Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA0467	23334	broad.mit.edu	37	1	43914130	43914130	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43914130C>A	uc001cjk.1	+	54	7709	c.7247C>A	c.(7246-7248)TCC>TAC	p.S2416Y	KIAA0467_uc001cjl.1_Missense_Mutation_p.S404Y	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	3315						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CATGCCAAATCCATTGGGGAC	0.627													11	24	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62550236	62550236	+	Silent	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62550236C>T	uc001dab.2	+	33	4407	c.4293C>T	c.(4291-4293)GTC>GTT	p.V1431V	INADL_uc009waf.1_Silent_p.V1431V|INADL_uc001daa.2_Silent_p.V1431V|INADL_uc001dad.3_Silent_p.V1128V|INADL_uc001dac.2_RNA|INADL_uc010oot.1_Silent_p.V215V|INADL_uc009wag.2_Silent_p.V215V|INADL_uc010oou.1_Silent_p.V104V	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1431					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GTCCCATTGTCCCTGGACAGG	0.488													39	108	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94466408	94466408	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94466408G>T	uc001dqh.2	-	47	6567	c.6463C>A	c.(6463-6465)CAG>AAG	p.Q2155K		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	2155	ABC transporter 2.|Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTGAGATGCTGAATGGTGCCC	0.552													4	135	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145075923	145075923	+	5'UTR	SNP	C	T	T	rs6656135		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145075923C>T	uc001emh.2	-	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'UTR|PDE4DIP_uc001emk.2_5'UTR	NM_022359	NP_071754	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTCCTGGTGTCTTCCGGGACT	0.667			T	PDGFRB	MPD								3	33	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185109279	185109279	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185109279G>C	uc001grf.3	-	8	1207	c.935C>G	c.(934-936)TCT>TGT	p.S312C	C1orf25_uc010pon.1_Missense_Mutation_p.S156C	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA	312						intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						CAGTGTCACAGAATTTTCATT	0.363													41	195	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186320603	186320603	+	Splice_Site	SNP	C	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186320603C>G	uc001grv.2	-	20	2767	c.2470_splice	c.e20-1	p.G824_splice		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCAGTATTCCCTAAAGCAAAG	0.323			T	NTRK1	papillary thyroid								7	182	---	---	---	---	PASS
SLC41A1	254428	broad.mit.edu	37	1	205767800	205767800	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205767800G>T	uc001hdh.1	-	6	1713	c.841C>A	c.(841-843)CTG>ATG	p.L281M	SLC41A1_uc001hdg.1_5'Flank|uc001hdi.1_5'Flank	NM_173854	NP_776253	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 member 1	281						integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			skin(2)	2	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GGCTCACTCAGTTCCAGGTAG	0.547													41	93	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1983506	1983506	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1983506T>C	uc002qxe.2	-	6	871	c.44A>G	c.(43-45)AAA>AGA	p.K15R	MYT1L_uc002qxd.2_Missense_Mutation_p.K15R|MYT1L_uc002qxf.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	15					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCGAACCCCTTTGGACCGCGT	0.597													13	37	---	---	---	---	PASS
ABCG5	64240	broad.mit.edu	37	2	44040251	44040251	+	3'UTR	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44040251T>C	uc002rtn.2	-	13					ABCG5_uc002rtm.2_3'UTR|ABCG5_uc002rto.2_3'UTR|ABCG5_uc002rtp.2_3'UTR	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGCCATGGCTTTCACTACCTG	0.408													16	33	---	---	---	---	PASS
TSPYL6	388951	broad.mit.edu	37	2	54482422	54482422	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54482422C>A	uc002rxr.2	-	1	988	c.867G>T	c.(865-867)AGG>AGT	p.R289S	ACYP2_uc002rxq.3_Intron	NM_001003937	NP_001003937	Q8N831	TSYL6_HUMAN	TSPY-like 6	289					nucleosome assembly	nucleus					0						TGCAGCCTGTCCTAGGGTGTC	0.468													80	196	---	---	---	---	PASS
PCGF1	84759	broad.mit.edu	37	2	74732306	74732306	+	Silent	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74732306C>T	uc002slz.2	-	9	770	c.744G>A	c.(742-744)TTG>TTA	p.L248L	LBX2_uc002slw.2_5'Flank|PCGF1_uc002sly.2_Silent_p.L165L	NM_032673	NP_116062	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	248					histone H2A monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	protein C-terminus binding|zinc ion binding			ovary(1)	1						ATTGTAAAAGCAAAGGGGATG	0.507													5	8	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47162787	47162787	+	Nonsense_Mutation	SNP	A	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47162787A>C	uc003cqs.2	-	3	3392	c.3339T>G	c.(3337-3339)TAT>TAG	p.Y1113*	SETD2_uc003cqv.2_Nonsense_Mutation_p.Y1102*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1113					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	p.D1113N(1)		kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTTTTCCTCATACAAATGTC	0.373			N|F|S|Mis		clear cell renal carcinoma								67	122	---	---	---	---	PASS
GMPPB	29925	broad.mit.edu	37	3	49760159	49760159	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49760159T>C	uc003cxk.1	-	5	656	c.431A>G	c.(430-432)TAC>TGC	p.Y144C	AMIGO3_uc003cxj.2_5'Flank|GMPPB_uc003cxl.1_Missense_Mutation_p.Y144C	NM_021971	NP_068806	Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B isoform 2	144					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity				0				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CACCACACCGTACTTGGAGGG	0.542													6	8	---	---	---	---	PASS
WNT5A	7474	broad.mit.edu	37	3	55504067	55504067	+	3'UTR	SNP	T	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55504067T>A	uc003dhn.2	-	5					WNT5A_uc003dhm.2_3'UTR|WNT5A_uc010hmw.2_3'UTR|WNT5A_uc010hmx.2_3'UTR	NM_003392	NP_003383	P41221	WNT5A_HUMAN	wingless-type MMTV integration site family,						activation of JUN kinase activity|activation of protein kinase B activity|axon guidance|cartilage development|cellular protein localization|cellular response to calcium ion|cellular response to interferon-gamma|cellular response to lipopolysaccharide|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|cervix development|cochlea morphogenesis|convergent extension involved in organogenesis|dopaminergic neuron differentiation|dorsal/ventral axis specification|embryonic digit morphogenesis|embryonic skeletal system development|epithelial cell proliferation involved in mammary gland duct elongation|epithelial to mesenchymal transition|face development|genitalia development|heart looping|hemopoietic stem cell proliferation|keratinocyte differentiation|lateral sprouting involved in mammary gland duct morphogenesis|lens development in camera-type eye|male gonad development|mammary gland branching involved in thelarche|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of mesenchymal cell proliferation|negative regulation of transcription, DNA-dependent|neural tube closure|olfactory bulb interneuron development|optic cup formation involved in camera-type eye development|palate development|positive regulation of angiogenesis|positive regulation of cartilage development|positive regulation of cGMP metabolic process|positive regulation of chemokine biosynthetic process|positive regulation of cytokine secretion involved in immune response|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of macrophage activation|positive regulation of macrophage cytokine production|positive regulation of mesenchymal cell proliferation|positive regulation of neuron projection development|positive regulation of NF-kappaB transcription factor activity|positive regulation of ossification|positive regulation of protein catabolic process|positive regulation of protein kinase C signaling cascade|positive regulation of T cell chemotaxis|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|primitive streak formation|regulation of branching involved in mammary gland duct morphogenesis|somitogenesis|tail morphogenesis|type B pancreatic cell development|urinary bladder development|uterus development|vagina development|Wnt receptor signaling pathway, calcium modulating pathway|wound healing	extracellular space|membrane fraction|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|receptor tyrosine kinase-like orphan receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		ATCACTGTACTTTCTATAAAT	0.433													16	35	---	---	---	---	PASS
APPL1	26060	broad.mit.edu	37	3	57286328	57286328	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57286328G>T	uc003dio.2	+	12	1231	c.1084G>T	c.(1084-1086)GAT>TAT	p.D362Y	APPL1_uc010hnb.2_Missense_Mutation_p.D362Y|APPL1_uc011bey.1_Missense_Mutation_p.D345Y	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH	362	Required for RAB5A binding.|PH.				apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		GAGTAAAAAAGATCATGAAGA	0.294													4	86	---	---	---	---	PASS
GPR171	29909	broad.mit.edu	37	3	150917098	150917098	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150917098G>A	uc003eyq.3	-	3	316	c.76C>T	c.(76-78)CTT>TTT	p.L26F	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_013308	NP_037440	O14626	GP171_HUMAN	G protein-coupled receptor 171	26	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATTCCAACAAGGAAAACTAAA	0.368													52	125	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196771400	196771400	+	3'UTR	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196771400G>A	uc003fxo.3	-	26					DLG1_uc011bub.1_3'UTR|DLG1_uc011buc.1_3'UTR|DLG1_uc011bud.1_3'UTR|DLG1_uc003fxn.3_3'UTR|DLG1_uc011bue.1_3'UTR|DLG1_uc010ial.2_3'UTR	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AATTCAACATGAAATCAGTAC	0.378													12	25	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52861345	52861345	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52861345C>A	uc003gzi.2	-	4	1856	c.1843G>T	c.(1843-1845)GAC>TAC	p.D615Y		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	615						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						ATCTGCGAGTCCCAAAGTGAC	0.493													41	120	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55156689	55156689	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55156689G>T	uc003han.3	+	22	3421	c.3090G>T	c.(3088-3090)GAG>GAT	p.E1030D	PDGFRA_uc003haa.2_Missense_Mutation_p.E790D	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	1030	Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CTGTCCCTGAGGAGGAGGACC	0.587			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			36	95	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55156690	55156690	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55156690G>T	uc003han.3	+	22	3422	c.3091G>T	c.(3091-3093)GAG>TAG	p.E1031*	PDGFRA_uc003haa.2_Nonsense_Mutation_p.E791*	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	1031	Cytoplasmic (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TGTCCCTGAGGAGGAGGACCT	0.587			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			35	94	---	---	---	---	PASS
ACSL6	23305	broad.mit.edu	37	5	131289980	131289980	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131289980G>T	uc010jdo.1	-	21	2124	c.2041C>A	c.(2041-2043)CTG>ATG	p.L681M	ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Missense_Mutation_p.L706M|ACSL6_uc003kvy.1_Missense_Mutation_p.L706M|ACSL6_uc003kwb.2_Missense_Mutation_p.L671M|ACSL6_uc003kvz.1_Missense_Mutation_p.L606M|ACSL6_uc003kwa.1_Missense_Mutation_p.L692M|ACSL6_uc003kvw.1_Missense_Mutation_p.L327M|ACSL6_uc010jdn.1_Missense_Mutation_p.L696M	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	681	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TACTCTCTCAGCTCAGGTCTC	0.373													29	112	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173317516	173317516	+	Silent	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317516C>A	uc003mcs.3	+	1	2186	c.780C>A	c.(778-780)CCC>CCA	p.P260P	CPEB4_uc010jju.1_Silent_p.P260P|CPEB4_uc010jjv.2_Silent_p.P260P|CPEB4_uc011dfg.1_Silent_p.P260P|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	260							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATCCCCCACCCTTCACACATA	0.542													6	369	---	---	---	---	PASS
GMPR	2766	broad.mit.edu	37	6	16274694	16274694	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16274694G>A	uc003nbs.2	+	5	628	c.514G>A	c.(514-516)GGA>AGA	p.G172R		NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	172					nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				TATTCTTTCCGGAGCAGATAT	0.483													3	101	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27420988	27420988	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27420988G>A	uc003njj.2	-	5	1161	c.350C>T	c.(349-351)TCT>TTT	p.S117F	ZNF184_uc010jqv.2_Missense_Mutation_p.S117F|ZNF184_uc003nji.2_Missense_Mutation_p.S117F	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	117					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTCTTCTTCAGAAATGTCAGG	0.373													73	187	---	---	---	---	PASS
TTBK1	84630	broad.mit.edu	37	6	43230690	43230690	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43230690G>T	uc003ouq.1	+	13	1867	c.1588G>T	c.(1588-1590)GTG>TTG	p.V530L	TTBK1_uc011dvg.1_Missense_Mutation_p.V53L	NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	530						cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CTTCCGCTCGGTGCCGCTGGC	0.637													4	17	---	---	---	---	PASS
SNHG5	387066	broad.mit.edu	37	6	86387116	86387116	+	Intron	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86387116T>C	uc003plb.3	-						SNHG5_uc003plc.3_Intron|SNHG5_uc003pld.3_Intron|SNHG5_uc003plf.2_RNA|SNORD50A_uc003ple.2_5'Flank					Homo sapiens chromosome 6 open reading frame 160, mRNA (cDNA clone IMAGE:3927795).												0						CACTGATCTCTAAGCAAACAG	0.413													46	91	---	---	---	---	PASS
TAAR6	319100	broad.mit.edu	37	6	132892288	132892288	+	Silent	SNP	T	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132892288T>A	uc011eck.1	+	1	828	c.828T>A	c.(826-828)ATT>ATA	p.I276I		NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	276	Helical; Name=6; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(1)	3	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		CATATAGCATTGATTCATTAA	0.408													74	168	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7398296	7398296	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7398296T>G	uc003src.1	-	35	3463	c.3346A>C	c.(3346-3348)AAG>CAG	p.K1116Q	COL28A1_uc011jxe.1_Missense_Mutation_p.K799Q	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	1116	BPTI/Kunitz inhibitor.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TGACATTCCTTTTCACTGTTG	0.398													76	167	---	---	---	---	PASS
IGF2BP3	10643	broad.mit.edu	37	7	23508130	23508130	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23508130T>A	uc003swg.2	-	2	473	c.207A>T	c.(205-207)GAA>GAT	p.E69D	IGF2BP3_uc003swh.1_RNA	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	69	RRM 1.				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						AGTGCTCAACTTCTATGGGTT	0.547													107	296	---	---	---	---	PASS
GPR141	353345	broad.mit.edu	37	7	37780155	37780155	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37780155G>A	uc003tfm.1	+	1	160	c.160G>A	c.(160-162)GCG>ACG	p.A54T	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	54	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						GACCACCATGGCGGTCATTAA	0.498													4	136	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114269991	114269991	+	Silent	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114269991G>A	uc003vhb.2	+	5	902	c.528G>A	c.(526-528)CAG>CAA	p.Q176Q	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.Q201Q|FOXP2_uc003vha.2_Silent_p.Q84Q|FOXP2_uc011kmu.1_Silent_p.Q193Q|FOXP2_uc011kmv.1_Silent_p.Q176Q|FOXP2_uc010ljz.1_Silent_p.Q84Q|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.Q176Q|FOXP2_uc003vgx.2_Silent_p.Q176Q|FOXP2_uc003vhd.2_Silent_p.Q176Q|FOXP2_uc003vhc.2_Silent_p.Q201Q	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	176	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						aacaacagcagcaacaacagc	0.159													3	25	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135277919	135277919	+	Silent	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135277919C>A	uc003vsw.2	+	12	1840	c.1809C>A	c.(1807-1809)CTC>CTA	p.L603L		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	603					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						TTTTGCAGCTCACGTCTACCA	0.423													44	109	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142468277	142468277	+	Intron	SNP	T	C	C	rs147433434	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142468277T>C	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|uc011ksp.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		AATCCACTCCTGATCCTTGCC	0.572													6	84	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86022348	86022348	+	Splice_Site	SNP	A	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86022348A>T	uc003ycw.2	+	3	465	c.311_splice	c.e3-2	p.G104_splice	LRRCC1_uc010lzz.1_Splice_Site|LRRCC1_uc010maa.1_Splice_Site|LRRCC1_uc003ycx.2_Splice_Site_p.G11_splice|LRRCC1_uc003ycy.2_Splice_Site_p.G84_splice	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a						cell division|mitosis	centriole|nucleus					0						ttttttttttaGGACTTGAAG	0.224													4	142	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133152339	133152339	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133152339C>T	uc003ytj.2	-	11	1777	c.1552G>A	c.(1552-1554)GCC>ACC	p.A518T	KCNQ3_uc010mdt.2_Missense_Mutation_p.A518T	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	518					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCTCGGATGGCGGCCTTCAGG	0.607													3	75	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101798612	101798612	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101798612T>G	uc004azb.1	+	21	2549	c.2343T>G	c.(2341-2343)GAT>GAG	p.D781E		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	781	Triple-helical region 3 (COL3).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GGGGGATGGATGGAGCCAGTA	0.522													6	124	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111640376	111640376	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111640376C>T	uc004bdm.3	-	35	4274	c.3754G>A	c.(3754-3756)GGA>AGA	p.G1252R	IKBKAP_uc004bdl.2_Missense_Mutation_p.G903R|IKBKAP_uc011lwc.1_Missense_Mutation_p.G1138R|IKBKAP_uc010mtq.2_Missense_Mutation_p.G903R|IKBKAP_uc004bdk.2_Missense_Mutation_p.G256R|IKBKAP_uc010mtp.2_RNA	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	1252					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						AATTCCCTTCCTTGTTCATCA	0.393													52	136	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123917154	123917154	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123917154C>A	uc004bkx.1	+	25	4359	c.4328C>A	c.(4327-4329)GCA>GAA	p.A1443E	CEP110_uc004bla.1_Missense_Mutation_p.A891E|CEP110_uc010mvo.1_Missense_Mutation_p.A112E|CEP110_uc004blb.1_Missense_Mutation_p.A112E|CEP110_uc010mvp.1_5'Flank	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1443	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						CGACTCCTGGCAGAGGCTGAG	0.468													44	150	---	---	---	---	PASS
DBH	1621	broad.mit.edu	37	9	136521598	136521598	+	Intron	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136521598G>A	uc004cel.2	+						uc010nao.1_Missense_Mutation_p.T65M	NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor						hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	GGATGGCAGCGTCTGCGTGGC	0.607													10	24	---	---	---	---	PASS
CARD9	64170	broad.mit.edu	37	9	139262211	139262211	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139262211T>G	uc004chg.3	-	8	1313	c.1147A>C	c.(1147-1149)AAG>CAG	p.K383Q	CARD9_uc011mdw.1_Missense_Mutation_p.K383Q|CARD9_uc011mdx.1_Missense_Mutation_p.K279Q	NM_052813	NP_434700	Q9H257	CARD9_HUMAN	caspase recruitment domain protein 9 isoform 1	383	Potential.				positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity			pancreas(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		CGCACCTGCTTGCGCAGCGCG	0.692													3	27	---	---	---	---	PASS
OR9G4	283189	broad.mit.edu	37	11	56510375	56510375	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56510375A>G	uc010rjo.1	-	1	913	c.913T>C	c.(913-915)TAT>CAT	p.Y305H		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	305	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						CTCAGGCTATAGATGAGAGGG	0.428													105	167	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59282457	59282457	+	Silent	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59282457C>T	uc010rkv.1	+	1	72	c.72C>T	c.(70-72)AGC>AGT	p.S24S		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAGAACTGAGCCAGGTCTTAT	0.413													83	229	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62297275	62297275	+	Silent	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62297275G>A	uc001ntl.2	-	5	4914	c.4614C>T	c.(4612-4614)GAC>GAT	p.D1538D	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1538					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AAACACCAAGGTCAGCCTTGG	0.502													121	259	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62652670	62652670	+	Silent	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62652670C>T	uc001nwd.2	+	9	1367	c.1143C>T	c.(1141-1143)AAC>AAT	p.N381N	SLC3A2_uc001nwb.2_Silent_p.N412N|SLC3A2_uc001nwc.2_Silent_p.N382N|SLC3A2_uc001nwe.2_Silent_p.N350N|SLC3A2_uc001nwf.2_Silent_p.N319N|SLC3A2_uc001nwg.2_Silent_p.N280N	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	381	Extracellular (Potential).				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						CGGGGACTAACTCCTCCGACC	0.423													49	141	---	---	---	---	PASS
DDI1	414301	broad.mit.edu	37	11	103908524	103908524	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103908524C>T	uc001phr.2	+	1	1217	c.974C>T	c.(973-975)CCC>CTC	p.P325L	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	325					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GAGGATCAACCCATGGATATG	0.458													6	219	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118498567	118498567	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118498567C>G	uc001ptr.1	+	7	1381	c.1028C>G	c.(1027-1029)GCC>GGC	p.A343G	PHLDB1_uc010ryh.1_Missense_Mutation_p.A342G|PHLDB1_uc001pts.2_Missense_Mutation_p.A343G|PHLDB1_uc001ptt.2_Missense_Mutation_p.A343G|PHLDB1_uc001ptu.1_Splice_Site|PHLDB1_uc001ptv.1_Missense_Mutation_p.A143G|PHLDB1_uc001ptw.1_5'Flank	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	343											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TTGGCGGAGGCCCGGAGAGCC	0.662													9	16	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6690533	6690533	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690533T>G	uc001qpo.2	-	32	4867	c.4703A>C	c.(4702-4704)GAA>GCA	p.E1568A	CHD4_uc001qpn.2_Missense_Mutation_p.E1561A|CHD4_uc001qpp.2_Missense_Mutation_p.E1593A|uc001qpq.1_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1568					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GAGGCTATTTTCCTCTATTTT	0.408													87	225	---	---	---	---	PASS
HNRNPA1	3178	broad.mit.edu	37	12	54678158	54678158	+	Intron	SNP	A	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54678158A>T	uc001sfl.2	+						HNRNPA1_uc001sfm.2_Intron|HNRNPA1_uc009zng.2_Intron|HNRNPA1_uc009znh.2_Intron|HNRNPA1_uc009zni.2_Intron|HNRNPA1_uc001sfn.2_Intron|HNRNPA1_uc001sfo.3_Intron|HNRNPA1_uc009znj.1_3'UTR	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1						interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3						GATGAACCCAATAACCCTAAT	0.348													18	31	---	---	---	---	PASS
BEST3	144453	broad.mit.edu	37	12	70087467	70087467	+	Silent	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70087467G>A	uc001svg.2	-	4	695	c.468C>T	c.(466-468)CAC>CAT	p.H156H	BEST3_uc001svd.1_Silent_p.H156H|BEST3_uc001sve.1_RNA|BEST3_uc010stm.1_Silent_p.H50H|BEST3_uc001svh.2_Intron|BEST3_uc001svi.1_RNA	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	156	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			CTTCAACCACGTGGTCCATTG	0.468													18	76	---	---	---	---	PASS
TMTC2	160335	broad.mit.edu	37	12	83526102	83526102	+	Silent	SNP	A	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83526102A>G	uc001szt.2	+	12	2877	c.2445A>G	c.(2443-2445)ACA>ACG	p.T815T	TMTC2_uc010suk.1_Silent_p.T570T	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	815						endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						ATGTCATCACACAGTCCAATC	0.522													23	47	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130897268	130897268	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130897268A>T	uc001uil.2	-	15	2881	c.2717T>A	c.(2716-2718)ATT>AAT	p.I906N		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	906	SH3 2.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GTTACAAGGAATAAGGCCAAG	0.463													4	131	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20025322	20025322	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20025322C>A	uc001umd.2	-	12	996	c.785G>T	c.(784-786)CGA>CTA	p.R262L	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.R151L|TPTE2_uc001ume.2_Missense_Mutation_p.R185L|TPTE2_uc009zzm.2_Intron|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	262	Phosphatase tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATTGTAGACTCGATAGTGGTT	0.338													40	138	---	---	---	---	PASS
PABPC3	5042	broad.mit.edu	37	13	25670664	25670664	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25670664A>C	uc001upy.2	+	1	389	c.328A>C	c.(328-330)ATT>CTT	p.I110L		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	110	RRM 2.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GGATAAGTCCATTAATAATAA	0.393													76	182	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33261392	33261392	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33261392A>C	uc010abf.2	+	12	1483	c.1325A>C	c.(1324-1326)CAT>CCT	p.H442P	PDS5B_uc001uuo.2_Missense_Mutation_p.H442P|PDS5B_uc010abg.2_RNA|PDS5B_uc010teb.1_Missense_Mutation_p.H144P	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	442					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAATTGCTACATATATATTAT	0.303													52	136	---	---	---	---	PASS
ABCC4	10257	broad.mit.edu	37	13	95830003	95830003	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95830003A>C	uc001vmd.3	-	13	1804	c.1685T>G	c.(1684-1686)CTC>CGC	p.L562R	ABCC4_uc010afk.2_Missense_Mutation_p.L562R|ABCC4_uc001vme.2_Missense_Mutation_p.L562R|ABCC4_uc010tih.1_Missense_Mutation_p.L487R|ABCC4_uc001vmf.2_Missense_Mutation_p.L519R|ABCC4_uc010afl.1_Missense_Mutation_p.L519R|ABCC4_uc010afm.1_Missense_Mutation_p.L575R	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	562	ABC transporter 1.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	TACTGCACTGAGAGGATCGTC	0.438													46	83	---	---	---	---	PASS
C14orf149	112849	broad.mit.edu	37	14	59942835	59942835	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59942835T>G	uc001xee.1	-	3	815	c.776A>C	c.(775-777)AAC>ACC	p.N259T		NM_144581	NP_653182	Q96EM0	PRCM_HUMAN	proline racemase-like	259							proline racemase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.14)	L-Proline(DB00172)	AACACAAATGTTGGTGGTTGG	0.333													60	278	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54025233	54025233	+	Silent	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54025233C>T	uc002acj.2	-	2	156	c.114G>A	c.(112-114)GAG>GAA	p.E38E	WDR72_uc010bfi.1_Silent_p.E38E	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	38	WD 1.									lung(1)|skin(1)	2				all cancers(107;0.0511)		AGAGCTGACCCTCTTGACTTC	0.488													67	174	---	---	---	---	PASS
RORA	6095	broad.mit.edu	37	15	60797816	60797816	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60797816T>C	uc002agv.2	-	7	1088	c.932A>G	c.(931-933)CAG>CGG	p.Q311R	uc002ags.1_Intron|RORA_uc002agt.3_Missense_Mutation_p.Q223R|RORA_uc002agw.2_Missense_Mutation_p.Q303R|RORA_uc002agx.2_Missense_Mutation_p.Q278R	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b	311	Ligand-binding.				positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						AGATATATTCTGTGCAAGGTG	0.368													7	236	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1389514	1389514	+	Silent	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1389514G>A	uc002clk.1	+	5	423	c.423G>A	c.(421-423)GAG>GAA	p.E141E	BAIAP3_uc002clj.2_Silent_p.E123E|BAIAP3_uc010uuz.1_Silent_p.E106E|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvb.1_Silent_p.E158E|BAIAP3_uc010uvc.1_Silent_p.E106E	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	141					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TGCTCTACGAGGAGGCCCTGT	0.682													9	20	---	---	---	---	PASS
ALG1	56052	broad.mit.edu	37	16	5134982	5134982	+	3'UTR	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5134982G>A	uc002cym.2	+	13					ALG1_uc002cyj.2_3'UTR|ALG1_uc002cyn.2_3'UTR|ALG1_uc010bue.2_3'UTR|ALG1_uc010uxy.1_3'UTR|FAM86A_uc002cyo.2_3'UTR|FAM86A_uc002cyp.2_3'UTR	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase						dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)				ACCTCCCAGTGGCCAGAAGCT	0.552													4	29	---	---	---	---	PASS
ABCC6P1	653190	broad.mit.edu	37	16	18602586	18602586	+	Missense_Mutation	SNP	G	A	A	rs139672562	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18602586G>A	uc002dfg.2	+	8	984	c.784G>A	c.(784-786)GTC>ATC	p.V262I	ABCC6P1_uc010vam.1_Missense_Mutation_p.V205I	NR_003569				SubName: Full=cDNA FLJ51267, highly similar to Multidrug resistance-associated protein 6;												0						CCTCAGCCTCGTCATCAGTGA	0.582													3	58	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24834791	24834791	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24834791C>T	uc002dmm.2	+	25	5666	c.5552C>T	c.(5551-5553)GCC>GTC	p.A1851V	TNRC6A_uc010bxs.2_Missense_Mutation_p.A1598V|TNRC6A_uc002dmn.2_Missense_Mutation_p.A1549V|TNRC6A_uc002dmo.2_Missense_Mutation_p.A1490V|TNRC6A_uc002dmr.2_Missense_Mutation_p.A50V	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1851	Sufficient for interaction with EIF2C2.|RRM.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		GCTGAGTTTGCCAGTGAAGAG	0.577													5	213	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27732992	27732992	+	Silent	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27732992T>C	uc002dow.2	+	14	1743	c.1719T>C	c.(1717-1719)GTT>GTC	p.V573V	KIAA0556_uc002dox.1_Silent_p.V481V	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	573										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						AGATCAAGGTTCGGAATTACT	0.537													16	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	29110438	29110438	+	Intron	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29110438T>C	uc010vct.1	-						RRN3P2_uc002dsf.3_RNA|RRN3P2_uc002dsg.3_RNA|RRN3P2_uc010vdn.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TTGCAGTATCTTCAGAGTCTG	0.328													3	77	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77327151	77327151	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77327151G>A	uc002ffc.3	-	20	3430	c.3011C>T	c.(3010-3012)TCC>TTC	p.S1004F	ADAMTS18_uc010chc.1_Missense_Mutation_p.S592F	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1004	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						ACAGGTCTTGGAACACTTGAG	0.468													18	104	---	---	---	---	PASS
SPATA22	84690	broad.mit.edu	37	17	3370723	3370723	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3370723T>C	uc002fvm.2	-	3	406	c.169A>G	c.(169-171)ACA>GCA	p.T57A	SPATA22_uc010vrg.1_Intron|SPATA22_uc010vrf.1_Missense_Mutation_p.T57A|SPATA22_uc002fvn.2_Missense_Mutation_p.T57A|SPATA22_uc002fvo.2_Missense_Mutation_p.T57A|SPATA22_uc002fvp.2_Missense_Mutation_p.T57A|SPATA22_uc010ckf.2_Intron	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	57											0						TTCTTACCTGTAGGTAGAGGA	0.279													66	126	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	4017674	4017674	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4017674G>A	uc002fxe.2	-	4	849	c.785C>T	c.(784-786)TCG>TTG	p.S262L	ZZEF1_uc002fxk.1_Missense_Mutation_p.S262L	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	262	DOC.						calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AATGTCTGCCGAGTTGGAGGA	0.448													49	195	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7696378	7696378	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7696378G>A	uc002giu.1	+	47	7438	c.7424G>A	c.(7423-7425)GGC>GAC	p.G2475D		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2475	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCATTCGGGGGCAAAAGCATG	0.512													5	152	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904115	21904115	+	RNA	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904115G>A	uc002gza.2	+	1		c.54G>A				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ccggctgccaggagtcgcaag	0.000													4	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	34234256	34234256	+	RNA	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34234256G>A	uc010ctx.1	-	1		c.2698C>T								Homo sapiens cDNA FLJ43944 fis, clone TESTI4014392.																		TGATTCAGTGGAGTTTGAGCT	0.468													12	32	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67023488	67023488	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67023488T>C	uc002jhu.2	-	14	2037	c.1894A>G	c.(1894-1896)ATT>GTT	p.I632V	ABCA9_uc010dez.2_Missense_Mutation_p.I632V	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	632	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TCTCCTAAAATGGCAATCCCA	0.303													22	59	---	---	---	---	PASS
JMJD6	23210	broad.mit.edu	37	17	74719948	74719948	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74719948A>T	uc002jso.2	-	3	1035	c.711T>A	c.(709-711)AAT>AAA	p.N237K	JMJD6_uc002jsn.1_Missense_Mutation_p.N237K|JMJD6_uc010dgz.2_Missense_Mutation_p.N237K|C17orf95_uc002jsp.2_5'Flank|C17orf95_uc002jsq.2_5'Flank	NM_015167	NP_055982	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6 isoform 2	237	JmjC.				mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding			skin(2)|ovary(1)	3						GATAAATAACATTAAACCAGG	0.493													64	145	---	---	---	---	PASS
HEXDC	284004	broad.mit.edu	37	17	80400154	80400154	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80400154A>C	uc002kew.2	+	12	1406	c.1355A>C	c.(1354-1356)CAC>CCC	p.H452P	HEXDC_uc002kev.3_Missense_Mutation_p.T482P|HEXDC_uc010diq.2_Silent_p.A454A|HEXDC_uc010wvm.1_RNA			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	452					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GAAAACGTGCACCCCAGCCTG	0.677													4	9	---	---	---	---	PASS
NPC1	4864	broad.mit.edu	37	18	21119752	21119752	+	Intron	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21119752G>A	uc002kum.3	-						NPC1_uc010xaz.1_Intron|NPC1_uc010xba.1_3'UTR	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGCTTCTGAAGTACAAGACAA	0.498													27	34	---	---	---	---	PASS
DSC1	1823	broad.mit.edu	37	18	28720256	28720256	+	Silent	SNP	G	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28720256G>A	uc002kwn.2	-	10	1531	c.1269C>T	c.(1267-1269)AAC>AAT	p.N423N	DSC1_uc002kwm.2_Silent_p.N423N	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	423	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TGACTTCATAGTTCAATGGCT	0.313													9	102	---	---	---	---	PASS
LOC100132288	100132288	broad.mit.edu	37	21	9907198	9907198	+	3'UTR	SNP	C	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9907198C>T	uc002zka.1	-	4					LOC100132288_uc010gqn.1_RNA	NM_001033515	NP_001028687			hypothetical protein LOC100132288												0						GTGCAGAAAGCTAACGCACTG	0.592													3	11	---	---	---	---	PASS
KRTAP13-1	140258	broad.mit.edu	37	21	31768847	31768847	+	Missense_Mutation	SNP	G	C	C	rs151147550	byFrequency	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768847G>C	uc002yoa.2	+	1	456	c.443G>C	c.(442-444)CGC>CCC	p.R148P		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	148						intermediate filament				ovary(1)	1						GGATTCTGCCGCCCAACCTAC	0.517													20	29	---	---	---	---	PASS
DGCR2	9993	broad.mit.edu	37	22	19076918	19076918	+	Silent	SNP	C	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19076918C>A	uc002zoq.1	-	2	413	c.165G>T	c.(163-165)GCG>GCT	p.A55A	DGCR2_uc002zor.1_5'UTR|DGCR2_uc011agr.1_Intron	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor	55	Extracellular (Potential).|LDL-receptor class A.				cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)					CCTCGCAAGTCGCCCAGCCGT	0.607													24	47	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157718251	157718252	+	Intron	INS	-	AAAA	AAAA			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157718251_157718252insAAAA	uc001fre.2	-						FCRL2_uc001frd.2_Intron|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor						cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			aataaataaataaataaataaa	0.168													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30410441	30410441	+	IGR	DEL	A	-	-	rs79540423		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30410441delA								YPEL5 (27043 upstream) : LBH (43956 downstream)																							TTTTTGGGTTAAAAAAAAAAA	0.259													7	4	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54163724	54163725	+	Intron	INS	-	AAATA	AAATA	rs146083561	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54163724_54163725insAAATA	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TAGAATACAACAAATAATATAA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																							tcaccaccatcaccactgcca	0.000													4	2	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166894165	166894166	+	Intron	INS	-	T	T	rs149059939	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166894165_166894166insT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AAATTATACTCtttttttttat	0.153													12	6	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169712115	169712116	+	Intron	INS	-	A	A	rs74552507		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169712115_169712116insA	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						GTTGTGTGAACaaaaaaaaaaa	0.248													4	2	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172693471	172693474	+	Intron	DEL	CACA	-	-	rs3836020		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172693471_172693474delCACA	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	cacacacatgcacacacacacaca	0.284													3	6	---	---	---	---	
PRKRA	8575	broad.mit.edu	37	2	179306614	179306614	+	Intron	DEL	C	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179306614delC	uc002umf.2	-						PRKRA_uc002umc.2_Intron|PRKRA_uc002umd.2_Intron|PRKRA_uc002ume.2_Intron|PRKRA_uc002umg.2_Intron	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			GCTATTAAttctttttttttt	0.139													4	2	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230655614	230655614	+	Intron	DEL	T	-	-	rs34456622		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230655614delT	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGGGAATAAGTTTTTTTCCCA	0.289													3	3	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1443811	1443812	+	Intron	INS	-	A	A	rs72185294		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1443811_1443812insA	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGGCATTGGCCAAAAAAAAAAA	0.371													4	3	---	---	---	---	
NKTR	4820	broad.mit.edu	37	3	42676571	42676571	+	Intron	DEL	G	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42676571delG	uc003clo.2	+						NKTR_uc003clm.1_Intron|NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Intron|NKTR_uc003clr.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		aaaaaaaaaagaaCTTTAGAC	0.323													8	5	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52668670	52668671	+	Frame_Shift_Ins	INS	-	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668670_52668671insT	uc003des.2	-	11	1260_1261	c.1248_1249insA	c.(1246-1251)AAATACfs	p.K416fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Ins_p.K416fs|PBRM1_uc003der.2_Frame_Shift_Ins_p.K384fs|PBRM1_uc003det.2_Frame_Shift_Ins_p.K416fs|PBRM1_uc003deu.2_Frame_Shift_Ins_p.K416fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Ins_p.K416fs|PBRM1_uc010hmk.1_Frame_Shift_Ins_p.K416fs|PBRM1_uc003dey.2_Frame_Shift_Ins_p.K416fs|PBRM1_uc003dez.1_Frame_Shift_Ins_p.K416fs|PBRM1_uc003dfb.1_Frame_Shift_Ins_p.K314fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	416_417	Bromo 3.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAATCAGGGTATTTTTTCTTTG	0.347			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								158	86	---	---	---	---	
DAPP1	27071	broad.mit.edu	37	4	100784876	100784876	+	Intron	DEL	T	-	-	rs71913814		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100784876delT	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		GATTTGTCTGTTTTTTTTTTT	0.353													10	5	---	---	---	---	
FAM149A	25854	broad.mit.edu	37	4	187078591	187078592	+	Intron	DEL	AT	-	-	rs112998639		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187078591_187078592delAT	uc003iyt.3	+						FAM149A_uc011cla.1_Intron|FAM149A_uc010isj.2_Intron|FAM149A_uc010isk.2_Intron|FAM149A_uc003iyu.3_Intron|FAM149A_uc010isl.2_Intron|FAM149A_uc011clb.1_Intron	NM_015398	NP_056213	A5PLN7	F149A_HUMAN	hypothetical protein LOC25854											breast(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CCGTGGTAACATGTGGAGTGGC	0.475													2	5	---	---	---	---	
PCBD2	84105	broad.mit.edu	37	5	134297762	134297763	+	3'UTR	INS	-	TG	TG	rs151192110	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134297762_134297763insTG	uc010jdz.2	+	4					PCBD2_uc011cxw.1_Intron	NM_032151	NP_115527	Q9H0N5	PHS2_HUMAN	pterin-4 alpha-carbinolamine dehydratase 2						positive regulation of transcription, DNA-dependent|tetrahydrobiopterin biosynthetic process		4-alpha-hydroxytetrahydrobiopterin dehydratase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTATAACAGTTtgtgtgtgtgt	0.015													4	4	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156381896	156381896	+	Intron	DEL	T	-	-	rs71922795		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156381896delT	uc003lwh.2	-						TIMD4_uc010jii.2_Intron	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain							integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ttttctttccttttttttttt	0.164													4	3	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5985001	5985001	+	Intron	DEL	G	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5985001delG	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron|RSPH10B2_uc011jwk.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tgtaatcccagcactttggga	0.119													4	2	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33394948	33394948	+	Intron	DEL	T	-	-	rs67055748		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33394948delT	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TACTTTCCTCTGCTGCTTCCC	0.577													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110220240	110220241	+	IGR	DEL	AC	-	-	rs57160910		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110220240_110220241delAC								RAD23B (125771 upstream) : KLF4 (26894 downstream)																							aaaaaaaaaaacaaaaaaacaa	0.168													4	2	---	---	---	---	
C9orf78	51759	broad.mit.edu	37	9	132594369	132594370	+	Intron	INS	-	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132594369_132594370insA	uc004byp.2	-						C9orf78_uc004byo.2_Intron|C9orf78_uc004byq.1_Intron	NM_016520	NP_057604	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78												0		Ovarian(14;0.00556)				TTACAGTTGGCAAAAAAAAAAA	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133834273	133834275	+	IGR	DEL	CAC	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133834273_133834275delCAC								FIBCD1 (19818 upstream) : LAMC3 (50229 downstream)																							ccaccaccatcaccaccatcacc	0.000													4	2	---	---	---	---	
COL13A1	1305	broad.mit.edu	37	10	71664662	71664670	+	Intron	DEL	TTTTTTTTT	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71664662_71664670delTTTTTTTTT	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	ttcttttttctttttttttttttttttGC	0.478													4	5	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	271387	271387	+	Intron	DEL	T	-	-	rs66703624		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:271387delT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		actgCATCTCTTTTTTTTTTT	0.189													4	3	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101763830	101763831	+	Intron	INS	-	AA	AA			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101763830_101763831insAA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						cgtgtctacataaaaaaaaaaa	0.000													4	2	---	---	---	---	
SYNE2	23224	broad.mit.edu	37	14	64465928	64465929	+	Intron	INS	-	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64465928_64465929insT	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGTGATTTTCTTTCAGGTACC	0.391													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22448191	22448191	+	IGR	DEL	C	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22448191delC								OR4N3P (33806 upstream) : MIR1268 (65038 downstream)																							aaaaaaaaaaCACCAAAAAAC	0.114													5	3	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66257236	66257237	+	Intron	INS	-	A	A	rs138144863	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66257236_66257237insA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CGCCCATTCCCAGCTCATACCT	0.673													3	4	---	---	---	---	
DECR2	26063	broad.mit.edu	37	16	460579	460579	+	Intron	DEL	T	-	-	rs11315123		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:460579delT	uc002chb.2	+						DECR2_uc002chc.2_Intron|DECR2_uc010bqv.2_Intron|DECR2_uc002chd.2_Intron|DECR2_uc002che.1_Intron	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2							peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				GGCCTCCCCCTGACGGCCGCC	0.781													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13966971	13966973	+	IGR	DEL	TGG	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13966971_13966973delTGG								SHISA9 (632699 upstream) : ERCC4 (47041 downstream)																							gtggtggtgatggtggtggtggt	0.177													4	5	---	---	---	---	
CDH3	1001	broad.mit.edu	37	16	68684841	68684842	+	Intron	DEL	AA	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68684841_68684842delAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding			ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGAACAGGTTAAAAAAAAAAAA	0.485													4	2	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19684555	19684555	+	Intron	DEL	C	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19684555delC	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TCtttcttttctttttttttt	0.159													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20648273	20648273	+	IGR	DEL	T	-	-	rs36007188		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20648273delT								LGALS9B (277425 upstream) : CCDC144NL (118437 downstream)																							AACACTAGACTTTTTTTTTTT	0.313													4	3	---	---	---	---	
THOC4	10189	broad.mit.edu	37	17	79845834	79845835	+	3'UTR	INS	-	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79845834_79845835insA	uc002kbu.2	-	6						NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4						intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GTTTCAGAATTaaaaaaaaaaa	0.312													4	3	---	---	---	---	
USP14	9097	broad.mit.edu	37	18	204905	204905	+	Intron	DEL	T	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:204905delT	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142	P54578	UBP14_HUMAN	ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TTTATTTTCCTTTTTTTTTTT	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15168718	15168719	+	IGR	DEL	GT	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15168718_15168719delGT								ANKRD30B (315981 upstream) : LOC644669 (144836 downstream)																							TAGTGCTtgcgtgtgtgtgtgt	0.262													3	5	---	---	---	---	
DSG3	1830	broad.mit.edu	37	18	29028057	29028058	+	Intron	INS	-	TTTG	TTTG	rs141268501	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29028057_29028058insTTTG	uc002kws.2	+							NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein						cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTTGTTGTTTTTTATGTTGTA	0.243													4	3	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													4	2	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3297537	3297537	+	Intron	DEL	C	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3297537delC	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						AGCTAGGGttctttttttttt	0.279													6	4	---	---	---	---	
RNF24	11237	broad.mit.edu	37	20	3928693	3928694	+	Intron	INS	-	A	A			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3928693_3928694insA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150	Q9Y225	RNF24_HUMAN	ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0						aactccgtctcaaaaaaaaaaa	0.109													3	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													14	9	---	---	---	---	
ZNF335	63925	broad.mit.edu	37	20	44597959	44597959	+	Intron	DEL	G	-	-	rs144514871		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44597959delG	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron|ZNF335_uc002xqx.1_Intron|ZNF335_uc002xqy.2_5'Flank	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				ccatgagacaggggtgactgt	0.114													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11114454	11114455	+	IGR	DEL	AA	-	-	rs71860936		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114454_11114455delAA								BAGE (15517 upstream) : None (None downstream)																							ATTTTTTTTTAAAAAGCAAGTT	0.307													3	3	---	---	---	---	
EIF3D	8664	broad.mit.edu	37	22	36907941	36907942	+	Intron	INS	-	TT	TT	rs71324812		TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36907941_36907942insTT	uc003apq.2	-						EIF3D_uc011amr.1_Intron|EIF3D_uc003apr.2_Intron|EIF3D_uc011ams.1_Intron|EIF3D_uc011amt.1_Intron	NM_003753	NP_003744	O15371	EIF3D_HUMAN	eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1						GCTAttttttcttttttttttt	0.228													6	4	---	---	---	---	
SH3BP1	23616	broad.mit.edu	37	22	38041195	38041196	+	Intron	INS	-	C	C	rs143917543	by1000genomes	TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38041195_38041196insC	uc003ati.2	+						SH3BP1_uc003atg.1_Intron|SH3BP1_uc011anl.1_Intron|SH3BP1_uc003ath.1_Intron|SH3BP1_uc003atj.1_Intron|SH3BP1_uc003atk.1_Intron|uc003atl.1_Intron	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1						signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					ggtggcctggactaggacagag	0.203													4	4	---	---	---	---	
PHEX	5251	broad.mit.edu	37	X	22129815	22129816	+	Intron	DEL	TG	-	-			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22129815_22129816delTG	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						CTATTGTTTTTGTGTGTGTGTG	0.317													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155231339	155231340	+	Intron	INS	-	T	T			TCGA-B0-5121-01A-02D-1421-08	TCGA-B0-5121-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155231339_155231340insT	uc004fnv.1	+						IL9R_uc010nvn.2_Intron|IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTTCCTCCTCCTATCAGTAATC	0.540													4	6	---	---	---	---	
