGR	DEL	A	-	-	rs66463347		TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23605003delA								NCAM2 (693789 upstream) : None (None downstream)																							ggaaggaaggaaaagaaggaa	0.169													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499407	40499408	+	IGR	INS	-	G	G	rs145268564	by1000genomes	TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499407_40499408insG								ETS2 (302531 upstream) : PSMG1 (47982 downstream)																							TTCATTGTtttttttttgtttt	0.312													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	54868437	54868437	+	IGR	DEL	T	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54868437delT								MAGED2 (25992 upstream) : TRO (78812 downstream)																							TGGTTTTACCTTTTTTTTTTG	0.378													6	3	---	---	---	---	
GPRASP1	9737	broad.mit.edu	37	X	101911040	101911041	+	Frame_Shift_Ins	INS	-	G	G			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101911040_101911041insG	uc004ejj.3	+	5	3000_3001	c.2199_2200insG	c.(2197-2202)GATGGGfs	p.D733fs	GPRASP1_uc004eji.3_Frame_Shift_Ins_p.D733fs|GPRASP1_uc010nod.2_Frame_Shift_Ins_p.D733fs	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	733_734	Glu-rich.					cytoplasm	protein binding			ovary(1)|lung(1)	2						GTAATATAGATGGGACTGGAGA	0.441													41	75	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155235936	155235937	+	Intron	DEL	TG	-	-			TCGA-B0-5115-01A-01D-1421-08	TCGA-B0-5115-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155235936_155235937delTG	uc004fnv.1	+						IL9R_uc010nvn.2_Intron|IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gatgtgtgactgtgtgcatgtg	0.361													4	2	---	---	---	---	
