Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
OTUD3	23252	broad.mit.edu	37	1	20233088	20233088	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20233088A>G	uc001bcs.3	+	7	1118	c.999A>G	c.(997-999)GCA>GCG	p.A333A		NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN	OTU domain containing 3	333											0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AAAACAAAGCAAATAAAAACC	0.468													31	249	---	---	---	---	PASS
RPL5	6125	broad.mit.edu	37	1	93307322	93307322	+	Splice_Site	SNP	G	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93307322G>C	uc001doz.2	+	8	873	c.795_splice	c.e8-1	p.R265_splice	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_Splice_Site|RPL5_uc001dpb.2_Splice_Site_p.R215_splice	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		ATCTTTTGTAGGTGGAACCGT	0.338													5	48	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144911962	144911962	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144911962C>T	uc001elw.3	-	16	2438	c.2147G>A	c.(2146-2148)GGT>GAT	p.G716D	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.G782D|PDE4DIP_uc001emc.1_Missense_Mutation_p.G716D|PDE4DIP_uc001emd.1_Missense_Mutation_p.G716D|PDE4DIP_uc001emb.1_Missense_Mutation_p.G879D|PDE4DIP_uc001eme.1_Missense_Mutation_p.G245D|PDE4DIP_uc001emf.1_Missense_Mutation_p.G501D	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	716					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTGCATTGAACCCTAAAAAAT	0.368			T	PDGFRB	MPD								12	353	---	---	---	---	PASS
SHC1	6464	broad.mit.edu	37	1	154941261	154941261	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154941261T>G	uc001ffv.2	-	3	837	c.616A>C	c.(616-618)ACA>CCA	p.T206P	SHC1_uc001ffz.1_5'Flank|SHC1_uc001ffw.2_Missense_Mutation_p.T206P|SHC1_uc001ffx.2_Missense_Mutation_p.T96P|SHC1_uc001ffy.2_Missense_Mutation_p.T96P	NM_183001	NP_892113	P29353	SHC1_HUMAN	SHC-transforming protein 1 isoform 1	206	PID.				activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(1)|skin(1)	2	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTCCTCCTTGTCGCCCCCTTA	0.637													9	69	---	---	---	---	PASS
LEMD1	93273	broad.mit.edu	37	1	205350814	205350814	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205350814G>T	uc001hcj.1	-	6	620	c.518C>A	c.(517-519)ACT>AAT	p.T173N	LEMD1_uc001hci.1_3'UTR|LEMD1_uc001hck.1_RNA|LEMD1_uc001hcl.1_Missense_Mutation_p.T132N|LEMD1_uc001hcm.1_RNA|LEMD1_uc001hcn.1_RNA|uc001hch.1_Intron			Q68G75	LEMD1_HUMAN	RecName: Full=LEM domain-containing protein 1;          Short=LEMP-1; AltName: Full=Cancer/testis antigen 50;          Short=CT50;	173						integral to membrane|nuclear envelope					0	Breast(84;0.247)		BRCA - Breast invasive adenocarcinoma(75;0.0938)			ATTTTCCACAGTCAGGTAGAC	0.458													36	202	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234599596	234599596	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234599596T>C	uc001hwd.2	-	6	1386	c.1386A>G	c.(1384-1386)CCA>CCG	p.P462P		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	462					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TTATTTCTTCTGGAAGAAGAG	0.353													20	183	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247076628	247076628	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076628T>C	uc001ibu.1	-	3	469	c.462A>G	c.(460-462)GGA>GGG	p.G154G	AHCTF1_uc001ibv.1_Silent_p.G163G	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	154	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CAGCTGCCACTCCAAAAAGCC	0.413													5	115	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111431891	111431891	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111431891T>C	uc002tgc.2	-	2	190	c.78A>G	c.(76-78)GAA>GAG	p.E26E	BUB1_uc010yxh.1_Intron|BUB1_uc010fkb.2_Silent_p.E26E|BUB1_uc002tgd.2_Silent_p.E26E	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	26	BUB1 N-terminal.|Necessary for kinetochore localization.				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ACCTTTCCCATTCACCAAGAG	0.378													7	394	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128263302	128263302	+	Silent	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128263302G>T	uc002ton.2	-	3	480	c.177C>A	c.(175-177)GGC>GGA	p.G59G	IWS1_uc010yzl.1_RNA|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	59					transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTTTGGGGAGGCCATCTTCTC	0.348													18	133	---	---	---	---	PASS
GPR39	2863	broad.mit.edu	37	2	133175094	133175094	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133175094G>A	uc002ttl.2	+	1	948	c.479G>A	c.(478-480)TGG>TAG	p.W160*		NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39	160	Helical; Name=4; (Potential).					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						GGCTTCGTCTGGGTCACCTCC	0.607													3	23	---	---	---	---	PASS
MARCH7	64844	broad.mit.edu	37	2	160604578	160604578	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160604578G>T	uc002uax.2	+	5	899	c.777G>T	c.(775-777)AGG>AGT	p.R259S	MARCH7_uc010foq.2_Missense_Mutation_p.R259S|MARCH7_uc010zcn.1_Missense_Mutation_p.R203S|MARCH7_uc010for.2_Missense_Mutation_p.R221S|MARCH7_uc002uay.2_RNA	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin	259	Ser-rich.						ligase activity|zinc ion binding				0						ATTCAGAAAGGGTTGTTTCAT	0.418													4	96	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210560752	210560752	+	Silent	SNP	C	T	T	rs141793873		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210560752C>T	uc002vde.1	+	7	4106	c.3858C>T	c.(3856-3858)ACC>ACT	p.T1286T	MAP2_uc002vdc.1_Silent_p.T1286T|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.T1282T	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1286					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	CTGTTGTGACCATCGAGGATG	0.527													6	149	---	---	---	---	PASS
SLC4A7	9497	broad.mit.edu	37	3	27442256	27442256	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27442256G>A	uc003cdv.2	-	16	2470	c.2399C>T	c.(2398-2400)TCT>TTT	p.S800F	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Missense_Mutation_p.S681F|SLC4A7_uc011aww.1_Missense_Mutation_p.S809F|SLC4A7_uc011awx.1_Missense_Mutation_p.S796F|SLC4A7_uc011awy.1_Missense_Mutation_p.S792F|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Missense_Mutation_p.S681F|SLC4A7_uc011axb.1_Missense_Mutation_p.S796F|SLC4A7_uc010hfl.2_Missense_Mutation_p.S350F|SLC4A7_uc003cdw.2_Missense_Mutation_p.S676F	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	800	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						TATACTCACAGAAACAGTAAG	0.338													85	522	---	---	---	---	PASS
ALAS1	211	broad.mit.edu	37	3	52246387	52246387	+	Silent	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52246387G>A	uc003dcy.1	+	11	2050	c.1713G>A	c.(1711-1713)CGG>CGA	p.R571R	ALAS1_uc003dcz.1_Silent_p.R571R|ALAS1_uc011bec.1_Silent_p.R588R	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor	571					heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	AGCTCCTACGGATTGCCCCCA	0.517													13	98	---	---	---	---	PASS
TMEM45A	55076	broad.mit.edu	37	3	100287800	100287800	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100287800T>C	uc003dtz.1	+	5	1036	c.723T>C	c.(721-723)GCT>GCC	p.A241A	TMEM45A_uc003dua.1_Silent_p.A257A|TMEM45A_uc003dub.1_RNA	NM_018004	NP_060474	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	241						integral to membrane				skin(2)|ovary(1)	3						TGAATTATGCTTTCATTACCT	0.353													8	404	---	---	---	---	PASS
CCNL1	57018	broad.mit.edu	37	3	156877253	156877253	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156877253C>T	uc003fbf.2	-	2	918	c.319G>A	c.(319-321)GGG>AGG	p.G107R	CCNL1_uc003fbd.1_Missense_Mutation_p.G107R|CCNL1_uc003fbg.2_RNA|CCNL1_uc011bor.1_RNA|CCNL1_uc003fbi.1_5'UTR	NM_020307	NP_064703	Q9UK58	CCNL1_HUMAN	cyclin L1	107	Cyclin-like 1.				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nuclear speck	protein kinase binding			lung(3)|breast(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			AACACCTGCCCCGTTGCCATC	0.572													5	115	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49019332	49019332	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49019332A>G	uc003gyv.2	+	9	1435	c.1253A>G	c.(1252-1254)AAA>AGA	p.K418R	CWH43_uc011bzl.1_Missense_Mutation_p.K391R	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	418					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						TATGAGAGAAAACTGGGCAAA	0.328													9	613	---	---	---	---	PASS
NUP54	53371	broad.mit.edu	37	4	77053776	77053776	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77053776A>G	uc003hjs.2	-	6	935	c.807T>C	c.(805-807)AAT>AAC	p.N269N	NUP54_uc010ije.2_5'UTR|NUP54_uc011cbs.1_Silent_p.N89N|NUP54_uc011cbt.1_Silent_p.N221N|NUP54_uc003hjt.2_Silent_p.N89N	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	269	9 X 2 AA repeats of F-G.			FEQANIKTQLQQL -> LNKPYKNTIAAT (in Ref. 1; AAF67488).	carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						GTGTTTTTATATTGGCTTGTT	0.403													6	487	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77244475	77244475	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77244475T>C	uc003hkb.3	-	23	3398	c.3245A>G	c.(3244-3246)GAT>GGT	p.D1082G		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	1082	Potential.									skin(3)|ovary(2)|pancreas(1)	6						CAGCTGTAAATCTTCTACCAG	0.398													8	656	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82377759	82377759	+	Intron	SNP	C	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82377759C>A	uc003hmi.1	-						RASGEF1B_uc003hmj.1_Intron|RASGEF1B_uc010ijq.1_Intron|RASGEF1B_uc003hmk.2_Missense_Mutation_p.A162S	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CCCACCCAGGCTCTGCCTGGG	0.483													10	92	---	---	---	---	PASS
ADH1A	124	broad.mit.edu	37	4	100203706	100203706	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100203706T>C	uc003hur.1	-	6	696	c.625A>G	c.(625-627)ATT>GTT	p.I209V	uc003hum.1_Intron|ADH1A_uc011ceg.1_Missense_Mutation_p.I209V|ADH1A_uc010ilf.1_5'UTR	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit	209					ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	CAGCCCATAATAGCAGATAGG	0.473													5	268	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153244135	153244135	+	Silent	SNP	C	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153244135C>G	uc003ims.2	-	12	2171	c.2022G>C	c.(2020-2022)CGG>CGC	p.R674R	FBXW7_uc011cii.1_Silent_p.R674R|FBXW7_uc003imt.2_Silent_p.R674R|FBXW7_uc011cih.1_Silent_p.R498R|FBXW7_uc003imq.2_Silent_p.R594R|FBXW7_uc003imr.2_Silent_p.R556R	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	674					interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R674Q(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGGCTCTGATCCGCCACACAA	0.493			Mis|N|D|F		colorectal|endometrial|T-ALL								30	255	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186283245	186283245	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186283245T>C	uc003ixh.2	+	17	2516	c.2327T>C	c.(2326-2328)CTT>CCT	p.L776P	SNX25_uc010ish.2_Missense_Mutation_p.L492P|SNX25_uc003ixi.2_Missense_Mutation_p.L280P	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	776					cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CAAAAGCTGCTTGAAAACATT	0.468													8	74	---	---	---	---	PASS
SLC23A1	9963	broad.mit.edu	37	5	138707764	138707764	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138707764T>C	uc003leh.2	-	14	1825	c.1728A>G	c.(1726-1728)AAA>AAG	p.K576K	SLC23A1_uc003leg.2_Silent_p.K580K	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	576					brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CAATCTGATCTTTTGAACTTG	0.403													7	395	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51887615	51887615	+	Silent	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51887615C>T	uc003pah.1	-	33	5640	c.5364G>A	c.(5362-5364)TTG>TTA	p.L1788L	PKHD1_uc003pai.2_Silent_p.L1788L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1788	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GGGGCAGAACCAAGCAGCTGA	0.433													4	122	---	---	---	---	PASS
LYRM2	57226	broad.mit.edu	37	6	90347063	90347063	+	Missense_Mutation	SNP	G	A	A	rs142214691		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90347063G>A	uc003pnm.2	-	3	235	c.196C>T	c.(196-198)CGG>TGG	p.R66W	LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|LYRM2_uc010kcf.1_Intron|LYRM2_uc010kcg.2_RNA|LYRM2_uc003pnl.3_RNA	NM_020466	NP_065199	Q9NU23	LYRM2_HUMAN	LYR motif containing 2	66											0		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		ATCATCATCCGGATTGTATCC	0.318													6	556	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111694019	111694019	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111694019T>C	uc003puy.3	-	13	5862	c.5539A>G	c.(5539-5541)ATG>GTG	p.M1847V	REV3L_uc003pux.3_Missense_Mutation_p.M1769V|REV3L_uc003puz.3_Missense_Mutation_p.M1769V	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	1847	Mediates interaction with MAD2L2.				DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GGTGTCAACATATCATTGTTT	0.423								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					5	248	---	---	---	---	PASS
WTAP	9589	broad.mit.edu	37	6	160174480	160174480	+	Intron	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160174480T>C	uc003qsl.2	+						WTAP_uc003qso.2_Silent_p.S28S	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1						cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TGGATGGCTCTTTCCTTTGCA	0.408													6	249	---	---	---	---	PASS
TCP10L2	401285	broad.mit.edu	37	6	167591987	167591987	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167591987C>T	uc010kkp.2	+	5	745	c.614C>T	c.(613-615)CCG>CTG	p.P205L		NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN	t-complex 10-like 2	205											0						ACTGGAAGGCCGACTCCCGGT	0.522													5	443	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170597750	170597750	+	Intron	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170597750A>G	uc003qxm.2	-						DLL1_uc011ehc.1_Intron|DLL1_uc003qxn.3_3'UTR	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor						cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		TGGCTGGGGGATGGGTGGGCA	0.542													11	392	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44152653	44152653	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44152653A>G	uc003tkb.2	+	19	2938	c.2633A>G	c.(2632-2634)GAC>GGC	p.D878G	AEBP1_uc003tkc.3_Missense_Mutation_p.D453G|AEBP1_uc003tkd.2_Missense_Mutation_p.D128G	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	878	Interaction with PTEN (By similarity).				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTGGGCTGTGACAAGTTCCCT	0.577													5	90	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	82996992	82996992	+	Silent	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82996992G>A	uc003uhy.1	-	17	2704	c.2238C>T	c.(2236-2238)CCC>CCT	p.P746P		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	746	Arg/Lys-rich (basic).				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TCCACTTGGAGGGTGACATTT	0.493													29	256	---	---	---	---	PASS
AP1S1	1174	broad.mit.edu	37	7	100802339	100802339	+	Splice_Site	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100802339G>T	uc003uxv.3	+	4	402	c.292_splice	c.e4-1	p.V98_splice		NM_001283	NP_001274	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1						intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					CGCCCTCCCAGGTGTGCGAGC	0.567													4	65	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107820706	107820706	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107820706G>A	uc003vfb.2	-	25	3283	c.2812C>T	c.(2812-2814)CCA>TCA	p.P938S	NRCAM_uc003vfc.2_Missense_Mutation_p.P922S|NRCAM_uc011kmk.1_Missense_Mutation_p.P933S|NRCAM_uc003vfd.2_Missense_Mutation_p.P914S|NRCAM_uc003vfe.2_Missense_Mutation_p.P914S	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	938	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						GGGCTGGCTGGGCCCTCCCCT	0.532													15	49	---	---	---	---	PASS
DNAJB9	4189	broad.mit.edu	37	7	108213528	108213528	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108213528A>G	uc003vfn.2	+	3	605	c.403A>G	c.(403-405)AAG>GAG	p.K135E		NM_012328	NP_036460	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	135					ER-associated protein catabolic process|protein folding	endoplasmic reticulum|nucleolus	heat shock protein binding|misfolded protein binding|unfolded protein binding				0						TGGATCCAAGAAGCGTTTTGA	0.368													7	424	---	---	---	---	PASS
ING3	54556	broad.mit.edu	37	7	120595899	120595899	+	Intron	SNP	T	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120595899T>A	uc003vjn.2	+						ING3_uc011knr.1_Intron|ING3_uc003vjl.2_3'UTR|ING3_uc003vjm.1_Intron|ING3_uc003vjo.2_Intron|ING3_uc003vjp.2_Intron|ING3_uc011kns.1_Intron	NM_019071	NP_061944	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3 isoform 1						histone H2A acetylation|histone H4 acetylation|positive regulation of apoptosis|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Piccolo NuA4 histone acetyltransferase complex	zinc ion binding			ovary(1)	1	all_neural(327;0.117)					TTAGCAAGTCTATACGGCGGT	0.318													4	13	---	---	---	---	PASS
UBN2	254048	broad.mit.edu	37	7	138958082	138958082	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138958082A>G	uc011kqr.1	+	10	1755	c.1755A>G	c.(1753-1755)GAA>GAG	p.E585E	UBN2_uc003vuv.2_Silent_p.E308E	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	585										ovary(1)|skin(1)	2						ATGGATCTGAAGAGGATGATG	0.338													8	695	---	---	---	---	PASS
SGCZ	137868	broad.mit.edu	37	8	14412407	14412407	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14412407G>T	uc003wwq.2	-	2	728	c.68C>A	c.(67-69)ACC>AAC	p.T23N	SGCZ_uc010lss.2_Missense_Mutation_p.T10N	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta	10	Cytoplasmic (Potential).				cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ATTCTGTTGGGTTGCTAGTAT	0.318													15	589	---	---	---	---	PASS
ENTPD4	9583	broad.mit.edu	37	8	23305336	23305336	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23305336C>T	uc003xdl.2	-	4	433	c.269G>A	c.(268-270)GGG>GAG	p.G90E	ENTPD4_uc011kzu.1_Missense_Mutation_p.G90E|ENTPD4_uc003xdm.2_Missense_Mutation_p.G90E|ENTPD4_uc011kzv.1_Missense_Mutation_p.G90E|ENTPD4_uc011kzw.1_Missense_Mutation_p.G56E	NM_004901	NP_004892	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	90	Lumenal (Potential).				UDP catabolic process	autophagic vacuole membrane|cytoplasmic vesicle|integral to Golgi membrane	uridine-diphosphatase activity			ovary(1)|kidney(1)	2		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CACCACGATCCCATAGTTCAC	0.448													5	279	---	---	---	---	PASS
DDHD2	23259	broad.mit.edu	37	8	38105328	38105328	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38105328A>G	uc003xlb.2	+	10	1600	c.1223A>G	c.(1222-1224)AAG>AGG	p.K408R	DDHD2_uc003xlc.2_Missense_Mutation_p.K408R|DDHD2_uc011lbl.1_Missense_Mutation_p.K220R|DDHD2_uc003xld.2_Missense_Mutation_p.K27R	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	408	SAM.				lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			ATCTTTGAGAAGGAGAAAGTA	0.333													6	263	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95174382	95174382	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95174382T>C	uc003ygh.2	-	11	1416	c.1291A>G	c.(1291-1293)ACC>GCC	p.T431A	CDH17_uc011lgo.1_Missense_Mutation_p.T217A|CDH17_uc011lgp.1_Missense_Mutation_p.T431A	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	431	Extracellular (Potential).|Cadherin 4.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AAACAAAGGGTCTTGAAATCT	0.313													9	411	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121301974	121301974	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121301974G>A	uc003yox.2	+	34	4470	c.4205G>A	c.(4204-4206)CGA>CAA	p.R1402Q	COL14A1_uc003yoz.2_Missense_Mutation_p.R367Q	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1402	Nonhelical region (NC4).|TSP N-terminal.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AAAATGGTTCGATCAAGAGGA	0.423													18	359	---	---	---	---	PASS
EPB41L4B	54566	broad.mit.edu	37	9	111976002	111976002	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111976002G>T	uc004bdz.1	-	17	2025	c.1730C>A	c.(1729-1731)CCT>CAT	p.P577H		NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	577						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						GATGTGCAGAGGAGGCCAGGG	0.542													14	98	---	---	---	---	PASS
CUL2	8453	broad.mit.edu	37	10	35299283	35299283	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35299283C>T	uc001ixv.2	-	21	2404	c.2194G>A	c.(2194-2196)GAA>AAA	p.E732K	CUL2_uc009xma.2_Missense_Mutation_p.E601K|CUL2_uc010qer.1_Missense_Mutation_p.E751K|CUL2_uc001ixw.2_Missense_Mutation_p.E732K	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	732					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						TGGCTGCGTTCTATGTATTGT	0.463													26	193	---	---	---	---	PASS
LRRC18	474354	broad.mit.edu	37	10	50121787	50121787	+	Silent	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50121787G>A	uc001jhd.2	-	1	494	c.414C>T	c.(412-414)ACC>ACT	p.T138T	WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Silent_p.T138T	NM_001006939	NP_001006940	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	138	LRR 5.					cytoplasm				ovary(1)|pancreas(1)	2						CCCCCAGTGTGGTGGGCACGC	0.592													15	111	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68688186	68688186	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68688186C>A	uc001jmz.1	+	2	2062	c.1512C>A	c.(1510-1512)AAC>AAA	p.N504K	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.N504K	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	504	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GCACCTATAACAAATCGGGCT	0.458													5	30	---	---	---	---	PASS
CH25H	9023	broad.mit.edu	37	10	90966990	90966990	+	Silent	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90966990C>T	uc001kfz.2	-	1	82	c.60G>A	c.(58-60)CTG>CTA	p.L20L		NM_003956	NP_003947	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	20					bile acid biosynthetic process|fatty acid biosynthetic process|sterol biosynthetic process	cytosol|endoplasmic reticulum membrane|integral to membrane	cholesterol 25-hydroxylase activity|iron ion binding				0		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		AGAGGGGCTGCAGGAACAGCT	0.632													5	19	---	---	---	---	PASS
ANKRD1	27063	broad.mit.edu	37	10	92680030	92680030	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92680030C>T	uc001khe.1	-	2	351	c.103G>A	c.(103-105)GCT>ACT	p.A35T		NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein	35					cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				GTAACAGCAGCTTCATACTCT	0.512													4	216	---	---	---	---	PASS
SLK	9748	broad.mit.edu	37	10	105765356	105765356	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105765356G>A	uc001kxo.1	+	10	2421	c.2387G>A	c.(2386-2388)CGC>CAC	p.R796H	SLK_uc001kxp.1_Missense_Mutation_p.R796H	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	796					apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AAGAAAACACGCAAATTTATT	0.333													7	375	---	---	---	---	PASS
SFXN4	119559	broad.mit.edu	37	10	120921912	120921912	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120921912G>C	uc001leb.2	-	3	237	c.192C>G	c.(190-192)AAC>AAG	p.N64K	SFXN4_uc001ldy.2_5'Flank|SFXN4_uc001ldz.2_5'UTR|SFXN4_uc001lea.2_RNA	NM_213649	NP_998814	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	64					iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		GTTGCCTCGAGTTTTCTATAC	0.458													30	179	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32996944	32996944	+	Intron	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32996944C>T	uc001mty.2	+						QSER1_uc001mtz.1_Intron|QSER1_uc001mua.2_Silent_p.L1213L	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1											ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					TAAGGAGACTCTAGCCATAGT	0.284													6	77	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43469635	43469635	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43469635G>A	uc001mxi.2	+	19	2763	c.2749G>A	c.(2749-2751)GTG>ATG	p.V917M	TTC17_uc010rfj.1_Missense_Mutation_p.V917M|TTC17_uc001mxl.2_5'Flank	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	917							binding			ovary(5)	5						GACTGCCATCGTGAGTACCTG	0.493													9	69	---	---	---	---	PASS
LOC645332	645332	broad.mit.edu	37	11	67560337	67560337	+	3'UTR	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67560337G>A	uc001omt.3	-	4					LOC645332_uc001omu.3_3'UTR	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						TGGCTTTGTGGGGAACCGAGT	0.507													3	18	---	---	---	---	PASS
NFRKB	4798	broad.mit.edu	37	11	129740063	129740063	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129740063A>G	uc001qfi.2	-	24	3058	c.2857T>C	c.(2857-2859)TTG>CTG	p.L953L	NFRKB_uc001qfg.2_Silent_p.L978L|NFRKB_uc001qfh.2_Silent_p.L976L|NFRKB_uc010sbw.1_Silent_p.L963L|NFRKB_uc009zcr.2_Silent_p.L239L	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	953					DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GGCAGACGCAATACATCCTTA	0.557													4	50	---	---	---	---	PASS
TAS2R46	259292	broad.mit.edu	37	12	11214646	11214646	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11214646G>T	uc001qzp.1	-	1	248	c.248C>A	c.(247-249)ACT>AAT	p.T83N	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176887	NP_795368	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	83	Extracellular (Potential).				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		ATTGTAAGCAGTAATTCTTAC	0.393													35	191	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18649023	18649023	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18649023T>C	uc001rdt.2	+	20	2814	c.2698T>C	c.(2698-2700)TTG>CTG	p.L900L	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Silent_p.L941L|PIK3C2G_uc010sic.1_Silent_p.L719L	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	900					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				ATCTAATGCTTTGCCATTGAA	0.343													66	615	---	---	---	---	PASS
KRAS	3845	broad.mit.edu	37	12	25380282	25380282	+	Missense_Mutation	SNP	G	C	C	rs104886029		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25380282G>C	uc001rgp.1	-	3	357	c.176C>G	c.(175-177)GCA>GGA	p.A59G	KRAS_uc001rgq.1_Missense_Mutation_p.A59G	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	59	GTP.		A -> T (in bladder cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.A59T(8)|p.A59E(3)|p.A59G(2)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTCTTGACCTGCTGTGTCGAG	0.418		119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			26	219	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50616129	50616129	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50616129T>A	uc001rwj.3	-	4	479	c.305A>T	c.(304-306)GAC>GTC	p.D102V	LIMA1_uc001rwh.3_5'UTR|LIMA1_uc001rwi.3_5'UTR|LIMA1_uc001rwk.3_Missense_Mutation_p.D102V|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	102					actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						AGGAGGATGGTCTGCTCTGTG	0.527													13	84	---	---	---	---	PASS
FAM186A	121006	broad.mit.edu	37	12	50790205	50790205	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50790205A>G	uc001rwl.2	-	1	201	c.63T>C	c.(61-63)GAT>GAC	p.D21D		NM_001145475	NP_001138947	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	21											0						TGATGGTGGAATCCTTGATGC	0.363													7	481	---	---	---	---	PASS
IL26	55801	broad.mit.edu	37	12	68619014	68619014	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68619014A>G	uc001stx.1	-	3	313	c.278T>C	c.(277-279)GTT>GCT	p.V93A		NM_018402	NP_060872	Q9NPH9	IL26_HUMAN	interleukin 26 precursor	93					cell-cell signaling|negative regulation of epithelial cell proliferation|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of JAK-STAT cascade|positive regulation of protein kinase B signaling cascade|positive regulation of stress-activated MAPK cascade|positive regulation of transcription from RNA polymerase II promoter	cytosol|extracellular space|soluble fraction	cytokine activity				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		TTGACCAAAAACGTCTTCCAT	0.358													5	170	---	---	---	---	PASS
CENPJ	55835	broad.mit.edu	37	13	25480535	25480535	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25480535T>C	uc001upt.3	-	7	1894	c.1641A>G	c.(1639-1641)AAA>AAG	p.K547K	CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA|CENPJ_uc001upu.2_5'Flank	NM_018451	NP_060921	Q9HC77	CENPJ_HUMAN	centromere protein J	547					cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding			ovary(2)	2		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		ATTCAGACTCTTTCATGGTCT	0.438													5	94	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26148985	26148985	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26148985G>T	uc001uqk.2	+	19	1844	c.1702G>T	c.(1702-1704)GAA>TAA	p.E568*	ATP8A2_uc010tdi.1_Nonsense_Mutation_p.E528*|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Nonsense_Mutation_p.E78*	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	528	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TAATGTCCTGGAATTTTCTAG	0.323													48	404	---	---	---	---	PASS
CKAP2	26586	broad.mit.edu	37	13	53042450	53042450	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53042450T>C	uc001vgv.2	+	7	1714	c.1517T>C	c.(1516-1518)CTA>CCA	p.L506P	CKAP2_uc001vgu.2_Missense_Mutation_p.L505P|CKAP2_uc010tha.1_Missense_Mutation_p.L457P	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN	cytoskeleton associated protein 2 isoform 2	506					apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GTAGATATTCTAACAATGAAG	0.274													6	567	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73586435	73586435	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73586435A>G	uc001xno.2	+	19	2662	c.2454A>G	c.(2452-2454)GAA>GAG	p.E818E	RBM25_uc010ttu.1_Silent_p.E818E|RBM25_uc001xnp.2_Silent_p.E613E	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	818	PWI.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		TTGATGAAGAAGCAGAAGTTT	0.318													8	630	---	---	---	---	PASS
DLST	1743	broad.mit.edu	37	14	75355812	75355812	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75355812T>C	uc001xqv.2	+	4	224	c.161T>C	c.(160-162)GTC>GCC	p.V54A	DLST_uc001xqu.2_5'UTR|DLST_uc001xqt.2_5'UTR|DLST_uc010tuw.1_Intron|DLST_uc010tuu.1_Missense_Mutation_p.V54A|DLST_uc001xqs.2_RNA|DLST_uc010tuv.1_Missense_Mutation_p.V54A	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2	54					lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		AACAACAGTGTCTTCAGTGTT	0.408													8	690	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34153323	34153323	+	Silent	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34153323A>G	uc001zhi.2	+	102	14479	c.14409A>G	c.(14407-14409)ACA>ACG	p.T4803T	RYR3_uc010bar.2_Silent_p.T4798T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4803					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACTTTGACACAACCCCTCATG	0.383													9	614	---	---	---	---	PASS
C15orf60	283677	broad.mit.edu	37	15	73766229	73766229	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73766229T>C	uc002avq.2	+	2	244	c.216T>C	c.(214-216)GGT>GGC	p.G72G	C15orf60_uc010bjb.2_Silent_p.G72G	NM_001042367	NP_001035826	Q7Z4M0	CO060_HUMAN	hypothetical protein LOC283677	72										pancreas(1)	1						TTATATCAGGTCATTTCTTCA	0.308													8	714	---	---	---	---	PASS
SEC11A	23478	broad.mit.edu	37	15	85230906	85230906	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85230906T>C	uc002blb.1	-	3	629	c.261A>G	c.(259-261)ATA>ATG	p.I87M	SEC11A_uc002blc.1_Missense_Mutation_p.I61M	NM_014300	NP_055115	P67812	SC11A_HUMAN	SEC11-like 1	87	Lumenal (Potential).				energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	protein binding|serine-type peptidase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			CTCTTCCTTCTATCCTAAAAA	0.378													82	556	---	---	---	---	PASS
GSPT1	2935	broad.mit.edu	37	16	11980334	11980334	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11980334C>T	uc002dbr.2	-	7	860	c.833G>A	c.(832-834)TGG>TAG	p.W278*	GSPT1_uc002dbu.2_Nonsense_Mutation_p.W415*|GSPT1_uc002dbt.2_Nonsense_Mutation_p.W416*|GSPT1_uc010bux.2_Nonsense_Mutation_p.W278*	NM_001130007	NP_001123479	P15170	ERF3A_HUMAN	G1 to S phase transition 1 isoform 3	278					G1/S transition of mitotic cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation	intracellular	GTP binding|GTPase activity|protein binding|translation release factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						TTACATGTACCAAGGACAGAA	0.333													5	337	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58743325	58743325	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58743325T>C	uc002eof.1	-	9	1280	c.1166A>G	c.(1165-1167)GAA>GGA	p.E389G	GOT2_uc010vim.1_Missense_Mutation_p.E346G	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	389					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ACTCACCTGTTCAGGCTTTAG	0.408													20	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													6	39	---	---	---	---	PASS
DLG4	1742	broad.mit.edu	37	17	7111517	7111517	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7111517G>T	uc002get.3	-	4	1402	c.201C>A	c.(199-201)CAC>CAA	p.H67Q	DLG4_uc010cly.2_Missense_Mutation_p.H24Q|DLG4_uc010vto.1_Missense_Mutation_p.H67Q|DLG4_uc002geu.2_Missense_Mutation_p.H24Q	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	24					axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						GGGCCGGGCTGTGCTCCAGAG	0.682													4	44	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7637553	7637553	+	Silent	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7637553C>T	uc002giu.1	+	5	695	c.681C>T	c.(679-681)GCC>GCT	p.A227A	DNAH2_uc002git.2_Silent_p.A227A|DNAH2_uc010vuk.1_Silent_p.A227A	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	227	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGCAGAGGCCATGAACATGA	0.532													5	151	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7801818	7801818	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7801818C>A	uc002gje.2	+	13	2206	c.2056C>A	c.(2056-2058)CTA>ATA	p.L686I	CHD3_uc002gjd.2_Missense_Mutation_p.L745I|CHD3_uc002gjf.2_Missense_Mutation_p.L686I	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	686					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				TTCCAGAGAACTAATTATGGG	0.507													9	112	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	20405972	20405972	+	RNA	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20405972G>A	uc002gxb.2	-	5		c.1047C>T								Homo sapiens similar to Keratin, type I cytoskeletal 16 (Cytokeratin-16) (CK-16) (Keratin-16) (K16), mRNA (cDNA clone IMAGE:4752428).																		ACCTCACTGCGGCTGCTCTGT	0.587													3	11	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29162600	29162600	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29162600C>A	uc002hfs.1	+	2	1847	c.1501C>A	c.(1501-1503)CAA>AAA	p.Q501K	ATAD5_uc002hft.1_Missense_Mutation_p.Q398K	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	501					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GGGAAACACTCAAAAGAAAGA	0.308													5	218	---	---	---	---	PASS
KRT32	3882	broad.mit.edu	37	17	39619147	39619147	+	Silent	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39619147G>A	uc002hwr.2	-	6	1213	c.1152C>T	c.(1150-1152)GAC>GAT	p.D384D		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	384	Coil 2.|Rod.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)				GGGCCCGGACGTCCAGCAGCA	0.637													4	18	---	---	---	---	PASS
DNAJC7	7266	broad.mit.edu	37	17	40148366	40148366	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40148366A>G	uc002hyo.2	-	4	605	c.368T>C	c.(367-369)CTA>CCA	p.L123P	DNAJC7_uc010cxu.2_Missense_Mutation_p.L67P|DNAJC7_uc010cxv.2_Missense_Mutation_p.L67P|DNAJC7_uc010wgb.1_Missense_Mutation_p.L67P|DNAJC7_uc010wgc.1_5'UTR|DNAJC7_uc002hyp.2_Missense_Mutation_p.L67P|DNAJC7_uc010cxw.2_RNA	NM_003315	NP_003306	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	123	TPR 3.				chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding			ovary(1)	1		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				ATCCAGTTCTAGGGCTCTCTG	0.418													19	147	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6898615	6898615	+	Intron	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898615G>T	uc010wzi.1	+						ARHGAP28_uc002knc.2_3'UTR|ARHGAP28_uc002knd.2_3'UTR|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_3'UTR			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AGGGATTTGGGTATCCAGTAG	0.363													9	82	---	---	---	---	PASS
PIGN	23556	broad.mit.edu	37	18	59815498	59815498	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59815498A>G	uc002lii.3	-	8	1071	c.623T>C	c.(622-624)TTA>TCA	p.L208S	PIGN_uc002lij.3_Missense_Mutation_p.L208S	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	208	Lumenal (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				TAATAAATGTAAGAAAAAAAC	0.294													42	292	---	---	---	---	PASS
PAPL	390928	broad.mit.edu	37	19	39591391	39591391	+	Silent	SNP	T	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39591391T>G	uc002oki.2	+	7	979	c.705T>G	c.(703-705)GGT>GGG	p.G235G	PAPL_uc010egl.2_Missense_Mutation_p.V194G	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	235						extracellular region	acid phosphatase activity|metal ion binding				0						GGGATCTGGGTCCCGCCCACA	0.622													6	57	---	---	---	---	PASS
LILRB5	10990	broad.mit.edu	37	19	54760570	54760570	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54760570G>A	uc002qex.2	-	3	248	c.137C>T	c.(136-138)ACC>ATC	p.T46I	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Missense_Mutation_p.T46I|LILRB5_uc002qey.2_Missense_Mutation_p.T46I|LILRB5_uc002qez.2_Missense_Mutation_p.T46I|LILRB5_uc002qfa.1_Missense_Mutation_p.T36I|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	46	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACACCAGAGGGTCACGGGCTT	0.622													7	21	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243438	56243438	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243438G>A	uc002qly.2	-	2	1787	c.1759C>T	c.(1759-1761)CAT>TAT	p.H587Y		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	587						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TGTTGACAATGCTTCAGGCAG	0.373													33	171	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													3	11	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37137768	37137768	+	Silent	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37137768C>T	uc002xiw.2	+	6	1046	c.789C>T	c.(787-789)CCC>CCT	p.P263P	RALGAPB_uc010zvz.1_Silent_p.P263P|RALGAPB_uc002xix.2_Silent_p.P263P|RALGAPB_uc002xiy.1_Silent_p.P263P|RALGAPB_uc002xiz.2_Silent_p.P41P|RALGAPB_uc002xja.1_5'UTR	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	263					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TTAAAGTTCCCGATGAAGATG	0.358													6	472	---	---	---	---	PASS
YWHAB	7529	broad.mit.edu	37	20	43535034	43535034	+	Silent	SNP	G	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43535034G>A	uc002xmt.2	+	7	978	c.696G>A	c.(694-696)TCG>TCA	p.S232S	YWHAB_uc002xmu.2_Silent_p.S232S	NM_003404	NP_003395	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan	232					activation of MAPKK activity|activation of pro-apoptotic gene products|axon guidance|cytoplasmic sequestering of protein|epidermal growth factor receptor signaling pathway|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|mRNA metabolic process|negative regulation of protein dephosphorylation|nerve growth factor receptor signaling pathway|Ras protein signal transduction	centrosome|cytosol|melanosome|perinuclear region of cytoplasm	histone deacetylase binding|phosphoserine binding|protein domain specific binding			kidney(2)|ovary(1)|breast(1)	4		Myeloproliferative disorder(115;0.0122)				TGTGGACATCGGAAAACCAGG	0.458													6	390	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906858	10906858	+	3'UTR	SNP	T	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906858T>G	uc002yip.1	-	24					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_3'UTR|TPTE_uc002yir.1_3'UTR|TPTE_uc010gkv.1_3'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTGGCAGGGTTGGAAAGAAC	0.303													22	199	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906928	10906928	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906928C>T	uc002yip.1	-	24	2001	c.1633G>A	c.(1633-1635)GAT>AAT	p.D545N	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D527N|TPTE_uc002yir.1_Missense_Mutation_p.D507N|TPTE_uc010gkv.1_Missense_Mutation_p.D407N	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	545					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.D527N(1)		ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCTACAACATCACTGGAAGTC	0.383													34	667	---	---	---	---	PASS
CLIC6	54102	broad.mit.edu	37	21	36081084	36081084	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36081084C>T	uc010gmt.1	+	5	1751	c.1751C>T	c.(1750-1752)ACG>ATG	p.T584M	CLIC6_uc002yuf.1_Missense_Mutation_p.T566M	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	584	GST C-terminal.					chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						ATAAAAAACACGAAGAAGGAT	0.458													19	106	---	---	---	---	PASS
LOC391322	391322	broad.mit.edu	37	22	24373819	24373819	+	Silent	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24373819T>C	uc011ajk.1	+	2	339	c.318T>C	c.(316-318)TCT>TCC	p.S106S		NM_001144931	NP_001138403			similar to D-dopachrome tautomerase												0						AATATTATTCTAAAACACAAT	0.517													14	90	---	---	---	---	PASS
FRMPD4	9758	broad.mit.edu	37	X	12736620	12736620	+	Silent	SNP	C	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12736620C>A	uc004cuz.1	+	16	4181	c.3675C>A	c.(3673-3675)GGC>GGA	p.G1225G	FRMPD4_uc011mij.1_Silent_p.G1217G	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1225					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						GTGGCACAGGCAGCAGTGGCA	0.587													4	15	---	---	---	---	PASS
CXorf30	645090	broad.mit.edu	37	X	36385149	36385149	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36385149C>T	uc011mkc.1	+	16	2078	c.1430C>T	c.(1429-1431)GCT>GTT	p.A477V		NM_001098843	NP_001092313	A6PW82	CX030_HUMAN	hypothetical protein LOC645090	477										lung(2)|breast(1)	3						ATGTTGATCGCTACTGAACCT	0.363													7	653	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54043171	54043171	+	Splice_Site	SNP	T	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54043171T>C	uc004dsu.2	-	6	636	c.563_splice	c.e6-1	p.G188_splice	PHF8_uc004dst.2_Splice_Site_p.G152_splice|PHF8_uc004dsv.2_Splice_Site_p.G18_splice|PHF8_uc004dsw.2_Splice_Site_p.G152_splice|PHF8_uc004dsx.2_5'Flank|PHF8_uc004dsy.2_Splice_Site_p.G152_splice	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8						brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						TGTCAGAACCTGGAGTAAAGA	0.473													18	177	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112058900	112058900	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112058900G>T	uc004epr.2	-	2	1078	c.1078C>A	c.(1078-1080)CAG>AAG	p.Q360K	AMOT_uc004eps.2_5'UTR|AMOT_uc004ept.1_Missense_Mutation_p.Q360K	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	360					actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						TGGTGAGCCTGATTAGGAAGG	0.423													5	61	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123630881	123630881	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123630881C>G	uc004euj.2	-	20	3744	c.3680G>C	c.(3679-3681)AGT>ACT	p.S1227T	ODZ1_uc011muj.1_Missense_Mutation_p.S1226T|ODZ1_uc010nqy.2_Missense_Mutation_p.S1227T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1227	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTCCAAAATACTAACGGAGTT	0.398													19	103	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8723663	8723666	+	Intron	DEL	CAGC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8723663_8723666delCAGC	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		tcctccagtgcagccagCCAGCCA	0.083													4	2	---	---	---	---	
CTNNBIP1	56998	broad.mit.edu	37	1	9926855	9926855	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9926855delC	uc001aqk.1	-						CTNNBIP1_uc001aql.1_Intron	NM_020248	NP_064633	Q9NSA3	CNBP1_HUMAN	catenin, beta interacting protein 1						anterior/posterior pattern formation|branching involved in ureteric bud morphogenesis|negative regulation of mesenchymal cell proliferation|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell proliferation|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of Wnt receptor signaling pathway|positive regulation of monocyte differentiation|positive regulation of osteoblast differentiation|regulation of vascular permeability involved in acute inflammatory response|Wnt receptor signaling pathway	Axin-APC-beta-catenin-GSK3B complex|cytosol|nucleus	armadillo repeat domain binding|beta-catenin binding				0		all_lung(284;1.82e-05)|Lung NSC(185;3.08e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;7.32e-08)|COAD - Colon adenocarcinoma(227;1.73e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000912)|KIRC - Kidney renal clear cell carcinoma(229;0.00112)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		agtcgagatgccagataggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13197573	13197573	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13197573delT								LOC440563 (13606 upstream) : PRAMEF3 (131260 downstream)																							CAGCGCAGCCTTTTTTTTTGT	0.512													7	4	---	---	---	---	
PTPRU	10076	broad.mit.edu	37	1	29588399	29588400	+	Intron	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29588399_29588400insA	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		catgcagttgtaaaaaaaatac	0.015													4	2	---	---	---	---	
SERINC2	347735	broad.mit.edu	37	1	31906613	31906614	+	Intron	INS	-	TATG	TATG			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31906613_31906614insTATG	uc010ogh.1	+						SERINC2_uc010ogg.1_Intron|SERINC2_uc001bst.2_Intron|SERINC2_uc001bsu.2_Intron|SERINC2_uc001bsv.2_Intron	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like							integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		AGGTCAGGAGCTCCAGGGTCCC	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34748275	34748275	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34748275delA								C1orf94 (63546 upstream) : MIR552 (386925 downstream)																							CAGAATTTACATACATTCTGA	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37079274	37079275	+	IGR	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37079274_37079275delAC								CSF3R (130765 upstream) : GRIK3 (181853 downstream)																							aggtacactgacacacacacac	0.064													4	2	---	---	---	---	
MTF1	4520	broad.mit.edu	37	1	38306459	38306459	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38306459delA	uc001cce.1	-						MTF1_uc009vvj.1_Intron	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GAAGGTTAAGAAAAAAAAAAA	0.453													3	3	---	---	---	---	
MTF1	4520	broad.mit.edu	37	1	38308589	38308589	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38308589delG	uc001cce.1	-						MTF1_uc009vvj.1_Intron	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				gcggactactggggtcagggt	0.090													4	2	---	---	---	---	
NFYC	4802	broad.mit.edu	37	1	41175331	41175331	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41175331delT	uc001cgb.2	+						NFYC_uc010ojm.1_Intron|NFYC_uc001cfx.3_Intron|NFYC_uc009vwd.2_Intron|NFYC_uc001cfz.2_Intron|NFYC_uc010ojn.1_Intron|NFYC_uc001cfy.3_Intron|NFYC_uc001cgc.2_Intron	NM_014223	NP_055038	Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma isoform 2						protein folding|regulation of transcription from RNA polymerase II promoter	CCAAT-binding factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)|kidney(1)	3	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			ATAGAAACTGTTTAGCTTCAG	0.368													4	2	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	42982339	42982339	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42982339delT	uc001chn.2	+						CCDC30_uc001chm.2_Intron|CCDC30_uc010oju.1_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						tcctcttccatttttcaccat	0.010													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	53839488	53839488	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53839488delA								LRP8 (45667 upstream) : FLJ40434 (64556 downstream)																							AGCACCACGGAAAAACACCTT	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54488932	54488933	+	IGR	INS	-	ACAC	ACAC	rs142788862	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54488932_54488933insACAC								LDLRAD1 (5129 upstream) : TMEM59 (8418 downstream)																							TCCTGCTCTTTacacacacaca	0.173													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54876252	54876252	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54876252delA								SSBP3 (4160 upstream) : ACOT11 (131678 downstream)																							ACCTCTGATCAAAACCTTCGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56305168	56305168	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56305168delT								USP24 (624406 upstream) : PPAP2B (655265 downstream)																							atgaaactgcttttttagccc	0.000													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58482904	58482904	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58482904delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						TCACTTTGGCAAAAAGCCCAT	0.458													4	2	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	63128443	63128443	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63128443delA	uc001daq.2	-						DOCK7_uc001dap.2_Intron|DOCK7_uc009wah.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						aaaaaagaagaaaaaaaaGTT	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	63615676	63615676	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63615676delC								ATG4C (285627 upstream) : FOXD3 (173054 downstream)																							ACTTTCCCTTCACAAGGACAA	0.423													4	2	---	---	---	---	
USP33	23032	broad.mit.edu	37	1	78188044	78188044	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78188044delA	uc001dht.2	-						USP33_uc001dhs.2_Intron|USP33_uc001dhu.2_Intron|USP33_uc001dhv.2_Intron|USP33_uc001dhw.2_Intron	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TCATAATAGcaaaaaaaaaaa	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82470429	82470429	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82470429delA								LPHN2 (12323 upstream) : None (None downstream)																							GAGTCAGAGTAAAAAAAAATA	0.438													4	3	---	---	---	---	
RNPC3	55599	broad.mit.edu	37	1	104070846	104070846	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104070846delA	uc010oul.1	+						RNPC3_uc010oum.1_Intron|RNPC3_uc010oun.1_Intron	NM_017619	NP_060089	Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3						mRNA processing	U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GTTGAGATGGAAATGGAACTT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	108921140	108921141	+	Intron	DEL	TG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108921140_108921141delTG	uc001dvq.2	+							NM_001143989				neuroblastoma breakpoint family, member 4																		tatatatgtatgtgtgtgtgtg	0.228													6	3	---	---	---	---	
KIAA1324	57535	broad.mit.edu	37	1	109697616	109697616	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109697616delG	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		AAACCTCTTTGGGATGTGTGT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110423424	110423424	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110423424delT								EPS8L3 (116860 upstream) : CSF1 (29809 downstream)																							CCTCACTCCCTTTTTACCCTA	0.448													4	2	---	---	---	---	
SLC16A1	6566	broad.mit.edu	37	1	113460677	113460680	+	Intron	DEL	AATA	-	-	rs111571180		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113460677_113460680delAATA	uc001ecx.2	-						SLC16A1_uc001ecy.2_Intron|SLC16A1_uc001ecz.2_Intron	NM_003051	NP_003042	P53985	MOT1_HUMAN	solute carrier family 16, member 1						blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Pyruvic acid(DB00119)	CTGTGAAGACaataaataaataaa	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116333356	116333357	+	IGR	INS	-	T	T	rs144708098	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116333356_116333357insT								CASQ2 (21930 upstream) : NHLH2 (45644 downstream)																							cctggatcaagtttttttttct	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142551474	142551475	+	IGR	DEL	TA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142551474_142551475delTA								None (None upstream) : None (None downstream)																							tgaaaaattttatgtcagcgta	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142956513	142956514	+	Intron	DEL	CT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142956513_142956514delCT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		ttagaacttactgtgttccagg	0.089													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145018385	145018385	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145018385delA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_RNA	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGGAAGTTGGAAAAACTGGAa	0.318			T	PDGFRB	MPD								4	4	---	---	---	---	
FCRL5	83416	broad.mit.edu	37	1	157522376	157522376	+	5'Flank	DEL	A	-	-	rs76456913		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157522376delA	uc001fqu.2	-						FCRL5_uc009wsm.2_5'Flank|FCRL5_uc010phv.1_5'Flank|FCRL5_uc010phw.1_5'Flank|FCRL5_uc001fqv.1_5'Flank|FCRL5_uc010phx.1_5'Flank	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ATGATCAAAGAAAAAAAAAAG	0.219													6	3	---	---	---	---	
ATP1A2	477	broad.mit.edu	37	1	160089160	160089161	+	Intron	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160089160_160089161insA	uc001fvc.2	+						ATP1A2_uc001fvb.2_Intron	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			AAACTAATTCCTGAAAGCCTAG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	167146581	167146581	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167146581delT								DUSP27 (48179 upstream) : POU2F1 (43562 downstream)																							attcttgatgtttttttgaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177451279	177451280	+	IGR	DEL	GG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177451279_177451280delGG								FAM5B (199722 upstream) : SEC16B (446209 downstream)																							CGAGTGACTTGGGAGACTTCAT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177589992	177589992	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177589992delT								FAM5B (338435 upstream) : SEC16B (307497 downstream)																							gtcactgacattttttttccc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187008652	187008654	+	IGR	DEL	TTT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187008652_187008654delTTT								PLA2G4A (50547 upstream) : None (None downstream)																							CTACTTAGTATTTTAGACACTTT	0.369													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195869379	195869379	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195869379delT								None (None upstream) : KCNT2 (325534 downstream)																							taaacttgactttttggtgga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	196997265	196997265	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196997265delT								CFHR5 (18464 upstream) : F13B (11056 downstream)																							tttctttctgtttttttttca	0.000													4	2	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197512716	197512716	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197512716delA	uc010ppe.1	-						DENND1B_uc010ppf.1_Intron	NM_001142795	NP_001136267	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 1							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						ATTTCATTGTAAAAAAAAATC	0.343													4	2	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210781146	210781147	+	Intron	DEL	AG	-	-	rs112129241		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210781146_210781147delAG	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TAAAAAAAATAGAGAGAGAGAG	0.391													4	2	---	---	---	---	
SUSD4	55061	broad.mit.edu	37	1	223421682	223421682	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223421682delG	uc001hnx.2	-						SUSD4_uc001hny.3_Intron|SUSD4_uc010puw.1_Intron|SUSD4_uc001hnz.2_Intron	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a							integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)		CAGGGACTCTGCTCCCATATT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228631722	228631722	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228631722delC								HIST3H3 (18696 upstream) : HIST3H2A (13344 downstream)																							gcgtctctggcccccagatcc	0.000													4	2	---	---	---	---	
ABCB10	23456	broad.mit.edu	37	1	229678427	229678427	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229678427delG	uc001htp.3	-							NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10							integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				ACAACAGAGTGGGAAGAGACA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234019467	234019468	+	IGR	INS	-	TCA	TCA			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234019467_234019468insTCA								KCNK1 (211209 upstream) : SLC35F3 (21211 downstream)																							CTCAACCCTCTTCATCTGAAGC	0.455													4	2	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236148505	236148505	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236148505delA	uc001hxo.2	-						NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	aaaaaaaaagaaaaaaaaaaG	0.164													8	4	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239756308	239756308	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239756308delT	uc001hyo.1	+									P20309	ACM3_HUMAN	Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	CCTATCATCCTTTACACCTTC	0.527													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239980998	239980999	+	Intron	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239980998_239980999delAC	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TGCTCCCTCTACACACACACAC	0.495													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	240072588	240072588	+	3'UTR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240072588delA	uc001hyp.2	+	5						NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TAGGAGGAGGAAGGCGAGGGC	0.463													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241487083	241487083	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241487083delC	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TGAAATGCAACCCAACTCCAA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6351921	6351921	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6351921delT								LOC400940 (223557 upstream) : CMPK2 (628582 downstream)																							TCTGCTCAGATTTTTTTTTCA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7459505	7459505	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7459505delG								RNF144A (275198 upstream) : LOC339788 (603053 downstream)																							AAAGGAGTTAGCACGTGAGGT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11988521	11988521	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11988521delA								LPIN1 (20990 upstream) : TRIB2 (868477 downstream)																							GTATATAATTAAAAAAAATTG	0.358													4	2	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17860451	17860451	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17860451delA	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					cttttataacaaaaaaaTTAA	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19770364	19770364	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19770364delG								OSR1 (211992 upstream) : TTC32 (326154 downstream)																							tctcagccctggtgctgtgtt	0.159													4	2	---	---	---	---	
DNMT3A	1788	broad.mit.edu	37	2	25532424	25532424	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25532424delG	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron|DNMT3A_uc002rge.2_Intron|DNMT3A_uc002rgf.2_Intron	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCACCACCGGGGGGCACTG	0.368			Mis|F|N|S		AML								4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28135115	28135115	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28135115delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					CTCCTTATTCTTTTTTTTTTT	0.313													4	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29165470	29165470	+	Intron	DEL	T	-	-	rs67816126		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29165470delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTATGGAAGATtttttttttc	0.169													6	3	---	---	---	---	
MEMO1	51072	broad.mit.edu	37	2	32129852	32129853	+	Intron	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32129852_32129853delGT	uc002rnx.2	-						MEMO1_uc010ymu.1_Intron|MEMO1_uc010ezq.2_Intron|MEMO1_uc002rny.2_Intron|MEMO1_uc002rnz.2_Intron|MEMO1_uc010ymv.1_Intron	NM_015955	NP_057039	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1 isoform 1						regulation of microtubule-based process	cytosol|nucleus				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					TAAAGGCAAAGTGATATAAAAG	0.347													4	2	---	---	---	---	
RASGRP3	25780	broad.mit.edu	37	2	33774434	33774435	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33774434_33774435delCA	uc002rox.2	+						RASGRP3_uc010ync.1_Intron|RASGRP3_uc002roy.2_Intron	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					TATGCTCCTGcacacacacaca	0.351													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37986321	37986322	+	IGR	INS	-	AATA	AATA	rs146587638	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37986321_37986322insAATA								CDC42EP3 (86995 upstream) : FAM82A1 (166140 downstream)																							gtctcagagggaataatcagcc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	50117321	50117321	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50117321delT								FSHR (735691 upstream) : NRXN1 (28323 downstream)																							ttgtttgttatttttTTTTCt	0.005													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50711154	50711154	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50711154delA	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGGCAAATATAAAAGAACAGC	0.328													4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54195688	54195688	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54195688delA	uc002rxp.2	-						PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AACATGACTTAGGAAAAAAAC	0.388													4	2	---	---	---	---	
CCDC88A	55704	broad.mit.edu	37	2	55537716	55537716	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55537716delA	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010fbw.2_5'Flank|CCDC88A_uc002ryu.2_Intron|CCDC88A_uc002rys.2_Intron|CCDC88A_uc002ryw.2_Intron|CCDC88A_uc010fby.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						gactgaaaagaaaaaaaaaaa	0.189													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60129892	60129892	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60129892delT								None (None upstream) : BCL11A (548411 downstream)																							TTTAAAACTGTTTTTTATAAA	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	68172620	68172620	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68172620delA								ETAA1 (535087 upstream) : C1D (96713 downstream)																							gggaatggataaaaagaagga	0.184													4	2	---	---	---	---	
SNRNP27	11017	broad.mit.edu	37	2	70124269	70124270	+	Intron	INS	-	T	T	rs139819450	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70124269_70124270insT	uc002sfw.2	+						SNRNP27_uc002sfv.2_Intron|SNRNP27_uc002sfx.2_Intron	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						TGAAACCCAGGTTTTTTTTTAA	0.312													4	2	---	---	---	---	
TEX261	113419	broad.mit.edu	37	2	71221417	71221418	+	Intron	DEL	CC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71221417_71221418delCC	uc002shn.2	-						TEX261_uc010fdy.2_Intron	NM_144582	NP_653183	Q6UWH6	TX261_HUMAN	testis expressed sequence 261							integral to membrane					0						cgaatgggaaccagccagagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	76599948	76599948	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76599948delA								C2orf3 (661837 upstream) : LRRTM4 (374910 downstream)																							TTTCCTCTGCAAAAAAAGTCC	0.373													4	2	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77711446	77711446	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77711446delT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TATGTTCTCCTTTTTTTTTCC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	84114541	84114542	+	IGR	DEL	TG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84114541_84114542delTG								None (None upstream) : FUNDC2P2 (403264 downstream)																							TTCTTTTGTATGTGTGTGTGTG	0.322													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	86220049	86220049	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86220049delA								ST3GAL5 (103892 upstream) : LOC90784 (27290 downstream)																							gagttatgagaaaaaaaaaac	0.219													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90207211	90207212	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90207211_90207212insC	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		taacgttctttcctgagcaaag	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91778533	91778533	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91778533delC								None (None upstream) : LOC654342 (26659 downstream)																							CCCTTCTCTTCCCCGCTTTGC	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91913741	91913741	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91913741delT								LOC654342 (65766 upstream) : GGT8P (49627 downstream)																							TTTACAGAGATTTTTTTCTTT	0.328													4	2	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100037693	100037693	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100037693delA	uc002tad.2	-						REV1_uc002tac.2_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						CACTTTTGGGAAAAAAAAAAC	0.343								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	4	---	---	---	---	
CREG2	200407	broad.mit.edu	37	2	101990108	101990108	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101990108delG	uc002tba.2	-							NM_153836	NP_722578	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2							extracellular region	FMN binding			ovary(1)	1						ATAGTGCAATGGCAGAGGAAC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102242149	102242149	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102242149delT								RFX8 (150984 upstream) : MAP4K4 (72339 downstream)																							ACCCAGCAGCTTTCTGTCAGC	0.547													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104448412	104448412	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104448412delA								None (None upstream) : LOC150568 (602393 downstream)																							taccccTGCTAAAAATTTTTA	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105621775	105621775	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105621775delC								POU3F3 (148305 upstream) : MRPS9 (32708 downstream)																							AAATATGCCTCCCTTTCTTCT	0.443													4	2	---	---	---	---	
NPHP1	4867	broad.mit.edu	37	2	110923079	110923079	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110923079delG	uc002tfn.3	-						NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Intron|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						aaaaataaaagaaacataaaa	0.055													4	2	---	---	---	---	
NPHP1	4867	broad.mit.edu	37	2	110923084	110923085	+	Intron	DEL	AT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110923084_110923085delAT	uc002tfn.3	-						NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Intron|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						taaaagaaacataaaagcatta	0.050													4	2	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	116461817	116461818	+	Intron	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116461817_116461818insA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						CCTAGCCATTTAAAAAAAAAAA	0.347													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121523311	121523311	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121523311delG	uc010yyu.1	+						GLI2_uc002tmp.1_Intron			P10070	GLI2_HUMAN	SubName: Full=cDNA FLJ60878, highly similar to Homo sapiens GLI-Kruppel family member GLI2, mRNA;						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GGGCCCCCTTGGCCTAGCAAA	0.587													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125554924	125554924	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125554924delT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATTTTATCAGTTTTTAGATCC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126444203	126444203	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126444203delA								CNTNAP5 (771342 upstream) : GYPC (969481 downstream)																							GAAGTTTTATACCTCTAGTCT	0.363													5	3	---	---	---	---	
POLR2D	5433	broad.mit.edu	37	2	128605994	128605994	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128605994delT	uc002tpj.2	-						uc010fmc.2_5'Flank|POLR2D_uc002tpk.2_Intron	NM_004805	NP_004796	O15514	RPB4_HUMAN	DNA directed RNA polymerase II polypeptide D						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA-directed RNA polymerase activity|nucleotide binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0675)		tttttttttcttttttttgag	0.114													4	2	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133838345	133838346	+	Intron	DEL	AA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133838345_133838346delAA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						ATACAAATGTAAAAATTAGCCG	0.371													4	2	---	---	---	---	
TMEM163	81615	broad.mit.edu	37	2	135292841	135292842	+	Intron	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135292841_135292842delAC	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		CTCACTGAAAACACACACACAC	0.426													4	2	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137617281	137617281	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137617281delT	uc010zbj.1	+											Homo sapiens mRNA for KIAA1679 protein, partial cds.											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCACAGTGCGTTTTTATGTTC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154072275	154072275	+	IGR	DEL	T	-	-	rs34847594		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154072275delT								ARL6IP6 (454508 upstream) : RPRM (261577 downstream)																							CTTTCTAGCATTTTTTTTTTC	0.214													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179534646	179534646	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179534646delT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGAGCACACTTTTTTTTTTC	0.308													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	182133444	182133445	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182133444_182133445delCA	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																		tgtaattcACCACACACACACA	0.322													4	2	---	---	---	---	
CLK1	1195	broad.mit.edu	37	2	201726825	201726825	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201726825delA	uc002uwe.2	-						CLK1_uc010zhi.1_Intron|CLK1_uc002uwf.2_Intron|CLK1_uc002uwg.2_Intron|CLK1_uc010fsv.2_Intron	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1						cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						GGAAGAATGCAAAAAAAAAAA	0.353													6	4	---	---	---	---	
MPP4	58538	broad.mit.edu	37	2	202543518	202543518	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202543518delT	uc002uyk.3	-						MPP4_uc010ftj.2_Intron|MPP4_uc010zhq.1_Intron|MPP4_uc010zhr.1_Intron|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_Intron|MPP4_uc010ftk.2_Intron|MPP4_uc002uym.1_Intron	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4							cytoplasm	protein binding				0						agcccccagctttgaacatca	0.000													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203681920	203681921	+	Intron	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203681920_203681921delTC	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						GGTCCCTAAGTCTCTCTCTCTC	0.421													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205600251	205600252	+	Intron	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205600251_205600252delTC	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		aaaagttatgtcaaaaacaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	207263016	207263016	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207263016delC								ZDBF2 (83868 upstream) : ADAM23 (45352 downstream)																							ACAAACAGCTCCACCCAAGAT	0.418													4	2	---	---	---	---	
STK16	8576	broad.mit.edu	37	2	220113490	220113490	+	3'UTR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220113490delG	uc002vko.2	+	8					STK16_uc002vks.2_3'UTR|STK16_uc002vkp.2_3'UTR|STK16_uc002vkr.2_3'UTR|STK16_uc002vkq.2_3'UTR	NM_001008910	NP_001008910	O75716	STK16_HUMAN	serine/threonine kinase 16						protein complex assembly	membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGGTGGGTGGGGGTTGGGA	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221380961	221380962	+	IGR	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221380961_221380962insT								SLC4A3 (874260 upstream) : EPHA4 (901787 downstream)																							AAGAATCTTGATTTTTTTTCTC	0.356													4	2	---	---	---	---	
CCDC140	151278	broad.mit.edu	37	2	223164516	223164516	+	Intron	DEL	A	-	-	rs28945086		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223164516delA	uc002vnb.1	+						PAX3_uc002vmt.1_5'Flank|PAX3_uc002vmy.1_5'Flank|PAX3_uc002vmv.1_5'Flank|PAX3_uc002vmw.1_5'Flank|PAX3_uc002vmx.1_5'Flank|PAX3_uc010fwo.2_5'Flank|PAX3_uc002vmz.1_5'Flank|PAX3_uc002vna.1_5'Flank	NM_153038	NP_694583	Q96MF4	CC140_HUMAN	coiled-coil domain containing 140												0		Renal(207;0.0376)		Epithelial(121;4.03e-10)|all cancers(144;1.8e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGGTGCAGAAAAAAACCTG	0.542													4	2	---	---	---	---	
KCNE4	23704	broad.mit.edu	37	2	223914887	223914888	+	5'Flank	INS	-	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223914887_223914888insG	uc002vnl.3	+							NM_080671	NP_542402	Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related							integral to membrane	voltage-gated potassium channel activity			ovary(1)	1		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGGAAGTATGTGGGAATCGGGG	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224920257	224920257	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224920257delC								SERPINE2 (16221 upstream) : FAM124B (323159 downstream)																							taagctatttccaggtctctt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237918420	237918420	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237918420delT								CXCR7 (427428 upstream) : COPS8 (75664 downstream)																							CAATCATCAGTTTAGATCATT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240691222	240691222	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240691222delC								HDAC4 (367876 upstream) : NDUFA10 (208936 downstream)																							ATCCATCCCTCCCCCAAACAC	0.542													4	2	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11329711	11329711	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11329711delA	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						taagggttgtaaaaaaaataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	18643095	18643095	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18643095delA								SATB1 (162843 upstream) : KCNH8 (546922 downstream)																							AAGTACAATGAAAAAAAATAT	0.383													4	2	---	---	---	---	
SLC4A7	9497	broad.mit.edu	37	3	27478676	27478679	+	Intron	DEL	TACT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27478676_27478679delTACT	uc003cdv.2	-						SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfm.2_Intron|SLC4A7_uc003cdw.2_Intron	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate							apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						accccatctctactaaaaatacaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	31449243	31449244	+	IGR	DEL	AA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31449243_31449244delAA								GADL1 (513090 upstream) : STT3B (125247 downstream)																							ATCATGAGTTAATCTTTTTGGA	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40762572	40762572	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40762572delG								ZNF621 (181529 upstream) : CTNNB1 (473829 downstream)																							ttccctctctgcagcatcagg	0.000													4	2	---	---	---	---	
ARIH2	10425	broad.mit.edu	37	3	48999911	48999912	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48999911_48999912delTT	uc003cvb.2	+						ARIH2_uc003cvc.2_Intron|ARIH2_uc003cvf.2_Intron|ARIH2_uc010hkl.2_Intron	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2						developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		ACTAGAGATCTTAAGATACAGA	0.416													4	2	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49378203	49378203	+	5'Flank	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49378203delT	uc003cwq.2	-						USP4_uc003cwr.2_5'Flank	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		GTACTCCACATTAGTTACCCA	0.532													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51086898	51086898	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51086898delT	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		tgctggttccttttttaaatg	0.025													4	2	---	---	---	---	
LRIG1	26018	broad.mit.edu	37	3	66445568	66445568	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66445568delC	uc003dmx.2	-						LRIG1_uc011bfu.1_Intron|LRIG1_uc003dmw.2_Intron|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TGATGGCTGGCCCACGATAAG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72091514	72091514	+	Intron	DEL	A	-	-	rs71915391		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72091514delA	uc003dpb.1	-											Homo sapiens cDNA FLJ39871 fis, clone SPLEN2015730.																		TGAGGTGAGGAAAAAAAAAAG	0.473													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72732249	72732249	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72732249delC								RYBP (236475 upstream) : SHQ1 (66181 downstream)																							GCAGTTTTGTCCCCACCCCAG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	79827883	79827885	+	IGR	DEL	TTT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79827883_79827885delTTT								ROBO1 (10824 upstream) : None (None downstream)																							atgtccatagtttttaaaataag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	89825437	89825439	+	IGR	DEL	CTC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89825437_89825439delCTC								EPHA3 (294155 upstream) : None (None downstream)																							tcttcttcttctccttctccttc	0.000													4	2	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	96636593	96636593	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96636593delA	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						cctgaaagggaaaaaaaaaat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105004839	105004839	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105004839delG								None (None upstream) : ALCAM (80874 downstream)																							AAAATATAAAGAAACAGGTAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116741467	116741467	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116741467delA								LOC285194 (305582 upstream) : None (None downstream)																							ATACAAAGAGAAAAAAATAGA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	123624510	123624511	+	IGR	DEL	CT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123624510_123624511delCT								MYLK (21361 upstream) : CCDC14 (7765 downstream)																							ATCACATACACTCAATAACTCA	0.436													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124339614	124339614	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124339614delG	uc003ehg.2	+						KALRN_uc003ehi.2_Intron|KALRN_uc003ehk.2_Intron|KALRN_uc003ehj.2_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TAGGGGCAGAGGGTGGAGTTC	0.542													4	2	---	---	---	---	
KIAA1257	57501	broad.mit.edu	37	3	128706154	128706154	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128706154delT	uc003elj.3	-						KIAA1257_uc003elg.1_Intron|KIAA1257_uc003eli.3_Intron	NM_020741	NP_065792	Q9ULG3	K1257_HUMAN	hypothetical protein LOC57501												0						ttgttttttgttttttttttt	0.199													2	4	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	131067776	131067777	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131067776_131067777insC	uc003eny.2	+						uc003eoc.1_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						AAAACTAttctccccctcattt	0.040													4	2	---	---	---	---	
NCRNA00119	348808	broad.mit.edu	37	3	132530307	132530308	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132530307_132530308delTT	uc003epg.1	+							NR_002811				Homo sapiens cDNA clone IMAGE:4826885.												0						tttctcaggcttttaggcttgc	0.000													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	139799846	139799847	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139799846_139799847delCA	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GAATATCCTTCACTCCACAGCG	0.307										HNSCC(16;0.037)			4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	139813789	139813789	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139813789delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						ATTGCTGGAACCAGCAGGAGT	0.398										HNSCC(16;0.037)			4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140283990	140283991	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140283990_140283991delCA	uc003etn.2	+							NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GAGGACAAGGCAAGAGTGTGCC	0.426										HNSCC(16;0.037)			4	2	---	---	---	---	
ACPL2	92370	broad.mit.edu	37	3	140992432	140992432	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140992432delT	uc003etu.2	+						ACPL2_uc003etv.2_Intron|ACPL2_uc011bna.1_Intron|ACPL2_uc011bnb.1_Intron	NM_152282	NP_689495	Q8TE99	ACPL2_HUMAN	acid phosphatase-like 2 precursor							extracellular region	acid phosphatase activity			skin(1)	1						TGTTGGTTGCTTTTGAGAGGG	0.478													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159548498	159548499	+	Intron	DEL	TA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159548498_159548499delTA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GTTCCACATCTATAGTGTGGGA	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	175923297	175923297	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175923297delA								NAALADL2 (399871 upstream) : TBL1XR1 (815246 downstream)																							ccgctaccctaatcagtcaac	0.000													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186037947	186037947	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186037947delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	taacctactctttttttctat	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191471283	191471284	+	IGR	INS	-	T	T	rs35031122		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191471283_191471284insT								PYDC2 (292040 upstream) : FGF12 (388400 downstream)																							TCCACTTTTGGCTGTCTCCTCT	0.411													4	2	---	---	---	---	
ATP13A4	84239	broad.mit.edu	37	3	193130400	193130401	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193130400_193130401delGA	uc003ftd.2	-						ATP13A4_uc010hzi.2_Intron	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TGGATACATTgagagagagaga	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193619706	193619706	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193619706delA								OPA1 (204107 upstream) : LOC100128023 (91178 downstream)																							tgttttttttacagcattgta	0.000													4	2	---	---	---	---	
WHSC1	7468	broad.mit.edu	37	4	1921662	1921662	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1921662delA	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gdy.1_Intron|WHSC1_uc010icd.1_Intron|WHSC1_uc003gea.1_Intron|WHSC1_uc010ice.1_Intron|WHSC1_uc003geh.1_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		acgccgtctcaaaaaaaaagg	0.169			T	IGH@	MM								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	16493311	16493311	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16493311delA								FLJ39653 (233501 upstream) : LDB2 (9856 downstream)																							atattcacttaaaaaatcagg	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17466076	17466076	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17466076delA								LDB2 (565652 upstream) : QDPR (21944 downstream)																							ttatcagatcaaaaaaacagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17470331	17470331	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17470331delC								LDB2 (569907 upstream) : QDPR (17689 downstream)																							CAGCAGGTCTCCAGTGCTTGG	0.512											OREG0016129	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26837118	26837118	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26837118delT								TBC1D19 (80203 upstream) : STIM2 (25246 downstream)																							cccttctacattttcgatctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49121124	49121125	+	IGR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49121124_49121125insA								CWH43 (57031 upstream) : None (None downstream)																							cattccattttttccaatccac	0.000													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54556281	54556282	+	Intron	INS	-	T	T	rs140329710	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54556281_54556282insT	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	atttgcttctcgtacactttta	0.000			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61915762	61915762	+	IGR	DEL	C	-	-	rs5858666		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61915762delC								None (None upstream) : LPHN3 (151212 downstream)																							atggcacttgcccattttcag	0.020													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	68172436	68172436	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68172436delT								None (None upstream) : CENPC1 (165553 downstream)																							ttgccaaaccttttcaaaata	0.000													4	2	---	---	---	---	
STAP1	26228	broad.mit.edu	37	4	68456331	68456332	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68456331_68456332delGA	uc003hde.3	+						STAP1_uc003hdf.2_Intron	NM_012108	NP_036240	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0						TTTAATTCTTGATTCCTTTTTT	0.317													4	2	---	---	---	---	
MAPK10	5602	broad.mit.edu	37	4	87080230	87080230	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87080230delA	uc003hpq.2	-						MAPK10_uc010ikg.2_Intron|MAPK10_uc003hpr.2_Intron|MAPK10_uc003hps.2_Intron|MAPK10_uc003hpt.2_Intron|MAPK10_uc003hpu.2_Intron|MAPK10_uc003hpv.2_Intron|MAPK10_uc010ikh.1_Intron|uc003hpw.2_Intron	NM_138982	NP_620448	P53779	MK10_HUMAN	mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TTCTCTGACCAAAAAAAAAAC	0.274													6	5	---	---	---	---	
HERC6	55008	broad.mit.edu	37	4	89317716	89317716	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89317716delA	uc011cdi.1	+						HERC6_uc003hrp.1_Intron|HERC6_uc011cdj.1_Intron|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ATTAAAAAAGAAAAAAAATAG	0.274													4	2	---	---	---	---	
HERC3	8916	broad.mit.edu	37	4	89579958	89579958	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89579958delT	uc003hrw.1	+						HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TGATTTTCCATTTCTTTTCTT	0.323													4	2	---	---	---	---	
C4orf37	285555	broad.mit.edu	37	4	98529543	98529543	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98529543delG	uc003htt.1	-							NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		CAGTGGCACAGGTATAAGTGA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	100099760	100099760	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100099760delT	uc003hum.1	+											Homo sapiens full length insert cDNA clone ZD94A03.																		gctttgactgtttttttaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	116422774	116422774	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116422774delA								NDST4 (387742 upstream) : MIR1973 (798107 downstream)																							TTATCAGGAGAAAAAAAAATA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	122505757	122505757	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122505757delG								QRFPR (203576 upstream) : ANXA5 (83396 downstream)																							TTCTGAGAATGGAGATGGGTC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	137849697	137849697	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137849697delA								None (None upstream) : PCDH18 (590379 downstream)																							agaaggctagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138998892	138998892	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138998892delT	uc003ihh.2	-											Homo sapiens hypothetical protein LOC641365, mRNA (cDNA clone IMAGE:5273182).																		aatattggagttaccaaggga	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	141702640	141702642	+	IGR	DEL	ACC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141702640_141702642delACC								TBC1D9 (25169 upstream) : RNF150 (84083 downstream)																							GTCCTCATCTACCACCAGGGCCA	0.429													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152787952	152787952	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152787952delC								PET112L (105806 upstream) : FBXW7 (454459 downstream)																							tctcacagttctgaagactag	0.050													4	2	---	---	---	---	
DCHS2	54798	broad.mit.edu	37	4	155350843	155350843	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155350843delT	uc003inx.2	-							NM_001142552	NP_001136024	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 2						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTCCCATAAGTTTTTTTTTTT	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	166705057	166705058	+	IGR	DEL	TT	-	-	rs11324036		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166705057_166705058delTT								CPE (285576 upstream) : TLL1 (89352 downstream)																							ACTCTCTCACTTTTTTTTTTTC	0.411													4	3	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186720099	186720099	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186720099delT	uc003iyl.2	-						SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc003iyp.2_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GCCTGTCTTCTTTTTTGAACT	0.383													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190568888	190568889	+	IGR	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190568888_190568889delTC								None (None upstream) : FRG1 (293085 downstream)																							tttccttccttctctctctcCC	0.426													4	2	---	---	---	---	
SEMA5A	9037	broad.mit.edu	37	5	9227108	9227109	+	Intron	INS	-	AT	AT	rs146979886	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9227108_9227109insAT	uc003jek.2	-							NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						attaattaaaaatatatatata	0.351													6	3	---	---	---	---	
LOC285692	285692	broad.mit.edu	37	5	9718963	9718964	+	Intron	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9718963_9718964insA	uc003jen.2	-							NR_027112				Homo sapiens clone TEE10 Cri-du-chat region mRNA.												0						gcattctgtttaaaaagtgaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10123441	10123441	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10123441delA								LOC285692 (219505 upstream) : FAM173B (102997 downstream)																							TTTTAACACCAAAAAAGCACC	0.478													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11467756	11467756	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11467756delA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ATTTTAAAAGAAAAGGGTGAC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28968452	28968452	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28968452delT								None (None upstream) : None (None downstream)																							ATTTTATGTATTTTTTTTAGG	0.363													4	2	---	---	---	---	
SKP2	6502	broad.mit.edu	37	5	36154570	36154570	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36154570delA	uc003jkc.1	+						SKP2_uc011cou.1_Intron|SKP2_uc003jkd.2_Intron|LMBRD2_uc003jkb.1_5'Flank	NM_005983	NP_005974	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ttaaccttctaaaaatgacac	0.010													4	2	---	---	---	---	
WDR70	55100	broad.mit.edu	37	5	37578159	37578160	+	Intron	INS	-	A	A	rs148864157	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37578159_37578160insA	uc003jkv.2	+						WDR70_uc010iva.1_Intron	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAGGAATAGATGGTGAAGGATG	0.416													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38246572	38246572	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38246572delA								GDNF (406790 upstream) : EGFLAM (11961 downstream)																							TGATAGATCTAAAAGAAATTT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42745900	42745901	+	IGR	INS	-	AAG	AAG	rs143159932	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42745900_42745901insAAG								GHR (23975 upstream) : CCDC152 (11019 downstream)																							ccctacatagaaaggctatcta	0.119													2	5	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58489630	58489630	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58489630delG	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	CACAGGATATGCAATAGTAGA	0.463													4	2	---	---	---	---	
NLN	57486	broad.mit.edu	37	5	65076355	65076355	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65076355delT	uc003juf.2	+						NLN_uc003jue.2_Intron|NLN_uc003jug.2_Intron	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CTTAATAATCTTTTTTTTTTT	0.313													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70961086	70961087	+	IGR	INS	-	TTTC	TTTC	rs150111880	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70961086_70961087insTTTC								MCCC2 (6558 upstream) : CARTPT (53907 downstream)																							CTCCAGAGTCATTTCTGCTCTG	0.421													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	76086677	76086677	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76086677delA								F2R (55083 upstream) : F2RL1 (28156 downstream)																							CAGAGACAGCAAACCAGCTAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	86411817	86411817	+	5'Flank	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86411817delA	hsa-mir-4280|MI0015889	-																													AGTTGCCTTTATTGTGCTTCA	0.328													4	2	---	---	---	---	
LOC645323	645323	broad.mit.edu	37	5	87980582	87980583	+	RNA	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87980582_87980583delTC	uc011cua.1	-	1		c.38_39delGA			LOC645323_uc003kjh.3_RNA	NR_015436				Homo sapiens cDNA FLJ34037 fis, clone FCBBF2005439.												0						CCAGCTCGTTtctctctctctc	0.401													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	88345187	88345187	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88345187delA								MEF2C (145318 upstream) : None (None downstream)																							AGAAAGGATCAAAAAAATATG	0.323													4	2	---	---	---	---	
RHOBTB3	22836	broad.mit.edu	37	5	95068896	95068896	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95068896delA	uc003klm.2	+						RHOBTB3_uc003klk.1_Intron	NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TTGGTAAAATAAAAAACAGGC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95417392	95417393	+	IGR	DEL	AT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95417392_95417393delAT								MIR583 (2476 upstream) : PCSK1 (308726 downstream)																							CTTCAGAGAGATAGAGGGATCC	0.455													4	2	---	---	---	---	
WDR36	134430	broad.mit.edu	37	5	110437795	110437795	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110437795delT	uc003kpd.2	+						WDR36_uc010jbu.2_Intron	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36						response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)|skin(1)	2		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TACACACGTATTTTTTTTTCC	0.294													6	3	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112616464	112616464	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112616464delT	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GTGATTCTCCTTTTACCTGTT	0.358													4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112724698	112724698	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112724698delG	uc003kql.3	-							NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GATTATCAAAGGTCATGAATT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121191336	121191337	+	IGR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121191336_121191337insA								FTMT (2815 upstream) : SRFBP1 (106319 downstream)																							tcctcatccttaaaaaaatgcc	0.000													4	3	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126646282	126646282	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126646282delT	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GAGATGTCTCTTTTTTACTTG	0.358													4	2	---	---	---	---	
SLC12A2	6558	broad.mit.edu	37	5	127480612	127480612	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127480612delT	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GACTTTTGTCTTTTTTTCCCC	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135413926	135413926	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135413926delG								TGFBI (14420 upstream) : MIR886 (2251 downstream)																							GAAGGCTAATGGGAATATTTC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135998881	135998881	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135998881delC								TRPC7 (305808 upstream) : SPOCK1 (312107 downstream)																							GTGTGTTTCTCCCCCACCTCA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	138923296	138923296	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138923296delT								TMEM173 (61004 upstream) : UBE2D2 (17455 downstream)																							ATCCCAATTCTTTCCTGAGAG	0.473													4	2	---	---	---	---	
PCDHA1	56147	broad.mit.edu	37	5	140305550	140305550	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140305550delA	uc003lhb.2	+						PCDHA1_uc003lha.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_5'Flank|PCDHAC1_uc003lig.1_5'Flank	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor						homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTATCACGCAAAAAAAAAGC	0.522													4	2	---	---	---	---	
SLC25A2	83884	broad.mit.edu	37	5	140682221	140682221	+	3'UTR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140682221delG	uc003ljf.2	-	1						NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2						mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	ATGGCTTTATGCAAAGGCCCT	0.418													4	2	---	---	---	---	
FGF1	2246	broad.mit.edu	37	5	142025472	142025472	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142025472delT	uc003lmn.3	-						FGF1_uc003lmp.3_Intron|FGF1_uc003lmq.2_Intron|FGF1_uc010jgj.2_Intron|FGF1_uc003lmr.2_Intron|FGF1_uc003lms.3_Intron	NM_000800	NP_000791	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)	TGtttttttgttttttttgtt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143269676	143269676	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143269676delG								HMHB1 (69394 upstream) : YIPF5 (268055 downstream)																							CAGCATTGGTGGATTCTTGCT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144483297	144483297	+	IGR	DEL	C	-	-	rs33985308		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144483297delC								KCTD16 (626353 upstream) : PRELID2 (655285 downstream)																							TGGAGGGTTTCTTTTTTTTTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	147239208	147239208	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147239208delA								SPINK1 (27948 upstream) : SCGB3A2 (19066 downstream)																							ATCTTATACCAAAAAAAATCT	0.219													5	3	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155133132	155133132	+	5'Flank	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155133132delG	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATTGCAATGTGCACAAAGGGC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	156490695	156490695	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156490695delA								HAVCR1 (4565 upstream) : HAVCR2 (22148 downstream)																							atgctaatgcaaaaaaggcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157898459	157898459	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157898459delA								CLINT1 (612291 upstream) : EBF1 (224465 downstream)																							CAAATGCATTAAAAAAAAGGG	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166138494	166138494	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166138494delA								None (None upstream) : ODZ2 (573349 downstream)																							ATCTGAATATAAAAGTCCCCC	0.289													4	2	---	---	---	---	
ERGIC1	57222	broad.mit.edu	37	5	172283822	172283822	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172283822delA	uc003mbw.3	+							NM_001031711	NP_001026881	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGAGAATGGATTGTAGCCTT	0.328													4	2	---	---	---	---	
LOC285780	285780	broad.mit.edu	37	6	6548500	6548500	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6548500delA	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0						acaaagcaggaaaaaaaaact	0.114													4	2	---	---	---	---	
BMP6	654	broad.mit.edu	37	6	7866113	7866114	+	Intron	INS	-	AAG	AAG			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7866113_7866114insAAG	uc003mxu.3	+							NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein						BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					ACATCTGGGTAAAGAAGTTAGC	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11849756	11849756	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11849756delC								C6orf105 (70476 upstream) : HIVEP1 (162968 downstream)																							gaacatatctccataacatca	0.144													4	2	---	---	---	---	
DCDC2	51473	broad.mit.edu	37	6	24292569	24292570	+	Intron	DEL	CG	-	-	rs34932860	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24292569_24292570delCG	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				CATTTACAGACGCAAAAAAAAA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28829145	28829146	+	RNA	DEL	TA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28829145_28829146delTA	uc003nlq.2	-	2		c.1041_1042delTA								Homo sapiens cDNA FLJ30941 fis, clone FEBRA2007458.																		GTAACACTGCTATAGAAATCTA	0.446													4	2	---	---	---	---	
LY6G6C	80740	broad.mit.edu	37	6	31687639	31687639	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31687639delT	uc003nwh.2	-						LY6G6C_uc010jtd.2_Intron	NM_025261	NP_079537	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex G6C precursor							anchored to membrane|plasma membrane					0						tttgaggccgttttctcagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35131031	35131031	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35131031delG								TCP11 (21844 upstream) : SCUBE3 (51159 downstream)																							CACACAGTGTGGGGACACACT	0.507													4	2	---	---	---	---	
ETV7	51513	broad.mit.edu	37	6	36325738	36325738	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36325738delC	uc003olz.1	-						ETV7_uc003oma.1_Intron	NM_016135	NP_057219	Q9Y603	ETV7_HUMAN	ets variant 7						organ morphogenesis|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						gggtgtcaatcccccatacag	0.000													4	2	---	---	---	---	
MTCH1	23787	broad.mit.edu	37	6	36952979	36952979	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36952979delC	uc003ond.1	-						MTCH1_uc003onc.1_Intron|MTCH1_uc010jwo.1_Intron|MTCH1_uc003one.3_Intron|MTCH1_uc011dtt.1_Intron	NM_014341	NP_055156	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier homolog 1						activation of caspase activity|neuronal ion channel clustering|positive regulation of apoptosis|regulation of signal transduction|transport	integral to membrane|mitochondrial inner membrane	protein binding				0						TTCGCACTCTCCCACCAAATT	0.547													4	2	---	---	---	---	
TREML3	340206	broad.mit.edu	37	6	41176951	41176951	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41176951delT	uc003oqb.2	-							NR_027256				Homo sapiens TREM-like transcript 3 (TLT3) mRNA, partial cds.												0						cctgaccctcttttctgcctc	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	51290116	51290118	+	IGR	DEL	GAT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51290116_51290118delGAT								TFAP2B (474791 upstream) : PKHD1 (190027 downstream)																							ttttaaaGAGgatgatgatgatg	0.172													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	64574392	64574393	+	Intron	INS	-	TT	TT	rs146770807	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64574392_64574393insTT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TTTTCTCCCTCTTTTCTGTTTC	0.292													2	4	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69664576	69664576	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69664576delT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				gttcaatggcttttttttttt	0.000													6	3	---	---	---	---	
KCNQ5	56479	broad.mit.edu	37	6	73736191	73736191	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73736191delA	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		agtttgctccaaaaggcctac	0.000													4	2	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74473025	74473025	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74473025delA	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						CCAATCCCTGAAAGAGCAAAA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85361792	85361792	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85361792delA								KIAA1009 (424457 upstream) : TBX18 (35289 downstream)																							TGCCAAAGAGAAATCCTGAGA	0.418													4	2	---	---	---	---	
NT5E	4907	broad.mit.edu	37	6	86157632	86157632	+	5'Flank	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86157632delA	uc003pko.3	+						NT5E_uc003pkn.2_5'Flank|NT5E_uc010kbr.2_5'Flank	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor						DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	ACACCTGGAGAAAAAAAGTAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92479787	92479787	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92479787delC								None (None upstream) : None (None downstream)																							GTACAGATTACCCATATGTGT	0.363													4	2	---	---	---	---	
HACE1	57531	broad.mit.edu	37	6	105219621	105219621	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105219621delA	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron|HACE1_uc010kcx.1_Intron|HACE1_uc003pqt.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		AGGTGTTTGGAAAAAAAAAAG	0.294													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108425808	108425810	+	IGR	DEL	TTA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108425808_108425810delTTA								OSTM1 (29867 upstream) : NR2E1 (61405 downstream)																							gcgcccggccTTATTATTATTAT	0.202													4	3	---	---	---	---	
HINT3	135114	broad.mit.edu	37	6	126280710	126280710	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126280710delA	uc003qal.3	+						HINT3_uc010keu.2_Intron	NM_138571	NP_612638	Q9NQE9	HINT3_HUMAN	histidine triad nucleotide binding protein 3							mitochondrion|nucleolus	hydrolase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.153)|GBM - Glioblastoma multiforme(226;0.0321)		tgaagtggtgaagcaaaaggc	0.000													4	2	---	---	---	---	
HINT3	135114	broad.mit.edu	37	6	126299112	126299112	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126299112delT	uc003qal.3	+	5					HINT3_uc010keu.2_3'UTR	NM_138571	NP_612638	Q9NQE9	HINT3_HUMAN	histidine triad nucleotide binding protein 3							mitochondrion|nucleolus	hydrolase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.153)|GBM - Glioblastoma multiforme(226;0.0321)		GGGCTCTGTATTTTTTTAAGT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	126799557	126799558	+	Intron	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126799557_126799558delTC	uc003qaq.1	-						CENPW_uc003qap.3_Intron					Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		tctctctttatctctctctctc	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132903931	132903931	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132903931delT								TAAR6 (11435 upstream) : TAAR5 (5800 downstream)																							CTCCCTCCTGTGATCACTGTA	0.274													4	2	---	---	---	---	
EYA4	2070	broad.mit.edu	37	6	133844719	133844719	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133844719delT	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		ACGAGTGCCCTTAATTACAGA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	144457718	144457718	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144457718delA								SF3B5 (40964 upstream) : STX11 (13936 downstream)																							CTATCCCTCTAAACAGATCCT	0.443													4	2	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150117924	150117924	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150117924delT	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		GATAATCAGGTTttttttgtt	0.214													4	2	---	---	---	---	
AKAP12	9590	broad.mit.edu	37	6	151605347	151605348	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151605347_151605348delCA	uc011eep.1	+						AKAP12_uc003qoe.2_Intron	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		agatcagtGTCACACATCGTTC	0.248													4	2	---	---	---	---	
IPCEF1	26034	broad.mit.edu	37	6	154483835	154483838	+	Intron	DEL	TCTA	-	-	rs144210319		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154483835_154483838delTCTA	uc003qpx.2	-						OPRM1_uc003qpt.1_Intron|IPCEF1_uc003qpv.2_Intron|IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368	Q8WWN9	ICEF1_HUMAN	phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0						tgttctctgctctatctatgttca	0.000													3	3	---	---	---	---	
FNDC1	84624	broad.mit.edu	37	6	159692702	159692702	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159692702delT	uc010kjv.2	+	23						NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCTTCTCTACTTTTTTTTGTT	0.418													3	3	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	165862198	165862201	+	Intron	DEL	ACAC	-	-	rs72380337		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165862198_165862201delACAC	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	GCCAAAGGAAacacacacacacac	0.299													6	3	---	---	---	---	
TTYH3	80727	broad.mit.edu	37	7	2691378	2691378	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2691378delT	uc003smp.2	+						TTYH3_uc010ksn.2_Intron|TTYH3_uc003smq.2_Intron	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN	tweety 3							chloride channel complex|plasma membrane	chloride channel activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		TTTTAAAATGTTTTTTTTTAA	0.438													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	3652371	3652371	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3652371delA	uc003smx.2	+							NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAGCTGTGGCAAAAGCGGAGT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4504987	4504987	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4504987delC								SDK1 (196358 upstream) : FOXK1 (178401 downstream)																							AAAAACTCTTCCCCAGCAGAG	0.423													4	2	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18934536	18934537	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18934536_18934537delCA	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003suk.2_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	tatgtgggtccagatgctggca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23257255	23257255	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23257255delA								NUPL2 (16626 upstream) : GPNMB (29061 downstream)																							AAAGCATATTAATAACTGCTG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38061364	38061365	+	IGR	INS	-	T	T	rs149487808	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38061364_38061365insT								EPDR1 (69825 upstream) : STARD3NL (156568 downstream)																							TCCAGTAGCTATTTTTTTTAGA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47312203	47312203	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47312203delT								None (None upstream) : TNS3 (2550 downstream)																							gttctttttcttttttttagt	0.000													5	5	---	---	---	---	
IKZF1	10320	broad.mit.edu	37	7	50439368	50439368	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50439368delC	uc003tow.3	+						IKZF1_uc003tox.3_Intron|IKZF1_uc003toy.3_Intron|IKZF1_uc011kck.1_Intron|IKZF1_uc003toz.3_Intron|IKZF1_uc010kyx.2_Intron	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)						cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(14)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TGCCTCTCCTCGGCACCTTCT	0.562			D		ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53418009	53418009	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53418009delA								POM121L12 (313392 upstream) : HPVC1 (850908 downstream)																							gtgctgccccaaaaaggaggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57172333	57172333	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57172333delA								DKFZp434L192 (607356 upstream) : ZNF479 (14995 downstream)																							accctgactcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70907653	70907653	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70907653delG	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATTTTCTTCCGGAAGTGTAGG	0.438													4	2	---	---	---	---	
ABCB4	5244	broad.mit.edu	37	7	87038329	87038329	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87038329delT	uc003uiv.1	-						ABCB4_uc003uiw.1_Intron|ABCB4_uc003uix.1_Intron	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4						cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					TGGTTTTCCCTTTTTTTTTTA	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93720047	93720047	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93720047delC								BET1 (86357 upstream) : COL1A2 (303826 downstream)																							TCAGTGATCTCCAGGTACCTG	0.537													4	2	---	---	---	---	
STAG3	10734	broad.mit.edu	37	7	99811114	99811115	+	Intron	INS	-	A	A	rs145931135	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99811114_99811115insA	uc003utx.1	+						STAG3_uc011kjk.1_Intron|GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Intron|GATS_uc011kjl.1_Intron|GATS_uc010lgu.2_Intron	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TAACATCTCAGAAAAAATCCGT	0.455													5	3	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122249690	122249691	+	Intron	DEL	AG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122249690_122249691delAG	uc010lkp.2	-						CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						CATGTTTATTAGACCCCAGGTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125246993	125246993	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125246993delT								POT1 (676956 upstream) : GRM8 (831659 downstream)																							ACTGCTTAGATTCCCTCCAAT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134110108	134110108	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134110108delC								SLC35B4 (108281 upstream) : AKR1B1 (16999 downstream)																							AAGGGGCCCTCCCAGAAGACT	0.567													4	2	---	---	---	---	
TRIM24	8805	broad.mit.edu	37	7	138263799	138263800	+	Intron	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138263799_138263800insT	uc003vuc.2	+						TRIM24_uc003vub.2_Intron	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha						cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						TTCATGTCTTCTAAGCCAGTTA	0.396													4	2	---	---	---	---	
LOC100124692	100124692	broad.mit.edu	37	7	141885945	141885945	+	Intron	DEL	T	-	-	rs111646116		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141885945delT	uc003vxa.2	+							NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0						CTTGGTTGTCTTTTTTTTTTT	0.229													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142141218	142141218	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142141218delC	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krv.1_5'Flank|uc003vyt.3_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		TCCAGCAGGACGGAAGCTCAG	0.552													4	2	---	---	---	---	
KEL	3792	broad.mit.edu	37	7	142645191	142645191	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142645191delT	uc003wcb.2	-							NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TCTTGATTTGTTTCCTGATGC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152764771	152764771	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152764771delT								ACTR3B (212308 upstream) : DPP6 (819648 downstream)																							GTGCCTTGAATTTTTTTTTTT	0.234													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157351850	157351850	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157351850delG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TGACTCCATCGGGGGACCCCC	0.582													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157936942	157936942	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157936942delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CTTTTCTGAGCCCCCCAAGGT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5424821	5424822	+	IGR	DEL	GC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5424821_5424822delGC								CSMD1 (572493 upstream) : MCPH1 (839299 downstream)																							catttttagtgcatgaggagac	0.005													4	2	---	---	---	---	
DEFA6	1671	broad.mit.edu	37	8	6786193	6786193	+	5'Flank	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6786193delC	uc003wqt.2	-							NM_001926	NP_001917	Q01524	DEF6_HUMAN	defensin, alpha 6 preproprotein						defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		GCAGAGCCCACACTATCTTCC	0.552											OREG0018513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8413466	8413466	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8413466delG								SGK223 (174209 upstream) : CLDN23 (146200 downstream)																							TAATCAACTTGAAATCTCTGT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8819315	8819315	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8819315delT								MFHAS1 (68184 upstream) : ERI1 (40999 downstream)																							GTGGCCAGGGTTCACATTGGC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20568331	20568331	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20568331delT								LZTS1 (455528 upstream) : GFRA2 (981199 downstream)																							TTTGACCCTGTTTTTTTTGTG	0.478													4	2	---	---	---	---	
ADAM7	8756	broad.mit.edu	37	8	24320694	24320694	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24320694delG	uc003xeb.2	+						ADAM7_uc003xea.1_Intron	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TCTGCTTGATGGAGTCAGGAT	0.333													4	2	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25856524	25856524	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25856524delG	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		ATTGACATGTGGCCAATTTCT	0.388													4	2	---	---	---	---	
GSR	2936	broad.mit.edu	37	8	30546502	30546502	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30546502delT	uc003xih.1	-							NM_000637	NP_000628	P00390	GSHR_HUMAN	glutathione reductase precursor						cell redox homeostasis|nucleobase, nucleoside and nucleotide interconversion	cytosol|mitochondrion	electron carrier activity|glutathione-disulfide reductase activity			ovary(2)|pancreas(2)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Glutathione(DB00143)|NADH(DB00157)	aagagaaaaCTTTTTTTTTTA	0.164													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47841738	47841738	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47841738delC								BEYLA (74331 upstream) : KIAA0146 (331804 downstream)																							TCCACCACCTCCCTCACTCAG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49437662	49437662	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49437662delT								UBE2V2 (463210 upstream) : EFCAB1 (185689 downstream)																							TCAGGATTCATTTTTTTTTGT	0.463													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56499704	56499705	+	IGR	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56499704_56499705delAC								XKR4 (60996 upstream) : TMEM68 (151615 downstream)																							TCCTGCACAAACACACTGTTTT	0.401													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56649398	56649398	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56649398delT								XKR4 (210690 upstream) : TMEM68 (1922 downstream)																							attttcctgattttttttatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61252545	61252545	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61252545delG								CA8 (58591 upstream) : RAB2A (177014 downstream)																							GGGAGGAGGTGGCATTTGAGT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61800384	61800385	+	IGR	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61800384_61800385delTT								CHD7 (20921 upstream) : CLVS1 (400140 downstream)																							tacacacagatttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64556394	64556395	+	IGR	DEL	AC	-	-	rs151231460		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64556394_64556395delAC								YTHDF3 (431049 upstream) : MIR124-2 (735311 downstream)																							GCTGCTGAAGACACACACAAAA	0.386													2	4	---	---	---	---	
LRRC67	286187	broad.mit.edu	37	8	67906011	67906011	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67906011delG	uc003xxc.2	-							NM_001013626	NP_001013648	Q7Z4L9	LRC67_HUMAN	leucine rich repeat containing 67												0						gctcacttttgtgtcccccat	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74332336	74332336	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74332336delG	uc003xzl.2	+	1	28	c.6delG	c.(4-6)TTGfs	p.L2fs						Homo sapiens cDNA FLJ32158 fis, clone PLACE6000231.																		TTGTCATGTTGGGTCGAGCAG	0.418													4	2	---	---	---	---	
PI15	51050	broad.mit.edu	37	8	75747096	75747113	+	Intron	DEL	CACATTCTCCTGATGATT	-	-	rs67423924		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75747096_75747113delCACATTCTCCTGATGATT	uc003yal.2	+						uc003yak.1_Intron|PI15_uc003yam.2_Intron	NM_015886	NP_056970	O43692	PI15_HUMAN	protease inhibitor 15 preproprotein							extracellular region	peptidase inhibitor activity			central_nervous_system(2)|ovary(1)	3	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			AGTCAGTGGGCACATTCTCCTGATGATTCACATTCTCC	0.390													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77507965	77507965	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77507965delC								None (None upstream) : LOC100192378 (15150 downstream)																							CACTGTAGCACCCATTGCTAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	79076167	79076168	+	IGR	DEL	TA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79076167_79076168delTA								None (None upstream) : PKIA (352168 downstream)																							gctgaaacattataatcaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	86529394	86529394	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86529394delA								CA2 (135673 upstream) : REXO1L1 (39170 downstream)																							TCGACAAGGCAAAAAAAAAAC	0.224													4	2	---	---	---	---	
RUNX1T1	862	broad.mit.edu	37	8	93072050	93072051	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93072050_93072051insC	uc003yfd.2	-						RUNX1T1_uc003yfc.1_Intron|RUNX1T1_uc003yfe.1_Intron|RUNX1T1_uc010mao.2_Intron|RUNX1T1_uc011lgi.1_Intron|RUNX1T1_uc003yfh.1_Intron	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1						generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			ACCTTTTTTTTCTCTCTTTTGG	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97652304	97652304	+	IGR	DEL	G	-	-	rs2582809	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97652304delG								SDC2 (28267 upstream) : PGCP (5195 downstream)																							AGTGTTTTTTGTTTTCTTTTC	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109572122	109572122	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109572122delT								TTC35 (72986 upstream) : TMEM74 (46958 downstream)																							ttggtatatataacagctatt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	121936827	121936828	+	IGR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121936827_121936828insA								SNTB1 (112518 upstream) : HAS2 (688443 downstream)																							GCTCTCCCAGCAGAAGATGATT	0.421													4	2	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126238927	126238927	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126238927delG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AACATGATTTGGGTAGTGAAG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127597123	127597123	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127597123delG								FAM84B (26657 upstream) : LOC727677 (704939 downstream)																							ATGTTTGGTTGTTTTAAGTAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129681725	129681726	+	IGR	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129681725_129681726delCA								MIR1208 (519291 upstream) : None (None downstream)																							cagtgatgttcaggccaccaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132068281	132068282	+	IGR	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132068281_132068282insC								ADCY8 (15446 upstream) : EFR3A (848077 downstream)																							acattcttggacccctgcttgt	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132516441	132516441	+	IGR	DEL	T	-	-	rs34947823		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132516441delT								ADCY8 (463606 upstream) : EFR3A (399918 downstream)																							tttagcttcatttttttccct	0.000													3	3	---	---	---	---	
KCNK9	51305	broad.mit.edu	37	8	140625044	140625044	+	Intron	DEL	T	-	-	rs72234184		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140625044delT	uc003yvf.1	-						KCNK9_uc003yve.1_Intron	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			cgctgttgggttttttttgcc	0.179													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141162100	141162100	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141162100delG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						accacgcactggggagccgga	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143713459	143713460	+	IGR	DEL	AC	-	-	rs71873115		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143713459_143713460delAC								ARC (17626 upstream) : JRK (25415 downstream)																							gtcgactggGacacacacacac	0.282													4	2	---	---	---	---	
C9orf68	55064	broad.mit.edu	37	9	4651692	4651693	+	Intron	INS	-	A	A	rs151297519	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4651692_4651693insA	uc011llz.1	-						C9orf68_uc003zik.2_Intron|C9orf68_uc003zil.2_Intron|C9orf68_uc010mhj.2_Intron|C9orf68_uc011lly.1_Intron|C9orf68_uc003zim.2_Intron	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN	hypothetical protein LOC55064												0		Breast(48;0.0456)		GBM - Glioblastoma multiforme(50;0.0222)		aaataaaggataaaaaaatcac	0.000													5	10	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8897321	8897322	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8897321_8897322insC	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AAAGAGATGTTTTTTTTTCGTA	0.401										TSP Lung(15;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	16277536	16277536	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16277536delA								C9orf93 (305641 upstream) : BNC2 (131966 downstream)																							AAAATGTTGCAAAAATAAATA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25718029	25718029	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25718029delA								TUSC1 (39173 upstream) : None (None downstream)																							ttcacgttggaggagcagcat	0.000													4	2	---	---	---	---	
LINGO2	158038	broad.mit.edu	37	9	28358861	28358861	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28358861delA	uc010mjf.1	-						LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTATTCATTCAAAAAAATAGG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32083559	32083559	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32083559delC								None (None upstream) : ACO1 (301042 downstream)																							tcttaagcatcccaagctccc	0.045													4	2	---	---	---	---	
DNAJA1	3301	broad.mit.edu	37	9	33030244	33030245	+	Intron	INS	-	AGTT	AGTT	rs140704545	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33030244_33030245insAGTT	uc003zsd.1	+						DNAJA1_uc011lnt.1_Intron|DNAJA1_uc003zse.1_Intron	NM_001539	NP_001530	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1						protein folding|response to heat|response to unfolded protein	membrane	ATP binding|heat shock protein binding|low-density lipoprotein particle receptor binding|metal ion binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		TAATAAGTAAAATTTATTGGAA	0.317													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66464851	66464851	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66464851delA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																		ACACAGTTTTACAAATTTTAG	0.408													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67908384	67908385	+	IGR	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67908384_67908385delCA								FAM27B (114195 upstream) : None (None downstream)																							TTGGAACAGTCACAGAGAAAAG	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68477460	68477460	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68477460delA								FAM27B (683271 upstream) : MIR1299 (524779 downstream)																							ggtctaagccaaaaaaaaata	0.080													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68483955	68483955	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68483955delG								FAM27B (689766 upstream) : MIR1299 (518284 downstream)																							gcccctggaagggactcaggg	0.179													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	85379248	85379248	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85379248delT								FLJ46321 (769078 upstream) : RASEF (218069 downstream)																							AAGGCAAGAATTTTTTTTTTC	0.393													4	2	---	---	---	---	
GOLM1	51280	broad.mit.edu	37	9	88679496	88679496	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88679496delC	uc004aol.2	-						GOLM1_uc010mqd.1_Intron|GOLM1_uc004aom.2_Intron	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0						atggccagggcctgcctttta	0.010													4	2	---	---	---	---	
CTSL3	392360	broad.mit.edu	37	9	90398543	90398543	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90398543delC	uc004apm.1	+							NR_027917				RecName: Full=Putative cathepsin L-like protein 3;          Short=Cathepsin L-like protein; AltName: Full=HCTSL-s;											ovary(1)	1						GAACTGCAGGCCCCAGCACAA	0.532													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94452798	94452798	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94452798delT	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						tgaaattctgtttttttttgt	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99924731	99924732	+	IGR	INS	-	G	G	rs145342037	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99924731_99924732insG								LOC340508 (80504 upstream) : ZNF322B (32901 downstream)																							AACTCTACAAAGAAATTGCCGT	0.267													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105345494	105345494	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105345494delT								GRIN3A (844632 upstream) : CYLC2 (412099 downstream)																							agttgttgcctgagtcgagga	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	109035068	109035069	+	Intron	DEL	TG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109035068_109035069delTG	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																		gagcccaatttgaatgtaggcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	109209219	109209219	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109209219delA								TMEM38B (671775 upstream) : ZNF462 (416159 downstream)																							ctacactagtaagggactgaa	0.000													4	2	---	---	---	---	
EPB41L4B	54566	broad.mit.edu	37	9	111965662	111965662	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111965662delG	uc004bdz.1	-							NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						gctttaagcagggggatggca	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120522162	120522162	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120522162delG								TLR4 (42398 upstream) : None (None downstream)																							GCATGTTTGTGGGTATGAGAG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126856160	126856160	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126856160delC								LHX2 (60718 upstream) : NEK6 (163726 downstream)																							TTGTTAATCTCACAAAAGGAT	0.507													4	2	---	---	---	---	
BAT2L1	84726	broad.mit.edu	37	9	134349674	134349675	+	Intron	INS	-	T	T	rs80075057		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134349674_134349675insT	uc004can.3	+						BAT2L1_uc010mzj.1_Intron|BAT2L1_uc004cao.3_Intron	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like								protein binding				0						tgatgcttatgtttttttttgg	0.262													3	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137606383	137606385	+	Intron	DEL	GGT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137606383_137606385delGGT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		tgctgatgaaggtggtggtggag	0.000													4	3	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	326857	326858	+	Intron	DEL	AA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:326857_326858delAA	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATGATTTTGTAAATTAAAAACC	0.337													4	2	---	---	---	---	
C10orf108	414235	broad.mit.edu	37	10	697637	697637	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:697637delT	uc001ifr.2	+						DIP2C_uc001ifp.2_Intron|C10orf108_uc010qab.1_3'UTR	NR_027152				SubName: Full=Novel protein; SubName: Full=Chromosome 10 open reading frame 108, isoform CRA_a;												0						AAATCTGGACTTTTGCTAAAT	0.478													4	2	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1387839	1387840	+	Intron	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1387839_1387840insT	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TGTTTCCCCCCGTGACTCTGAT	0.564													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6367910	6367910	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6367910delG								PFKFB3 (90405 upstream) : PRKCQ (101195 downstream)																							AATGAGTCCTGGGGTGCACTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6390215	6390215	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6390215delA								PFKFB3 (112710 upstream) : PRKCQ (78890 downstream)																							ACGCTGACATAAAAAAGGAAG	0.493													4	2	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7281812	7281812	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7281812delA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GGTTGTGTAGAAAAAGCGTTA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	13305238	13305238	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13305238delT								UCMA (28910 upstream) : PHYH (14559 downstream)																							GGATTTACCCTTTCTTGACAT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16569802	16569802	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16569802delA								C1QL3 (5798 upstream) : RSU1 (62817 downstream)																							TCAATGGGTGAAAAAAAGTTA	0.338													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24662068	24662068	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24662068delC	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TTTATGGGGACCTTTGCCAAG	0.483													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34939474	34939474	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34939474delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				GAAGTGGACATTTTTTTTTAA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44618467	44618468	+	IGR	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44618467_44618468delGA								HNRNPA3P1 (332602 upstream) : CXCL12 (247139 downstream)																							GCTATTAGAGGAGAGAGAGAGA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45274049	45274050	+	IGR	INS	-	AC	AC	rs145220984	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45274049_45274050insAC								CXCL12 (393507 upstream) : TMEM72 (132714 downstream)																							cagctggaaaggcgtgtgtctg	0.198													4	3	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49701702	49701702	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49701702delG	uc001jgt.2	-						ARHGAP22_uc001jgs.2_5'Flank|ARHGAP22_uc001jgu.2_Intron|ARHGAP22_uc010qgl.1_Intron|ARHGAP22_uc010qgm.1_Intron|ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						TGTCTCTCCTGGGGAACTTCT	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60681317	60681317	+	IGR	DEL	A	-	-	rs5785358		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60681317delA								BICC1 (92472 upstream) : PHYHIPL (255031 downstream)																							TCTTTCTAAGAAAAAAAAACC	0.194													4	3	---	---	---	---	
SLC16A9	220963	broad.mit.edu	37	10	61411980	61411983	+	3'UTR	DEL	AAAA	-	-	rs147748697	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61411980_61411983delAAAA	uc010qig.1	-	6						NM_194298	NP_919274	Q7RTY1	MOT9_HUMAN	solute carrier family 16 (monocarboxylic acid						urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3						atatttttttaaaaaatGACCAAT	0.363													4	2	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72258687	72258687	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72258687delA	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						tttatctcagaaaaaaaaaaa	0.144													4	2	---	---	---	---	
ADAMTS14	140766	broad.mit.edu	37	10	72449785	72449786	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72449785_72449786delTT	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						ctgtagaatgttagctccgtgc	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82057637	82057637	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82057637delT								MAT1A (8203 upstream) : DYDC1 (38227 downstream)																							CTATGTAttcttttttttttt	0.219													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87818805	87818807	+	Intron	DEL	GAG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87818805_87818807delGAG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	atgagctcatgaggaggaggagg	0.000										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	88112524	88112525	+	Intron	INS	-	C	C	rs77215100	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88112524_88112525insC	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GTTTTGCATGGCCCCCTCAGCT	0.421										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88851618	88851618	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88851618delT	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	GCAGATGAGGTTTTTTTTTTT	0.383													4	3	---	---	---	---	
TNKS2	80351	broad.mit.edu	37	10	93580472	93580473	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93580472_93580473delGA	uc001khp.2	+							NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				GGCTAAATTGGAGAGAGAGGAG	0.376													4	2	---	---	---	---	
TCTN3	26123	broad.mit.edu	37	10	97446056	97446057	+	Intron	DEL	TA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97446056_97446057delTA	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron|TCTN3_uc001kld.2_Intron|TCTN3_uc009xux.1_Intron|TCTN3_uc009xuy.1_Intron	NM_015631	NP_056446	Q6NUS6	TECT3_HUMAN	tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		tctaacACCTTATGGATCCTGG	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	101370020	101370025	+	IGR	DEL	CGCTAC	-	-	rs3215924		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101370020_101370025delCGCTAC								NKX2-3 (73742 upstream) : SLC25A28 (250 downstream)																							TTCTGTGCTGCGCTACCGCCCTAGGG	0.519													2	4	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101592725	101592727	+	Intron	DEL	CAG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101592725_101592727delCAG	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	aattcaggaacagaggcagagat	0.182													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114919470	114919470	+	Intron	DEL	T	-	-	rs71946744		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114919470delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron|TCF7L2_uc010qrv.1_Intron|TCF7L2_uc010qrw.1_Intron|TCF7L2_uc010qrx.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TGACTTTTACTTTTTTTTTTT	0.274													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115052520	115052520	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115052520delC								TCF7L2 (125086 upstream) : HABP2 (260258 downstream)																							CCAGGCACTTCCAGACTGATG	0.468													4	2	---	---	---	---	
C10orf122	387718	broad.mit.edu	37	10	127329362	127329362	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127329362delC	uc001lij.2	-							NM_001128202	NP_001121674	Q5VZQ5	CJ122_HUMAN	hypothetical protein LOC387718												0						CATGCTAGGACCAAAGACTGT	0.502													4	2	---	---	---	---	
OR51B5	282763	broad.mit.edu	37	11	5421281	5421281	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5421281delA	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGTGAGGAAGGAACATAA	0.403													4	2	---	---	---	---	
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5631153	5631153	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5631153delA	uc001mbf.2	+						HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Intron|TRIM6_uc010qzj.1_Intron|TRIM6_uc001mbc.1_Intron|TRIM6_uc001mbe.2_Intron|TRIM6_uc010qzk.1_Intron|TRIM6_uc010qzl.1_Intron|TRIM6_uc001mbd.2_Intron|TRIM6_uc001mbg.1_Intron|TRIM6_uc009yep.1_Intron	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite							intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		actccttctcaaaaaaaaaaG	0.189													4	3	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12452419	12452420	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12452419_12452420insC	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		GACTTTCTTTTCCCTCAACCAT	0.411													4	2	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12491281	12491281	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12491281delA	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		TCGTTTCCTGAAAAAAACATT	0.408													4	2	---	---	---	---	
ZDHHC13	54503	broad.mit.edu	37	11	19197719	19197720	+	3'UTR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19197719_19197720insA	uc001mpi.2	+	17					ZDHHC13_uc001mpj.2_3'UTR	NM_019028	NP_061901	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC domain containing 13 isoform						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|palmitoyltransferase activity|signal transducer activity|zinc ion binding				0						GGCAGACATCTAAAAAAAAAAC	0.257													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19815328	19815328	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19815328delT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ggccgctgccttcctcctgat	0.000													4	2	---	---	---	---	
SLC17A6	57084	broad.mit.edu	37	11	22383574	22383574	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22383574delT	uc001mqk.2	+							NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent						sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						GTCTAAGACCTTTTTTTTTTT	0.294													9	4	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32003386	32003387	+	Intron	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32003386_32003387insT	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					TTTTTCTGTGCTTTTTTTTTTC	0.317													4	2	---	---	---	---	
LDLRAD3	143458	broad.mit.edu	37	11	35993399	35993399	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35993399delT	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				AGAGGACAGATTACAGAACTG	0.488													4	2	---	---	---	---	
MS4A1	931	broad.mit.edu	37	11	60236247	60236247	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60236247delT	uc001npp.2	+	8					MS4A1_uc001npq.2_3'UTR|MS4A1_uc009yna.2_3'UTR|MS4A1_uc009ymz.2_3'UTR|MS4A1_uc010rlc.1_3'UTR	NM_152866	NP_690605	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member						B cell activation|immune response	integral to plasma membrane				ovary(3)|lung(2)	5					Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)	TAGTATAGTATTTTTTTTTGT	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	60548787	60548787	+	IGR	DEL	T	-	-	rs35635309		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60548787delT								MS4A15 (4583 upstream) : MS4A10 (4034 downstream)																							ctgattctccttgctctggtt	0.000													3	6	---	---	---	---	
SUV420H1	51111	broad.mit.edu	37	11	67950784	67950784	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67950784delA	uc001onm.1	-						SUV420H1_uc009yse.1_Intron|SUV420H1_uc001onn.1_Intron|SUV420H1_uc009ysf.2_Intron|SUV420H1_uc001ono.1_Intron|SUV420H1_uc001onp.2_Intron|SUV420H1_uc010rqa.1_Intron|SUV420H1_uc001onq.2_Intron	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						TTCAATGGGCaaaaaaaaaga	0.224													4	2	---	---	---	---	
SAPS3	55291	broad.mit.edu	37	11	68308977	68308978	+	Intron	INS	-	GG	GG	rs148965738	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68308977_68308978insGG	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			gttaagaggatggagtggcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68945001	68945001	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68945001delT								TPCN2 (15094 upstream) : MYEOV (116621 downstream)																							TAGTGGCCTCTTTTTTTTTCA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69916827	69916827	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69916827delA								FGF3 (282635 upstream) : ANO1 (7581 downstream)																							gtaagtggggaatggggtgag	0.050													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83267864	83267865	+	Intron	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83267864_83267865delTC	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GCTACAAAAGTCAGCATCCAGT	0.465													4	2	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89925063	89925063	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89925063delT	uc001pdf.3	+	19					NAALAD2_uc009yvx.2_3'UTR|NAALAD2_uc009yvy.2_3'UTR	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTGCAAAGCCTTTTTTTTTTG	0.299													6	5	---	---	---	---	
TRPC6	7225	broad.mit.edu	37	11	101457173	101457173	+	5'Flank	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101457173delG	uc001pgk.3	-						TRPC6_uc009ywy.2_5'Flank|TRPC6_uc009ywz.1_5'Flank	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GTGTCTCTGTGGGCAGAGGAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109808863	109808864	+	IGR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109808863_109808864insA								C11orf87 (509025 upstream) : ZC3H12C (155062 downstream)																							ttgctgccttcaagccactttc	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110856462	110856464	+	IGR	DEL	CTC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110856462_110856464delCTC								ARHGAP20 (272550 upstream) : C11orf53 (270243 downstream)																							CTTGGCCTGACTCCTCCTCCTCC	0.468													4	2	---	---	---	---	
C11orf53	341032	broad.mit.edu	37	11	111139931	111139931	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111139931delA	uc001plc.2	+							NM_198498	NP_940900	Q8IXP5	CK053_HUMAN	hypothetical protein LOC341032												0		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		ATTTAAAAAGAAAAAAAAAAT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116053820	116053821	+	IGR	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116053820_116053821delAC								CADM1 (678579 upstream) : BUD13 (565067 downstream)																							ATACATGCTTACAAAACAGATG	0.401													4	2	---	---	---	---	
FXYD6	53826	broad.mit.edu	37	11	117726579	117726580	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117726579_117726580delCA	uc001pro.1	-						FXYD6_uc001prp.1_Intron|FXYD6_uc001prq.1_Intron|FXYD6_uc001prr.1_Intron|FXYD6_uc009yzq.1_Intron	NM_022003	NP_071286	Q9H0Q3	FXYD6_HUMAN	FXYD domain-containing ion transport regulator 6							integral to membrane|plasma membrane	ion channel activity			central_nervous_system(1)|skin(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.89e-05)|Epithelial(105;0.00122)		CTGGCTGCTTCACTCTCTTGCT	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129524993	129524994	+	IGR	DEL	AA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129524993_129524994delAA								BARX2 (202820 upstream) : TMEM45B (160747 downstream)																							caacattcttaaagaaaaaaaa	0.000													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131698229	131698230	+	Intron	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131698229_131698230insT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						TATTGCCAAAATTGTCACTACC	0.124													4	2	---	---	---	---	
SLC6A13	6540	broad.mit.edu	37	12	361490	361490	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:361490delG	uc001qic.1	-						SLC6A13_uc009zdj.1_Intron|SLC6A13_uc010sdl.1_Intron	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			tgattgcactgggatgtgatg	0.010													4	2	---	---	---	---	
C12orf5	57103	broad.mit.edu	37	12	4427452	4427453	+	5'Flank	INS	-	TTAAT	TTAAT			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4427452_4427453insTTAAT	uc001qmp.2	+							NM_020375	NP_065108	Q9NQ88	TIGAR_HUMAN	TP53-induced glycolysis and apoptosis regulator							intracellular	fructose-2,6-bisphosphate 2-phosphatase activity			skin(1)	1			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			cagataactacttaatttcatt	0.084													4	2	---	---	---	---	
PLBD1	79887	broad.mit.edu	37	12	14659645	14659645	+	Intron	DEL	T	-	-	rs78906132		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14659645delT	uc001rcc.1	-							NM_024829	NP_079105	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1						lipid catabolic process	extracellular region	hydrolase activity				0						TTACAGATGATTTTTTTTTTT	0.274													6	3	---	---	---	---	
PIK3C2G	5288	broad.mit.edu	37	12	18440151	18440151	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18440151delT	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TTGCAGTGAATTTTTTTTTTT	0.323													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	20249648	20249648	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20249648delT								AEBP2 (574475 upstream) : PDE3A (272549 downstream)																							agttaacatcttcaataaatg	0.000													4	2	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21242658	21242658	+	Intron	DEL	T	-	-	rs61431566		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242658delT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TGCATTTAAATAAAAAAAAAA	0.124													8	5	---	---	---	---	
BCAT1	586	broad.mit.edu	37	12	24989757	24989757	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24989757delA	uc001rgd.3	-						BCAT1_uc001rgc.2_Intron|BCAT1_uc010six.1_Intron|BCAT1_uc010siy.1_Intron|BCAT1_uc001rge.3_Intron	NM_005504	NP_005495	P54687	BCAT1_HUMAN	branched chain aminotransferase 1, cytosolic						branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)	ggaaggaaagaaggaaggaag	0.100													4	2	---	---	---	---	
CCDC91	55297	broad.mit.edu	37	12	28410530	28410531	+	Intron	DEL	AA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28410530_28410531delAA	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rip.1_Intron	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					GATGAGTACTAAAGATCCTGTC	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33636526	33636526	+	IGR	DEL	G	-	-	rs112410600		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33636526delG								SYT10 (43772 upstream) : ALG10 (538690 downstream)																							TGTATATGCTGGCTCTTACTG	0.264													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38763579	38763580	+	IGR	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38763579_38763580insA								ALG10B (40052 upstream) : CPNE8 (282422 downstream)																							tccTCTGCCACAAAAAAATACC	0.322													4	2	---	---	---	---	
ARID2	196528	broad.mit.edu	37	12	46299067	46299067	+	3'UTR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46299067delA	uc001ros.1	+	21					ARID2_uc009zkg.1_3'UTR|ARID2_uc009zkh.1_3'UTR|ARID2_uc001rou.1_3'UTR	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		aagaaaaaggaaaaaaaaaaa	0.333													4	2	---	---	---	---	
FMNL3	91010	broad.mit.edu	37	12	50069946	50069948	+	Intron	DEL	CTC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50069946_50069948delCTC	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						ccaacctcttctcctcctcctcc	0.118													4	2	---	---	---	---	
GLS2	27165	broad.mit.edu	37	12	56881366	56881366	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56881366delA	uc001slj.2	-						GLS2_uc009zos.2_Intron|GLS2_uc001slk.2_Intron|GLS2_uc009zot.2_Intron|GLS2_uc001sll.2_RNA	NM_013267	NP_037399	Q9UI32	GLSL_HUMAN	glutaminase 2 precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding			ovary(1)|central_nervous_system(1)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CGCATCTCCTAAAATACACAC	0.582													4	2	---	---	---	---	
RDH16	8608	broad.mit.edu	37	12	57349941	57349941	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57349941delT	uc001smi.3	-						RDH16_uc009zpa.2_Intron|RDH16_uc010sqx.1_Intron	NM_003708	NP_003699	O75452	RDH16_HUMAN	retinol dehydrogenase 16						lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity				0						AGACATCTCATTTTTAAGAAT	0.433													4	2	---	---	---	---	
USP15	9958	broad.mit.edu	37	12	62696343	62696343	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62696343delT	uc001src.1	+						USP15_uc001srb.1_Intron|USP15_uc010ssj.1_Intron|USP15_uc010ssk.1_Intron|USP15_uc001sra.2_Intron	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		acattatgagtttttttttat	0.015													5	3	---	---	---	---	
PPM1H	57460	broad.mit.edu	37	12	63157978	63157979	+	Intron	INS	-	CAG	CAG	rs72522353	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63157978_63157979insCAG	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CCCAGAAGAGATGCACCCAGAG	0.480													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70322217	70322217	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70322217delG	uc001svu.1	+											RecName: Full=Uncharacterized protein C12orf28; Flags: Precursor;																		GCCCTTCCCTGGGGAAGATAT	0.468													4	2	---	---	---	---	
CRADD	8738	broad.mit.edu	37	12	94086969	94086969	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94086969delA	uc001tda.2	+						CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with						apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						aagcatctacaaagcaaccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98357151	98357153	+	IGR	DEL	AAT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98357151_98357153delAAT								RMST (398358 upstream) : LOC100128191 (549600 downstream)																							ctagttaaaaaATAAAAAAAGAA	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	101916912	101916912	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101916912delG								SPIC (36138 upstream) : MYBPC1 (71835 downstream)																							tttggaatgtgggaggaaacc	0.000													4	2	---	---	---	---	
SVOP	55530	broad.mit.edu	37	12	109307390	109307390	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109307390delT	uc010sxh.1	-							NM_018711	NP_061181	Q8N4V2	SVOP_HUMAN	SV2 related protein							cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity				0						acttcctagcttttggcacat	0.070													4	2	---	---	---	---	
C12orf34	84915	broad.mit.edu	37	12	110202437	110202437	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110202437delT	uc001tpd.1	+						MGC14436_uc010sxs.1_Intron|MGC14436_uc001tpe.2_Intron|C12orf34_uc001tpf.1_Intron	NM_032829	NP_116218	Q5U5X8	CL034_HUMAN	hypothetical protein LOC84915											ovary(1)	1						ACAGATATAATTTTTTTTTCC	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115483460	115483460	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115483460delT								TBX3 (361491 upstream) : MED13L (912923 downstream)																							ACACCTCGACTTTTTTTTCCT	0.313													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119525391	119525391	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119525391delT	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						CGATGGGGTGTTTTTTTAGCT	0.468													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125779616	125779616	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125779616delA								AACS (151744 upstream) : TMEM132B (31546 downstream)																							GCTGCAGAAGAAAAAAAGCAC	0.383													4	2	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	125866480	125866480	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125866480delG	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GCTTGGAGGTGGGGTCTGGTG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127613241	127613242	+	IGR	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127613241_127613242delTC								LOC100128554 (655911 upstream) : None (None downstream)																							ATGCCAAAATTCAACTGACAAA	0.366													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131048429	131048430	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131048429_131048430delTT	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		tccgtttcaattatatacaaaa	0.000													4	2	---	---	---	---	
N6AMT2	221143	broad.mit.edu	37	13	21342988	21342989	+	Intron	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21342988_21342989delGT	uc001uno.1	-						N6AMT2_uc009zzr.1_Intron|N6AMT2_uc001unp.2_Intron	NM_174928	NP_777588	Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2								methyltransferase activity|nucleic acid binding				0		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		ATTTATAAAGGTGACAGAGAGG	0.064													4	2	---	---	---	---	
FGF9	2254	broad.mit.edu	37	13	22265637	22265637	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22265637delG	uc001uog.2	+							NM_002010	NP_002001	P31371	FGF9_HUMAN	fibroblast growth factor 9 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		TCTTTCCTCTGTCCCTGCCTC	0.498													4	2	---	---	---	---	
KATNAL1	84056	broad.mit.edu	37	13	30801887	30801887	+	Intron	DEL	T	-	-	rs79342023		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30801887delT	uc001uss.2	-						KATNAL1_uc001ust.2_Intron	NM_001014380	NP_001014402	Q9BW62	KATL1_HUMAN	katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		TAGTGTGGGAttttttttttc	0.179													7	4	---	---	---	---	
HMGB1	3146	broad.mit.edu	37	13	31086061	31086061	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31086061delA	uc001usz.2	-							NM_002128	NP_002119	P09429	HMGB1_HUMAN	high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CTCCTGGTCTAACCTCTCTGA	0.458													4	2	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32935590	32935590	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32935590delA	uc001uub.1	+							NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset						cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		gggagttgccaaaaagaagca	0.000			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33481657	33481657	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33481657delC								PDS5B (129502 upstream) : KL (108544 downstream)																							gcaaacaaaacaaaaAACATA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	38058617	38058618	+	IGR	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38058617_38058618insC								CSNK1A1L (378816 upstream) : POSTN (78102 downstream)																							CTCCTCACTCTTCAGAAAGCCC	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	38058618	38058619	+	IGR	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38058618_38058619insC								CSNK1A1L (378817 upstream) : POSTN (78101 downstream)																							TCCTCACTCTTCAGAAAGCCCT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	48711696	48711696	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48711696delT								MED4 (42445 upstream) : ITM2B (95578 downstream)																							AGTGGGATCATTTTAAAAGAC	0.363													4	2	---	---	---	---	
VPS36	51028	broad.mit.edu	37	13	52992422	52992423	+	Intron	INS	-	A	A	rs137939288	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52992422_52992423insA	uc001vgs.2	-						VPS36_uc001vgq.2_Intron	NM_016075	NP_057159	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36						cellular membrane organization|endosome transport|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|late endosome|membrane|nucleus	lipid binding			skin(1)	1		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		attaaaaaaataaaaagaggcc	0.050													5	7	---	---	---	---	
TPTE2P3	220115	broad.mit.edu	37	13	53134791	53134791	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53134791delA	uc001vgw.2	+							NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0						cttaaagtataaaaaaaaaaa	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	71287709	71287709	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71287709delT								ATXN8OS (573824 upstream) : DACH1 (724389 downstream)																							TGCCAGTCACTTTTTTACATA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73881901	73881901	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73881901delC								KLF5 (230226 upstream) : KLF12 (378249 downstream)																							TCTATGCCCACCCCACCCTAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74941303	74941304	+	IGR	DEL	AG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74941303_74941304delAG								KLF12 (232909 upstream) : LOC647288 (870586 downstream)																							GTGCTGGATAAGAGAGAGAGAG	0.554													5	3	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92377337	92377337	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92377337delA	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				AAAGTCAGCTAAGTGACAAGC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101422498	101422498	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101422498delT								TMTC4 (95395 upstream) : NALCN (283632 downstream)																							TTTCCACTACTTTTTTTTTTG	0.433													4	3	---	---	---	---	
FGF14	2259	broad.mit.edu	37	13	102555589	102555590	+	Intron	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102555589_102555590delGT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCTAATTGTGgtgtgtgtgtgt	0.307													2	4	---	---	---	---	
TFDP1	7027	broad.mit.edu	37	13	114283890	114283890	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114283890delG	uc001vtw.2	+						TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Intron|TFDP1_uc010agx.2_Intron	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			acccacacttgactagagtgg	0.000										TSP Lung(29;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20529304	20529305	+	IGR	INS	-	TAAT	TAAT	rs150190820	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20529304_20529305insTAAT								OR4L1 (162 upstream) : OR4K17 (56261 downstream)																							aaacataaggatagagatctgc	0.129													4	3	---	---	---	---	
G2E3	55632	broad.mit.edu	37	14	31059419	31059420	+	Intron	DEL	GG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31059419_31059420delGG	uc001wqk.2	+						G2E3_uc010tpe.1_Intron|G2E3_uc010tpf.1_Intron	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase						apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GGAGCATTTTGGGTGATGAAGG	0.361													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	33505030	33505030	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33505030delG	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CTTTGGGTACGGGGGACGCCT	0.433													4	2	---	---	---	---	
SLC25A21	89874	broad.mit.edu	37	14	37187715	37187716	+	Intron	DEL	TC	-	-	rs71873540		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37187715_37187716delTC	uc001wtz.1	-							NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		TAACTCAACTTCTCTCTCTCTC	0.366													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56378766	56378766	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56378766delG								C14orf34 (115374 upstream) : PELI2 (206327 downstream)																							CCTCTGCTCTGGGGGATGCTG	0.532													4	2	---	---	---	---	
C14orf37	145407	broad.mit.edu	37	14	58669302	58669302	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58669302delA	uc010tro.1	-						ACTR10_uc001xdf.2_Intron|ACTR10_uc001xdg.2_Intron|ACTR10_uc001xdh.2_Intron	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						actccatctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
POMT2	29954	broad.mit.edu	37	14	77754848	77754848	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77754848delA	uc001xti.2	-						POMT2_uc001xth.1_Intron	NM_013382	NP_037514	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2						protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		actctgtctcaaaaaaaaaCA	0.224													5	3	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89641397	89641398	+	Intron	DEL	TC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89641397_89641398delTC	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						ACAAACATCTTCTCAAGGGAGG	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98665855	98665856	+	IGR	DEL	CA	-	-	rs35515031		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98665855_98665856delCA								C14orf64 (221394 upstream) : C14orf177 (512094 downstream)																							tatgcacatgcacacacacaca	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20121367	20121369	+	IGR	DEL	ATT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20121367_20121369delATT								None (None upstream) : GOLGA6L6 (615725 downstream)																							attacctgtcattgttgtacagc	0.069													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22527235	22527235	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22527235delG								MIR1268 (13955 upstream) : GOLGA8DP (175050 downstream)																							AATCCATGCTGGGGGCATGGA	0.597													4	2	---	---	---	---	
C15orf24	56851	broad.mit.edu	37	15	34383294	34383294	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34383294delC	uc001zhm.2	-						C15orf24_uc001zhn.2_Intron	NM_020154	NP_064539	Q9NPA0	CO024_HUMAN	chromosome 15 open reading frame 24 precursor							cytoplasm|integral to membrane	carbohydrate binding|carboxypeptidase activity|purine nucleotide binding				0		all_lung(180;1.76e-08)		all cancers(64;2.02e-17)|GBM - Glioblastoma multiforme(113;2.15e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		tgatctgtctcccacttcatc	0.095													4	2	---	---	---	---	
C15orf57	90416	broad.mit.edu	37	15	40849194	40849195	+	Intron	INS	-	AA	AA	rs142966713	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40849194_40849195insAA	uc001zmc.1	-						uc001zlx.1_RNA|C15orf57_uc001zly.2_Intron|C15orf57_uc001zma.1_Intron|C15orf57_uc001zmb.1_Intron|C15orf57_uc010bbr.2_3'UTR	NM_001080792	NP_001074261	Q9BV29	CO057_HUMAN	coiled-coil domain containing 32 isoform a											ovary(1)	1						TTCAAGAACATGAGAGACTGAT	0.342													7	5	---	---	---	---	
GCHFR	2644	broad.mit.edu	37	15	41055948	41055948	+	5'Flank	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41055948delG	uc001zmr.1	+						GCHFR_uc010ucr.1_5'Flank	NM_005258	NP_005249	P30047	GFRP_HUMAN	GTP cyclohydrolase I feedback regulatory						negative regulation of biosynthetic process|neurotransmitter metabolic process|nitric oxide biosynthetic process	cytosol|dendrite|melanosome|nuclear membrane				ovary(1)	1		all_cancers(109;3.3e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.58e-05)|COAD - Colon adenocarcinoma(120;0.149)|BRCA - Breast invasive adenocarcinoma(123;0.163)		AAGCGGGCGCGGGGGCAACAC	0.627													4	2	---	---	---	---	
MGA	23269	broad.mit.edu	37	15	42009482	42009482	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42009482delG	uc010ucy.1	+						MGA_uc010ucz.1_Intron	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1							MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		TAGCTGTTGTGGGTAGTACCA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	50435786	50435787	+	IGR	DEL	AG	-	-	rs151264657		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50435786_50435787delAG								ATP8B4 (24367 upstream) : SLC27A2 (38606 downstream)																							ttgactatacagagtcagccgt	0.015													2	4	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50868540	50868541	+	Intron	DEL	TG	-	-	rs62017165	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50868540_50868541delTG	uc001zyt.3	-						TRPM7_uc001zyr.2_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CCCATCTTTTTGTGTGTGTGTG	0.381													3	3	---	---	---	---	
AP4E1	23431	broad.mit.edu	37	15	51260736	51260736	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51260736delA	uc001zyx.1	+							NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TATCCAGAGGAAAAAAAAAAG	0.284													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	54951097	54951097	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54951097delC								UNC13C (30292 upstream) : RSL24D1 (522424 downstream)																							AAGACCAGCTCCCCGCTTCAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61855578	61855578	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61855578delC								RORA (334076 upstream) : VPS13C (289014 downstream)																							ATTTCATTTTCCTTGGTCCCC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	66569187	66569187	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66569187delT								MEGF11 (23112 upstream) : DIS3L (16446 downstream)																							TGTTGCTTGATTTTTTAATGC	0.388													4	2	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	76646649	76646649	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76646649delA	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						AAAAGAGCAGAAAAAAAAAAT	0.373													4	3	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78292960	78292960	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78292960delA	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						AAAAGACTCTAAAAATAGCGA	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	81902193	81902193	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81902193delG								TMC3 (235775 upstream) : MEX3B (431935 downstream)																							GGTTACCATTGAGAAACAGGA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	86501186	86501186	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86501186delA								KLHL25 (162997 upstream) : AGBL1 (184056 downstream)																							TACAAATAGTAAAAAAAAACT	0.333													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88317817	88317817	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88317817delA								NCRNA00052 (194900 upstream) : NTRK3 (102171 downstream)																							TTTTTTCAAGAAAAAAAAAAA	0.353													4	2	---	---	---	---	
NTRK3	4916	broad.mit.edu	37	15	88490545	88490546	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88490545_88490546delGA	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGGCTGGGCTGAGCAGACTGTG	0.371			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	99584318	99584319	+	IGR	DEL	GA	-	-	rs10594029		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99584318_99584319delGA								PGPEP1L (33294 upstream) : SYNM (60967 downstream)																							gtgtgtgtgtgAGAGAGAGAGA	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5751119	5751120	+	IGR	INS	-	T	T	rs144242174	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5751119_5751120insT								FAM86A (603330 upstream) : A2BP1 (318012 downstream)																							ATGCCTGTTTATTGTTAAAGAT	0.371													2	4	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12646564	12646564	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12646564delG	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						GATTTAGATTGGGGGACTGAT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12696110	12696110	+	IGR	DEL	T	-	-	rs11305364		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12696110delT								SNX29 (27965 upstream) : CPPED1 (57547 downstream)																							atctctcatcttccacttagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13717520	13717520	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13717520delA								SHISA9 (383248 upstream) : ERCC4 (296494 downstream)																							TACAGAAGGCAAAGTGGGTAG	0.418													4	2	---	---	---	---	
NDE1	54820	broad.mit.edu	37	16	15765368	15765368	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15765368delA	uc002ddt.1	+						NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron	NM_017668	NP_060138	Q9NXR1	NDE1_HUMAN	nuclear distribution gene E homolog 1						cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding			ovary(1)	1						gttaaaaaataaaaaaCCTGA	0.234													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15939589	15939590	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15939589_15939590delGA	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002deb.3_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						gaaaaagaaggagagagagaga	0.267			T	CBFB	AML								4	2	---	---	---	---	
ABCC1	4363	broad.mit.edu	37	16	16080589	16080590	+	Intron	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16080589_16080590delGT	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	gccatgaaaggtaagagactca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22637356	22637357	+	IGR	INS	-	TC	TC			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22637356_22637357insTC								LOC653786 (49170 upstream) : HS3ST2 (188503 downstream)																							ctctGTCCCTTTCTCTCTCTCC	0.114													4	2	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	24944943	24944943	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24944943delA	uc002dnb.2	-						ARHGAP17_uc002dmx.2_5'Flank|ARHGAP17_uc002dmw.2_5'Flank|ARHGAP17_uc002dmy.2_Intron|ARHGAP17_uc002dmz.2_Intron|ARHGAP17_uc002dna.2_Intron|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dne.1_5'Flank	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		ATCGGCATTTAAAAAAAAAGT	0.403													4	2	---	---	---	---	
GTF3C1	2975	broad.mit.edu	37	16	27489513	27489513	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27489513delA	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						aaaaggaaagaaaaaaaaaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29237409	29237410	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29237409_29237410delTT	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		ggtgattgagtttagatgaggc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33999831	33999831	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33999831delT								MIR1826 (34239 upstream) : UBE2MP1 (403971 downstream)																							caattttggcttttgtttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34658279	34658280	+	IGR	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34658279_34658280delCA								LOC283914 (32195 upstream) : LOC146481 (53505 downstream)																							cgcaTGCAggcacacacacaca	0.064													4	2	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47727687	47727688	+	Intron	INS	-	A	A			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47727687_47727688insA	uc002eev.3	+						PHKB_uc002eeu.3_Intron|PHKB_uc002eew.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				AAGTCATATTTAATAAAAAAAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52728899	52728899	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52728899delT								TOX3 (147185 upstream) : CHD9 (360046 downstream)																							ctcattctcatttttttttct	0.000													4	2	---	---	---	---	
RPGRIP1L	23322	broad.mit.edu	37	16	53691153	53691153	+	Intron	DEL	A	-	-	rs77480802		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53691153delA	uc002ehp.2	-						RPGRIP1L_uc002eho.3_Intron|RPGRIP1L_uc010vgy.1_Intron|RPGRIP1L_uc010cbx.2_Intron|RPGRIP1L_uc010vgz.1_Intron	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a						negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				actctgtctcaaaaaaaaaac	0.124													5	4	---	---	---	---	
CCL22	6367	broad.mit.edu	37	16	57399020	57399020	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57399020delT	uc002elh.2	+	3						NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0						agccTCCCCCTTTTTTTCCTA	0.239													4	2	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58587428	58587429	+	Intron	INS	-	T	T	rs72537185	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58587428_58587429insT	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002enx.2_Intron|CNOT1_uc002enz.1_Intron|CNOT1_uc010vik.1_5'Flank	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAACTGCATTACAGGTTAAAAG	0.337													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66267326	66267326	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66267326delA								LOC283867 (657123 upstream) : CDH5 (133199 downstream)																							TGAATGGCAGAAAAAATGATC	0.438													4	2	---	---	---	---	
PHLPP2	23035	broad.mit.edu	37	16	71682687	71682687	+	3'UTR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71682687delA	uc002fax.2	-	18					PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_3'UTR	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						acaaacaaacaaaaaaaaaac	0.219													4	2	---	---	---	---	
WDR59	79726	broad.mit.edu	37	16	74977491	74977491	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74977491delA	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdj.2_Intron	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						GCTGACTTTTAAAAAATAAAT	0.448													4	2	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76377341	76377341	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76377341delC	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TGATCATGCTCCCTCAAAACC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	77475572	77475572	+	IGR	DEL	T	-	-	rs4888632	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77475572delT								ADAMTS18 (6561 upstream) : NUDT7 (280839 downstream)																							tactgataaattttttttgac	0.000													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81712859	81712860	+	Intron	DEL	TG	-	-	rs71701140		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81712859_81712860delTG	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						TCTGTAGGGAtgtgtgtgtgtg	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	82303971	82303971	+	IGR	DEL	C	-	-	rs11337036		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82303971delC								MPHOSPH6 (100142 upstream) : CDH13 (356607 downstream)																							AAAGGAAGAGCAACTGGGAGG	0.408													7	6	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83204603	83204603	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83204603delT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		GCCCGCCTCCTTTTTTTTGAG	0.284													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84317711	84317712	+	IGR	INS	-	T	T	rs150669297	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84317711_84317712insT								KCNG4 (44355 upstream) : WFDC1 (10689 downstream)																							GAAAGACGGCCTTTTTTTCCTG	0.599													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85198356	85198356	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85198356delA								FAM92B (52242 upstream) : KIAA0182 (446673 downstream)																							aaaagaatttaaaaaaaaaga	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	10140222	10140223	+	IGR	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10140222_10140223delGT								GAS7 (38354 upstream) : MYH13 (63960 downstream)																							ctgaagcttagtagcacacaca	0.124													4	2	---	---	---	---	
MYH1	4619	broad.mit.edu	37	17	10421534	10421534	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10421534delA	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GAGGAATGAGAAAAAAAAAAA	0.393													4	3	---	---	---	---	
USP22	23326	broad.mit.edu	37	17	20920324	20920324	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20920324delT	uc002gym.3	-						USP22_uc002gyn.3_Intron|USP22_uc002gyl.3_Intron	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22						cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						TGCACCCTCCTTTCTCCTATT	0.363													4	2	---	---	---	---	
LGALS9	3965	broad.mit.edu	37	17	25961615	25961616	+	Intron	INS	-	C	C			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25961615_25961616insC	uc002gzp.2	+						LGALS9_uc002gzq.2_Intron|LGALS9_uc002gzr.2_Intron|LGALS9_uc010waa.1_Intron|LGALS9_uc002gzs.2_Intron	NM_009587	NP_033665	O00182	LEG9_HUMAN	galectin-9 isoform long						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	galactose binding|signal transducer activity				0	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		acaaacaaaaaccccccaaaaa	0.000													4	2	---	---	---	---	
PIGS	94005	broad.mit.edu	37	17	26882987	26882987	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26882987delA	uc002hbo.2	-						PIGS_uc002hbn.2_Intron|PIGS_uc010wap.1_Intron	NM_033198	NP_149975	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			breast(2)|urinary_tract(1)|kidney(1)	4	Lung NSC(42;0.00431)					actccgtctcaaaaaaaaaaa	0.194													5	5	---	---	---	---	
RAB11FIP4	84440	broad.mit.edu	37	17	29855146	29855149	+	Intron	DEL	AGAA	-	-	rs76175618		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29855146_29855149delAGAA	uc002hgn.1	+						RAB11FIP4_uc002hgo.2_Intron	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)						cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				aaTTAGTTTTAGAAAGAGGTTAGC	0.225													2	4	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32452123	32452123	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32452123delC	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	cttacctataccccaggacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34128486	34128486	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34128486delC								MMP28 (5846 upstream) : TAF15 (8000 downstream)																							CACAAACCTGCCCCAGGACAG	0.527													4	2	---	---	---	---	
RAMP2	10266	broad.mit.edu	37	17	40915045	40915045	+	3'UTR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40915045delT	uc002ibg.2	+	4					LOC100190938_uc002ibd.1_5'Flank|LOC100190938_uc002ibe.3_5'Flank|LOC100190938_uc002ibf.3_5'Flank|RAMP2_uc010cyt.2_3'UTR|RAMP2_uc002ibh.2_3'UTR	NM_005854	NP_005845	O60895	RAMP2_HUMAN	receptor activity modifying protein 2 precursor						intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	coated pit|integral to plasma membrane|lysosome	protein transporter activity				0		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0741)	Pramlintide(DB01278)	AAAATAAAACTTTTTTTTTGT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44486669	44486669	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44486669delT								ARL17A (47506 upstream) : LRRC37A2 (103407 downstream)																							tttttttttcttttttttttt	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48010857	48010857	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48010857delT								TAC4 (85478 upstream) : DLX4 (35705 downstream)																							CAGTGAGGCATTTTTTTGGTG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55213253	55213254	+	IGR	DEL	CT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55213253_55213254delCT								AKAP1 (14544 upstream) : MSI2 (119958 downstream)																							TGGGCCGCCCCTCTCTCTCTGG	0.510													4	2	---	---	---	---	
MTMR4	9110	broad.mit.edu	37	17	56592621	56592621	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56592621delA	uc002iwj.2	-						MTMR4_uc010dcx.1_5'Flank	NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4							cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAAGCTATACAAAAAAACGAA	0.458													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	58913428	58913429	+	Intron	DEL	AG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58913428_58913429delAG	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			attgagtggaagatacagaaag	0.074													4	2	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63186049	63186049	+	Intron	DEL	T	-	-	rs112552969		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63186049delT	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron|RGS9_uc002jfg.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TCCTTAGAACTTTTTTTTTTT	0.483													3	4	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64429160	64429160	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64429160delG	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	GCAGTTAGCCGGGGGGAAGGA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70638419	70638419	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70638419delA								SOX9 (515867 upstream) : SLC39A11 (3667 downstream)																							GAGGATTTGGAAAACCTGAAG	0.473													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70678989	70678990	+	Intron	DEL	TT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70678989_70678990delTT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						TGAGTCAATCTTTAGGACAGGA	0.361													4	2	---	---	---	---	
COG1	9382	broad.mit.edu	37	17	71198828	71198829	+	Intron	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71198828_71198829delGA	uc002jjg.2	+						COG1_uc002jjh.2_Intron|COG1_uc002jjf.1_Intron	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			ttgggaagctgaggcaggagca	0.000													4	2	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71535955	71535956	+	Intron	INS	-	A	A	rs139325258	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71535955_71535956insA	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						cagagacacacggggggaatgc	0.050													4	2	---	---	---	---	
KIF19	124602	broad.mit.edu	37	17	72337141	72337142	+	Intron	DEL	AT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72337141_72337142delAT	uc002jkm.3	+						KIF19_uc002jkj.2_Intron|KIF19_uc002jkk.2_Intron|KIF19_uc002jkl.2_Intron	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						ggtgggagtcatagctggcctt	0.000													4	2	---	---	---	---	
LPIN2	9663	broad.mit.edu	37	18	2929429	2929429	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2929429delA	uc002klo.2	-							NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AAAAATACATACAGATGTGGC	0.274													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8403263	8403263	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8403263delA	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CACATCATGGAATAAGCATTT	0.264													4	2	---	---	---	---	
MIB1	57534	broad.mit.edu	37	18	19399206	19399206	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19399206delC	uc002ktq.2	+						MIB1_uc002ktp.2_Intron	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1						Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			ctatatgttgcccaggttggt	0.015													4	2	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21778103	21778104	+	Intron	DEL	AG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21778103_21778104delAG	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron|OSBPL1A_uc002kvf.3_Intron	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TAGCATACCTAGAGAGTTATGA	0.317													4	2	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22780930	22780930	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22780930delT	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TATTTTCTTCTTTTTTTTCTG	0.294			T	PAX5	ALL								4	2	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29454189	29454189	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29454189delT	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_3'UTR	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						CTGTGGAATCTTTTTTTTTTT	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38434437	38434437	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38434437delC								None (None upstream) : KC6 (625801 downstream)																							TCCGACACTTCCCCACCTTGC	0.537													4	2	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43504538	43504538	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43504538delT	uc002lbm.2	-						KIAA1632_uc002lbo.1_Intron	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						GTTAATCTTCTTATGGAAGAG	0.378													4	2	---	---	---	---	
C18orf25	147339	broad.mit.edu	37	18	43790092	43790092	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43790092delG	uc002lbw.2	+						C18orf25_uc002lbx.2_Intron	NM_145055	NP_659492	Q96B23	CR025_HUMAN	ARKadia-like 1 isoform a											central_nervous_system(2)	2						gctatgtagagaacaggttgg	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46996564	46996565	+	IGR	INS	-	TCC	TCC	rs142123976		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46996564_46996565insTCC								DYM (9485 upstream) : C18orf32 (11465 downstream)																							cctcctcctcttcctcctcctc	0.406													4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47529521	47529521	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47529521delG	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		ACTATGAGCTGCTCTTCAAGG	0.502													4	2	---	---	---	---	
CCDC68	80323	broad.mit.edu	37	18	52581278	52581278	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52581278delC	uc002lfs.2	-						CCDC68_uc002lft.2_Intron	NM_001143829	NP_001137301	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68											skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		tctgtttcttcaaagtataag	0.000													4	2	---	---	---	---	
ONECUT2	9480	broad.mit.edu	37	18	55114090	55114090	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55114090delA	uc002lgo.2	+							NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2						organ morphogenesis	nucleus	sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		CAAAGAAAGCAAAAAATAGCC	0.473											OREG0024994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55856383	55856383	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55856383delT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CAAGTACCTATTTTTAGACTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65719860	65719860	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65719860delT								DSEL (535893 upstream) : TMX3 (621067 downstream)																							atgtgcaccgtttttttgcac	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75701805	75701806	+	IGR	DEL	GT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75701805_75701806delGT								GALR1 (719711 upstream) : None (None downstream)																							gctcggtgaagtgaagtgaagc	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14383154	14383155	+	IGR	DEL	CC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14383154_14383155delCC								LPHN1 (66157 upstream) : CD97 (109058 downstream)																							CTCCACTCCTCCCGCCCTGACC	0.530													4	2	---	---	---	---	
DNAJB1	3337	broad.mit.edu	37	19	14628248	14628248	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14628248delA	uc002myz.1	-						DNAJB1_uc010xnr.1_Intron	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1						chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		GGAAGAGAAGAAAAAAAAAAA	0.418													5	4	---	---	---	---	
RFXANK	8625	broad.mit.edu	37	19	19307690	19307690	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19307690delA	uc002nls.2	+						RFXANK_uc002nlt.2_Intron|RFXANK_uc002nlu.2_Intron|RFXANK_uc002nlv.2_Intron|RFXANK_uc002nlw.2_Intron	NM_003721	NP_003712	O14593	RFXK_HUMAN	regulatory factor X-associated							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2			Epithelial(12;0.00228)			caacagcaacaaaaaaaaaCA	0.254													3	4	---	---	---	---	
ZNF91	7644	broad.mit.edu	37	19	23540096	23540096	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23540096delA	uc002nrd.2	-									Q05481	ZNF91_HUMAN	Homo sapiens, Similar to hypothetical protein FLJ31526, clone IMAGE:4526544, mRNA.							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CAACAACAACAAAAAATTATG	0.234													4	2	---	---	---	---	
APLP1	333	broad.mit.edu	37	19	36360509	36360509	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36360509delC	uc002oce.2	+						APLP1_uc010xsz.1_Intron|APLP1_uc002ocf.2_Intron|APLP1_uc002ocg.2_Intron|APLP1_uc010xta.1_Frame_Shift_Del_p.P24fs	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2						apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGCAAAGAACCAGGGGACCC	0.687													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37516266	37516268	+	IGR	DEL	TGT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37516266_37516268delTGT								ZNF568 (27432 upstream) : ZNF420 (53114 downstream)																							TAAAGTTAACTGTTGTTGTTTTT	0.325													4	6	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	38955015	38955016	+	Intron	INS	-	AG	AG			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38955015_38955016insAG	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	tggggatggaaagagagagaga	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45065158	45065158	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45065158delG								CEACAM22P (5008 upstream) : PVR (81940 downstream)																							aaaaaaaaaagaaacccaaat	0.000													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54392679	54392679	+	Intron	DEL	T	-	-	rs35336576		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54392679delT	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		gacaaagaggttttttttttt	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57526781	57526781	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57526781delT								MIMT1 (166859 upstream) : USP29 (104728 downstream)																							agatccctccttcactccaca	0.000													4	2	---	---	---	---	
ZNF543	125919	broad.mit.edu	37	19	57833263	57833263	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57833263delA	uc002qoi.1	+							NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGTGTGGACTAAAAAAAAATG	0.468													4	2	---	---	---	---	
ZSCAN1	284312	broad.mit.edu	37	19	58558665	58558665	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58558665delG	uc002qrc.1	+							NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGGTCACTGTGGAGACAGAGG	0.527													4	2	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18491937	18491937	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18491937delG	uc002wqz.1	+						SEC23B_uc002wra.1_Intron|SEC23B_uc002wrb.1_Intron|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Intron	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TAGAGGTAGAGGGAGAGGATT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19158654	19158654	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19158654delG								C20orf79 (363621 upstream) : SLC24A3 (34636 downstream)																							CGAGGCATCTGGGGCATTCAG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22809174	22809174	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22809174delC								FOXA2 (243073 upstream) : SSTR4 (206883 downstream)																							CAAGCATTTACCCACCTGCTA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	34664142	34664142	+	IGR	DEL	T	-	-	rs113482157		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34664142delT								LOC647979 (25260 upstream) : EPB41L1 (15284 downstream)																							TTCACCCAACTTTTTTTTTTC	0.418													4	3	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	40834463	40834463	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40834463delA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAAGTGGACCAAAAAAAAAAT	0.453													2	4	---	---	---	---	
KCNB1	3745	broad.mit.edu	37	20	47989322	47989323	+	3'UTR	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47989322_47989323insT	uc002xur.1	-	2					KCNB1_uc002xus.1_3'UTR	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TGCCCTATGGCTTGGCCAACTT	0.520													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51726950	51726950	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51726950delT	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TCTCTATCCCTTTAGCATAAC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9474156	9474157	+	IGR	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9474156_9474157delGA								None (None upstream) : None (None downstream)																							acatcttcttgagaattgatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9854460	9854461	+	IGR	INS	-	CATT	CATT			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9854460_9854461insCATT								None (None upstream) : None (None downstream)																							CTGGATGCATCCATTCTCTCCC	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10141157	10141157	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10141157delA								None (None upstream) : TPTE (765586 downstream)																							cagataggtgaaaaaagaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10704482	10704483	+	IGR	INS	-	A	A	rs141719157		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10704482_10704483insA								None (None upstream) : TPTE (202260 downstream)																							aatatcttcacaaaaaaagtag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10720809	10720809	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10720809delG								None (None upstream) : TPTE (185934 downstream)																							tcaaaagaaaggttcaaacat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10863874	10863874	+	IGR	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10863874delG								None (None upstream) : TPTE (42869 downstream)																							atgaatccccgtccaacacag	0.020													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11059172	11059175	+	Intron	DEL	CTAT	-	-	rs56885467		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11059172_11059175delCTAT	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGGGAAATGACTATCTAACATAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11109138	11109140	+	IGR	DEL	CTT	-	-	rs112013691		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11109138_11109140delCTT								BAGE (10201 upstream) : None (None downstream)																							AGTTTACCTCCTTCTACGTTCAG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11128761	11128762	+	IGR	INS	-	TTG	TTG			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11128761_11128762insTTG								BAGE (29824 upstream) : None (None downstream)																							GGTTTCCTTTTTTGTTGTTGTT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11151911	11151912	+	IGR	INS	-	A	A	rs77036193		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11151911_11151912insA								BAGE (52974 upstream) : None (None downstream)																							AGGAGAAAGAGAAAAAAAATGA	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11161891	11161891	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11161891delA								BAGE (62954 upstream) : None (None downstream)																							acaaaaggctaatatccagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	17414505	17414506	+	IGR	DEL	GA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17414505_17414506delGA								USP25 (162128 upstream) : C21orf34 (28336 downstream)																							TGGGGCAGGGGAGAGAGAGAGA	0.366													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24388999	24388999	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24388999delA								None (None upstream) : None (None downstream)																							ttggagccataaagttcacaa	0.020													4	2	---	---	---	---	
APP	351	broad.mit.edu	37	21	27341297	27341297	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27341297delC	uc002ylz.2	-						APP_uc011acg.1_Intron|APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				ACTCCTATTACAAGATGTGAT	0.343													4	2	---	---	---	---	
N6AMT1	29104	broad.mit.edu	37	21	30250245	30250245	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30250245delA	uc002ymo.1	-						N6AMT1_uc002ymp.1_Intron|N6AMT1_uc002ymq.1_Intron	NM_013240	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1						positive regulation of cell growth	protein complex	nucleic acid binding|protein binding|protein methyltransferase activity				0						GAGGTGTTAGAAAAAAACATT	0.313													4	2	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39951671	39951671	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39951671delC	uc010gnw.2	-						ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				TCAGCGAAAACCCAACGGACC	0.507													4	2	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43332605	43332606	+	Intron	INS	-	A	A	rs4549207		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43332605_43332606insA	uc002yzw.2	-						C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						tttatttatttttttttttttt	0.188													5	4	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43332608	43332609	+	Intron	INS	-	A	A	rs11387062		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43332608_43332609insA	uc002yzw.2	-						C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						atttatttttttttttttttga	0.183													3	4	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43332611	43332612	+	Intron	INS	-	A	A	rs11387061		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43332611_43332612insA	uc002yzw.2	-						C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						tatttttttttttttttgagac	0.173													4	3	---	---	---	---	
SLC37A1	54020	broad.mit.edu	37	21	43929639	43929639	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43929639delG	uc002zbi.2	+						SLC37A1_uc002zbh.1_Intron	NM_018964	NP_061837	P57057	GLPT_HUMAN	solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0						CTGTAGGACTGGGAACGCCTA	0.428													4	2	---	---	---	---	
C21orf67	84536	broad.mit.edu	37	21	46357260	46357260	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46357260delA	uc011afm.1	-						C21orf67_uc002zgj.3_Intron|C21orf67_uc002zgk.3_Intron|C21orf70_uc002zgl.2_5'Flank|C21orf70_uc002zgm.2_5'Flank	NR_027128				RecName: Full=Uncharacterized protein C21orf67;												0						gtgtctctgcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
FTCD	10841	broad.mit.edu	37	21	47568683	47568683	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47568683delG	uc002zif.2	-						FTCD_uc002zig.2_Intron|FTCD_uc002zih.2_Intron|FTCD_uc010gqf.2_Intron|FTCD_uc010gqg.1_Intron	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase						folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	aggaacagttggaagaaagga	0.000													4	2	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18329162	18329163	+	Intron	INS	-	A	A	rs141609478	by1000genomes	TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18329162_18329163insA	uc002zng.3	-						MICAL3_uc011agl.1_Intron|MICAL3_uc002znh.2_Intron|MICAL3_uc002znj.1_Intron|MICAL3_uc002znk.1_Intron|MICAL3_uc002znl.1_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		CATGGGAAATTAAAAAAAAAAC	0.475													4	3	---	---	---	---	
C22orf25	128989	broad.mit.edu	37	22	20043311	20043312	+	Intron	INS	-	G	G			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20043311_20043312insG	uc010grw.1	+						C22orf25_uc002zrb.1_Intron|C22orf25_uc002zrc.1_Intron|C22orf25_uc002zrd.1_Intron|C22orf25_uc002zre.2_3'UTR|C22orf25_uc010grx.2_Intron|C22orf25_uc011ahe.1_Intron|C22orf25_uc011ahf.1_Intron|C22orf25_uc011ahg.1_Intron|C22orf25_uc002zrg.2_Intron|C22orf25_uc011ahh.1_Intron|C22orf25_uc002zrf.2_Intron|C22orf25_uc011ahi.1_Intron|C22orf25_uc010gry.1_Intron|C22orf25_uc002zrh.1_Intron	NM_152906	NP_690870	Q6ICL3	CV025_HUMAN	hypothetical protein LOC128989												0	Colorectal(54;0.0533)					CCTGCCAGGCACCTGAGGGGCT	0.658													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21611405	21611407	+	IGR	DEL	GCT	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21611405_21611407delGCT								LOC400891 (192950 upstream) : POM121L8P (25307 downstream)																							GTGTCCATGGGCTGCAAGTGGGT	0.542													7	5	---	---	---	---	
RAB36	9609	broad.mit.edu	37	22	23490252	23490252	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23490252delT	uc002zwv.1	+						RAB36_uc010gtw.1_Intron	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TGGAATGGCCTTTTTTGCATC	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32696960	32696960	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32696960delT								SLC5A4 (45642 upstream) : RFPL3 (53912 downstream)																							ttcaggtttcttttttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34415536	34415536	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34415536delA								LARGE (96952 upstream) : None (None downstream)																							AGACAACCACAAAAAAAAAAG	0.279													5	3	---	---	---	---	
LGALS2	3957	broad.mit.edu	37	22	37969750	37969750	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37969750delT	uc003ata.2	-							NM_006498	NP_006489	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2											breast(1)|skin(1)	2	Melanoma(58;0.0574)					tttttttttgtttttttgagc	0.169													4	2	---	---	---	---	
APOBEC3G	60489	broad.mit.edu	37	22	39474726	39474726	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39474726delT	uc003awx.2	+						APOBEC3G_uc003awy.2_5'Flank	NM_021822	NP_068594	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2	Melanoma(58;0.04)					tctctctctctttttttttga	0.199													4	2	---	---	---	---	
SERHL2	253190	broad.mit.edu	37	22	42952151	42952151	+	Intron	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42952151delC	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_RNA	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						GAGGGGAGCACAAAGGAGGAA	0.577													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	4872261	4872261	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4872261delT								None (None upstream) : NLGN4X (935823 downstream)																							taaaataaaatttTTTTAAAG	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	14820802	14820802	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14820802delT								GLRA2 (70871 upstream) : FANCB (40727 downstream)																							aaataagagatttttagagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	14821814	14821814	+	IGR	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14821814delT								GLRA2 (71883 upstream) : FANCB (39715 downstream)																							TCCTGCCAACTTTTTTCTTTC	0.383													4	2	---	---	---	---	
NHS	4810	broad.mit.edu	37	X	17723180	17723181	+	Intron	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17723180_17723181delCA	uc004cxx.2	+						NHS_uc011mix.1_Intron|NHS_uc004cxy.2_Intron|NHS_uc004cxz.2_Intron|NHS_uc004cya.2_Intron	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1							nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					GCGTCAGCAGCAGAAGAGTGGA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	27472679	27472680	+	IGR	DEL	CA	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27472679_27472680delCA								VENTXP1 (893511 upstream) : SMEK3P (5648 downstream)																							ccagctCCTGCACACACACACA	0.347													3	3	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31408680	31408680	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31408680delA	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ttgatcaaacaaaaaaaactt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36605668	36605668	+	IGR	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36605668delA								CXorf30 (202235 upstream) : FAM47C (420802 downstream)																							CAATGCCTTTAAAAAAAAAGT	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	40251284	40251284	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40251284delC								BCOR (214702 upstream) : ATP6AP2 (188932 downstream)																							GCCTAATGCGCCCTCACTTAT	0.333													4	2	---	---	---	---	
ATP6AP2	10159	broad.mit.edu	37	X	40443170	40443170	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40443170delG	uc004det.2	+						ATP6AP2_uc010nhc.2_Intron|ATP6AP2_uc011mkl.1_Intron|ATP6AP2_uc011mkm.1_Intron|ATP6AP2_uc011mkn.1_Intron	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory						angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0						GTGTGTTTTtggtgtttgcag	0.224													4	2	---	---	---	---	
RP2	6102	broad.mit.edu	37	X	46717393	46717393	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46717393delT	uc004dgw.3	+							NM_006915	NP_008846	O75695	XRP2_HUMAN	XRP2 protein						cell morphogenesis|CTP biosynthetic process|GTP biosynthetic process|protein folding|UTP biosynthetic process|visual perception	cytoplasm|plasma membrane	ATP binding|GTP binding|GTPase activator activity|nucleoside diphosphate kinase activity|unfolded protein binding				0						TGTATGTTTCTTTTTTTGGAG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48164542	48164542	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48164542delA	uc010nib.1	-							NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		AGCAGCCTTGAGTCTTTGGGA	0.507													5	3	---	---	---	---	
HDAC6	10013	broad.mit.edu	37	X	48677653	48677654	+	Intron	DEL	TG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48677653_48677654delTG	uc011mmi.1	+						HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc011mmk.1_Intron|HDAC6_uc004dkv.1_Intron|HDAC6_uc004dkw.1_Intron|HDAC6_uc004dkx.1_5'Flank	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	TTTGAGAAACTGTGTGTGTGTA	0.470													4	2	---	---	---	---	
ARHGEF9	23229	broad.mit.edu	37	X	62973136	62973136	+	Intron	DEL	T	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62973136delT	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						CTTCTAGACGTTTTTGGGTTT	0.383													4	2	---	---	---	---	
OPHN1	4983	broad.mit.edu	37	X	67332050	67332051	+	Intron	INS	-	AAG	AAG			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67332050_67332051insAAG	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						gagacccagaaacaaagacaaa	0.000													4	2	---	---	---	---	
NHSL2	340527	broad.mit.edu	37	X	71161291	71161291	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71161291delA	uc011mqa.1	+							NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2												0	Renal(35;0.156)					cagaatggttaaggggctctg	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	74562332	74562332	+	IGR	DEL	T	-	-	rs151293039		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74562332delT								UPRT (37900 upstream) : ZDHHC15 (25932 downstream)																							cattgtagtcttgctttgcat	0.000													4	2	---	---	---	---	
CYLC1	1538	broad.mit.edu	37	X	83134750	83134751	+	Intron	INS	-	AC	AC			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83134750_83134751insAC	uc004eei.1	+							NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head						cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						cacagacacatacacacacaca	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	84735085	84735085	+	IGR	DEL	C	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84735085delC								POF1B (100337 upstream) : MIR1321 (355700 downstream)																							ccgtatcatgccactctcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	95785996	95785996	+	IGR	DEL	G	-	-	rs148149848		TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95785996delG								LOC643486 (193095 upstream) : DIAPH2 (153666 downstream)																							TTTTAAAAAAGAAAAAAGGAA	0.353													4	2	---	---	---	---	
NOX1	27035	broad.mit.edu	37	X	100104072	100104072	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100104072delA	uc004egj.2	-						NOX1_uc004egl.3_Intron|NOX1_uc010nne.2_Intron	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long						angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						tctcaaaaagaaaaaaaaaag	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	109911232	109911233	+	IGR	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109911232_109911233delAC								TDGF3 (144983 upstream) : CHRDL1 (5852 downstream)																							GCAAGCTGCTACATCTCACAAT	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	127831837	127831838	+	IGR	DEL	AC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127831837_127831838delAC								ACTRT1 (645455 upstream) : SMARCA1 (748642 downstream)																							CATAGACTTTACACACACACAC	0.376													4	2	---	---	---	---	
SMARCA1	6594	broad.mit.edu	37	X	128624776	128624776	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128624776delA	uc004eun.3	-						SMARCA1_uc004eup.3_Intron|SMARCA1_uc011muk.1_Intron|SMARCA1_uc011mul.1_Intron	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated						ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						GGTGGTAGAGAAAAAAAAAAT	0.368													3	4	---	---	---	---	
LOC286467	286467	broad.mit.edu	37	X	130843752	130843752	+	Intron	DEL	G	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130843752delG	uc004ewi.2	-							NR_026975				Homo sapiens cDNA FLJ40592 fis, clone THYMU2010192.												0						tgcaaacgatggggagtggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	135949652	135949654	+	IGR	DEL	ATG	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135949652_135949654delATG								ARHGEF6 (86149 upstream) : RBMX (1699 downstream)																							aaaatatcttatgatggaaatca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136367399	136367401	+	IGR	DEL	TGC	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136367399_136367401delTGC								GPR101 (253566 upstream) : ZIC3 (280945 downstream)																							gaaagggtagtgcaagatcaggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	148653886	148653887	+	IGR	INS	-	T	T			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148653886_148653887insT								CXorf40A (21831 upstream) : MAGEA9B (9424 downstream)																							TTTAAAACTACATGTATTGTCA	0.312													4	2	---	---	---	---	
CD99L2	83692	broad.mit.edu	37	X	149961511	149961511	+	Intron	DEL	A	-	-			TCGA-B0-5400-01A-01D-1501-10	TCGA-B0-5400-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149961511delA	uc004fel.2	-						CD99L2_uc004fek.2_Intron|CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ataacattttatagacctacc	0.000													4	2	---	---	---	---	
