Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AADACL4	343066	broad.mit.edu	37	1	12726742	12726742	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12726742T>C	uc001auf.2	+	4	1220	c.1220T>C	c.(1219-1221)ATA>ACA	p.I407T		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	407	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		ATAAAGGGCATATGATAGTAA	0.438													5	39	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918734	16918734	+	5'UTR	SNP	G	C	C	rs3928093	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918734G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CCTGAACTCAGAGCTGAAAGC	0.453													4	18	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085373	17085373	+	Missense_Mutation	SNP	C	T	T	rs2092130	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085373C>T	uc010ock.1	-	10	1318	c.1318G>A	c.(1318-1320)GGG>AGG	p.G440R	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Missense_Mutation_p.M1I	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						TGGCTATCCCCATCTGGGTCT	0.602													3	41	---	---	---	---	PASS
FAM76A	199870	broad.mit.edu	37	1	28081734	28081734	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28081734C>A	uc001boq.2	+	7	730	c.628C>A	c.(628-630)CCA>ACA	p.P210T	FAM76A_uc009vtb.2_Missense_Mutation_p.P210T|FAM76A_uc001bor.2_Missense_Mutation_p.P244T|FAM76A_uc001bos.2_Missense_Mutation_p.P215T|FAM76A_uc001bot.2_Missense_Mutation_p.P181T|FAM76A_uc010ofm.1_Missense_Mutation_p.P130T	NM_152660	NP_689873	Q8TAV0	FA76A_HUMAN	hypothetical protein LOC199870 isoform 3	210											0		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGACTCACCAGGCACTGA	0.413													54	151	---	---	---	---	PASS
PTP4A2	8073	broad.mit.edu	37	1	32377374	32377374	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32377374C>T	uc001bty.1	-	4	1237	c.243G>A	c.(241-243)TGG>TGA	p.W81*	PTP4A2_uc010ogs.1_Nonsense_Mutation_p.W50*|PTP4A2_uc001btz.1_Intron	NM_080391	NP_536316	Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2	81	Tyrosine-protein phosphatase.					early endosome|plasma membrane	prenylated protein tyrosine phosphatase activity|protein binding|protein tyrosine/serine/threonine phosphatase activity				0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				ACAGGTTTAACCAATCATCTA	0.388													76	193	---	---	---	---	PASS
GJB4	127534	broad.mit.edu	37	1	35227533	35227533	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35227533C>T	uc001bxv.1	+	2	1048	c.678C>T	c.(676-678)TGC>TGT	p.C226C	GJB4_uc001bxw.3_Silent_p.C226C	NM_153212	NP_694944	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4	226	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GGCCTCGGTGCCGGGAATGCC	0.622													8	13	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36758252	36758252	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36758252C>T	uc001cae.3	+	7	2196	c.1972C>T	c.(1972-1974)CTA>TTA	p.L658L	THRAP3_uc001caf.3_Silent_p.L658L	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	658					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TACTAAATACCTAAAGAGAGG	0.373			T	USP6	aneurysmal bone cysts								4	206	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37271904	37271904	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37271904C>A	uc001caz.2	-	14	2250	c.2115G>T	c.(2113-2115)GAG>GAT	p.E705D	GRIK3_uc001cba.1_Missense_Mutation_p.E705D	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	705	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CCCACATCTTCTCGAAGGTGG	0.602													20	56	---	---	---	---	PASS
GNL2	29889	broad.mit.edu	37	1	38049232	38049232	+	Intron	SNP	A	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38049232A>C	uc001cbk.2	-						GNL2_uc010oif.1_Intron|GNL2_uc009vve.2_3'UTR	NM_013285	NP_037417	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2						ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)				GGTAATAAATATGTGATTGTA	0.274													3	4	---	---	---	---	PASS
RLF	6018	broad.mit.edu	37	1	40661376	40661376	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40661376G>A	uc001cfc.3	+	4	578	c.547G>A	c.(547-549)GTG>ATG	p.V183M		NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion	183					chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CAAGGAAGGGGTGTGGAAAAA	0.383													79	254	---	---	---	---	PASS
FGGY	55277	broad.mit.edu	37	1	60103939	60103939	+	Silent	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60103939T>C	uc001czi.3	+	11	1325	c.1113T>C	c.(1111-1113)GAT>GAC	p.D371D	FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Silent_p.D371D|FGGY_uc001czj.3_Silent_p.D370D|FGGY_uc001czk.3_Silent_p.D259D|FGGY_uc001czl.3_Silent_p.D283D|FGGY_uc001czm.3_Silent_p.D72D	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	371					carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					GTCACCTGGATCTGATTAAGA	0.423													6	436	---	---	---	---	PASS
RBMXL1	494115	broad.mit.edu	37	1	89448886	89448886	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89448886G>A	uc009wcx.2	-	3	1340	c.624C>T	c.(622-624)TCC>TCT	p.S208S	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Silent_p.S208S	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	208							nucleotide binding|RNA binding				0						CATCTCTTGGGGACAAATAAA	0.463													5	396	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103355037	103355037	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103355037C>T	uc001dul.2	-	59	4756	c.4438G>A	c.(4438-4440)GGA>AGA	p.G1480R	COL11A1_uc001duk.2_Missense_Mutation_p.G676R|COL11A1_uc001dum.2_Missense_Mutation_p.G1492R|COL11A1_uc001dun.2_Missense_Mutation_p.G1441R|COL11A1_uc009weh.2_Missense_Mutation_p.G1364R	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1480	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGGAGATCCTTGAGTTCCA	0.388													46	105	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	143425009	143425009	+	5'Flank	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143425009A>G	hsa-mir-3118-3|MI0014133	-						uc001ejn.1_RNA																							ctaccttacaagagctcctga	0.000													3	3	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158812131	158812131	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158812131A>G	uc001fsz.1	+	2	388	c.188A>G	c.(187-189)GAC>GGC	p.D63G		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	63	DAPIN.				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					GCCTGTCTAGACAAACTAATA	0.343													54	303	---	---	---	---	PASS
SLAMF8	56833	broad.mit.edu	37	1	159796590	159796590	+	5'UTR	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159796590A>G	uc001fue.3	+	1						NM_020125	NP_064510	Q9P0V8	SLAF8_HUMAN	SLAM family member 8 precursor							integral to membrane					0	all_hematologic(112;0.0597)					TGAACATGGGACTTTCCAGAA	0.517													26	57	---	---	---	---	PASS
C1orf204	284677	broad.mit.edu	37	1	159811018	159811018	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159811018G>T	uc001fug.1	-	3	450	c.340C>A	c.(340-342)CCA>ACA	p.P114T	C1orf204_uc001fuf.1_Intron	NM_001134233	NP_001127705	Q5VU13	VSIG8_HUMAN	hypothetical protein LOC284677	Error:Variant_position_missing_in_Q5VU13_after_alignment						integral to membrane					0						tcacagtgtgggctggagctg	0.005													36	121	---	---	---	---	PASS
PYCR2	29920	broad.mit.edu	37	1	226108045	226108045	+	3'UTR	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226108045C>A	uc001hpq.2	-	7					LEFTY1_uc010pvj.1_Intron|PYCR2_uc001hpp.2_3'UTR|PYCR2_uc001hpr.2_3'UTR	NM_013328	NP_037460	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member						proline biosynthetic process	cytoplasm	binding|pyrroline-5-carboxylate reductase activity				0	Breast(184;0.197)				L-Proline(DB00172)|NADH(DB00157)	AGCATGCTTTCTCCTTGCACA	0.552													6	15	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11337671	11337671	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11337671T>C	uc002rbd.1	-	26	3709	c.3260A>G	c.(3259-3261)GAA>GGA	p.E1087G		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	1087	Potential.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTCATTCAGTTCTTTCTGATA	0.358													7	595	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44023879	44023879	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44023879A>G	uc002rtk.2	+	8	695	c.599A>G	c.(598-600)AAG>AGG	p.K200R	DYNC2LI1_uc002rtj.2_Missense_Mutation_p.K200R|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.K201R|DYNC2LI1_uc010ynz.1_Missense_Mutation_p.K74R	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	200						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GAGAAGAGAAAGGTAATATGC	0.313													7	477	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69034592	69034592	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69034592G>A	uc002seu.2	+	5	1015	c.651G>A	c.(649-651)GGG>GGA	p.G217G	ARHGAP25_uc010yqk.1_Silent_p.G192G|ARHGAP25_uc010fdg.2_Silent_p.G218G|ARHGAP25_uc010yql.1_Silent_p.G178G|ARHGAP25_uc002sev.2_Silent_p.G211G|ARHGAP25_uc002sew.2_Silent_p.G210G|ARHGAP25_uc002sex.2_Silent_p.G211G|ARHGAP25_uc010fdh.1_RNA|ARHGAP25_uc002sey.2_5'UTR	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	217	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	p.A210fs*4(1)		ovary(2)|breast(2)	4						TTGATGCTGGGGAGCGGCCCT	0.607													23	66	---	---	---	---	PASS
RETSAT	54884	broad.mit.edu	37	2	85578126	85578126	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85578126C>A	uc002spd.2	-	3	565	c.374G>T	c.(373-375)CGT>CTT	p.R125L	RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.R64L|RETSAT_uc010fgf.2_Intron	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	125					retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	CTCTTCCATACGCCCAATGTA	0.512													36	80	---	---	---	---	PASS
RGPD4	285190	broad.mit.edu	37	2	108479382	108479382	+	Intron	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108479382T>C	uc010ywk.1	+						RGPD4_uc002tdu.2_5'UTR|RGPD4_uc010ywl.1_Intron	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						intracellular transport		binding			skin(2)	2						AATGCTCTTTTGTGATTTTTA	0.323													9	479	---	---	---	---	PASS
ITGB6	3694	broad.mit.edu	37	2	160994692	160994692	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160994692C>G	uc002ubh.2	-	9	1142	c.1126G>C	c.(1126-1128)GAA>CAA	p.E376Q	ITGB6_uc010fou.2_Missense_Mutation_p.E376Q|ITGB6_uc010zcq.1_Missense_Mutation_p.E334Q|ITGB6_uc010fov.1_Missense_Mutation_p.E376Q	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	376	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						ACTTCCAGTTCCACCTCAGAC	0.413													67	222	---	---	---	---	PASS
MYO1B	4430	broad.mit.edu	37	2	192228923	192228923	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192228923C>A	uc010fsg.2	+	11	1208	c.953C>A	c.(952-954)TCA>TAA	p.S318*	MYO1B_uc002usq.2_Nonsense_Mutation_p.S318*|MYO1B_uc002usr.2_Nonsense_Mutation_p.S318*	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	318	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ATTGATCAATCAGTTCTAGAA	0.413													61	233	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202677279	202677279	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202677279C>T	uc002uyt.2	+	4	491	c.442C>T	c.(442-444)CGA>TGA	p.R148*	CDK15_uc010ftm.2_Nonsense_Mutation_p.R13*|CDK15_uc002uys.2_Nonsense_Mutation_p.R97*|CDK15_uc010ftn.1_Nonsense_Mutation_p.R97*|CDK15_uc010fto.1_Nonsense_Mutation_p.R148*	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	148	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	TACAGCTATCCGAGAAGGTAA	0.403													4	251	---	---	---	---	PASS
ZMYND10	51364	broad.mit.edu	37	3	50378855	50378855	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50378855C>A	uc003dag.1	-	12	1455	c.1309G>T	c.(1309-1311)GAC>TAC	p.D437Y	RASSF1_uc003dad.1_5'Flank|RASSF1_uc003dae.1_5'Flank|RASSF1_uc010hlk.1_5'Flank|RASSF1_uc003daf.1_5'Flank|RASSF1_uc011bdq.1_5'Flank|ZMYND10_uc010hll.1_Missense_Mutation_p.D432Y	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10	437						cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TTGGCTCTGTCACCCTGGGCT	0.577										TSP Lung(30;0.18)			57	89	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128990672	128990672	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128990672C>T	uc003els.2	+	19	2006	c.1906C>T	c.(1906-1908)CCC>TCC	p.P636S	COPG_uc010htb.2_Missense_Mutation_p.P542S	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	636	Interaction with ZNF289/ARFGAP2.				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						CTCGCCTGAGCCCGTGGCCCT	0.577													4	124	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506627	195506627	+	Missense_Mutation	SNP	T	G	G	rs145875920	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506627T>G	uc011bto.1	-	3	11900	c.11440A>C	c.(11440-11442)ACT>CCT	p.T3814P	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGCTGGTGACA	0.582													8	76	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1746754	1746754	+	3'UTR	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1746754G>T	uc003gdo.2	+	16					TACC3_uc003gdp.2_3'UTR|TACC3_uc010ica.2_3'UTR	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing							centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCACGGAGCCGCTGTCCCCGC	0.498													11	17	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56316339	56316339	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56316339T>C	uc003haz.1	-	17	2193	c.1267A>G	c.(1267-1269)AGG>GGG	p.R423G	CLOCK_uc003hba.1_Missense_Mutation_p.R423G|CLOCK_uc010igu.1_5'Flank	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	423					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TGATCAAACCTTTCCAATGCT	0.448													6	343	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85674870	85674870	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85674870T>C	uc003hpd.2	-	35	6127	c.5719A>G	c.(5719-5721)ATT>GTT	p.I1907V		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	1907						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TAAGGGCGAATATTGAAGGGG	0.458													57	153	---	---	---	---	PASS
LARP1B	55132	broad.mit.edu	37	4	129128464	129128464	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129128464A>G	uc003iga.2	+	19	2604	c.2473A>G	c.(2473-2475)AAG>GAG	p.K825E	LARP1B_uc003igc.2_Missense_Mutation_p.K244E|LARP1B_uc010ioa.1_RNA|LARP1B_uc003ige.2_RNA|LARP1B_uc003igd.2_RNA|LARP1B_uc003igf.2_Missense_Mutation_p.K25E	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2	825							RNA binding				0						TTCTCAATCTAAGACACAGTC	0.284													71	203	---	---	---	---	PASS
AMACR	23600	broad.mit.edu	37	5	33989521	33989521	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33989521C>T	uc003jig.2	-	5	908	c.826G>A	c.(826-828)GCA>ACA	p.A276T	AMACR_uc003jih.2_3'UTR|AMACR_uc003jii.2_Missense_Mutation_p.A261T|AMACR_uc003jij.2_Missense_Mutation_p.A276T	NM_014324	NP_055139	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase isoform 1	276					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	mitochondrion|peroxisomal matrix	alpha-methylacyl-CoA racemase activity				0						GTCTTCTCTGCAAATACATCT	0.438													34	58	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39376876	39376876	+	Silent	SNP	T	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39376876T>A	uc003jlx.2	-	12	2544	c.2013A>T	c.(2011-2013)GGA>GGT	p.G671G	DAB2_uc003jlw.2_Silent_p.G650G	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	671	Required for interaction with MYO6 (By similarity).				cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			AAGTCTGCTCTCCCTTCCGCG	0.493											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	103	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54552206	54552206	+	3'UTR	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54552206G>A	uc003jpx.2	-	27					DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29								ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTAATGGCTAGTACCAACATT	0.289													13	137	---	---	---	---	PASS
RGMB	285704	broad.mit.edu	37	5	98129342	98129342	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98129342C>T	uc003knc.2	+	5	1724	c.1322C>T	c.(1321-1323)CCA>CTA	p.P441L		NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN	RGM domain family, member B	400					axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding				0		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		GCCCTGCACCCAAGGAAGGAA	0.557													6	340	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139217290	139217290	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139217290G>A	uc003leu.1	+	12	1951	c.1746G>A	c.(1744-1746)AGG>AGA	p.R582R		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	582	PH.				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCCACCAGGGCCTCTGACT	0.587													13	47	---	---	---	---	PASS
FBXO38	81545	broad.mit.edu	37	5	147819253	147819253	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147819253A>G	uc003lpf.1	+	19	3188	c.3068A>G	c.(3067-3069)TAC>TGC	p.Y1023C	FBXO38_uc003lpg.1_Missense_Mutation_p.Y948C|FBXO38_uc003lph.2_Missense_Mutation_p.Y778C	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	1023						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGGTCCCTACCCCTATCAC	0.428													4	213	---	---	---	---	PASS
CAP2	10486	broad.mit.edu	37	6	17556592	17556592	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17556592A>G	uc003ncb.2	+	13	1596	c.1353A>G	c.(1351-1353)AGA>AGG	p.R451R	CAP2_uc011dja.1_Silent_p.R425R|CAP2_uc011djb.1_Silent_p.R387R|CAP2_uc011djc.1_Silent_p.R339R|CAP2_uc011djd.1_Silent_p.R191R	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2	451	C-CAP/cofactor C-like.				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TTTTCCAGAGAGAATTTCCCA	0.403													126	375	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17669541	17669541	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669541A>G	uc003ncd.1	-	7	1197	c.997T>C	c.(997-999)TCT>CCT	p.S333P	NUP153_uc011dje.1_Missense_Mutation_p.S333P|NUP153_uc010jpl.1_Missense_Mutation_p.S333P	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	333					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			AGAGGAGAAGAAACAATGGAT	0.199													5	208	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27420748	27420748	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27420748T>C	uc003njj.2	-	5	1401	c.590A>G	c.(589-591)GAA>GGA	p.E197G	ZNF184_uc010jqv.2_Missense_Mutation_p.E197G|ZNF184_uc003nji.2_Missense_Mutation_p.E197G	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGGAGATGGTTCTTGTGTTAC	0.373													6	477	---	---	---	---	PASS
DPCR1	135656	broad.mit.edu	37	6	30918152	30918152	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30918152C>T	uc003nsg.2	+	2	1911	c.1911C>T	c.(1909-1911)TCC>TCT	p.S637S		NM_080870	NP_543146	Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane					0						CCACACCATCCCCAGCAGGGC	0.493													6	478	---	---	---	---	PASS
SCUBE3	222663	broad.mit.edu	37	6	35212548	35212548	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35212548C>T	uc003okf.1	+	18	2367	c.2361C>T	c.(2359-2361)AGC>AGT	p.S787S	SCUBE3_uc003okg.1_Silent_p.S786S|SCUBE3_uc003okh.1_Silent_p.S674S	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3	787					protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1						GAAACACAAGCACAGACTTTG	0.562													28	84	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42620330	42620330	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42620330C>T	uc011dur.1	+	25	2716	c.2716C>T	c.(2716-2718)CAA>TAA	p.Q906*	UBR2_uc011dus.1_Nonsense_Mutation_p.Q551*|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	906					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AACAATTCTGCAATGGGCTGT	0.418													5	281	---	---	---	---	PASS
GSTA3	2940	broad.mit.edu	37	6	52764776	52764776	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52764776T>G	uc003pbb.2	-	5	449	c.370A>C	c.(370-372)ATC>CTC	p.I124L	GSTA3_uc010jzq.2_Missense_Mutation_p.I68L	NM_000847	NP_000838	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	124	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity				0	Lung NSC(77;0.0912)				Glutathione(DB00143)	TTCTCTTTGATCAAGGCAATC	0.403													102	285	---	---	---	---	PASS
KLHL31	401265	broad.mit.edu	37	6	53518961	53518961	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53518961G>A	uc003pcb.3	-	2	1251	c.1110C>T	c.(1108-1110)GCC>GCT	p.A370A		NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1	370	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					CTTCACCACCGGCTACATAAA	0.418													4	201	---	---	---	---	PASS
HOXA9	3205	broad.mit.edu	37	7	27203168	27203168	+	3'UTR	SNP	G	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27203168G>C	uc003syt.2	-	2						NM_152739	NP_689952	P31269	HXA9_HUMAN	homeobox A9								protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)	2						GGGACGGACAGTTCTTTCTTT	0.483			T	NUP98|MSI2	AML*								60	129	---	---	---	---	PASS
CRHR2	1395	broad.mit.edu	37	7	30701795	30701795	+	Silent	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30701795G>T	uc003tbn.2	-	7	979	c.735C>A	c.(733-735)GGC>GGA	p.G245G	CRHR2_uc010kvw.1_Silent_p.G245G|CRHR2_uc010kvx.1_Silent_p.G244G|CRHR2_uc010kvy.1_Silent_p.G81G|CRHR2_uc003tbo.2_Silent_p.G231G|CRHR2_uc003tbp.2_Silent_p.G272G	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	245	Helical; Name=4; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						AGTAGAGCTTGCCGATGGCCC	0.562													93	209	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77885777	77885777	+	Nonsense_Mutation	SNP	G	T	T	rs147828101	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77885777G>T	uc003ugx.2	-	10	1784	c.1530C>A	c.(1528-1530)TAC>TAA	p.Y510*	MAGI2_uc003ugy.2_Nonsense_Mutation_p.Y510*|MAGI2_uc010ldx.1_Nonsense_Mutation_p.Y119*|MAGI2_uc010ldy.1_Nonsense_Mutation_p.Y119*|MAGI2_uc011kgr.1_Nonsense_Mutation_p.Y342*|MAGI2_uc011kgs.1_Nonsense_Mutation_p.Y347*	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	510	PDZ 2.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGGGCAAAGGGTAGCCACGAC	0.488													8	107	---	---	---	---	PASS
TMEM209	84928	broad.mit.edu	37	7	129845266	129845266	+	5'UTR	SNP	A	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129845266A>T	uc003vpn.2	-	1					TMEM209_uc010lmc.1_5'UTR|TMEM209_uc003vpo.2_5'UTR|C7orf45_uc003vpp.2_5'Flank	NM_032842	NP_116231	Q96SK2	TM209_HUMAN	transmembrane protein 209							integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)					GGGCATGCGCAAAGCCAAGCT	0.597													25	67	---	---	---	---	PASS
TRY6	154754	broad.mit.edu	37	7	142481278	142481278	+	Missense_Mutation	SNP	G	T	T	rs143782230	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481278G>T	uc011ksq.1	+	3	435	c.352G>T	c.(352-354)GTC>TTC	p.V118F	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						CACACCTGCCGTCATCAATGC	0.542													83	35	---	---	---	---	PASS
OR6V1	346517	broad.mit.edu	37	7	142749554	142749554	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142749554A>G	uc011ksv.1	+	1	117	c.117A>G	c.(115-117)GGA>GGG	p.G39G		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					CCTTCATGGGAAACACCATCA	0.498													6	324	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149485496	149485496	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149485496G>A	uc010lpk.2	+	27	3902	c.3902G>A	c.(3901-3903)TGG>TAG	p.W1301*		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1301	TIL 3.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGCCCGGGTGGCACTGCCAG	0.662													18	47	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2005831	2005831	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2005831G>A	uc003wpx.3	+	5	631	c.493G>A	c.(493-495)GTC>ATC	p.V165I	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	165	Ig-like C2-type 1.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ATCCCACACCGTCTGGGAGAG	0.597													36	83	---	---	---	---	PASS
FGF17	8822	broad.mit.edu	37	8	21903771	21903771	+	Silent	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21903771C>A	uc003xag.2	+	3	231	c.219C>A	c.(217-219)ATC>ATA	p.I73I	FGF17_uc003xah.2_Silent_p.I62I|FGF17_uc003xai.2_Silent_p.I96I	NM_003867	NP_003858	O60258	FGF17_HUMAN	fibroblast growth factor 17 precursor	73					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|nervous system development	extracellular space	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		GGCGTCGCATCTCCGCCACCG	0.657													6	18	---	---	---	---	PASS
GPR124	25960	broad.mit.edu	37	8	37693252	37693252	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37693252C>G	uc003xkj.2	+	13	2377	c.2014C>G	c.(2014-2016)CGT>GGT	p.R672G	GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	672	Extracellular (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGCAAGAGGCGTGGCGTGGC	0.652													9	10	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53598062	53598062	+	5'UTR	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53598062T>C	uc003xre.3	-	3					RB1CC1_uc003xrf.3_5'UTR	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1						autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AGCTTATACCTCACCCTCTGA	0.333													5	136	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104933998	104933998	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104933998T>C	uc003yls.2	+	8	1757	c.1516T>C	c.(1516-1518)TCA>CCA	p.S506P	RIMS2_uc003ylp.2_Missense_Mutation_p.S728P|RIMS2_uc003ylw.2_Missense_Mutation_p.S536P|RIMS2_uc003ylq.2_Missense_Mutation_p.S536P|RIMS2_uc003ylr.2_Missense_Mutation_p.S583P|RIMS2_uc003ylt.2_Missense_Mutation_p.S129P|RIMS2_uc003ylv.1_Missense_Mutation_p.S119P	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	806					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACAGTTCTTATCAGGACAACT	0.353										HNSCC(12;0.0054)			99	271	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16437153	16437153	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16437153G>T	uc003zml.2	-	6	1179	c.1039C>A	c.(1039-1041)CAA>AAA	p.Q347K	BNC2_uc011lmw.1_Missense_Mutation_p.Q252K|BNC2_uc003zmm.2_Missense_Mutation_p.Q305K|BNC2_uc003zmq.1_Missense_Mutation_p.Q361K|BNC2_uc003zmr.1_Missense_Mutation_p.Q384K|BNC2_uc003zmp.1_Missense_Mutation_p.Q375K|BNC2_uc010mij.1_Missense_Mutation_p.Q269K|BNC2_uc011lmv.1_Missense_Mutation_p.Q173K|BNC2_uc003zmo.1_Missense_Mutation_p.Q269K|BNC2_uc003zmj.2_Missense_Mutation_p.Q112K|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.Q112K|BNC2_uc003zmn.1_Missense_Mutation_p.Q112K	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	347					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		AACCCTGGTTGCTCTAACAGT	0.473													6	314	---	---	---	---	PASS
IFNW1	3467	broad.mit.edu	37	9	21141070	21141070	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21141070A>G	uc003zol.1	-	1	1075	c.500T>C	c.(499-501)GTC>GCC	p.V167A		NM_002177	NP_002168	P05000	IFNW1_HUMAN	interferon, omega 1 precursor	167				V -> D (in Ref. 7; AAA70091).	cell cycle arrest|defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TTCCATTCTGACAACTTCCCA	0.443													5	191	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	66459863	66459863	+	5'Flank	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66459863G>T	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_RNA					Homo sapiens cDNA, FLJ98602.																		tttcctggatggtgttgatgc	0.000													3	6	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84609412	84609412	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84609412C>T	uc004amn.2	+	4	4074	c.4027C>T	c.(4027-4029)CAG>TAG	p.Q1343*		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1343						integral to membrane					0						CTTGAAAACACAGCCTCCTCC	0.468													15	36	---	---	---	---	PASS
RBM17	84991	broad.mit.edu	37	10	6143320	6143320	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6143320C>T	uc001ijb.2	+	3	436	c.210C>T	c.(208-210)GAC>GAT	p.D70D	RBM17_uc010qav.1_Silent_p.D70D	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	70					mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						AAATTGTGGACACTCCACCGC	0.512													30	58	---	---	---	---	PASS
C10orf50	645528	broad.mit.edu	37	10	26880266	26880266	+	RNA	SNP	G	A	A	rs138111133	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26880266G>A	uc001ist.2	+	2		c.501G>A				NR_026793				Homo sapiens, clone IMAGE:5172288, mRNA.												0						ACCAAGCCCAGTGGACAGATG	0.443													3	24	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27702183	27702183	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27702183G>T	uc001itu.2	-	1	1115	c.997C>A	c.(997-999)CCT>ACT	p.P333T		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	333					spermatid development	integral to membrane	hedgehog receptor activity	p.P333A(1)		ovary(2)|pancreas(1)|skin(1)	4						TCGTACTCAGGGTCCTCGGTC	0.522													28	61	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68687006	68687006	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687006T>C	uc001jmz.1	+	2	882	c.332T>C	c.(331-333)CTC>CCC	p.L111P	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.L111P	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	111	LRR 3.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						ATACGCAGACTCAAAGAGCTG	0.368													5	82	---	---	---	---	PASS
MARCH5	54708	broad.mit.edu	37	10	94109483	94109483	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94109483T>G	uc001khx.1	+	5	941	c.609T>G	c.(607-609)CAT>CAG	p.H203Q	MARCH5_uc010qno.1_Missense_Mutation_p.H99Q	NM_017824	NP_060294	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	203					cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						TAGCAGATCATGTCTCTGCTA	0.398													87	244	---	---	---	---	PASS
GPAM	57678	broad.mit.edu	37	10	113916968	113916968	+	Intron	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113916968T>C	uc009xxy.1	-						GPAM_uc001kzp.2_Intron|GPAM_uc001kzq.1_3'UTR	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate						phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)		AACCTCAACATATCCCTGTAA	0.453													64	195	---	---	---	---	PASS
GPAM	57678	broad.mit.edu	37	10	113917124	113917124	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113917124A>G	uc009xxy.1	-	19	2202	c.2004T>C	c.(2002-2004)AGT>AGC	p.S668S	GPAM_uc001kzp.2_Silent_p.S668S|GPAM_uc001kzq.1_Silent_p.S668S	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate	668	Mitochondrial intermembrane (Potential).|Mitochondrial intermembrane (Potential).				phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)		CAAGACTAGGACTGATATCTT	0.483													6	224	---	---	---	---	PASS
PPP2R2D	55844	broad.mit.edu	37	10	133757602	133757602	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133757602A>G	uc001lks.2	+	4	752	c.509A>G	c.(508-510)GAC>GGC	p.D170G	PPP2R2D_uc001lkr.2_5'UTR|PPP2R2D_uc001lkt.2_5'UTR|PPP2R2D_uc009yay.2_Missense_Mutation_p.D38G	NM_018461	NP_060931	Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B,	203	WD 3.				cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			skin(1)	1		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)		TCTGCAGATGACCTGAGAATT	0.398													6	359	---	---	---	---	PASS
ZFP91	80829	broad.mit.edu	37	11	58384278	58384278	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58384278A>G	uc001nmx.3	+	10	1360	c.1192A>G	c.(1192-1194)AAG>GAG	p.K398E	ZFP91_uc001nmy.3_Missense_Mutation_p.K397E|ZFP91-CNTF_uc010rkm.1_RNA	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN	zinc finger protein 91	398					activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CACTGGCGAGAAGCCATTACA	0.428													5	166	---	---	---	---	PASS
FIBP	9158	broad.mit.edu	37	11	65653801	65653801	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65653801C>T	uc001ogd.2	-	4	625	c.504G>A	c.(502-504)CGG>CGA	p.R168R	FIBP_uc009yqu.2_Silent_p.R165R|FIBP_uc001oge.2_Silent_p.R168R	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a	168					fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		ACCTGGCCAACCGGTCAGAGA	0.577													44	100	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72289948	72289948	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72289948T>C	uc010rrc.1	-	28	2705	c.2462A>G	c.(2461-2463)AAG>AGG	p.K821R	PDE2A_uc001oso.2_Missense_Mutation_p.K800R|PDE2A_uc010rra.1_Missense_Mutation_p.K814R|PDE2A_uc001osn.2_Missense_Mutation_p.K565R|PDE2A_uc010rrb.1_Missense_Mutation_p.K812R|PDE2A_uc010rrd.1_Missense_Mutation_p.K706R	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	821	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TACCGCGATCTTTCTCGTAGT	0.587													6	288	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85431940	85431940	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85431940G>A	uc010rth.1	-	8	1798	c.1522C>T	c.(1522-1524)CCT>TCT	p.P508S	SYTL2_uc010rtg.1_Missense_Mutation_p.P509S|SYTL2_uc010rti.1_Missense_Mutation_p.P508S|SYTL2_uc010rtj.1_Missense_Mutation_p.P460S|SYTL2_uc010rte.1_5'Flank|SYTL2_uc001pax.2_5'Flank|SYTL2_uc001paz.2_5'Flank|SYTL2_uc001pba.2_5'Flank|SYTL2_uc001pay.2_5'Flank|SYTL2_uc001paw.2_5'Flank|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.P830S|SYTL2_uc001pbb.2_Missense_Mutation_p.P830S|SYTL2_uc001pbc.2_Missense_Mutation_p.P830S|SYTL2_uc010rtf.1_Missense_Mutation_p.P366S	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	508					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTTTTGGAAGGCATTTTCCTA	0.398													75	194	---	---	---	---	PASS
HMBS	3145	broad.mit.edu	37	11	118962906	118962906	+	Intron	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118962906T>C	uc001puz.1	+						HMBS_uc009zao.1_3'UTR|HMBS_uc001pvc.1_Intron|HMBS_uc009zap.1_Intron|HMBS_uc001pva.1_Intron|HMBS_uc001pvb.1_Intron|HMBS_uc001pvd.1_Intron|HMBS_uc001pve.1_Intron|HMBS_uc001pvf.1_Intron	NM_000190	NP_000181	P08397	HEM3_HUMAN	hydroxymethylbilane synthase isoform 1						peptidyl-pyrromethane cofactor linkage	cytosol	hydroxymethylbilane synthase activity				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CATGGTGACATATGCCTTCCC	0.532									Porphyria_Acute_Intermittent				23	75	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	14019045	14019045	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14019045G>A	uc001rbt.2	-	2	277	c.98C>T	c.(97-99)CCC>CTC	p.P33L		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	33	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GCCAATGCTGGGGGGGCTCTT	0.582													12	34	---	---	---	---	PASS
ZBTB39	9880	broad.mit.edu	37	12	57396861	57396861	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57396861A>G	uc001sml.1	-	2	1927	c.1841T>C	c.(1840-1842)TTT>TCT	p.F614S	RDH16_uc010sqx.1_5'Flank	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	614	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						TGTGTGGGCAAATCTTTTGCC	0.562													13	29	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72026187	72026187	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72026187T>A	uc001swo.2	-	15	3284	c.2925A>T	c.(2923-2925)GAA>GAT	p.E975D		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	975	Potential.				RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						TCAGGGCATATTCATATTCTA	0.378													31	96	---	---	---	---	PASS
NR2C1	7181	broad.mit.edu	37	12	95415923	95415923	+	3'UTR	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95415923T>C	uc001tdm.3	-	14						NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						AATTTCCAGATGCCTCAAAAG	0.363													5	79	---	---	---	---	PASS
ACTR6	64431	broad.mit.edu	37	12	100617614	100617614	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100617614A>G	uc001thb.1	+	11	1168	c.1112A>G	c.(1111-1113)GAT>GGT	p.D371G	ACTR6_uc001thc.1_Missense_Mutation_p.D263G|ACTR6_uc001thd.1_Missense_Mutation_p.D351G|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Missense_Mutation_p.D289G|ACTR6_uc001thf.1_Missense_Mutation_p.D269G|uc001thg.1_5'Flank	NM_022496	NP_071941	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog	371						cytoplasm|cytoskeleton				ovary(1)	1						GAGAATGATGATTTTGAAGAT	0.328													177	414	---	---	---	---	PASS
N4BP2L2	10443	broad.mit.edu	37	13	33016602	33016602	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33016602C>G	uc010abe.1	-	7	2094	c.2072G>C	c.(2071-2073)CGT>CCT	p.R691P	N4BP2L2_uc001uug.2_Missense_Mutation_p.R574P|N4BP2L2_uc010abd.1_Missense_Mutation_p.R604P|N4BP2L2_uc001uuh.2_Missense_Mutation_p.R522P|N4BP2L2_uc001uuj.2_Missense_Mutation_p.R110P|N4BP2L2_uc010tdz.1_Missense_Mutation_p.R676P	NM_033111	NP_149102	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5	Error:Variant_position_missing_in_Q92802_after_alignment											0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		CTCAAGGGAACGGTAGTCAGT	0.398													62	119	---	---	---	---	PASS
AP1G2	8906	broad.mit.edu	37	14	24033327	24033327	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24033327T>C	uc001wkl.2	-	11	1356	c.1019A>G	c.(1018-1020)GAT>GGT	p.D340G	AP1G2_uc001wkj.2_5'UTR|AP1G2_uc001wkk.3_Missense_Mutation_p.D268G|AP1G2_uc001wkn.2_5'UTR|uc001wko.1_Intron|AP1G2_uc001wkp.1_RNA|AP1G2_uc010tnp.1_Missense_Mutation_p.D340G	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2	340					interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		AGCACTGTGATCAGACTGCAC	0.592													16	20	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92087969	92087969	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92087969A>G	uc001xzs.1	-	19	2383	c.2243T>C	c.(2242-2244)GTC>GCC	p.V748A	CATSPERB_uc010aub.1_Missense_Mutation_p.V270A	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	748					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ATTCCGTATGACCTTAGCTTT	0.313													5	201	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107183594	107183594	+	RNA	SNP	C	T	T	rs116154875	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107183594C>T	uc010tyt.1	-	29		c.1963G>A								Parts of antibodies, mostly variable regions.												0						GCGGACCCAGCTCATGTAGTA	0.582													3	39	---	---	---	---	PASS
FAM82A2	55177	broad.mit.edu	37	15	41046894	41046894	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41046894G>T	uc001zmo.1	-	2	232	c.88C>A	c.(88-90)CTT>ATT	p.L30I	FAM82A2_uc001zmp.1_Missense_Mutation_p.L30I|FAM82A2_uc001zmq.1_Missense_Mutation_p.L30I	NM_018145	NP_060615	Q96TC7	RMD3_HUMAN	family with sequence similarity 82, member A2	30	Helical; (Potential).				apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0						TGGCTGTAAAGGAGGCACAGG	0.657													20	56	---	---	---	---	PASS
CCNB2	9133	broad.mit.edu	37	15	59415824	59415824	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59415824A>T	uc002afz.2	+	8	1232	c.1084A>T	c.(1084-1086)ATC>TTC	p.I362F	CCNB2_uc010bge.2_Missense_Mutation_p.I234F	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2	362					cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						AACTAAATTCATCGTAAGTAC	0.428													58	156	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79059785	79059785	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79059785G>A	uc002bej.3	-	18	3006	c.2795C>T	c.(2794-2796)ACT>ATT	p.T932I	ADAMTS7_uc010und.1_Intron	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	932	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						AGGGGTTTCAGTAGGGGGCCG	0.692													15	56	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79264229	79264229	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79264229G>A	uc002beq.2	-	27	4083	c.3708C>T	c.(3706-3708)TAC>TAT	p.Y1236Y	RASGRF1_uc002bep.2_Silent_p.Y1220Y|RASGRF1_uc002beo.2_Silent_p.Y452Y	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	1238	Ras-GEF.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GCTCTATTTTGTAGGCAGTTT	0.493													130	347	---	---	---	---	PASS
RAB11FIP3	9727	broad.mit.edu	37	16	521301	521301	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:521301A>G	uc002chf.2	+	3	1154	c.815A>G	c.(814-816)GAT>GGT	p.D272G		NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1	272					cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				GCAGATCCTGATGGCCAGTGC	0.632											OREG0003708	type=REGULATORY REGION|Gene=BC009036|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	223	---	---	---	---	PASS
STUB1	10273	broad.mit.edu	37	16	731639	731639	+	Intron	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:731639T>C	uc002cit.2	+						STUB1_uc002ciu.2_Intron|STUB1_uc010bqz.2_Intron|STUB1_uc002civ.2_RNA	NM_005861	NP_005852	Q9UNE7	CHIP_HUMAN	STIP1 homology and U-box containing protein 1						cellular response to misfolded protein|DNA repair|misfolded or incompletely synthesized protein catabolic process|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K63-linked ubiquitination|protein maturation|regulation of glucocorticoid metabolic process|ubiquitin-dependent SMAD protein catabolic process	cytoplasm|nuclear inclusion body|ubiquitin conjugating enzyme complex|ubiquitin ligase complex	Hsp70 protein binding|Hsp90 protein binding|kinase binding|misfolded protein binding|protein binding, bridging|protein homodimerization activity|SMAD binding|TPR domain binding|ubiquitin-ubiquitin ligase activity				0		Hepatocellular(780;0.00335)				TGTCTTGGGATAATTCTGAAT	0.577													15	17	---	---	---	---	PASS
RPL3L	6123	broad.mit.edu	37	16	1994677	1994677	+	3'UTR	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1994677C>A	uc002cnh.2	-	10					SEPX1_uc010uvs.1_5'Flank	NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						ttgcaattcccctgtcttaat	0.134													5	18	---	---	---	---	PASS
ANKS3	124401	broad.mit.edu	37	16	4776983	4776983	+	Silent	SNP	G	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4776983G>C	uc002cxj.1	-	4	661	c.366C>G	c.(364-366)CTC>CTG	p.L122L	ANKS3_uc002cxi.1_Silent_p.L49L|ANKS3_uc002cxk.2_Intron|ANKS3_uc002cxl.2_5'UTR|ANKS3_uc010uxs.1_Silent_p.L49L|ANKS3_uc002cxm.2_Intron	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	122	ANK 3.										0						AGCTCACCTGGAGAAGAAAGT	0.612													28	36	---	---	---	---	PASS
MKL2	57496	broad.mit.edu	37	16	14304164	14304164	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14304164A>G	uc010uza.1	+	4	374	c.219A>G	c.(217-219)CCA>CCG	p.P73P	MKL2_uc002dcg.2_Silent_p.P73P|MKL2_uc002dch.2_Silent_p.P62P|MKL2_uc010uzb.1_Silent_p.P22P	NM_014048	NP_054767	Q9ULH7	MKL2_HUMAN	megakaryoblastic leukemia 2 protein	62	RPEL 1.				cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5						GCATCATGCCACGTAAGATTT	0.478													54	202	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	28354223	28354223	+	Missense_Mutation	SNP	G	A	A	rs457403		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28354223G>A	uc010vcq.1	-	7	982	c.929C>T	c.(928-930)CCG>CTG	p.P310L	uc010vcr.1_Missense_Mutation_p.P328L					SubName: Full=LOC728741 protein;																		GGGTGGAAGCGGGACAAAGAG	0.383													7	19	---	---	---	---	PASS
HERC2P4	440362	broad.mit.edu	37	16	32163812	32163812	+	RNA	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32163812G>T	uc002ecx.2	-	1		c.63C>A				NR_002827				Homo sapiens hect domain and RLD 2 pseudogene 4, mRNA (cDNA clone IMAGE:5416019).												0						TGATGGAGCGGAGCTGGGAGT	0.517													12	89	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68845698	68845698	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68845698A>G	uc002ewg.1	+	7	1068	c.944A>G	c.(943-945)AAT>AGT	p.N315S	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.N315S	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	315	Cadherin 2.|Extracellular (Potential).		N -> S (in lobular breast carcinoma).		adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.N315S(2)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CCTGACAAAAATATGTTCACC	0.547			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				40	139	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70070398	70070398	+	Intron	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70070398T>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTTTCTCAGCTTCTCTTCGTC	0.378													5	194	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													4	29	---	---	---	---	PASS
ZNF469	84627	broad.mit.edu	37	16	88498466	88498466	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88498466C>T	uc002fku.2	+	2	4504	c.4504C>T	c.(4504-4506)CCT>TCT	p.P1502S		NM_001127464	NP_001120936	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1502	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACGTGTCCCCCTGAACGGAC	0.567													15	46	---	---	---	---	PASS
SPNS3	201305	broad.mit.edu	37	17	4391254	4391254	+	3'UTR	SNP	G	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4391254G>T	uc002fxt.2	+	12					SPNS3_uc002fxu.2_3'UTR|SPNS3_uc002fxv.2_3'UTR|uc002fxw.1_5'Flank	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						CAGTGCCTCGGTTCCTCTTTG	0.642													6	8	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10253892	10253892	+	Silent	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10253892C>T	uc002gmk.1	-	12	1215	c.1125G>A	c.(1123-1125)GCG>GCA	p.A375A	MYH13_uc010vvf.1_Silent_p.A50A	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	375	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CGTCTGGCTCCGCCTGCTCCT	0.542													58	87	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26087758	26087758	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26087758G>A	uc002gzu.2	-	24	3165	c.2901C>T	c.(2899-2901)TTC>TTT	p.F967F		NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	967	FAD-binding FR-type.				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	CGGGGAGGTGGAAGCCGCTGG	0.657											OREG0024268	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	30	---	---	---	---	PASS
PIP4K2B	8396	broad.mit.edu	37	17	36943164	36943164	+	Silent	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36943164G>A	uc002hqs.2	-	2	650	c.169C>T	c.(169-171)CTG>TTG	p.L57L	PIP4K2B_uc010wdt.1_Silent_p.L57L|PIP4K2B_uc010wdu.1_5'UTR	NM_003559	NP_003550	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	57	PIPK.				cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1						ACATTGCTCAGCTCATTGATC	0.453													81	199	---	---	---	---	PASS
CALCOCO2	10241	broad.mit.edu	37	17	46925766	46925766	+	Silent	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46925766T>C	uc002iof.2	+	4	445	c.366T>C	c.(364-366)CCT>CCC	p.P122P	CALCOCO2_uc010wlp.1_Silent_p.P143P|CALCOCO2_uc010wlq.1_Silent_p.P50P|CALCOCO2_uc010wlr.1_Silent_p.P146P|CALCOCO2_uc010wls.1_Silent_p.P122P	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	122					response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						CAAGTATTCCTTTCCAATTCC	0.448													7	586	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48266574	48266574	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48266574A>G	uc002iqm.2	-	40	3018	c.2892T>C	c.(2890-2892)CCT>CCC	p.P964P		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	964	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	CTCTCTGACCAGGCAGGCCGA	0.617			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						6	29	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76450634	76450634	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76450634C>T	uc010dhp.1	-	9	1546	c.1324G>A	c.(1324-1326)GTG>ATG	p.V442M	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGGCGTCCACGATCAGCGGC	0.612													4	226	---	---	---	---	PASS
PPP4R1	9989	broad.mit.edu	37	18	9570186	9570186	+	Silent	SNP	T	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9570186T>A	uc002koe.1	-	11	1660	c.1542A>T	c.(1540-1542)CTA>CTT	p.L514L	PPP4R1_uc002kof.2_5'UTR|PPP4R1_uc010wzo.1_Silent_p.L360L|PPP4R1_uc002kod.1_Silent_p.L497L|PPP4R1_uc010wzp.1_RNA	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	514	HEAT 10.				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						TGTGGGGCTCTAGATTTTCTA	0.393													68	215	---	---	---	---	PASS
CCDC11	220136	broad.mit.edu	37	18	47765035	47765035	+	Silent	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47765035T>C	uc002lee.2	-	7	1345	c.1254A>G	c.(1252-1254)GAA>GAG	p.E418E		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	418	Potential.									ovary(1)|pancreas(1)|skin(1)	3				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		TGTGTTTCTGTTCCATAGCAC	0.333													7	642	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74590089	74590089	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74590089A>G	uc002lmi.2	+	7	1157	c.959A>G	c.(958-960)GAG>GGG	p.E320G	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Missense_Mutation_p.E320G	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	320					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGTTCTACAGAGACTGCTCAT	0.323													6	281	---	---	---	---	PASS
ZNF317	57693	broad.mit.edu	37	19	9268631	9268631	+	Intron	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9268631A>G	uc002mku.2	+						ZNF317_uc002mkv.2_5'UTR|ZNF317_uc002mkw.2_Intron|ZNF317_uc002mkx.2_Intron|ZNF317_uc002mky.2_Intron	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCCTCCCTCAACCTGTGTCTT	0.587													14	41	---	---	---	---	PASS
ALKBH6	84964	broad.mit.edu	37	19	36504305	36504305	+	Translation_Start_Site	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36504305C>T	uc002oct.2	-	2	95	c.-5G>A	c.(-7--3)TGGTG>TGATG		ALKBH6_uc002ocv.1_Missense_Mutation_p.V27M|ALKBH6_uc002ocx.1_Translation_Start_Site|ALKBH6_uc002ocw.1_Missense_Mutation_p.V27M|ALKBH6_uc010eeo.1_Translation_Start_Site|ALKBH6_uc010eep.1_Missense_Mutation_p.V27M|uc002ocy.2_5'Flank	NM_032878	NP_116267	Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 isoform 2							cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCCATCAACACCAACTCCTTG	0.587													32	111	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55174375	55174375	+	5'UTR	SNP	C	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55174375C>A	uc002qgp.2	+	1					LILRB4_uc002qgo.1_Missense_Mutation_p.H5N|LILRB4_uc002qgq.2_5'UTR|LILRB4_uc010ers.1_5'UTR|LILRB4_uc002qgr.2_Missense_Mutation_p.H5N|LILRB4_uc010ert.2_Missense_Mutation_p.H5N|LILRB4_uc010eru.2_Missense_Mutation_p.H5N	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,							integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		GGAACAACCCCATGACGAGAA	0.612											OREG0003670	type=REGULATORY REGION|Gene=LILRB4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	11	---	---	---	---	PASS
ZNF8	7554	broad.mit.edu	37	19	58805702	58805702	+	Silent	SNP	C	G	G	rs142117860		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58805702C>G	uc002qry.1	+	4	658	c.528C>G	c.(526-528)CTC>CTG	p.L176L	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	176					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		ACAAAACTCTCAGACTCAGGG	0.463													16	41	---	---	---	---	PASS
GTPBP5	26164	broad.mit.edu	37	20	60772957	60772957	+	Silent	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60772957T>C	uc002yce.3	+	4	440	c.402T>C	c.(400-402)GGT>GGC	p.G134G	GTPBP5_uc011aab.1_5'UTR|GTPBP5_uc011aac.1_5'UTR|GTPBP5_uc011aad.1_Intron|GTPBP5_uc011aae.1_Intron|GTPBP5_uc011aaf.1_Intron|GTPBP5_uc011aag.1_Silent_p.G134G	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5	134	Localized in the mitocondria.|Not localized in the mitocondria.				ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)			GGTACCAGGGTTTCAGTGGAG	0.577													5	154	---	---	---	---	PASS
CHODL	140578	broad.mit.edu	37	21	19629058	19629058	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19629058G>A	uc002ykv.2	+	2	703	c.312G>A	c.(310-312)TGG>TGA	p.W104*	CHODL_uc002ykr.2_Nonsense_Mutation_p.W63*|CHODL_uc002yks.2_Nonsense_Mutation_p.W63*|CHODL_uc002ykt.2_Nonsense_Mutation_p.W63*|CHODL_uc002yku.2_Nonsense_Mutation_p.W63*	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor	104	Extracellular (Potential).|C-type lectin.				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		TAGGGCTTTGGAGGAATGGAG	0.473													71	194	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40578170	40578170	+	Silent	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40578170A>G	uc002yxk.1	-	37	4367	c.4228T>C	c.(4228-4230)TTA>CTA	p.L1410L	BRWD1_uc010goc.1_Silent_p.L53L|BRWD1_uc002yxl.2_Silent_p.L1410L|BRWD1_uc010god.1_Silent_p.L328L	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1410					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TCTTCAAATAAGGCAGATAAT	0.284													6	189	---	---	---	---	PASS
UPB1	51733	broad.mit.edu	37	22	24891258	24891258	+	5'UTR	SNP	A	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24891258A>G	uc003aaf.2	+	1					UPB1_uc003aae.2_5'UTR|UPB1_uc011ajt.1_5'UTR|C22orf45_uc003aad.1_5'Flank	NM_016327	NP_057411	Q9UBR1	BUP1_HUMAN	beta-ureidopropionase						pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding			ovary(2)	2	Colorectal(2;0.0339)					GCTGTCTGGGAGCGAGAGTAA	0.657													3	5	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	C	C	rs142470496	byFrequency	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091840T>C	uc003adu.1	-	11	1189	c.1117A>G	c.(1117-1119)AAG>GAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				7	68	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				5	70	---	---	---	---	PASS
SCUBE1	80274	broad.mit.edu	37	22	43599960	43599960	+	3'UTR	SNP	C	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43599960C>T	uc003bdt.1	-	22						NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				CAGGTGCACCCTCCGCGGACC	0.657													21	59	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45779436	45779436	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45779436T>G	uc003bgc.2	-	12	2021	c.1969A>C	c.(1969-1971)AGT>CGT	p.S657R	SMC1B_uc003bgd.2_Missense_Mutation_p.S657R|SMC1B_uc003bge.1_Missense_Mutation_p.S440R	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	657	Flexible hinge.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTTAAGTCACTTGACCCTCCA	0.363													188	482	---	---	---	---	PASS
ZFX	7543	broad.mit.edu	37	X	24228904	24228904	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24228904G>A	uc004dbf.2	+	9	2087	c.1829G>A	c.(1828-1830)TGT>TAT	p.C610Y	ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Missense_Mutation_p.C649Y|ZFX_uc010nfz.2_Missense_Mutation_p.C266Y	NM_003410	NP_003401	P17010	ZFX_HUMAN	zinc finger protein, X-linked	610	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(2)	2						TGTGACATTTGTCTTCTGACT	0.428													4	154	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129771284	129771284	+	Silent	SNP	T	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129771284T>C	uc004evw.2	-	12	1735	c.1317A>G	c.(1315-1317)CAA>CAG	p.Q439Q	ENOX2_uc004evx.2_Silent_p.Q410Q|ENOX2_uc004evy.2_Silent_p.Q410Q|ENOX2_uc004evv.2_Silent_p.Q264Q	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	439	Potential.				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						GGACTTTGCCTTGTTCTTGCT	0.473													8	593	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3105881	3105882	+	Intron	INS	-	CG	CG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3105881_3105882insCG	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGGCCTGGTACAGAGAAAAACA	0.614			T	EVI1	MDS|AML								4	2	---	---	---	---	
DNAJC11	55735	broad.mit.edu	37	1	6735784	6735785	+	Intron	DEL	TA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6735784_6735785delTA	uc001aof.2	-						DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Intron|DNAJC11_uc010nzu.1_Intron	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11						protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		cacccagccCTATATATTTGTA	0.188													4	2	---	---	---	---	
UBE4B	10277	broad.mit.edu	37	1	10215143	10215144	+	Intron	DEL	GT	-	-	rs61782928		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10215143_10215144delGT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		gagagagagagtgtgtgtgtgt	0.297													4	2	---	---	---	---	
MAD2L2	10459	broad.mit.edu	37	1	11742630	11742630	+	5'Flank	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11742630delG	uc001asp.2	-						MAD2L2_uc009vnc.2_Intron|MAD2L2_uc001asq.3_Intron	NM_006341	NP_006332	Q9UI95	MD2L2_HUMAN	MAD2 homolog						cell division|DNA damage response, signal transduction resulting in transcription|double-strand break repair|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of mitotic anaphase-promoting complex activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription, DNA-dependent|regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleoplasm|spindle|zeta DNA polymerase complex	JUN kinase binding				0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		tgcagtcctaggaaatctgca	0.159								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14761554	14761554	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14761554delG								PRDM2 (609982 upstream) : KAZ (163659 downstream)																							ACCTCAGCCAGGGTCTCCTTG	0.567													4	2	---	---	---	---	
ESPNP	284729	broad.mit.edu	37	1	17043468	17043468	+	Intron	DEL	A	-	-	rs66463616		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17043468delA	uc001azn.1	-							NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GGACAGCCAGAAGCAGGTGTG	0.687													4	2	---	---	---	---	
TMCO4	255104	broad.mit.edu	37	1	20059175	20059175	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20059175delG	uc001bcn.2	-						TMCO4_uc001bcm.2_Intron|TMCO4_uc001bco.1_Intron|TMCO4_uc001bcp.1_Intron	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		cttgagaccaggagttcgaga	0.139													4	2	---	---	---	---	
SEPN1	57190	broad.mit.edu	37	1	26139056	26139063	+	Intron	DEL	ACACACAC	-	-	rs66781270		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26139056_26139063delACACACAC	uc010oer.1	+						SEPN1_uc010oes.1_Intron	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor							endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		ctacacacaaacacacacacacacacac	0.183													6	3	---	---	---	---	
TRNP1	388610	broad.mit.edu	37	1	27322961	27322961	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27322961delA	uc001bnj.3	+							NM_001013642	NP_001013664	Q6NT89	TRNP1_HUMAN	TMF regulated nuclear protein						cell cycle	nucleus					0						GGAAGTAATGAAGGGGGCAAT	0.522													4	2	---	---	---	---	
STX12	23673	broad.mit.edu	37	1	28148555	28148555	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28148555delA	uc001bou.3	+							NM_177424	NP_803173	Q86Y82	STX12_HUMAN	syntaxin 12						cholesterol efflux|intracellular protein transport|protein stabilization|vesicle-mediated transport	Golgi apparatus|integral to membrane|membrane raft|phagocytic vesicle	SNAP receptor activity			breast(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		ccaaacaaacaaaaaaCACTT	0.179													4	2	---	---	---	---	
EYA3	2140	broad.mit.edu	37	1	28369364	28369364	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28369364delT	uc001bpi.1	-						EYA3_uc010ofs.1_Intron|EYA3_uc010oft.1_Intron|EYA3_uc001bpj.2_Intron|EYA3_uc001bpk.1_Intron|EYA3_uc010ofu.1_Intron	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3						anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		CCGCTCtttcttttttttttg	0.209													5	3	---	---	---	---	
OPRD1	4985	broad.mit.edu	37	1	29145797	29145797	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29145797delA	uc001brf.1	+							NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1						immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	accccatttcaaaaaaaaaag	0.294													4	3	---	---	---	---	
SDC3	9672	broad.mit.edu	37	1	31352764	31352764	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31352764delT	uc001bse.2	-						SDC3_uc001bsd.2_5'Flank	NM_014654	NP_055469	O75056	SDC3_HUMAN	syndecan 3							integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		ACATAGACCCTTGAAATGACA	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37073924	37073925	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37073924_37073925delTG								CSF3R (125415 upstream) : GRIK3 (187203 downstream)																							gggtgggacctgtgaacaggat	0.010													4	2	---	---	---	---	
KLF17	128209	broad.mit.edu	37	1	44582761	44582761	+	5'Flank	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44582761delT	uc001clp.2	+						KLF17_uc009vxf.1_Intron	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393						regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					tttttcattctttttttttag	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48365348	48365348	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48365348delT								FOXD2 (458986 upstream) : SKINTL (202039 downstream)																							gtTTTGTGTGTTTGTGCAATA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48443353	48443353	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48443353delA								FOXD2 (536991 upstream) : SKINTL (124034 downstream)																							GGCCGGGATGAAAAAAAAAAA	0.338													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54896993	54896993	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54896993delT								SSBP3 (24901 upstream) : ACOT11 (110937 downstream)																							gataTGGGCCttttttttttc	0.025													4	2	---	---	---	---	
C1orf175	374977	broad.mit.edu	37	1	55146622	55146622	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55146622delT	uc010ooe.1	+						C1orf175_uc001cxq.2_Intron|C1orf175_uc010ooc.1_Intron|C1orf175_uc001cxs.2_Intron|C1orf175_uc010ood.1_Intron|C1orf175_uc010oof.1_Intron|C1orf175_uc001cxr.1_Intron|C1orf175_uc010oog.1_Intron|C1orf175_uc010ooh.1_Intron|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_Intron|C1orf175_uc009vzr.1_5'Flank	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977							integral to membrane	binding				0						cccaccagggttttttttttc	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55913733	55913733	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55913733delA								USP24 (232971 upstream) : None (None downstream)																							AAGTAAAGGGAAAAAAGCAAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59294909	59294909	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59294909delT	uc001czf.2	+						uc010oop.1_Intron					Homo sapiens cDNA FLJ30588 fis, clone BRAWH2008128.																		ctgggtttggtttttttttgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62697564	62697564	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62697564delT								L1TD1 (19566 upstream) : KANK4 (4274 downstream)																							TTTTGAATCCttttttttttg	0.184													2	4	---	---	---	---	
JAK1	3716	broad.mit.edu	37	1	65309085	65309085	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65309085delC	uc001dbu.1	-						JAK1_uc009wam.1_Intron|JAK1_uc009wal.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		TCCACTTTTTCCAcaggtaga	0.209			Mis		ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	75661825	75661825	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75661825delT								LHX8 (34609 upstream) : SLC44A5 (5991 downstream)																							TCGAGTTGGATTTTTTTTTCC	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91224670	91224670	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91224670delG								BARHL2 (41876 upstream) : ZNF644 (156190 downstream)																							CCTCCTTCCTGGGCATTCTGT	0.338													4	2	---	---	---	---	
SLC35A3	23443	broad.mit.edu	37	1	100458952	100458952	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100458952delT	uc001dsp.1	+						SLC35A3_uc001dsq.1_Intron|SLC35A3_uc009wdy.1_Intron|SLC35A3_uc001dsr.1_Intron|SLC35A3_uc001dss.1_5'Flank	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A						UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		TTGGTTTCTGTTTTTTTTTCT	0.239													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	105212635	105212635	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105212635delA								None (None upstream) : None (None downstream)																							TCTGAGAGAGAAAAAAAAGAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	108081900	108081901	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108081900_108081901insA								NTNG1 (57429 upstream) : VAV3 (31881 downstream)																							TGCCCCCTGTGGATCACAAACA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110271891	110271892	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110271891_110271892delAC								GSTM5 (11003 upstream) : GSTM3 (4662 downstream)																							aaggaccgaaacacacacacac	0.000													4	2	---	---	---	---	
CSF1	1435	broad.mit.edu	37	1	110463928	110463928	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110463928delT	uc001dyu.2	+						CSF1_uc001dyt.2_Intron|CSF1_uc001dyv.3_Intron|CSF1_uc001dyw.3_Intron	NM_172212	NP_757351	P09603	CSF1_HUMAN	colony stimulating factor 1 isoform a precursor						cell proliferation|developmental process involved in reproduction|macrophage differentiation|monocyte activation|osteoclast differentiation|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of cellular protein metabolic process|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of monocyte differentiation|positive regulation of mononuclear cell proliferation|positive regulation of protein kinase activity	extracellular space|integral to membrane|perinuclear region of cytoplasm|plasma membrane|receptor complex	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding|protein homodimerization activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		accagccttcttttagtcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111982182	111982182	+	IGR	DEL	A	-	-	rs79762729		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111982182delA								OVGP1 (11783 upstream) : WDR77 (331 downstream)																							tcaacaaaagaaaaaaaaaaC	0.184													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	113321482	113321482	+	IGR	DEL	C	-	-	rs35389669		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113321482delC								FAM19A3 (51628 upstream) : SLC16A1 (132990 downstream)																							cttgctgcctccaattccacc	0.070													4	2	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113990477	113990477	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113990477delA	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		actgtgtctcaaaaaaaaaaa	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116788661	116788664	+	IGR	DEL	CTCC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116788661_116788664delCTCC								C1orf161 (110800 upstream) : ATP1A1 (126340 downstream)																							gaatggtggtctcccaaaagatca	0.186													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120634925	120634926	+	IGR	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120634925_120634926delAG								NOTCH2 (22649 upstream) : FAM72B (204079 downstream)																							ctgtctcaaaaGAGAGAGAGAG	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143243198	143243198	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143243198delG	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		caatatcacaggggggtgtac	0.179													4	2	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116403	145116403	+	3'UTR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116403delT	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						TTTGATGGCCTTTTAAACAAG	0.299													4	2	---	---	---	---	
APH1A	51107	broad.mit.edu	37	1	150238775	150238775	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150238775delA	uc001ety.1	-						APH1A_uc010pbx.1_Intron|APH1A_uc001etz.1_3'UTR|APH1A_uc001eua.1_Intron|APH1A_uc010pby.1_3'UTR|APH1A_uc001eub.1_Intron|APH1A_uc010pbz.1_3'UTR	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform						amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding			ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAACGGTCACAAAAGGACAAA	0.567													4	2	---	---	---	---	
SCNM1	79005	broad.mit.edu	37	1	151140436	151140436	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151140436delA	uc001ewz.2	+						LYSMD1_uc001ewy.2_5'Flank|LYSMD1_uc010pcr.1_5'Flank|SCNM1_uc009wmn.2_Intron	NM_024041	NP_076946	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCTTAAGATTAAAAAAAACTT	0.254													4	2	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151178274	151178274	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151178274delA	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			actccgtctcaaaaaaaagaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152138867	152138867	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152138867delT								RPTN (7163 upstream) : HRNR (45691 downstream)																							tacaaagtcatttacttggtg	0.005													4	2	---	---	---	---	
SPRR2D	6703	broad.mit.edu	37	1	153030057	153030057	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153030057delA	uc009wnz.2	-						SPRR2A_uc001fbf.2_Intron|SPRR2A_uc001fbd.2_5'Flank|SPRR2A_uc009woa.2_Intron			P22532	SPR2D_HUMAN	Homo sapiens cDNA FLJ76407 complete cds, highly similar to Homo sapiens small proline-rich protein 2D (SPRR2D), mRNA.						keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAACTACCCAAAACAATGCT	0.443													4	2	---	---	---	---	
ASH1L	55870	broad.mit.edu	37	1	155354698	155354698	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155354698delT	uc009wqq.2	-						RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Intron	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			acaaatttgctttttttgtca	0.000													4	3	---	---	---	---	
SMG5	23381	broad.mit.edu	37	1	156242370	156242370	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156242370delT	uc001foc.3	-							NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					TGACCTCttcttttttttttt	0.234													6	4	---	---	---	---	
ARHGEF11	9826	broad.mit.edu	37	1	156936136	156936137	+	Intron	DEL	GC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156936136_156936137delGC	uc001fqo.2	-						ARHGEF11_uc001fqn.2_Intron	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					tgctttcactgcaactcagcac	0.109													4	2	---	---	---	---	
SLAMF7	57823	broad.mit.edu	37	1	160710074	160710074	+	Intron	DEL	A	-	-	rs113236906		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160710074delA	uc001fwq.2	+						SLAMF7_uc010pjn.1_Intron|SLAMF7_uc001fws.2_Intron|SLAMF7_uc001fwr.2_Intron|SLAMF7_uc010pjo.1_Intron|SLAMF7_uc010pjp.1_Intron|SLAMF7_uc010pjq.1_Intron|SLAMF7_uc010pjr.1_Intron	NM_021181	NP_067004	Q9NQ25	SLAF7_HUMAN	SLAM family member 7						cell adhesion|natural killer cell activation|natural killer cell mediated cytotoxicity	integral to membrane	receptor activity			skin(2)|ovary(1)	3	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CCCTCACTTTAAAAAAAAAAA	0.398													2	4	---	---	---	---	
TOMM40L	84134	broad.mit.edu	37	1	161208132	161208132	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161208132delG	uc009wuf.1	+						NR1I3_uc001fzf.2_5'Flank|NR1I3_uc001fzg.2_5'Flank|NR1I3_uc001fzh.2_5'Flank|NR1I3_uc001fzi.2_5'Flank|NR1I3_uc001fzj.2_5'Flank|NR1I3_uc001fzk.2_5'Flank|NR1I3_uc001fzl.2_5'Flank|NR1I3_uc001fzm.2_5'Flank|NR1I3_uc001fzn.2_5'Flank|NR1I3_uc009wug.2_5'Flank|NR1I3_uc001fzp.2_5'Flank|NR1I3_uc001fzo.2_5'Flank|NR1I3_uc001fzq.2_5'Flank|NR1I3_uc001fzr.2_5'Flank|NR1I3_uc001fzs.2_5'Flank|NR1I3_uc001fzt.2_5'Flank|NR1I3_uc001fzu.2_5'Flank|NR1I3_uc001fzv.2_5'Flank|NR1I3_uc001fzw.2_5'Flank|NR1I3_uc001fzx.2_5'Flank|NR1I3_uc001fzy.2_5'Flank|NR1I3_uc001fzz.2_5'Flank|NR1I3_uc001gaa.2_5'Flank|NR1I3_uc001gab.2_5'Flank|NR1I3_uc001gac.2_5'Flank|NR1I3_uc010pkm.1_5'Flank|NR1I3_uc010pkn.1_5'Flank	NM_032174		Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40						protein transport	mitochondrial outer membrane|pore complex	porin activity|voltage-gated anion channel activity			large_intestine(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GGACTCCAGTGGGTGGGAACC	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164902221	164902221	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164902221delA								PBX1 (47921 upstream) : LMX1A (268884 downstream)																							ATCTTGTAGGAAAAAAAAAAG	0.368													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168183894	168183895	+	IGR	INS	-	G	G	rs144521509	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168183894_168183895insG								TIPRL (12545 upstream) : SFT2D2 (11360 downstream)																							tgaggaagagtgactcaaagaa	0.000													2	5	---	---	---	---	
PRDX6	9588	broad.mit.edu	37	1	173454855	173454855	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173454855delA	uc001giy.1	+							NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6						cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						GGAAATCTACAAAAAAAAAGT	0.363													6	3	---	---	---	---	
CENPL	91687	broad.mit.edu	37	1	173790057	173790057	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173790057delA	uc001gje.3	-						CENPL_uc009wwg.2_Intron|CENPL_uc001gjg.3_Intron|CENPL_uc001gjf.3_Intron	NM_033319	NP_201576	Q8N0S6	CENPL_HUMAN	centromere protein L isoform 2						mitotic prometaphase	chromosome, centromeric region|cytosol|nucleus					0						atgtgactataaaaaggcaac	0.055													4	2	---	---	---	---	
ASTN1	460	broad.mit.edu	37	1	176857664	176857664	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176857664delA	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TAGGCTCTAGAAAAAAAATTA	0.478													4	2	---	---	---	---	
FAM5C	339479	broad.mit.edu	37	1	190165789	190165789	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190165789delT	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AACTGATAGGTTTTTTTTTGT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194570407	194570410	+	IGR	DEL	TCTT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194570407_194570410delTCTT								None (None upstream) : None (None downstream)																							tttctttctgtctttctttctttc	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198365904	198365904	+	IGR	DEL	G	-	-	rs11301437		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198365904delG								NEK7 (74358 upstream) : ATP6V1G3 (126452 downstream)																							GTTTGGGGATGGGGGTCACTT	0.224													1	5	---	---	---	---	
SRGAP2	23380	broad.mit.edu	37	1	206635245	206635246	+	3'UTR	INS	-	AC	AC	rs144856136	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206635245_206635246insAC	uc001hdy.2	+	20					SRGAP2_uc010pru.1_3'UTR	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					acacacattttacacacacaca	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212677412	212677412	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212677412delC								NENF (57693 upstream) : ATF3 (61285 downstream)																							agcaatggctcccaatcaaga	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214127170	214127170	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214127170delA	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																		TTGAGAGGGGAAAAAAATACC	0.453													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217038068	217038069	+	Intron	INS	-	TT	TT	rs141584307	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217038068_217038069insTT	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CGTGGAGTAACAGACCAACTTA	0.495													7	4	---	---	---	---	
TGFB2	7042	broad.mit.edu	37	1	218596606	218596606	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218596606delG	uc001hlm.2	+						TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		AAGGGTTTGTGGGGATTTAAA	0.358													4	2	---	---	---	---	
CAPN8	388743	broad.mit.edu	37	1	223850155	223850155	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223850155delA	uc009xee.2	-							NM_001143962	NP_001137434	A6NHC0	CAN8_HUMAN	calpain 8						proteolysis	Golgi apparatus	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						tatctcaaacaaaaaaaaaga	0.000													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241142892	241142892	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241142892delT	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			gggagaggccttaggcactgg	0.005													4	2	---	---	---	---	
PXDN	7837	broad.mit.edu	37	2	1721385	1721386	+	Intron	INS	-	A	A	rs141032154	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1721385_1721386insA	uc002qxa.2	-						PXDN_uc002qxb.1_Intron|PXDN_uc002qxc.1_Intron	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor						extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGTCTTCTAATAATGCAGACAG	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2466685	2466685	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2466685delC								MYT1L (131640 upstream) : TSSC1 (726056 downstream)																							acaggtggttctctcccacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5692232	5692232	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5692232delT								None (None upstream) : SOX11 (140567 downstream)																							TCTCAAGTCCTTTTATTTCAA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5877050	5877050	+	IGR	DEL	T	-	-	rs5829028		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5877050delT								SOX11 (35534 upstream) : LOC150622 (195769 downstream)																							GGGCATGCCATTTTTTTTTTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7488838	7488838	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7488838delG								RNF144A (304531 upstream) : LOC339788 (573720 downstream)																							AGTTGCCCATGGCTGTGTGTG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11790879	11790880	+	IGR	INS	-	T	T	rs149142537	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11790879_11790880insT								GREB1 (7967 upstream) : NTSR2 (7425 downstream)																							GCCATGCTTTCTTGCAAGCTAT	0.421													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15043743	15043743	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15043743delC								FAM84A (252810 upstream) : NBAS (263289 downstream)																							GTATCACTATCCCCAGAACCA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18537866	18537866	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18537866delT								KCNS3 (423642 upstream) : NT5C1B (198125 downstream)																							ctgaATGTTCTTCTACTCCCA	0.104													4	2	---	---	---	---	
POMC	5443	broad.mit.edu	37	2	25384885	25384885	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25384885delT	uc002rfy.1	-						POMC_uc002rfz.1_Intron|POMC_uc002rga.1_Intron	NM_001035256	NP_001030333	P01189	COLI_HUMAN	proopiomelanocortin preproprotein						cell-cell signaling|cellular nitrogen compound metabolic process|cellular pigmentation|generation of precursor metabolites and energy|hormone biosynthetic process|negative regulation of tumor necrosis factor production|neuropeptide signaling pathway|peptide hormone processing|positive regulation of transcription from RNA polymerase II promoter|regulation of appetite|regulation of blood pressure	extracellular space|stored secretory granule	hormone activity|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Hydrocortisone(DB00741)|Loperamide(DB00836)|Trilostane(DB01108)	TGCAACACACTTCCCATCCCA	0.507													4	2	---	---	---	---	
DTNB	1838	broad.mit.edu	37	2	25611012	25611019	+	Intron	DEL	TCTTGTCC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25611012_25611019delTCTTGTCC	uc002rgh.2	-						DTNB_uc002rgg.2_Intron|DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgp.1_Intron	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGCAGGAATCTTGTCCGTGTTTGCAC	0.514													17	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	28893060	28893061	+	IGR	INS	-	G	G	rs141997029	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28893060_28893061insG								PLB1 (26447 upstream) : PPP1CB (81551 downstream)																							ttgagagaagagagatggatgg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41796971	41796971	+	IGR	DEL	G	-	-	rs148493166	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41796971delG								None (None upstream) : PKDCC (478190 downstream)																							ATCTTTGCCTGGGAAAAGCAT	0.408													4	2	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43596292	43596292	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43596292delG	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTACTAAATTGCTCAGTCTCC	0.438													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47149674	47149675	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47149674_47149675insT	uc002rvm.2	+						MCFD2_uc010fba.2_Intron|MCFD2_uc010yof.1_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ctcagggaaaatttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	47501640	47501640	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47501640delG	uc002rvu.1	-											Homo sapiens cDNA FLJ37024 fis, clone BRACE2010837.									p.?(1)									cactggatgtggggcaggtat	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	49116355	49116356	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49116355_49116356delTG								LHCGR (133475 upstream) : FSHR (73297 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.342													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50542309	50542309	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50542309delT	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATATGTGAGCTTTTTTTTCCC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52849244	52849244	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52849244delT								None (None upstream) : None (None downstream)																							CTACAGTTCCTTTTTTAAAAG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57794784	57794784	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57794784delC								None (None upstream) : VRK2 (340002 downstream)																							CCCTCCTCCACCCCAACACTT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60158039	60158039	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60158039delG								None (None upstream) : BCL11A (520264 downstream)																							agcaggagctggagtgatgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	75166705	75166708	+	IGR	DEL	CTGT	-	-	rs34867108		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75166705_75166708delCTGT								HK2 (46231 upstream) : POLE4 (19067 downstream)																							CACTCACTGACTGTCTGGGTGGTG	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	76136128	76136128	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76136128delT								C2orf3 (198017 upstream) : LRRTM4 (838730 downstream)																							taagatcctgtttttgcctgt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	83218215	83218215	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83218215delA								None (None upstream) : None (None downstream)																							TTGCATTCTTATGCTTAGTAA	0.318													4	2	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85787730	85787730	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85787730delA	uc002sps.2	-						GGCX_uc010yss.1_5'Flank|GGCX_uc010yst.1_Intron	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	ccgtctaaggaaaaaaaaaaa	0.174													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89168935	89168936	+	Intron	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89168935_89168936delAG	uc010ytr.1	-											Parts of antibodies, mostly variable regions.																		CTGAGAagaaagagagagagag	0.307													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91780070	91780070	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91780070delT								None (None upstream) : LOC654342 (25122 downstream)																							cctttttttcttttttttgag	0.005													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91813677	91813677	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91813677delT	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						TTAAATGTACTTTTAATGTAT	0.194													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91828280	91828281	+	Intron	INS	-	T	T	rs146552335	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91828280_91828281insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						tctattctctatatGGGCCTCA	0.262													6	3	---	---	---	---	
KCNIP3	30818	broad.mit.edu	37	2	95979683	95979684	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95979683_95979684delAC	uc002sup.2	+							NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1						apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		acacacacatacacacacacac	0.292													4	2	---	---	---	---	
VWA3B	200403	broad.mit.edu	37	2	98775174	98775174	+	Intron	DEL	G	-	-	rs11297362		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98775174delG	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6						ACCGTTTCCTGGGGGTGGTGG	0.612													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103823380	103823381	+	IGR	DEL	AA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103823380_103823381delAA								TMEM182 (389244 upstream) : None (None downstream)																							ACATAAAACTAAAAGCAGCACA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104778805	104778805	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104778805delA								None (None upstream) : LOC150568 (272000 downstream)																							ataacaacttaaaaaaaaaaa	0.045													4	4	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	109858566	109858568	+	Intron	DEL	CGC	-	-	rs13426149		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109858566_109858568delCGC	uc010ywt.1	+							NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						CTCCTCTGTTCGCCTCCTGTTTT	0.557													3	3	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125358553	125358553	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125358553delT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		atcagtcacctttgcaagtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126293017	126293018	+	IGR	INS	-	CAAG	CAAG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126293017_126293018insCAAG								CNTNAP5 (620156 upstream) : None (None downstream)																							aacaaaacaaaCAAACAAACAC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127056534	127056534	+	IGR	DEL	G	-	-	rs360259	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127056534delG								None (None upstream) : GYPC (357150 downstream)																							tgacagggaagaaaaaaagca	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130268201	130268201	+	IGR	DEL	T	-	-	rs149261095		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130268201delT								None (None upstream) : LOC389033 (412234 downstream)																							aactcaagactgctatctggc	0.090													3	4	---	---	---	---	
MCM6	4175	broad.mit.edu	37	2	136626526	136626526	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136626526delA	uc002tuw.2	-							NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	ATTTATGTTTAAAAAAAAAAT	0.299													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	149280167	149280167	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149280167delC								MBD5 (9125 upstream) : EPC2 (122393 downstream)																							AAGTTTCTATCCAAATATATT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153732570	153732570	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153732570delT								ARL6IP6 (114803 upstream) : RPRM (601282 downstream)																							ttccagagactaggtcttaca	0.000													3	6	---	---	---	---	
GPD2	2820	broad.mit.edu	37	2	157437676	157437676	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157437676delT	uc002tzf.3	+						GPD2_uc010zch.1_Intron|GPD2_uc002tzd.3_Intron|GPD2_uc002tze.1_Intron	NM_001083112	NP_001076581	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2,						cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1						TCTTGTAGAGTTTTTTTTTTA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	158089516	158089516	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158089516delT								GPD2 (619269 upstream) : GALNT5 (24824 downstream)																							tacccttgacttttttttttt	0.000													1	5	---	---	---	---	
CCDC148	130940	broad.mit.edu	37	2	159061241	159061241	+	Intron	DEL	T	-	-	rs34562513		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159061241delT	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148											ovary(2)	2						tacttgactcTGTCCAAATTC	0.119													6	3	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159992511	159992512	+	Intron	DEL	TT	-	-	rs72041397		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992511_159992512delTT	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TGTACTGAAATTTtgtgtgtgt	0.376													5	6	---	---	---	---	
PLA2R1	22925	broad.mit.edu	37	2	160833042	160833045	+	Intron	DEL	ATTA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160833042_160833045delATTA	uc002ube.1	-						PLA2R1_uc010zcp.1_Intron|PLA2R1_uc002ubf.2_Intron	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor						endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						GACTACATTTATTAATTATTAATT	0.289													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	169902916	169902916	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169902916delA								ABCB11 (15083 upstream) : DHRS9 (18383 downstream)																							gtccacacacaaaaaaaaaac	0.005													4	2	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172692698	172692700	+	Intron	DEL	AGG	-	-	rs149731455		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172692698_172692700delAGG	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TGAAACGTGTAGGAGAAAGTGAC	0.374													1	5	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174090636	174090637	+	Intron	INS	-	A	A	rs67401411		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174090636_174090637insA	uc002uhz.2	+						ZAK_uc002uhy.2_3'UTR|ZAK_uc010zei.1_3'UTR|uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			ATTCCACAATTAAAAAAAAAAA	0.327													3	3	---	---	---	---	
ATF2	1386	broad.mit.edu	37	2	175995090	175995090	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175995090delA	uc002ujl.2	-						ATF2_uc010fqv.2_Intron|ATF2_uc002ujv.2_Intron|ATF2_uc002ujm.2_Intron|ATF2_uc002ujn.2_Intron|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_Intron|ATF2_uc002ujq.2_Intron|ATF2_uc002ujr.2_Intron|ATF2_uc010fqu.2_Intron|ATF2_uc002ujs.2_Intron|ATF2_uc002ujt.2_Intron|ATF2_uc002uju.2_Intron|ATF2_uc002ujw.1_Intron|ATF2_uc002ujx.1_Intron|ATF2_uc002ujy.1_Intron	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)			CTTTCTTATTATGAGAGTAGA	0.274													4	2	---	---	---	---	
ATP5G3	518	broad.mit.edu	37	2	176047763	176047764	+	5'Flank	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176047763_176047764insG	uc002ujz.3	-						ATP5G3_uc002uka.3_5'Flank|ATP5G3_uc002ukb.1_5'Flank	NM_001002258	NP_001002258	P48201	AT5G3_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.147)			TAGATCCTCCAGGGGAAAAAAT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176225313	176225313	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176225313delT								ATP5G3 (178823 upstream) : KIAA1715 (565097 downstream)																							TTTTGTGATCTTTAGATTGTG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	178422615	178422615	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178422615delA								TTC30B (5091 upstream) : TTC30A (56412 downstream)																							agaataattcaagggtacagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	182627034	182627035	+	IGR	DEL	TT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182627034_182627035delTT								CERKL (81653 upstream) : SSFA2 (129437 downstream)																							GAAACCACACTTTTTTTTAGGG	0.391													4	2	---	---	---	---	
MYO1B	4430	broad.mit.edu	37	2	192206500	192206500	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192206500delT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002uss.1_Intron	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			TAAAATGGGCTTCCTCACTTA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192793663	192793664	+	IGR	DEL	CA	-	-	rs67177416		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192793663_192793664delCA								SDPR (81682 upstream) : TMEFF2 (21085 downstream)																							ATTCAGAATTcacacacacaca	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	198658357	198658357	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198658357delA								BOLL (7419 upstream) : PLCL1 (11069 downstream)																							agaggattccagggatgtaga	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204873200	204873200	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204873200delT								ICOS (46904 upstream) : PARD3B (537316 downstream)																							cctgtatttctttttccccag	0.020													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206455105	206455105	+	Intron	DEL	C	-	-	rs11284868		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206455105delC	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		aggcttacttccccctcttct	0.000													2	4	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209551975	209551976	+	Intron	DEL	AA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209551975_209551976delAA	uc010fuo.1	+									P49190	PTH2R_HUMAN	Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		tccagctattaagtctagcatc	0.000													4	2	---	---	---	---	
PECR	55825	broad.mit.edu	37	2	216913759	216913759	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216913759delA	uc002vft.2	-						PECR_uc010zjq.1_Intron|PECR_uc002vfr.2_Intron|PECR_uc002vfs.2_Intron	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	ACAAACTAACAAAAAAAATGC	0.348													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218330736	218330737	+	Intron	DEL	CC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218330736_218330737delCC	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						tcaatttcttccaaatcatttc	0.173													4	2	---	---	---	---	
DES	1674	broad.mit.edu	37	2	220286392	220286392	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220286392delT	uc002vll.2	+							NM_001927	NP_001918	P17661	DESM_HUMAN	desmin						cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTGGAAACAAttttttttttt	0.289													6	4	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230674994	230674994	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230674994delA	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACTTAAGTCTAAGGATTGAGA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	231429115	231429117	+	IGR	DEL	AGG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231429115_231429117delAGG								SP100 (18798 upstream) : CAB39 (148440 downstream)																							gtctttggaaaggaggaggagtc	0.000													3	4	---	---	---	---	
NMUR1	10316	broad.mit.edu	37	2	232390679	232390680	+	Intron	INS	-	CA	CA	rs141246136	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232390679_232390680insCA	uc002vry.3	-							NM_006056	NP_006047	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|calcium ion transport|calcium-mediated signaling|chloride transport|smooth muscle contraction	integral to plasma membrane|membrane fraction	neuromedin U receptor activity			lung(3)|central_nervous_system(1)|pancreas(1)	5		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		acacacacatgcacacacacac	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235084685	235084685	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235084685delT								SPP2 (98909 upstream) : ARL4C (317003 downstream)																							gctcgctttctttttttTGAT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236012934	236012935	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236012934_236012935delAC								SH3BP4 (48578 upstream) : AGAP1 (389801 downstream)																							CAATTAAACAACACACACACAC	0.262													3	3	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236450862	236450862	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236450862delG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						AGTGGGTCCCGGGGGGGGGCC	0.527													6	4	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236580589	236580589	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236580589delG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						GGGGGATTCTGGGGGTGGAAG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	240439302	240439303	+	IGR	DEL	GA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240439302_240439303delGA								HDAC4 (115956 upstream) : NDUFA10 (460855 downstream)																							GAGGCTGGGGgagagagagaga	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241171082	241171084	+	IGR	DEL	AGC	-	-	rs35338605		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241171082_241171084delAGC								OTOS (91009 upstream) : GPC1 (204031 downstream)																							CCTGATTGAGAGCAGAGGTGGTC	0.567													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241418451	241418451	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241418451delC								GPC1 (10957 upstream) : ANKMY1 (388 downstream)																							TCCAGGCCCTCCTTCCTCTCA	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242484881	242484884	+	IGR	DEL	ATGG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242484881_242484884delATGG								STK25 (35921 upstream) : BOK (13308 downstream)																							GAGTAGCAAAATGGATGAAGATGA	0.436													2	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242960098	242960098	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242960098delA								C2orf85 (144616 upstream) : LOC728323 (70746 downstream)																							cctgtctcagaaaaaaaagaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5262974	5262975	+	IGR	DEL	CT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5262974_5262975delCT								EDEM1 (1325 upstream) : None (None downstream)																							atagcccatactcaggatagtt	0.114													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191528	10191529	+	Frame_Shift_Ins	INS	-	TT	TT			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191528_10191529insTT	uc003bvc.2	+	3	734_735	c.521_522insTT	c.(520-522)AATfs	p.N174fs	VHL_uc003bvd.2_Frame_Shift_Ins_p.N133fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	174					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.N174fs*28(2)|p.N174fs*41(1)|p.P172fs*39(1)|p.N174D(1)|p.Y175fs*28(1)|p.E173fs*26(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AAGCCTGAGAATTACAGGAGAC	0.530		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				88	61	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	18548692	18548693	+	IGR	INS	-	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18548692_18548693insC								SATB1 (68440 upstream) : KCNH8 (641324 downstream)																							CTGTTTTGCCACCCCCTAAGAA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	26784635	26784636	+	IGR	INS	-	C	C	rs142870835	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26784635_26784636insC								LRRC3B (32372 upstream) : NEK10 (367759 downstream)																							gcacacagataattcagccagc	0.000													5	3	---	---	---	---	
RBMS3	27303	broad.mit.edu	37	3	29354448	29354448	+	Intron	DEL	C	-	-	rs17023239	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29354448delC	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				TTCACGTGTACCCCATCATTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	45328465	45328465	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45328465delG								TMEM158 (60651 upstream) : LARS2 (101610 downstream)																							agacagtgatggtggcagggg	0.000													4	2	---	---	---	---	
DHX30	22907	broad.mit.edu	37	3	47868572	47868572	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47868572delG	uc003cru.2	+						DHX30_uc003crs.2_Intron|DHX30_uc003crt.2_Intron|DHX30_uc010hjr.1_Intron	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30							mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GAGATTGGGCGGAGAAGAGGA	0.493													4	2	---	---	---	---	
ZNF717	100131827	broad.mit.edu	37	3	75788507	75788507	+	Intron	DEL	A	-	-	rs33942133		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75788507delA	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695	C9JSV9	C9JSV9_HUMAN	zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						CTGAAATGAGAAAAAAGGTAT	0.358													6	4	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	96870097	96870097	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96870097delT	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						ttctttgtagtttttcctttt	0.000													4	2	---	---	---	---	
DCBLD2	131566	broad.mit.edu	37	3	98545008	98545009	+	Intron	INS	-	A	A	rs140022428	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98545008_98545009insA	uc003dtd.2	-						DCBLD2_uc003dte.2_Intron	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2						cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						TGGCTTTGGTTAAAAAAAAAGC	0.361													4	3	---	---	---	---	
BBX	56987	broad.mit.edu	37	3	107360383	107360383	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107360383delT	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TTTCTTATACTTTTTTTTGGA	0.368													2	4	---	---	---	---	
KIAA2018	205717	broad.mit.edu	37	3	113391360	113391360	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113391360delA	uc003eam.2	-						KIAA2018_uc003eal.2_5'Flank	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717						regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						TTTATACAGCAAAAAAAAATC	0.299													7	4	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115378910	115378910	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115378910delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		TCATGAAGGGTTTGTTACTGC	0.403													4	2	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	115676295	115676295	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115676295delT	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CCATCACCTATTTTTTTTTTA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117111298	117111299	+	IGR	DEL	CT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117111298_117111299delCT								LOC285194 (675413 upstream) : None (None downstream)																							ctctctgttgctctctctctct	0.248													4	2	---	---	---	---	
SEC22A	26984	broad.mit.edu	37	3	122964515	122964515	+	Intron	DEL	A	-	-	rs138937782		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122964515delA	uc003ege.2	+						SEC22A_uc003egf.2_Intron	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)		accctgTCTCAAAAAAAAAGG	0.119													9	5	---	---	---	---	
RUVBL1	8607	broad.mit.edu	37	3	127830308	127830308	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127830308delC	uc003ekh.2	-						RUVBL1_uc003ekf.2_Intron|RUVBL1_uc010hss.2_Intron	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1						cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		tttctttcagccccacatcta	0.055													4	2	---	---	---	---	
TMEM108	66000	broad.mit.edu	37	3	132951008	132951008	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132951008delC	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_Intron|TMEM108_uc003epk.2_Intron	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4						tctgatccctccaagtctaat	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135223626	135223626	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135223626delC								EPHB1 (244321 upstream) : PPP2R3A (460941 downstream)																							GGATCGTCCACAGACAGGCGG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137569985	137569986	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137569985_137569986insA								SOX14 (85589 upstream) : CLDN18 (147672 downstream)																							aatagttaaacaaaatggagtt	0.059													4	2	---	---	---	---	
RBP2	5948	broad.mit.edu	37	3	139184416	139184416	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139184416delG	uc003eth.2	-							NM_004164	NP_004155	P50120	RET2_HUMAN	retinol binding protein 2, cellular						epidermis development|retinoid metabolic process|steroid metabolic process|vitamin A metabolic process	cytosol	retinal binding|retinol binding|transporter activity			skin(1)	1					Vitamin A(DB00162)	CCCAAGCTCTGGGGTAGCCCA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140907338	140907338	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140907338delA								SPSB4 (39886 upstream) : ACPL2 (43344 downstream)																							ACTGGGGAGTAATGGCCCATC	0.577													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143203354	143203354	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143203354delC	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						CGTGTGATGACCTCACCTGAT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144130570	144130571	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144130570_144130571delTG								C3orf58 (419361 upstream) : None (None downstream)																							tctctgtgtatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
CPA3	1359	broad.mit.edu	37	3	148586470	148586470	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148586470delA	uc003ewm.2	+							NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor						proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TGAAGTCCTTAAAAAAAAAAA	0.318													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148651997	148651997	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148651997delG								CPA3 (37127 upstream) : GYG1 (57378 downstream)																							CTTCATATGTGGGATGATTTG	0.498													4	2	---	---	---	---	
TM4SF1	4071	broad.mit.edu	37	3	149092998	149092998	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149092998delA	uc003exb.1	-						TM4SF1_uc003exc.1_Intron	NM_014220	NP_055035	P30408	T4S1_HUMAN	transmembrane 4 superfamily member 1							integral to plasma membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			tctctgggggaaaaaaaaaga	0.164													6	3	---	---	---	---	
C3orf16	389161	broad.mit.edu	37	3	149513587	149513588	+	5'Flank	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149513587_149513588delGT	uc003exl.2	-						C3orf16_uc011bnt.1_5'Flank	NM_001144960	NP_001138432	E9PHT4	E9PHT4_HUMAN	hypothetical protein LOC389161												0						tttacaaatggtgaacatagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155088213	155088213	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155088213delG								MME (186695 upstream) : PLCH1 (109458 downstream)																							ccaaagccaaggacaaaggca	0.294													4	2	---	---	---	---	
PPM1L	151742	broad.mit.edu	37	3	160747273	160747273	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160747273delT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ATGAAACCACTTTTAAACTTT	0.303													4	2	---	---	---	---	
SI	6476	broad.mit.edu	37	3	164757421	164757421	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164757421delT	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GATAATACAGTTTTTTTTTTC	0.244										HNSCC(35;0.089)			3	4	---	---	---	---	
LAMP3	27074	broad.mit.edu	37	3	182867812	182867812	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182867812delA	uc003flh.3	-							NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3						cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TGGGGAATGGAATGAATAAGG	0.512													4	2	---	---	---	---	
ECE2	9718	broad.mit.edu	37	3	183993158	183993159	+	Intron	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183993158_183993159delTG	uc003fni.3	+						ECE2_uc011brg.1_5'Flank|ECE2_uc011brh.1_5'Flank|ECE2_uc003fnl.3_5'Flank|ECE2_uc003fnm.3_5'Flank|ECE2_uc003fnk.3_5'Flank|ECE2_uc011bri.1_5'Flank|ECE2_uc010hxv.2_5'Flank	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGTGTAGGCTGTGTGTGTGTG	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186317426	186317426	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186317426delT								DNAJB11 (13838 upstream) : AHSG (13424 downstream)																							GACCACTCCCTTCTTCAGGGC	0.522													4	2	---	---	---	---	
ATP13A4	84239	broad.mit.edu	37	3	193130419	193130420	+	Intron	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193130419_193130420delAG	uc003ftd.2	-						ATP13A4_uc010hzi.2_Intron	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		agagagagacagagagagagaT	0.257													2	4	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193404148	193404149	+	Intron	INS	-	CTT	CTT	rs145971924	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193404148_193404149insCTT	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		ATTGATGCCTCCTTCTGTAACA	0.406													4	2	---	---	---	---	
NCBP2	22916	broad.mit.edu	37	3	196664216	196664216	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196664216delA	uc003fxd.1	-						NCBP2_uc003fxb.1_Intron|NCBP2_uc011btz.1_Intron|NCBP2_uc003fxc.1_Intron|NCBP2_uc003fxe.1_Intron|NCBP2_uc003fxf.2_3'UTR	NM_007362	NP_031388	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa						gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of RNA export from nucleus|positive regulation of viral transcription|regulation of translational initiation|snRNA export from nucleus|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm	nucleotide binding|protein binding|RNA 7-methylguanosine cap binding				0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		TTCACGGTTTAAAAAAAAAAT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3607512	3607513	+	IGR	INS	-	C	C	rs144084479	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607512_3607513insC								LRPAP1 (73288 upstream) : ADRA2C (160562 downstream)																							GGAATGGCAGGAGGCTGCGTGC	0.629													3	3	---	---	---	---	
LOC348926	348926	broad.mit.edu	37	4	3951121	3951122	+	Intron	INS	-	TGTC	TGTC	rs71636744		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3951121_3951122insTGTC	uc011bvu.1	-						LOC348926_uc003ghn.2_Intron	NR_024253				Homo sapiens hypothetical protein LOC348926, mRNA (cDNA clone IMAGE:4546485), partial cds.												0						cgttttcACTTTGTGCAGGAAG	0.297													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7737270	7737270	+	Intron	DEL	G	-	-	rs11307451		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7737270delG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						gagctgaactggagaatctgg	0.259													2	4	---	---	---	---	
CLNK	116449	broad.mit.edu	37	4	10535006	10535006	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10535006delC	uc003gmo.3	-						CLNK_uc003gmp.2_Intron	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						TGTTCCACTTCCCCAGTTCTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14437091	14437091	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14437091delA								BOD1L (807763 upstream) : CPEB2 (568431 downstream)																							ccatctctacaaaaaaatgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19493837	19493837	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19493837delA								None (None upstream) : SLIT2 (761398 downstream)																							tttgcttggtaaaacaatcac	0.109													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21454043	21454043	+	Intron	DEL	G	-	-	rs34189364		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21454043delG	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				ACTGCTCAGTGggttgggggc	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	23350572	23350572	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23350572delT								GBA3 (529381 upstream) : PPARGC1A (443073 downstream)																							aagatacacctgcaatgtggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24280616	24280619	+	IGR	DEL	TGTT	-	-	rs146418529		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24280616_24280619delTGTT								PPARGC1A (388916 upstream) : MIR573 (241196 downstream)																							AAATAGAAACTGTTTGTTCCTGGA	0.456													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24302672	24302672	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24302672delA								PPARGC1A (410972 upstream) : MIR573 (219143 downstream)																							aaagagaaggaaaaaaaaaat	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31393946	31393946	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31393946delT								PCDH7 (245525 upstream) : None (None downstream)																							CTTTTGGGCATTTTTTCTGAT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37215901	37215902	+	IGR	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37215901_37215902delGT								MIR1255B-1 (787851 upstream) : KIAA1239 (30788 downstream)																							GGGAAAAAAGGTGTGAAGAAAG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38196382	38196382	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38196382delT								TBC1D1 (55589 upstream) : FLJ13197 (417940 downstream)																							GAGAGATTGGTTTTTTTTCAC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	41712833	41712833	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41712833delA								LIMCH1 (10774 upstream) : PHOX2B (33267 downstream)																							gtttttgtttAATTGTTAGAC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49237605	49237606	+	5'Flank	DEL	AT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49237605_49237606delAT	uc003gyy.2	-											DQ587539																		CTGAACTGACATGTGTATATAC	0.371													2	9	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54731909	54731910	+	Intron	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54731909_54731910insG	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	tgtatagatgaggaaactgaaa	0.000			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	55698249	55698249	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55698249delG								KIT (91370 upstream) : KDR (246178 downstream)																							cctagcatatggtcagtttcc	0.010													4	2	---	---	---	---	
KDR	3791	broad.mit.edu	37	4	55981760	55981761	+	Intron	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55981760_55981761delTG	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	tgtgtgtgtatgtgtgtgtgtg	0.277			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56179421	56179421	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56179421delT								KDR (187659 upstream) : SRD5A3 (32988 downstream)																							AACAAATGTGTTTTTTTCCCC	0.249													4	2	---	---	---	---	
KIAA1211	57482	broad.mit.edu	37	4	57045430	57045431	+	Intron	DEL	TT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57045430_57045431delTT	uc003hbk.2	+							NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GTTCTTAATGTTTTTTTTTTTT	0.401													3	4	---	---	---	---	
SLC4A4	8671	broad.mit.edu	37	4	72400304	72400304	+	Intron	DEL	A	-	-	rs71673479		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72400304delA	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			TTTAAATCTGAAAAAAAAAAA	0.328													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76644062	76644063	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76644062_76644063insA								G3BP2 (45395 upstream) : USO1 (5766 downstream)																							tggagctagagaaaaaaaaaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78542464	78542464	+	IGR	DEL	T	-	-	rs78067057		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78542464delT								CXCL13 (9478 upstream) : CNOT6L (92078 downstream)																							ttttgttttgttttttttttt	0.294													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80309455	80309456	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80309455_80309456insT								NAA11 (62284 upstream) : GK2 (18052 downstream)																							TGCTTTTTAAATTTTTTTTGAG	0.302													4	2	---	---	---	---	
FAM13A	10144	broad.mit.edu	37	4	89671194	89671195	+	Intron	DEL	CC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89671194_89671195delCC	uc003hse.1	-						FAM13A_uc003hsa.1_Intron|FAM13A_uc003hsb.1_Intron|FAM13A_uc003hsd.1_Intron|FAM13A_uc003hsc.1_Intron|FAM13A_uc011cdq.1_Intron|FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsg.1_Intron|FAM13A_uc010ikr.1_Intron	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						CAGCCTCTCTCCTCTTGAATAA	0.505													12	8	---	---	---	---	
SNCA	6622	broad.mit.edu	37	4	90756027	90756027	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90756027delT	uc003hsq.2	-						SNCA_uc010ikt.2_Intron|SNCA_uc003hso.2_Intron|SNCA_uc003hsp.2_Intron|SNCA_uc003hsr.2_Intron|uc003hss.1_5'Flank	NM_001146054	NP_001139526	P37840	SYUA_HUMAN	alpha-synuclein isoform NACP140						activation of caspase activity|anti-apoptosis|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	Melatonin(DB01065)	AAGGTGGAACTTTAGGAACAA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	94825153	94825154	+	IGR	INS	-	G	G	rs141734489	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94825153_94825154insG								ATOH1 (74011 upstream) : SMARCAD1 (303605 downstream)																							ACAACAAGCCTGTGGTCAGACA	0.465													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101131163	101131163	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101131163delG								DDIT4L (19550 upstream) : EMCN (185337 downstream)																							TACTTAGCCTGGGAGTCCCAG	0.423													4	2	---	---	---	---	
PAPSS1	9061	broad.mit.edu	37	4	108557194	108557194	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108557194delT	uc003hyk.2	-							NM_005443	NP_005434	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		TTAAACAGTATTATACTACTT	0.353													4	2	---	---	---	---	
RRH	10692	broad.mit.edu	37	4	110756944	110756944	+	Intron	DEL	T	-	-	rs71595523		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110756944delT	uc003hzv.2	+							NM_006583	NP_006574	O14718	OPSX_HUMAN	peropsin						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		cttaaatgtctttttttTTTT	0.159													8	5	---	---	---	---	
ALPK1	80216	broad.mit.edu	37	4	113261015	113261015	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113261015delG	uc003iap.3	+						ALPK1_uc003iam.2_Intron|ALPK1_uc011cfw.1_Intron|ALPK1_uc003ian.3_Intron|ALPK1_uc011cfx.1_Intron|ALPK1_uc003iao.3_Intron	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1								ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CAGAAGGTGTGGTTAGCACTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	116541049	116541050	+	IGR	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116541049_116541050delGT								NDST4 (506017 upstream) : MIR1973 (679831 downstream)																							acatacacacgtatacacatat	0.134													4	2	---	---	---	---	
PRDM5	11107	broad.mit.edu	37	4	121673853	121673853	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121673853delA	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						AATAATAGGCAAAAAAATGCA	0.149													4	2	---	---	---	---	
SPATA5	166378	broad.mit.edu	37	4	123965269	123965269	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123965269delC	uc003iez.3	+							NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						aaatcttgatcccacttgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	125056472	125056472	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125056472delG								LOC285419 (204954 upstream) : ANKRD50 (528996 downstream)																							GATTCTTGCAGTATTAACTCA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131432974	131432974	+	IGR	DEL	T	-	-	rs111493316		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131432974delT								None (None upstream) : None (None downstream)																							attcataaacttttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149948860	149948860	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149948860delC								NR3C2 (585217 upstream) : None (None downstream)																							gctgggatggcccttcaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156214104	156214104	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156214104delA								NPY2R (75878 upstream) : MAP9 (49710 downstream)																							ccaggtaaagaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	178202096	178202096	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178202096delA								VEGFC (488201 upstream) : NEIL3 (28895 downstream)																							GCATGTTACCAAAAAAAAAAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185509030	185509030	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185509030delT								IRF2 (113304 upstream) : CASP3 (39822 downstream)																							TTGTTTTTTgttttttttgtg	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189296527	189296527	+	IGR	DEL	G	-	-	rs140775290		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189296527delG								TRIML1 (227878 upstream) : None (None downstream)																							gattgacgctgggaaatgaag	0.000													2	6	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190865262	190865270	+	Intron	DEL	GTTGATGGT	-	-	rs112856018	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190865262_190865270delGTTGATGGT	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		cttgccaagagttgatggtgttatcagtc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4981017	4981017	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4981017delG								None (None upstream) : LOC340094 (53455 downstream)																							tgactttggtgggcctgaagc	0.000													4	2	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7493916	7493916	+	Intron	DEL	A	-	-	rs77051547	byFrequency	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7493916delA	uc003jdz.1	+							NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GATTCATCCTAAGTAAAAGAG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16406160	16406160	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16406160delA								MARCH11 (226263 upstream) : ZNF622 (45469 downstream)																							AGGAAAAAATAAAAAATTACT	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20035158	20035158	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20035158delT								CDH18 (46851 upstream) : None (None downstream)																							agctgctttctttttttctgt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23649268	23649268	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23649268delA								PRDM9 (120564 upstream) : CDH10 (837942 downstream)																							CAAGCTGTCTAAAATAACATC	0.328													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32003635	32003636	+	Intron	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32003635_32003636delCA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						cacacacacgcacacacacaca	0.223													4	2	---	---	---	---	
NIPBL	25836	broad.mit.edu	37	5	36897588	36897588	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36897588delT	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CCTCCTCCAGTTTTCCAAATA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39810285	39810285	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39810285delG								DAB2 (384950 upstream) : PTGER4 (869747 downstream)																							GTTAACTATTGGGTTTATTGA	0.299													4	2	---	---	---	---	
OXCT1	5019	broad.mit.edu	37	5	41845061	41845061	+	Intron	DEL	G	-	-	rs73750413		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41845061delG	uc003jmn.2	-							NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor						cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	aaaaaaaaaagaaccaccacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43733221	43733223	+	IGR	DEL	TCC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43733221_43733223delTCC								NNT (27554 upstream) : FGF10 (571874 downstream)																							ACAGCATCATtcctcctcctcct	0.256													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	45737611	45737611	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45737611delG								HCN1 (41391 upstream) : None (None downstream)																							GGGTGAGAGTGGGGAATCTGC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50752171	50752171	+	IGR	DEL	T	-	-	rs76402763		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50752171delT								ISL1 (61614 upstream) : None (None downstream)																							ttcagcactgtttttttttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57001935	57001935	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57001935delT								ACTBL2 (223299 upstream) : PLK2 (747877 downstream)																							GCATAACCTATTTTTTTTATT	0.408													4	2	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59329932	59329932	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59329932delG	uc003jsb.2	-						PDE4D_uc010iwj.1_Intron|PDE4D_uc003jse.1_Intron	NM_006203	NP_006194	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 2						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	GCAATGATGTGGGAGATAGGA	0.413													4	2	---	---	---	---	
FLJ37543	285668	broad.mit.edu	37	5	60981605	60981606	+	Intron	DEL	GA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60981605_60981606delGA	uc003jst.1	+						uc003jsu.1_Intron|uc010iwo.1_Intron|uc003jsv.2_Intron	NM_173667	NP_775938	Q2M2E5	CE064_HUMAN	hypothetical protein LOC285668 precursor							extracellular region					0		Lung NSC(810;0.000468)|Prostate(74;0.0283)|Breast(144;0.237)				gggagatagggagagagagaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67952528	67952528	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67952528delA								PIK3R1 (354881 upstream) : SLC30A5 (437290 downstream)																							AGATTTTAAGAAAAAATAGGA	0.448													4	2	---	---	---	---	
FAM169A	26049	broad.mit.edu	37	5	74096090	74096090	+	Intron	DEL	T	-	-	rs113346993		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74096090delT	uc003kdm.2	-						FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Intron	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049												0						TTTTTGTTTGTTTTTTTTTTG	0.284													4	4	---	---	---	---	
PAPD4	167153	broad.mit.edu	37	5	78937261	78937261	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78937261delT	uc010jae.1	+						PAPD4_uc003kgb.2_Intron|PAPD4_uc010jaf.1_Intron|PAPD4_uc003kga.2_Intron|PAPD4_uc003kfz.2_Intron	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4						histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TCACTATGTGTTTTTTTTTTT	0.303													4	4	---	---	---	---	
TMEM167A	153339	broad.mit.edu	37	5	82368091	82368091	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82368091delA	uc003khx.3	-							NM_174909	NP_777569	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A precursor							Golgi membrane|integral to membrane					0						TGGTAGAGTGAAAAAAAATTA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	83073378	83073378	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83073378delG								HAPLN1 (56482 upstream) : EDIL3 (164748 downstream)																							ATTTTCCTGAGGGGAAAAAAA	0.294													4	2	---	---	---	---	
EDIL3	10085	broad.mit.edu	37	5	83287663	83287663	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83287663delA	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		CTATCTCCCTAAAGCTCCCCT	0.463													4	2	---	---	---	---	
EDIL3	10085	broad.mit.edu	37	5	83389005	83389005	+	Intron	DEL	T	-	-	rs5869208		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83389005delT	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATCTTTCTCCTTTTTTTTTTT	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	88901871	88901872	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88901871_88901872insA								MEF2C (702002 upstream) : CETN3 (787659 downstream)																							GTAGAATCCTGAAAAAAATCAG	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	91152095	91152095	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91152095delG								LOC100129716 (435564 upstream) : None (None downstream)																							TTTCTGATGTGGGGATTTTTA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	91281426	91281426	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91281426delA								LOC100129716 (564895 upstream) : None (None downstream)																							TGAATCGTAGAAAAAAAAGTA	0.269													4	2	---	---	---	---	
MCTP1	79772	broad.mit.edu	37	5	94082757	94082757	+	Intron	DEL	T	-	-	rs75071502		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94082757delT	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kku.2_Intron	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		GGTTTCCAGCTTTTTTTTTAG	0.254													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95148524	95148524	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95148524delG								RHOBTB3 (16455 upstream) : GLRX (1030 downstream)																							CTGGGTTTGAGGCGGATAGAG	0.204													4	2	---	---	---	---	
ELL2	22936	broad.mit.edu	37	5	95234666	95234667	+	Intron	INS	-	AAAC	AAAC	rs143997177	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95234666_95234667insAAAC	uc003klr.3	-							NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		GCTTaagcaaaaaacaaacaaa	0.198													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95529054	95529055	+	IGR	INS	-	T	T	rs139799756	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95529054_95529055insT								MIR583 (114138 upstream) : PCSK1 (197064 downstream)																							AACTGTAGAGATTTaaatatga	0.144													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96199716	96199716	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96199716delT	uc003kmo.1	-											Homo sapiens cDNA FLJ37666 fis, clone BRHIP2011576.																		AAATTCTTGATTTTTTTTTAC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97080717	97080717	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97080717delA								RIOK2 (561712 upstream) : None (None downstream)																							acaaacaaacaaaaaaaaaCC	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98954904	98954905	+	IGR	DEL	TC	-	-	rs141824606		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98954904_98954905delTC								CHD1 (692666 upstream) : LOC100133050 (760304 downstream)																							GAGGTATGTGTCTGCTGTTATA	0.287													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99707784	99707784	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99707784delT								None (None upstream) : LOC100133050 (7425 downstream)																							ttaaactctattttttatgat	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	106290651	106290651	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106290651delA								None (None upstream) : EFNA5 (421940 downstream)																							tctgttttctaacaaatgtct	0.000													4	2	---	---	---	---	
APC	324	broad.mit.edu	37	5	112145693	112145693	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112145693delA	uc010jby.2	+						APC_uc011cvt.1_Intron|APC_uc003kpz.3_Intron|APC_uc003kpy.3_Intron|APC_uc010jbz.2_Intron	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli						canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		actccgtctcaaaaaaaaaag	0.000		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113026738	113026738	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113026738delT								YTHDC2 (95759 upstream) : KCNN2 (671278 downstream)																							TACACTTTAATTTTTTTTTTT	0.239													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117601033	117601033	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117601033delT								None (None upstream) : DTWD2 (571538 downstream)																							AAAGAATCTATTTTTTTTCTT	0.368													4	2	---	---	---	---	
DTWD2	285605	broad.mit.edu	37	5	118317242	118317242	+	Intron	DEL	A	-	-	rs72174792		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118317242delA	uc003ksa.2	-							NM_173666	NP_775937	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2												0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		AACTCAGCAGAAAAAAAAAAT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	120080912	120080914	+	IGR	DEL	TCT	-	-	rs113650160		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120080912_120080914delTCT								PRR16 (57950 upstream) : None (None downstream)																							CCCAGAAATCTCTTTTTTTATTC	0.330													3	3	---	---	---	---	
SRFBP1	153443	broad.mit.edu	37	5	121354816	121354816	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121354816delA	uc003kst.1	+							NM_152546	NP_689759	Q8NEF9	SRFB1_HUMAN	serum response factor binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TTATACAGATATCTTATCTAA	0.244													6	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121445530	121445530	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121445530delT								LOX (31475 upstream) : ZNF474 (19685 downstream)																							tgaggtcaggttgggggacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123355938	123355941	+	IGR	DEL	TTTG	-	-	rs72427051		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123355938_123355941delTTTG								CSNK1G3 (403476 upstream) : ZNF608 (616669 downstream)																							gacaagggtttttgtttgtttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125235487	125235487	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125235487delA								None (None upstream) : GRAMD3 (460301 downstream)																							TGGTTGTTGTAATGCAACTTG	0.383													4	2	---	---	---	---	
MARCH3	115123	broad.mit.edu	37	5	126287546	126287546	+	Intron	DEL	T	-	-	rs111789958		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126287546delT	uc003kuf.2	-						MARCH3_uc011cxc.1_Intron	NM_178450	NP_848545	Q86UD3	MARH3_HUMAN	membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)		TAGGTGtttattttttttttg	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126972794	126972794	+	IGR	DEL	T	-	-	rs11312836		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126972794delT								PRRC1 (82016 upstream) : CTXN3 (11919 downstream)																							AACAGGCTAATTTTTTTGGAG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	129573845	129573845	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129573845delA								CHSY3 (51519 upstream) : HINT1 (921030 downstream)																							gtaggagctcaaaaaaatacg	0.104													4	2	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	133997488	133997488	+	Intron	DEL	T	-	-	rs1975505		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133997488delT	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tCATTAGTAGttttttttttc	0.045													4	2	---	---	---	---	
CATSPER3	347732	broad.mit.edu	37	5	134308335	134308335	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134308335delA	uc003lag.2	+							NM_178019	NP_821138	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			gaagatggggaaaaaaaaatc	0.000													4	2	---	---	---	---	
SMAD5	4090	broad.mit.edu	37	5	135486865	135486865	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135486865delG	uc003lbj.1	+						SMAD5_uc003lbk.1_Intron|SMAD5_uc003lbl.1_Intron	NM_001001419	NP_001001419	Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway|embryonic pattern specification|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ggcatccagtggttttgaggg	0.075													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	140442131	140442132	+	IGR	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140442131_140442132delAG								PCDHB1 (8619 upstream) : PCDHB2 (32105 downstream)																							gtttcaaaaaagagagagagag	0.139													4	2	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140805454	140805454	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140805454delT	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGB8P_uc011daz.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAATCTTCTTTGGTAGTAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141188893	141188894	+	IGR	INS	-	A	A	rs13170789	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141188893_141188894insA								ARAP3 (127093 upstream) : PCDH1 (43789 downstream)																							gagagagagagggggggagatt	0.198													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141188894	141188895	+	IGR	INS	-	A	A	rs661074	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141188894_141188895insA								ARAP3 (127094 upstream) : PCDH1 (43788 downstream)																							agagagagagggggggagattg	0.198													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141209317	141209317	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141209317delC								ARAP3 (147517 upstream) : PCDH1 (23366 downstream)																							TTGTCTTCCTCCCCACCCCAA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141786830	141786831	+	IGR	DEL	TG	-	-	rs143736151		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141786830_141786831delTG								SPRY4 (82210 upstream) : FGF1 (184913 downstream)																							cctgagaggctgtgaggatgaa	0.302													4	5	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142497897	142497897	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142497897delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			caacttcttcttttttttgaa	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144027314	144027314	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144027314delT								KCTD16 (170370 upstream) : None (None downstream)																							TTCATACATATTTTTTTTTTG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144541393	144541393	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144541393delT								KCTD16 (684449 upstream) : PRELID2 (597189 downstream)																							AAAATGCTACTTTTTTTTCTA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144945689	144945689	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144945689delA								None (None upstream) : PRELID2 (192893 downstream)																							GCAGGTTACTAAGCCTCAGAA	0.274													4	2	---	---	---	---	
ABLIM3	22885	broad.mit.edu	37	5	148582883	148582884	+	Intron	DEL	AC	-	-	rs67091255		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148582883_148582884delAC	uc003lpy.2	+						ABLIM3_uc003lpz.1_Intron|ABLIM3_uc003lqa.1_Intron|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Intron|ABLIM3_uc003lqd.1_Intron|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Intron	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3						axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			catcactactaccaccataacc	0.178													1	5	---	---	---	---	
LOC728264	728264	broad.mit.edu	37	5	148804230	148804231	+	RNA	DEL	CT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148804230_148804231delCT	uc003lqq.2	+	2		c.4389_4390delCT			LOC728264_uc003lqs.2_RNA|LOC728264_uc003lqp.2_RNA					Homo sapiens cDNA FLJ44517 fis, clone UTERU3002667.												0						CTTTCTTGGGCTCTCTCTCTCT	0.554													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	150303623	150303623	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150303623delT								ZNF300 (19232 upstream) : LOC134466 (6377 downstream)																							gatcctagggtttttttatct	0.000													4	2	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150509258	150509259	+	Intron	INS	-	TTTGTTTG	TTTGTTTG	rs144537590	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150509258_150509259insTTTGTTTG	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCTTACTGTtttgtttgttt	0.163													6	3	---	---	---	---	
FAT2	2196	broad.mit.edu	37	5	150917523	150917524	+	Intron	INS	-	AA	AA			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150917523_150917524insAA	uc003lue.3	-						GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor						epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATGGAAAGACAAAGAAGAGGG	0.465													176	117	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152028427	152028428	+	Intron	INS	-	ATGAC	ATGAC	rs138016711	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152028427_152028428insATGAC	uc003luw.1	-						uc003lux.1_Intron					Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		gtaagaaattgatgagagaatg	0.025													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153810876	153810877	+	Intron	INS	-	C	C	rs148986567	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153810876_153810877insC	uc003lvi.2	-											Homo sapiens cDNA FLJ38109 fis, clone D3OST2001788.																		GATTACCACTGCCTACAGGTAA	0.450													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154603323	154603323	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154603323delC								KIF4B (205638 upstream) : SGCD (531740 downstream)																							cccatactttcccattcacag	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154659165	154659166	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154659165_154659166delTG								KIF4B (261480 upstream) : SGCD (475897 downstream)																							catgcatgcatgtgtgtgtgtg	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163306080	163306080	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163306080delG								MAT2B (359747 upstream) : None (None downstream)																							TTCTCCAATTGGGATTGTAGA	0.338													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167488637	167488637	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167488637delA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		ATTTTTGTTGAAAATGTCAGA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168018721	168018721	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168018721delG								PANK3 (12133 upstream) : SLIT3 (74351 downstream)																							tttaaaagcaggggaatgtca	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168027173	168027173	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168027173delC								PANK3 (20585 upstream) : SLIT3 (65899 downstream)																							ttctaattttccccaggtaag	0.000													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168607296	168607296	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168607296delG	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			cagtggatgtggggagagtgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168849475	168849476	+	IGR	INS	-	AG	AG	rs141253718	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168849475_168849476insAG								SLIT3 (121342 upstream) : CCDC99 (161162 downstream)																							TTTCTGAAGAAAGAGCGGCACC	0.441													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	169537398	169537398	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169537398delT								FOXI1 (670 upstream) : C5orf58 (122552 downstream)																							TGAAGCTGGATTTTTTGTTAG	0.493													4	2	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	169851027	169851027	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169851027delT	uc003map.2	+							NM_001034838	NP_001030010	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 3						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCATGATGATTTTAAAATGT	0.358													4	2	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	170012162	170012163	+	Intron	INS	-	A	A	rs148596566	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170012162_170012163insA	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGAAAAAAAAGAAAAAAAAATC	0.134													4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170597499	170597500	+	Intron	INS	-	T	T	rs140821100	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170597499_170597500insT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron|RANBP17_uc003mbb.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATTGGGCAGCATTTTTTTTTAT	0.356			T	TRD@	ALL								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170785587	170785588	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170785587_170785588delCA								TLX3 (46450 upstream) : NPM1 (28532 downstream)																							ATTTTTCCCTCAACTGCTTTAA	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172145808	172145811	+	IGR	DEL	ATGT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172145808_172145811delATGT								NEURL1B (27277 upstream) : DUSP1 (49291 downstream)																							ggatgcatggatgtatgtatgtat	0.000													3	3	---	---	---	---	
CPEB4	80315	broad.mit.edu	37	5	173351607	173351607	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173351607delT	uc003mcs.3	+						CPEB4_uc010jju.1_Intron|CPEB4_uc010jjv.2_Intron|CPEB4_uc011dfg.1_Intron|CPEB4_uc003mct.3_Intron|CPEB4_uc003mcu.3_Intron	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding								nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			tattgagggattttttttggc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173986536	173986536	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173986536delG								HMP19 (450355 upstream) : MSX2 (165039 downstream)																							TTCTAACTTTGAACCTGTTAG	0.328													4	2	---	---	---	---	
GPRIN1	114787	broad.mit.edu	37	5	176039503	176039503	+	5'Flank	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176039503delG	uc003meo.1	-							NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth							growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			cagccatggtggggggtaggt	0.000													4	2	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178655303	178655303	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178655303delT	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		atagaaaacctgaggcccaca	0.234													4	2	---	---	---	---	
MAPK9	5601	broad.mit.edu	37	5	179715588	179715588	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179715588delG	uc003mls.3	-						MAPK9_uc003mlt.3_Intron|MAPK9_uc010jlc.2_Intron|MAPK9_uc003mlv.3_Intron|MAPK9_uc011dgx.1_Intron	NM_002752	NP_002743	P45984	MK09_HUMAN	mitogen-activated protein kinase 9 isoform JNK2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTTACAGATGAGTGCAATCG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2498245	2498246	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2498245_2498246delTG								GMDS (252399 upstream) : C6orf195 (124726 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6044326	6044327	+	IGR	DEL	AC	-	-	rs140569906	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6044326_6044327delAC								NRN1 (36693 upstream) : F13A1 (99985 downstream)																							AAATGAAGAGACCCCCCCCCCA	0.381													4	2	---	---	---	---	
SSR1	6745	broad.mit.edu	37	6	7282105	7282105	+	3'UTR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7282105delT	uc003mxf.3	-	8					SSR1_uc003mxg.3_3'UTR|SSR1_uc010jny.2_3'UTR	NM_003144	NP_003135	P43307	SSRA_HUMAN	signal sequence receptor, alpha precursor						cotranslational protein targeting to membrane|positive regulation of cell proliferation	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Ovarian(93;0.0398)					AAGGAAACCATTTAGGTCTAA	0.448													4	2	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7564613	7564613	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7564613delT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATATCTTTACTTTTTAATGTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11667864	11667864	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11667864delC								TMEM170B (84108 upstream) : C6orf105 (46026 downstream)																							tgtcatgactccaacccggga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18802634	18802634	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18802634delT								MIR548A1 (230523 upstream) : None (None downstream)																							atcactaagctttttactatc	0.000													4	2	---	---	---	---	
MBOAT1	154141	broad.mit.edu	37	6	20115797	20115798	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20115797_20115798insT	uc003ncx.1	-						MBOAT1_uc011dji.1_Intron	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			CGAAGTCTCAATTTTTTTTCAA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	23434608	23434608	+	IGR	DEL	T	-	-	rs35141686		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23434608delT								HDGFL1 (863859 upstream) : NRSN1 (691806 downstream)																							CCCAAGTGGCTTTTTTTTTTG	0.378													5	3	---	---	---	---	
DCDC2	51473	broad.mit.edu	37	6	24307465	24307466	+	Intron	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24307465_24307466insA	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				AAACCTGGTCCAAAAAAAAACA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26605221	26605222	+	RNA	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26605221_26605222delCA	uc010jqm.1	+	2		c.1197_1198delCA								Homo sapiens cDNA clone IMAGE:4830894.																		CAAACACACCCACACACACACC	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29662357	29662357	+	IGR	DEL	T	-	-	rs35756998		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29662357delT								ZFP57 (13470 upstream) : HLA-F (28760 downstream)																							ttgggcaggatttttttttcc	0.000													2	5	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32547137	32547138	+	Intron	INS	-	A	A	rs143328971	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32547137_32547138insA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						CCTCTACCATCATTCtggtgtg	0.198													4	2	---	---	---	---	
FTSJD2	23070	broad.mit.edu	37	6	37410336	37410336	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37410336delG	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						cctgtccaatggggacagcaa	0.045													4	2	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	38067841	38067841	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38067841delT	uc003onx.2	+							NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						tctttttttcttttttttttt	0.174													4	3	---	---	---	---	
DAAM2	23500	broad.mit.edu	37	6	39810090	39810090	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39810090delG	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGTCTAGATGGGGGAGAAGT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	41576663	41576663	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41576663delC								FOXP4 (6542 upstream) : MDFI (28267 downstream)																							CCTCCCTGCACCCCTCCTCTA	0.567													4	2	---	---	---	---	
CNPY3	10695	broad.mit.edu	37	6	42905321	42905321	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42905321delA	uc003ota.3	+						CNPY3_uc003osy.2_Intron|CNPY3_uc003osz.2_Intron|CNPY3_uc003otc.3_Intron|CNPY3_uc003otb.3_Intron	NM_006586	NP_006577	Q9BT09	CNPY3_HUMAN	trinucleotide repeat containing 5 precursor						innate immune response	endoplasmic reticulum				ovary(1)	1	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			actccttctcaaaaaaaaaaG	0.254													6	5	---	---	---	---	
GLYATL3	389396	broad.mit.edu	37	6	49479980	49479980	+	Intron	DEL	T	-	-	rs11358799		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49479980delT	uc003ozi.2	+							NM_001010904	NP_001010904	Q5SZD4	GLYL3_HUMAN	glycine N-acyltransferase-like protein 3							mitochondrion	glycine N-acyltransferase activity				0						tacacttttcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53288201	53288201	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53288201delA								ELOVL5 (74259 upstream) : GCLC (73939 downstream)																							taaccttgccaaaatcttcat	0.030													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57487052	57487052	+	Intron	DEL	T	-	-	rs80219335		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57487052delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		agactccatctcaaaaaaaag	0.000													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57497895	57497896	+	Intron	INS	-	AG	AG	rs140446033		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57497895_57497896insAG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATAAGACAATCAGAAAAGCAAT	0.322													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57542931	57542931	+	IGR	DEL	G	-	-	rs112793267		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57542931delG								PRIM2 (29556 upstream) : GUSBL2 (703228 downstream)																							agacctgtaagataataaatg	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57562855	57562855	+	IGR	DEL	A	-	-	rs68009168		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57562855delA								PRIM2 (49480 upstream) : GUSBL2 (683304 downstream)																							aagctgtcacaaaaggagatg	0.025													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57782034	57782034	+	IGR	DEL	C	-	-	rs34726523		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57782034delC								PRIM2 (268659 upstream) : GUSBL2 (464125 downstream)																							GGATTTCTGACAAAAAAAAAA	0.428													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58674846	58674846	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58674846delT								GUSBL2 (387122 upstream) : None (None downstream)																							ttttcctccctttttatttaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	64190432	64190432	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64190432delA								LGSN (160550 upstream) : PTP4A1 (41219 downstream)																							AAAGAAAGCCAAAAAAAAAAC	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	64426572	64426572	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64426572delT								PHF3 (2167 upstream) : EYS (3304 downstream)																							gggagattcctttttttttgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	67501140	67501141	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67501140_67501141insA								None (None upstream) : None (None downstream)																							caaaaaaggagaaaaatttcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	68326083	68326083	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68326083delT								None (None upstream) : None (None downstream)																							ttataccatattttttctatg	0.070													4	2	---	---	---	---	
IMPG1	3617	broad.mit.edu	37	6	76726826	76726826	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76726826delG	uc003pik.1	-							NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1						visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				aaggcTAAATGGGGGGACAAA	0.199													4	2	---	---	---	---	
IMPG1	3617	broad.mit.edu	37	6	76744717	76744718	+	Intron	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76744717_76744718delGT	uc003pik.1	-							NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1						visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				tattatgtgcgtgtgtgtgtgt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76803820	76803821	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76803820_76803821delAC								IMPG1 (21485 upstream) : None (None downstream)																							acagaaatctacagaactgtcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	78491700	78491701	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78491700_78491701insT								HTR1B (318580 upstream) : None (None downstream)																							GGATTGTGTGCTTTTTTTTTAA	0.391													4	2	---	---	---	---	
NT5E	4907	broad.mit.edu	37	6	86172105	86172105	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86172105delT	uc003pko.3	+						NT5E_uc003pkn.2_Intron|NT5E_uc010kbr.2_Intron	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor						DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	AGCAGCATCATTTTTTTTTCT	0.488													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	91917335	91917335	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91917335delT								MAP3K7 (620428 upstream) : None (None downstream)																							agttctggacttttttttttg	0.000													4	2	---	---	---	---	
FBXL4	26235	broad.mit.edu	37	6	99340968	99340968	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99340968delT	uc003ppf.1	-						FBXL4_uc003ppg.1_Intron|FBXL4_uc003pph.1_Intron|FBXL4_uc010kcp.2_Intron	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4						ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TGACTCCAGATTTTTTTTTTC	0.388													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106798713	106798713	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106798713delT								ATG5 (25018 upstream) : AIM1 (161017 downstream)																							gtggtaattgttttatgtttg	0.030													4	2	---	---	---	---	
RTN4IP1	84816	broad.mit.edu	37	6	107020275	107020276	+	Intron	INS	-	A	A	rs146508064	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107020275_107020276insA	uc003prj.2	-						RTN4IP1_uc010kdd.2_Intron|RTN4IP1_uc003prk.2_Intron	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor							mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		GGCATTCGAAGACCAATAGCAT	0.525													4	5	---	---	---	---	
TRAF3IP2	10758	broad.mit.edu	37	6	111912795	111912796	+	Frame_Shift_Ins	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111912795_111912796insT	uc011ebc.1	-	3	1109_1110	c.494_495insA	c.(493-495)AATfs	p.N165fs	TRAF3IP2_uc003pvg.2_Frame_Shift_Ins_p.N165fs|TRAF3IP2_uc003pvf.2_Frame_Shift_Ins_p.N165fs|TRAF3IP2_uc010kdw.2_Frame_Shift_Ins_p.N165fs|TRAF3IP2_uc010kdx.2_Frame_Shift_Ins_p.N165fs	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2	174					intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CTGCTGAGGCATTAGGTAAACT	0.525													20	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114010562	114010562	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114010562delT								None (None upstream) : MARCKS (167965 downstream)																							ATTTGTTTGCTTTTTTTTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114703569	114703570	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114703569_114703570delTG								HS3ST5 (40029 upstream) : None (None downstream)																							tatgtgtatttgtgtgtgtgtg	0.327													4	2	---	---	---	---	
ARHGAP18	93663	broad.mit.edu	37	6	129997927	129997927	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129997927delA	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050	Q8N392	RHG18_HUMAN	Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		ttgggtgtggaaaaaaaaagt	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	133438588	133438588	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133438588delA								LOC285735 (10878 upstream) : EYA4 (123148 downstream)																							tcttctatgtaatttggtctg	0.179													4	2	---	---	---	---	
EYA4	2070	broad.mit.edu	37	6	133789076	133789076	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133789076delG	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CTGTAACAAAGGAGGGAAACT	0.318													4	2	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136311502	136311502	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136311502delG	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	ccaaagtgctgggattacagg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138903933	138903933	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138903933delA								NHSL1 (10265 upstream) : CCDC28A (190724 downstream)																							CCATCTCTGGAACATTTCTCA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142547307	142547307	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142547307delT								VTA1 (5224 upstream) : GPR126 (75749 downstream)																							CATGTCTGCCTTTTTTGGTCC	0.303													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144606823	144606824	+	5'Flank	INS	-	TTA	TTA	rs676859	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144606823_144606824insTTA	uc010khq.1	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTTTTTTTTTTAAATACATCGC	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	146785504	146785505	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146785504_146785505insA								GRM1 (26773 upstream) : RAB32 (79323 downstream)																							ATCTCTATTTGAAAAAAAAAAG	0.213													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152590012	152590013	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152590012_152590013insT	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATCTGAAAACAGAATAGGTAT	0.317										HNSCC(10;0.0054)			4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162036945	162036945	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162036945delC	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		AGGAAAATCACCCTCTCTCGG	0.517													4	2	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8254776	8254776	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8254776delT	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron|ICA1_uc011jxg.1_Intron|ICA1_uc003srs.1_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		CCCTACACCCTCCCACTACTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10963322	10963323	+	IGR	DEL	AC	-	-	rs36095837		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10963322_10963323delAC								None (None upstream) : NDUFA4 (9492 downstream)																							acacacacatacacacacacac	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15184115	15184115	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15184115delA								DGKB (241565 upstream) : TMEM195 (55828 downstream)																							AAAATAAGTCAAAAAAGGTGT	0.308													4	2	---	---	---	---	
SNX13	23161	broad.mit.edu	37	7	17930332	17930332	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17930332delA	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron|SNX13_uc003stx.1_Intron|SNX13_uc003sty.2_Intron			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					GCCTAGatttaaaaaaaaaaa	0.303													4	2	---	---	---	---	
SNX10	29887	broad.mit.edu	37	7	26411779	26411782	+	Intron	DEL	AATT	-	-	rs111896977		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26411779_26411782delAATT	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_Intron|SNX10_uc010kuw.2_Intron	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN	sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0						ATAATGAAAAAATTAATTGACTGA	0.211													1	8	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29276435	29276436	+	Intron	INS	-	T	T	rs28467	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29276435_29276436insT	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						tccttggctcatggccccacat	0.000													3	4	---	---	---	---	
GARS	2617	broad.mit.edu	37	7	30662266	30662267	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30662266_30662267insT	uc003tbm.2	+							NM_002047	NP_002038	P41250	SYG_HUMAN	glycyl-tRNA synthetase						cell death|diadenosine tetraphosphate biosynthetic process|glycyl-tRNA aminoacylation	cytosol|mitochondrial matrix|soluble fraction	ATP binding|glycine-tRNA ligase activity|protein dimerization activity			ovary(1)	1					Glycine(DB00145)	ATAGAATATACTTTTTTTTTTT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	36107647	36107647	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36107647delC								SEPT7 (162732 upstream) : EEPD1 (85189 downstream)																							GAAGTTCCTGCCAGTAGCTCA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	36852614	36852614	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36852614delT								AOAH (88461 upstream) : ELMO1 (41347 downstream)																							tgcccacaaattttggagcca	0.000													4	2	---	---	---	---	
NUDCD3	23386	broad.mit.edu	37	7	44484839	44484839	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44484839delG	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						CCCCTACCTTGTCCACCCTGA	0.448													4	2	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45677742	45677742	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45677742delA	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	aacaaaaaacaaaaaaaaacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46001447	46001447	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46001447delT								IGFBP3 (40576 upstream) : None (None downstream)																							ctctagcccatttttttctgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46353822	46353822	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46353822delT								IGFBP3 (392951 upstream) : TNS3 (960931 downstream)																							atttttagggttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47628303	47628303	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47628303delT								TNS3 (6561 upstream) : C7orf65 (66539 downstream)																							CACCCCTTCCTACCTTTCATG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47711713	47711713	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47711713delT								C7orf65 (10467 upstream) : PKD1L1 (102577 downstream)																							GGTATGGGAATTTTTTTTGTT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52176785	52176785	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52176785delC								COBL (792270 upstream) : POM121L12 (926564 downstream)																							ATATGGAAGACCCAGGAAATC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55282433	55282433	+	IGR	DEL	G	-	-	rs34666294		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55282433delG								EGFR (7403 upstream) : LANCL2 (150708 downstream)																							CAGATGGCTTGGGGCCACCCC	0.498													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55298042	55298042	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55298042delT								EGFR (23012 upstream) : LANCL2 (135099 downstream)																							cttatgaagcttagtttggtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55300784	55300784	+	IGR	DEL	C	-	-	rs34081786		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55300784delC								EGFR (25754 upstream) : LANCL2 (132357 downstream)																							CCTCTGGCTGCCCCCAATGTG	0.443													3	3	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71178199	71178200	+	3'UTR	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71178199_71178200delGT	uc003tvy.2	+	11					WBSCR17_uc003tvz.2_3'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				gcgtggcagggtgtgtgtgtgt	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75945112	75945112	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75945112delT								HSPB1 (11502 upstream) : YWHAG (10996 downstream)																							AGAAGTAttctttttttttta	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	76226659	76226659	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76226659delA	uc003ufs.1	+											Homo sapiens hypothetical LOC554248, mRNA (cDNA clone MGC:87732 IMAGE:5768316), complete cds.																		agaacaagacaagggtgacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	77090365	77090365	+	IGR	DEL	G	-	-	rs73145976		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77090365delG								PION (44648 upstream) : PTPN12 (76408 downstream)																							aaaaaaaaaagaaaGAAAAAA	0.199													4	2	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	78058597	78058598	+	Intron	INS	-	CTTG	CTTG	rs146085895	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78058597_78058598insCTTG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTTCTCTGGTCTTTGGTGCTAT	0.416													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79498742	79498742	+	IGR	DEL	A	-	-	rs146469666		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79498742delA								MAGI2 (415852 upstream) : GNAI1 (265398 downstream)																							TAGAGGAAGGAAAAAAAAAGA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84136420	84136421	+	IGR	INS	-	A	A	rs144554178	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84136420_84136421insA								SEMA3A (312203 upstream) : SEMA3D (488453 downstream)																							gaggaaacagtaatgacaaggc	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84970959	84970959	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84970959delC								SEMA3D (154788 upstream) : None (None downstream)																							CTTCTTCAAACCAGTGCCCCA	0.348													4	2	---	---	---	---	
GRM3	2913	broad.mit.edu	37	7	86286808	86286808	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86286808delG	uc003uid.2	+						GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor						synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GCTAGAATGTGGGATTGAATT	0.388													4	2	---	---	---	---	
SGCE	8910	broad.mit.edu	37	7	94270519	94270519	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94270519delT	uc003unl.2	-						SGCE_uc003unm.2_Intron|SGCE_uc003unn.2_Intron|SGCE_uc011kic.1_Intron|SGCE_uc011kid.1_Intron	NM_003919	NP_003910	O43556	SGCE_HUMAN	sarcoglycan, epsilon isoform 2						cell-matrix adhesion|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ggatgagagcttagaaaagac	0.000													4	2	---	---	---	---	
LMTK2	22853	broad.mit.edu	37	7	97815946	97815946	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97815946delT	uc003upd.1	+							NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GCGTACTTTCTTATCCAAGAA	0.453													6	4	---	---	---	---	
TAF6	6878	broad.mit.edu	37	7	99710906	99710906	+	Intron	DEL	A	-	-	rs75828513		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99710906delA	uc003uti.2	-						TAF6_uc003utg.2_Intron|TAF6_uc003uth.2_Intron|TAF6_uc003utk.2_Intron|TAF6_uc011kji.1_Intron|TAF6_uc003utj.2_Intron|TAF6_uc003utl.2_Intron|TAF6_uc003utm.2_Intron|TAF6_uc003utn.1_Intron	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actctgtctcaaaaaaaaaaG	0.299													11	5	---	---	---	---	
ACTL6B	51412	broad.mit.edu	37	7	100252392	100252393	+	Intron	INS	-	A	A	rs148942066		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100252392_100252393insA	uc003uvy.2	-						ACTL6B_uc003uvz.2_Intron|uc003uwa.1_5'Flank	NM_016188	NP_057272	O94805	ACL6B_HUMAN	actin-like 6B						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex|SWI/SNF complex	ATP binding|protein binding|structural constituent of cytoskeleton			ovary(1)	1	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					gagactgtgtcaaaaaaaaaaa	0.213													4	4	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100367814	100367814	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100367814delT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCGGGATTTCTTTTTTTTTTT	0.269													7	4	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105471885	105471885	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105471885delG	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						CTGGGCAACAGGTGGACAAAA	0.418													4	2	---	---	---	---	
IMMP2L	83943	broad.mit.edu	37	7	111082721	111082721	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111082721delA	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		AACAACTAACAAAAAAAACAC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121183466	121183466	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121183466delT								FAM3C (147044 upstream) : PTPRZ1 (329693 downstream)																							cctggccCTGTTTTTTTTAAA	0.035													4	2	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122308299	122308299	+	Intron	DEL	T	-	-	rs34508926		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122308299delT	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						GAAAATTCCATTTTTTTTTAC	0.348													3	3	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127380269	127380270	+	Intron	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127380269_127380270delTG	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CATGTCTGGCTGTGTGTGTGTT	0.386													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127509323	127509323	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127509323delA	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						agaaggctttagggttggagc	0.000													4	2	---	---	---	---	
LOC100128542	100128542	broad.mit.edu	37	7	150446399	150446400	+	5'Flank	INS	-	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150446399_150446400insC	uc011kuw.1	+							NM_001162367	NP_001155839			hypothetical protein LOC100128542												0						TTCTCATCAAGCCCCCTCACCT	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155852756	155852756	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155852756delG								SHH (247789 upstream) : C7orf4 (480429 downstream)																							CTGGAGGTGTGGGGGTGCCTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1227509	1227509	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1227509delA								ERICH1 (546283 upstream) : DLGAP2 (222060 downstream)																							GGAGAATTAGAAAAAAAAATG	0.403													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4228568	4228568	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4228568delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ctcttttgtgaaggctaatca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5257371	5257372	+	IGR	DEL	TG	-	-	rs35939436		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5257371_5257372delTG								CSMD1 (405043 upstream) : None (None downstream)																							GACgtgtgtctgtgtgtgtgtg	0.233													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5934526	5934527	+	IGR	DEL	AT	-	-	rs140466076		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5934526_5934527delAT								None (None upstream) : MCPH1 (329594 downstream)																							gtccacgtacatgtgtgtatct	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6872115	6872115	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6872115delG								DEFA1B (34501 upstream) : DEFA5 (40714 downstream)																							catgcactctggtacaacaat	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9163511	9163511	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9163511delG								PPP1R3B (154427 upstream) : TNKS (249934 downstream)																							AAAGTACGGTGGGGGCTCTGA	0.279													4	2	---	---	---	---	
MTMR9	66036	broad.mit.edu	37	8	11164056	11164056	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11164056delT	uc003wtm.2	+						MTMR9_uc010lrx.2_Intron|MTMR9_uc011kxa.1_Intron	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9							cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CATCTTCTCATTTTTTTTTGG	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11770937	11770938	+	IGR	INS	-	T	T	rs144505228	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11770937_11770938insT								CTSB (45291 upstream) : DEFB136 (60510 downstream)																							aaggaagaggctttttattcgg	0.005													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	16266083	16266084	+	IGR	INS	-	A	A	rs143393248	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16266083_16266084insA								MSR1 (215783 upstream) : FGF20 (584250 downstream)																							tacatttctgcaaaaaaaaaac	0.010													4	5	---	---	---	---	
CNOT7	29883	broad.mit.edu	37	8	17088040	17088040	+	3'UTR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17088040delT	uc003wxf.1	-	7					CNOT7_uc003wxg.1_3'UTR	NM_013354	NP_037486	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7						carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		CCTGAATGCGTTTTTTTTTTT	0.358													3	3	---	---	---	---	
MTMR7	9108	broad.mit.edu	37	8	17160867	17160867	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17160867delA	uc003wxm.2	-						MTMR7_uc003wxn.2_Intron|MTMR7_uc011kya.1_Intron|MTMR7_uc011kyb.1_Intron	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7								protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		AATAATTAAGAAAAAAAACCT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18288791	18288792	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18288791_18288792delTG								NAT2 (30068 upstream) : PSD3 (96022 downstream)																							CAAAAGACTCTGTGTGTGTGTC	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23787720	23787720	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23787720delA								STC1 (75400 upstream) : ADAM28 (363860 downstream)																							TTGTGGGGGGAAAAAAGTTCC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26276974	26276974	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26276974delA								BNIP3L (6330 upstream) : PNMA2 (85222 downstream)																							AACATCAACTAACAGTGTTTT	0.318													4	2	---	---	---	---	
ADRA1A	148	broad.mit.edu	37	8	26632866	26632866	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26632866delT	uc003xfh.1	-						ADRA1A_uc003xfc.1_Intron|ADRA1A_uc010lul.1_Intron|ADRA1A_uc003xfd.1_Intron|ADRA1A_uc003xfe.1_Intron|ADRA1A_uc010lum.1_Intron|ADRA1A_uc003xff.1_Intron|ADRA1A_uc003xfg.1_Intron	NM_000680	NP_000671	P35348	ADA1A_HUMAN	alpha-1A-adrenergic receptor isoform 1						activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)	CTCATTCTTCTTTTTTTTGCC	0.398													4	2	---	---	---	---	
TRIM35	23087	broad.mit.edu	37	8	27143442	27143443	+	3'UTR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27143442_27143443insA	uc003xfl.1	-	6					TRIM35_uc010lup.1_3'UTR	NM_171982	NP_741983	Q9UPQ4	TRI35_HUMAN	tripartite motif-containing 35 isoform 2						apoptosis|induction of apoptosis|negative regulation of mitotic cell cycle	cytoplasm|nucleus	zinc ion binding				0		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		TCACCACGCCCAATCCAGCCCC	0.490													4	2	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32559636	32559636	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32559636delG	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Intron|NRG1_uc010lvt.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTCCTGTTGTGGGAATACGAG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37565901	37565901	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37565901delT								ZNF703 (9505 upstream) : ERLIN2 (28196 downstream)																							caaagtcctcttttttttttc	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37854372	37854373	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37854372_37854373insA								ADRB3 (30188 upstream) : EIF4EBP1 (33647 downstream)																							ttcactcgtggaaaaaaaaatg	0.193											OREG0018717	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PLAT	5327	broad.mit.edu	37	8	42037123	42037123	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42037123delG	uc003xos.2	-						PLAT_uc010lxf.1_Intron|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Intron|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1						blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ctcagcaagtgggatttgaaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54107997	54107997	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54107997delC								NPBWR1 (254544 upstream) : OPRK1 (30279 downstream)																							TCCACCTACTCCCCACCACCT	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54580252	54580252	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54580252delA								OPRK1 (416058 upstream) : ATP6V1H (47864 downstream)																							AGGACAAGCCAAAAAAAAAAA	0.468													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57646306	57646306	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57646306delT								PENK (287024 upstream) : IMPAD1 (224185 downstream)																							TTCTTTAACCTTTTTTTTTTA	0.259													4	2	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59543849	59543849	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59543849delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TTTTAGGCACTTTTTTTTTTA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66286518	66286518	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66286518delA								CYP7B1 (575170 upstream) : ARMC1 (228554 downstream)																							aggaaggctgaagtagacatg	0.005													4	2	---	---	---	---	
C8orf46	254778	broad.mit.edu	37	8	67424310	67424311	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67424310_67424311insT	uc003xwg.2	+						C8orf46_uc003xwh.2_Intron|C8orf46_uc011let.1_Intron|C8orf46_uc003xwi.2_Intron	NM_152765	NP_689978	Q8TAG6	CH046_HUMAN	hypothetical protein LOC254778											skin(2)	2			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			caaaaaaaaaaaaaaaaaagaa	0.238													4	2	---	---	---	---	
STAU2	27067	broad.mit.edu	37	8	74635363	74635364	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74635363_74635364delAC	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Intron|STAU2_uc003xzr.2_Intron	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			acacacacatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76674556	76674557	+	IGR	INS	-	T	T	rs139259220	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76674556_76674557insT								HNF4G (195497 upstream) : LOC100192378 (848558 downstream)																							CCTACACAATATTTTTTTTTCA	0.149													4	3	---	---	---	---	
ZFHX4	79776	broad.mit.edu	37	8	77734255	77734256	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77734255_77734256delAC	uc003yav.2	+						ZFHX4_uc003yau.1_Intron|ZFHX4_uc003yaw.1_Intron	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctctCCACATACACACACATGC	0.198										HNSCC(33;0.089)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84086224	84086224	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84086224delT								None (None upstream) : None (None downstream)																							CCCAGTGACCTTTTTTTTCTT	0.348													4	2	---	---	---	---	
CNGB3	54714	broad.mit.edu	37	8	87627092	87627093	+	Intron	INS	-	TT	TT	rs140886325	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87627092_87627093insTT	uc003ydx.2	-						CNGB3_uc010maj.2_Intron	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						caaggctggagtacagccactc	0.040													4	2	---	---	---	---	
RBM12B	389677	broad.mit.edu	37	8	94745438	94745438	+	3'UTR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94745438delA	uc003yfz.2	-	3						NM_203390	NP_976324	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B								nucleotide binding|RNA binding				0	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTTAAATTTGAAAAAAAAAAA	0.284													4	2	---	---	---	---	
KIAA1429	25962	broad.mit.edu	37	8	95505220	95505221	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95505220_95505221delAC	uc003ygo.1	-						KIAA1429_uc010maz.1_Intron	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1						mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TTAAAAACAAACACACACACAC	0.332													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95626172	95626172	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95626172delA								KIAA1429 (60484 upstream) : ESRP1 (27192 downstream)																							tctctgtctcaaaaaaaaaag	0.134													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96243780	96243780	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96243780delC								PLEKHF2 (74869 upstream) : C8orf37 (14455 downstream)																							ACAGCGCACTCCCTCACTGGC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	99373350	99373350	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99373350delC								NIPAL2 (66729 upstream) : KCNS2 (65900 downstream)																							ACACTGAGTACCCCCCTTCCC	0.448													5	3	---	---	---	---	
STK3	6788	broad.mit.edu	37	8	99757896	99757898	+	Intron	DEL	AGC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99757896_99757898delAGC	uc003yip.2	-						STK3_uc003yio.2_Intron|STK3_uc010mbm.1_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		taataagcagagcagaccttttg	0.000													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106672677	106672677	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106672677delA	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GTGAAGAATGAATCCCTGCCC	0.388													4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	114374855	114374855	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114374855delT	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron|CSMD3_uc003ynx.3_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCACTCAGTATTTCCACCCTG	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117106298	117106298	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117106298delT								TRPS1 (425070 upstream) : EIF3H (550758 downstream)																							TGATTCACACTTCAGTATGAA	0.368													4	2	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121227674	121227674	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121227674delA	uc003yox.2	+						COL14A1_uc003yoy.2_Intron|COL14A1_uc010mde.1_Intron	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			aagggaggggaaaaaagaaaa	0.000													4	2	---	---	---	---	
ATAD2	29028	broad.mit.edu	37	8	124406320	124406320	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124406320delT	uc003yqh.3	-						ATAD2_uc011lii.1_Intron|ATAD2_uc003yqi.3_Intron|ATAD2_uc003yqj.2_Intron	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			caacctaaggttttttttcct	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127345825	127345825	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127345825delT								TRIB1 (895183 upstream) : FAM84B (218862 downstream)																							GTCCCGTTTCTTTAGAAATTG	0.363													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	140962577	140962578	+	Intron	DEL	TT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140962577_140962578delTT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GCACAAATACTTTTTACTTGGC	0.391													4	2	---	---	---	---	
LOC100133669	100133669	broad.mit.edu	37	8	144098980	144098981	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144098980_144098981delAC	uc011ljz.1	-						LOC100133669_uc003yxl.3_Intron|LY6E_uc003yxn.2_5'Flank|LY6E_uc003yxm.2_5'Flank|LY6E_uc003yxo.2_5'Flank	NR_026913				Homo sapiens, clone IMAGE:3342869, mRNA.												0						CAGCCTCcatacacacacacac	0.441													3	3	---	---	---	---	
DMRT1	1761	broad.mit.edu	37	9	926174	926175	+	Intron	INS	-	T	T	rs150603098	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:926174_926175insT	uc003zgv.2	+							NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CAGGTGTGGTGTTCTCTTTACA	0.361													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	3124658	3124658	+	IGR	DEL	G	-	-	rs58012187	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3124658delG								KIAA0020 (280528 upstream) : RFX3 (99991 downstream)																							ACTATACCAAGAAAAAAACAA	0.289													4	2	---	---	---	---	
GLIS3	169792	broad.mit.edu	37	9	4137592	4137594	+	Intron	DEL	TAT	-	-	rs140045882		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4137592_4137594delTAT	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron|GLIS3_uc003zib.1_Intron|GLIS3_uc010mhg.1_Intron	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		AGTAAGATGATATTATTAGGAAC	0.424													2	4	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6639246	6639246	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6639246delA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	CCACAGCCACAAAAAAAAAGA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11946835	11946835	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11946835delA								None (None upstream) : TYRP1 (746551 downstream)																							Cttccagagtaagaagatgtg	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	17827295	17827295	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17827295delT								SH3GL2 (30175 upstream) : ADAMTSL1 (646809 downstream)																							ctgatatgccttatagcaaaa	0.000													4	2	---	---	---	---	
FAM154A	158297	broad.mit.edu	37	9	18950287	18950289	+	Intron	DEL	CAG	-	-	rs150640582		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18950287_18950289delCAG	uc003zni.1	-						FAM154A_uc010mip.1_Intron	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297											pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		TCAAAATTTACAGCAGCATAATT	0.379													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	21106498	21106498	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21106498delA								IFNB1 (28555 upstream) : IFNW1 (34133 downstream)																							TTCGCTTGGGAAAGTTCTGGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25352889	25352889	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25352889delA								None (None upstream) : TUSC1 (323505 downstream)																							AGGGATTATGATGAAGTATGG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	30964560	30964561	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30964560_30964561delTG								None (None upstream) : None (None downstream)																							atatccatactgtggaatacta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32614298	32614299	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32614298_32614299delCA								NDUFB6 (41116 upstream) : TAF1L (15153 downstream)																							AAGTCACATTCACACACACACC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34152050	34152050	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34152050delT								DCAF12 (25279 upstream) : UBAP1 (26961 downstream)																							TTTTTTTTCCTTTTTTTCCCC	0.224													4	2	---	---	---	---	
DNAI1	27019	broad.mit.edu	37	9	34489849	34489849	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34489849delA	uc003zum.2	+							NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1						cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		actctgtctcaaaaaaaaaaG	0.244									Kartagener_syndrome				6	4	---	---	---	---	
TMEM8B	51754	broad.mit.edu	37	9	35834083	35834083	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35834083delT	uc003zym.2	+						TMEM8B_uc003zyk.2_Intron|TMEM8B_uc003zyl.2_Intron|TMEM8B_uc003zyn.2_Intron|TMEM8B_uc003zyo.2_Intron	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a						cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1						CACACATCTGTTTTTTTTAGG	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36787651	36787652	+	IGR	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36787651_36787652delGT								MELK (109973 upstream) : PAX5 (50879 downstream)																							TTGGTGGAGGGTGTGTGTGTGT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	37088309	37088309	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37088309delT								PAX5 (53833 upstream) : ZCCHC7 (32160 downstream)																							tttgtttttcttttttttttt	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38654531	38654531	+	IGR	DEL	A	-	-	rs141748783	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38654531delA								C9orf122 (31256 upstream) : CNTNAP3 (418235 downstream)																							ACATTCACACAGCAGTGAAGT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44109097	44109098	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44109097_44109098insA								FAM75A6 (478367 upstream) : FAM27C (881138 downstream)																							ATAAAGGTCTCAAAAATCCAGA	0.347													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44887939	44887940	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44887939_44887940delCA								None (None upstream) : FAM27C (102296 downstream)																							cacatacagccacacacacaca	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68439331	68439332	+	IGR	INS	-	C	C	rs78399630		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68439331_68439332insC								FAM27B (645142 upstream) : MIR1299 (562907 downstream)																							AGCATAGTAAtttttttttttt	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77830087	77830087	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77830087delA								OSTF1 (67974 upstream) : PCSK5 (675473 downstream)																							GTAGGAAATGAAAAAAACAAA	0.353													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79907383	79907384	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79907383_79907384insT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron|VPS13A_uc010mpo.1_5'Flank	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						agtttatcgggttttttttcct	0.059													4	2	---	---	---	---	
CEP78	84131	broad.mit.edu	37	9	80864564	80864565	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80864564_80864565insT	uc004akx.2	+						CEP78_uc004aky.3_Intron|CEP78_uc010mpp.2_Intron|CEP78_uc011lsp.1_3'UTR	NM_032171	NP_115547	Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa isoform b						G2/M transition of mitotic cell cycle	centrosome|cytosol				ovary(1)	1						CTGATATTTTCTTTTTTTTTTT	0.252													4	2	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	95036865	95036866	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95036865_95036866insT	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	CGTTAACTTTGTAACAGTTTTT	0.366													81	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97067015	97067016	+	IGR	DEL	GT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97067015_97067016delGT								ZNF169 (1724 upstream) : FAM22F (13462 downstream)																							CAAGGGAAGCGTGTGTGTGTGT	0.465													3	3	---	---	---	---	
PTCH1	5727	broad.mit.edu	37	9	98272284	98272285	+	5'Flank	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98272284_98272285insA	uc004avk.3	-						PTCH1_uc010mro.2_5'Flank|PTCH1_uc010mrp.2_5'Flank|PTCH1_uc010mrq.2_5'Flank|PTCH1_uc004avl.3_5'Flank|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron|PTCH1_uc004avo.2_Intron|PTCH1_uc010mrv.1_Intron|PTCH1_uc010mrw.1_Intron	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCCCCCAACTTAAAAAAAAAAA	0.426									Basal_Cell_Nevus_syndrome				4	5	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99006946	99006946	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99006946delA	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	tcctcaccacaaaaaaaaaac	0.000													3	3	---	---	---	---	
INVS	27130	broad.mit.edu	37	9	103026900	103026901	+	Intron	INS	-	A	A	rs150449755		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103026900_103026901insA	uc004bap.1	+						INVS_uc010mta.1_Intron|INVS_uc011lve.1_Intron|INVS_uc004bao.1_Intron|INVS_uc004baq.1_Intron|INVS_uc004bar.1_Intron|INVS_uc010mtb.1_Intron	NM_014425	NP_055240	Q9Y283	INVS_HUMAN	inversin isoform a						negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|membrane|microtubule|nucleus|spindle	calmodulin binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.056)				aactccgtctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
TMEFF1	8577	broad.mit.edu	37	9	103323993	103323993	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103323993delT	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)				AACAAAAATCTTTTTTTTTTT	0.249													6	3	---	---	---	---	
SMC2	10592	broad.mit.edu	37	9	106878840	106878843	+	Intron	DEL	ATCA	-	-	rs112423295		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106878840_106878843delATCA	uc004bbv.2	+						SMC2_uc004bbu.1_Intron|SMC2_uc004bbw.2_Intron|SMC2_uc011lvl.1_Intron|SMC2_uc004bbx.2_Intron	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2						cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						TCACATGACTATCAATCAGGTGAT	0.343													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110435860	110435860	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110435860delG								KLF4 (183813 upstream) : None (None downstream)																							CCACACAGCTGGTGTGAGACT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110708153	110708153	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110708153delC								KLF4 (456106 upstream) : ACTL7B (908718 downstream)																							atggttgtgtctttggacagg	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110770832	110770832	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110770832delA								KLF4 (518785 upstream) : ACTL7B (846039 downstream)																							cagattgaagaaaTGTGTACA	0.070													4	2	---	---	---	---	
PALM2-AKAP2	445815	broad.mit.edu	37	9	112918958	112918958	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112918958delA	uc004bej.3	+						PALM2-AKAP2_uc004bek.3_Intron|AKAP2_uc011lwi.1_Intron|AKAP2_uc004bem.2_Intron|AKAP2_uc011lwj.1_Intron|PALM2-AKAP2_uc004ben.2_Intron	NM_007203	NP_009134	Q9Y2D5	AKAP2_HUMAN	PALM2-AKAP2 protein isoform 1								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						TGCCTGTTTCAAAAAAAAATT	0.433													6	3	---	---	---	---	
LPAR1	1902	broad.mit.edu	37	9	113758746	113758746	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113758746delA	uc004bfa.2	-						LPAR1_uc011lwm.1_Intron|LPAR1_uc004bfb.2_Intron|LPAR1_uc004bfc.2_Intron|LPAR1_uc011lwn.1_Intron|LPAR1_uc011lwo.1_Intron|LPAR1_uc010mub.2_Intron	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						GTCCGCTTACAAAAAAATAAG	0.269													4	2	---	---	---	---	
TSC1	7248	broad.mit.edu	37	9	135782947	135782948	+	Intron	INS	-	C	C	rs147566970	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135782947_135782948insC	uc004cca.2	-						TSC1_uc004ccb.3_Intron|TSC1_uc011mcq.1_Intron|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		cacaatctcggctcactgcaac	0.059			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				2	4	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137577899	137577901	+	Intron	DEL	ACT	-	-	rs143296254	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577899_137577901delACT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		tcatttatccactatccatccat	0.177													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	754811	754811	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:754811delT								DIP2C (19203 upstream) : LARP4B (100673 downstream)																							aatggagttgttttttccttg	0.000													4	2	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1664039	1664039	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1664039delT	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		aatcccaggattttttttgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2056814	2056815	+	5'Flank	DEL	TA	-	-	rs148757774	byFrequency	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2056814_2056815delTA	uc001igo.1	-											Homo sapiens cDNA FLJ40155 fis, clone TESTI2014362.																		TGAAGTGTTTTATTTTTGTTGT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	2394417	2394418	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2394417_2394418insT								ADARB2 (614699 upstream) : PFKP (715334 downstream)																							ACTGGCTTAAATTTGTAAAAAC	0.391													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3615248	3615248	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3615248delA	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		ACCAGGCCCTAAGAGTTAACG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	7575258	7575259	+	IGR	INS	-	G	G	rs140338567	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7575258_7575259insG								SFMBT2 (121808 upstream) : ITIH5 (26377 downstream)																							agcatcactgcgggggcggggg	0.069													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8332921	8332922	+	IGR	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8332921_8332922insG								GATA3 (215759 upstream) : None (None downstream)																							GTTAATTAGAAGGGGGGGCACT	0.450													4	2	---	---	---	---	
UPF2	26019	broad.mit.edu	37	10	11987682	11987682	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11987682delA	uc001ila.2	-						UPF2_uc001ilb.2_Intron|UPF2_uc001ilc.2_Intron	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				GTTCATGTTTAAAAAGGAGAA	0.308													4	2	---	---	---	---	
BEND7	222389	broad.mit.edu	37	10	13488703	13488707	+	Intron	DEL	AACAC	-	-	rs3831319		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13488703_13488707delAACAC	uc001imm.2	-						BEND7_uc001iml.2_Intron|BEND7_uc001imn.2_3'UTR|BEND7_uc001imo.3_Intron	NM_152751	NP_689964	Q8N7W2	BEND7_HUMAN	BEN domain containing 7 isoform 1								protein binding			ovary(1)|breast(1)	2						TCTATGGCTTAACACAACAGCGTGC	0.468													2	4	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13712738	13712739	+	Intron	DEL	TT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13712738_13712739delTT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						ACAATGTCTCTTATGTAGAATA	0.287													4	2	---	---	---	---	
HSPA14	51182	broad.mit.edu	37	10	14882433	14882433	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14882433delT	uc001inf.2	+						CDNF_uc001inb.1_5'Flank|CDNF_uc010qbv.1_5'Flank|CDNF_uc001inc.1_5'Flank|HSPA14_uc001ind.2_Intron|HSPA14_uc001ine.2_Intron|HSPA14_uc010qbw.1_Intron	NM_016299	NP_057383	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14 isoform 1						'de novo' cotranslational protein folding	cytosol	ATP binding|protein binding			ovary(2)|breast(2)|lung(1)	5						CATTTTTAGATTTTTTTTAAC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23603622	23603622	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23603622delT								PTF1A (120443 upstream) : C10orf67 (1899 downstream)																							aaaaatccacttttttttcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	31052620	31052620	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31052620delT								LYZL2 (133973 upstream) : ZNF438 (80947 downstream)																							CATTTTAAACTTTTTTTTTCA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32451186	32451187	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32451186_32451187delAC								KIF5B (105815 upstream) : EPC1 (106672 downstream)																							CCTgagcaaaacacacacacac	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33724022	33724022	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33724022delT								NRP1 (100016 upstream) : PARD3 (676076 downstream)																							ctaatggccattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35250233	35250233	+	IGR	DEL	T	-	-	rs4509703		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35250233delT								PARD3 (146310 upstream) : CUL2 (48575 downstream)																							tttctttttctttttttttgt	0.184													4	2	---	---	---	---	
GJD4	219770	broad.mit.edu	37	10	35894971	35894971	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35894971delG	uc001iyy.1	+							NM_153368	NP_699199	Q96KN9	CXD4_HUMAN	connexin40.1						cell communication	connexon complex|integral to membrane				large_intestine(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CTGGAAGCTTGGttttttttt	0.214													3	3	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	49984721	49984722	+	Intron	INS	-	TC	TC			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49984721_49984722insTC	uc001jha.3	+							NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						GGCAGATACTTTGGGGTTATTG	0.579													4	2	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	49984726	49984729	+	Intron	DEL	GTTA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49984726_49984729delGTTA	uc001jha.3	+							NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						ATACTTTGGGGTTATTGTCAGAAG	0.588													4	2	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	49984732	49984733	+	Intron	INS	-	C	C			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49984732_49984733insC	uc001jha.3	+							NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						TGGGGTTATTGTCAGAAGCGAG	0.579													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57327605	57327605	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57327605delA	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				atcagacatgaaaaaaaaaac	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	57777352	57777355	+	IGR	DEL	ATTT	-	-	rs140934257		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57777352_57777355delATTT								PCDH15 (389650 upstream) : ZWINT (339844 downstream)																							tatgcaaatcatttattatgaaaa	0.000													2	4	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	69285419	69285419	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69285419delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AAACAGCAGGAAAAAAAAATG	0.383													3	3	---	---	---	---	
AIFM2	84883	broad.mit.edu	37	10	71890688	71890689	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71890688_71890689delAC	uc001jqp.1	-							NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like						apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1						atacacacagacacacacacac	0.371													2	4	---	---	---	---	
CBARA1	10367	broad.mit.edu	37	10	74127330	74127330	+	3'UTR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74127330delA	uc001jtb.1	-	13					CBARA1_uc010qjw.1_3'UTR|CBARA1_uc010qjx.1_3'UTR|CBARA1_uc009xqo.1_RNA	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						CAGAGCCATGAAGCAACTACT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	76793566	76793566	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76793566delA								MYST4 (927 upstream) : DUPD1 (4028 downstream)																							CTGCCAGCCTAACAGCCCTCT	0.547													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	81051803	81051803	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81051803delC	uc001kaf.2	+						ZMIZ1_uc001kag.2_Intron|ZMIZ1_uc001kah.1_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GAGGCCCCGTCCCCTCTAGGT	0.602													4	6	---	---	---	---	
TSPAN14	81619	broad.mit.edu	37	10	82244582	82244582	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82244582delA	uc001kcj.3	+						TSPAN14_uc009xss.2_Intron|TSPAN14_uc001kci.3_Intron	NM_030927	NP_112189	Q8NG11	TSN14_HUMAN	tetraspanin 14 isoform 1							integral to membrane				ovary(1)|central_nervous_system(1)	2			Colorectal(32;0.229)			GAAGGTGGGTAAAATGGACTT	0.368													4	2	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	83931137	83931137	+	Intron	DEL	T	-	-	rs5786534		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83931137delT	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TTTAAAGCACTGCTTCTACTT	0.443													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86342178	86342178	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86342178delG								FAM190B (63902 upstream) : None (None downstream)																							TTTGATTGATGGGGATTGTGG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86419366	86419366	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86419366delT								FAM190B (141090 upstream) : GRID1 (939946 downstream)																							GACAGGCTCCTTGCTCTCCCC	0.547													4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88811194	88811194	+	3'UTR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88811194delT	uc001keh.2	-	13					GLUD1_uc001keg.2_3'UTR|GLUD1_uc010qmp.1_3'UTR	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCCCCAGCACTAGCACTGATT	0.433													4	2	---	---	---	---	
PTEN	5728	broad.mit.edu	37	10	89632552	89632552	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89632552delT	uc001kfb.2	+							NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.0?(12)|p.?(4)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAGCAaacccttaacatgtta	0.055		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			4	2	---	---	---	---	
HTR7	3363	broad.mit.edu	37	10	92599202	92599202	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92599202delA	uc001kha.2	-						HTR7_uc001kgz.2_Intron|HTR7_uc001khb.2_Intron	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d						blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GTTCCAGATGAAAAAAAAACC	0.378													4	2	---	---	---	---	
TLL2	7093	broad.mit.edu	37	10	98133754	98133754	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98133754delT	uc001kml.1	-							NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor						cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TCCGCCTTGCTTTTGGTCCAG	0.353													4	2	---	---	---	---	
UBTD1	80019	broad.mit.edu	37	10	99264079	99264080	+	Intron	INS	-	T	T	rs144555966	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99264079_99264080insT	uc001knv.1	+							NM_024954	NP_079230	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1												0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		ttgctcaagcctcctgtgacac	0.000													5	6	---	---	---	---	
SUFU	51684	broad.mit.edu	37	10	104354486	104354486	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104354486delT	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron|SUFU_uc009xxe.1_5'Flank|SUFU_uc009xxf.1_5'Flank	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		CTGCCttttctttttttgaga	0.204			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111231200	111231201	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111231200_111231201delTG								None (None upstream) : XPNPEP1 (393323 downstream)																							GCCAGCTGAAtgtgtgtgtgtg	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112380580	112380580	+	IGR	DEL	A	-	-	rs34836824		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112380580delA								SMC3 (16190 upstream) : RBM20 (23575 downstream)																							TAAATTCTTTAAAAAAAAAAA	0.353													4	3	---	---	---	---	
HSPA12A	259217	broad.mit.edu	37	10	118452172	118452172	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118452172delT	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)		CTCTAGCCCCTTTCCCTCACT	0.303													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121072575	121072575	+	Intron	DEL	T	-	-	rs113754814		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121072575delT	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		atgatgatggtggtggtgatg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125127259	125127260	+	Intron	INS	-	G	G	rs140600457	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125127259_125127260insG	uc001lhg.1	+											full-length cDNA clone CS0DD008YJ14 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).																		TGAAGGTAATAGGCAGGCAGGT	0.421													4	2	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127579378	127579379	+	Intron	INS	-	C	C	rs5788726		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127579378_127579379insC	uc001ljg.1	-							NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				agtggctcatgcctgtaatccc	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	129296255	129296255	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129296255delG								DOCK1 (45474 upstream) : NPS (51358 downstream)																							TGGAAATCGTGGGGCGGGCAC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130083053	130083053	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130083053delC	uc001lkg.1	+											Homo sapiens cDNA FLJ42232 fis, clone THYMU3000224.																		AATGACTGAGCCCATGGGACA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131055368	131055369	+	IGR	INS	-	G	G	rs11449280		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131055368_131055369insG								None (None upstream) : MGMT (210085 downstream)																							TAAAAAAAAAAAGCCAAGTAAA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132588818	132588818	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132588818delA								GLRX3 (606034 upstream) : TCERG1L (301838 downstream)																							actcacccccacacacacaga	0.000													4	2	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134408843	134408844	+	Intron	INS	-	T	T	rs142852945	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134408843_134408844insT	uc001llp.2	+						INPP5A_uc001llo.1_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TGTTCAATCCATTTTTTTAGAG	0.436													1	5	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	194852	194853	+	5'Flank	INS	-	CTCG	CTCG	rs66749725		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:194852_194853insCTCG	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TCAGGAACACAGGGCCACAGCC	0.545													4	2	---	---	---	---	
INS-IGF2	723961	broad.mit.edu	37	11	2173927	2173927	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2173927delT	uc001lvm.2	-						INS-IGF2_uc001lvi.2_Intron	NM_001042376	NP_001035835	Q1WM24	Q1WM24_HUMAN	insulin- insulin-like growth factor 2						glucose metabolic process	extracellular region	hormone activity				0		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		TGCCGAAACCTTTTTTGGTGG	0.527													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4935775	4935775	+	IGR	DEL	C	-	-	rs112141503		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4935775delC								OR51A7 (6239 upstream) : OR51G2 (174 downstream)																							TTACATTTTACCCCCCCCTGC	0.244													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	6035441	6035442	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6035441_6035442insA								OR56A4 (11063 upstream) : OR56A1 (12537 downstream)																							aagccactgagaaaaaaacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	19126696	19126696	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19126696delT								MRGPRX2 (44468 upstream) : ZDHHC13 (11996 downstream)																							atcacatcccttttttttggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22633741	22633741	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22633741delT								SLC17A6 (232697 upstream) : FANCF (10338 downstream)																							aatttttgtgttttttttttg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	29548257	29548257	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29548257delC								None (None upstream) : KCNA4 (483509 downstream)																							aatactatggcccagccacct	0.000													4	2	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31629488	31629488	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31629488delT	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					ggagacctccttttttttgca	0.015													4	2	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32072133	32072133	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32072133delT	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					actgcctgtctttttttcaga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33418093	33418093	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33418093delA								HIPK3 (42154 upstream) : C11orf41 (145784 downstream)																							GATCCTTCTTATGGCATTGCG	0.433													4	2	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35365601	35365601	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35365601delT	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	TCATTAAAACTTTTTTTTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	36851588	36851588	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36851588delT								C11orf74 (155198 upstream) : None (None downstream)																							ctttgGGGTCTTACCTTCAGA	0.129													4	2	---	---	---	---	
HSD17B12	51144	broad.mit.edu	37	11	43840322	43840323	+	Intron	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43840322_43840323insA	uc001mxq.3	+							NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						TGGCTAATAGGAATATATCTAA	0.332													4	2	---	---	---	---	
CHST1	8534	broad.mit.edu	37	11	45676690	45676691	+	Intron	DEL	CT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45676690_45676691delCT	uc001mys.1	-							NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)						galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		ctttcttcacctctctgggcct	0.015											OREG0020932	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
DGKZ	8525	broad.mit.edu	37	11	46387521	46387522	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46387521_46387522insT	uc001ncn.1	+						DGKZ_uc001nch.1_Intron|DGKZ_uc010rgq.1_Intron|DGKZ_uc001ncj.1_Intron|DGKZ_uc010rgr.1_Intron|DGKZ_uc001nck.1_Intron|DGKZ_uc001ncl.2_Intron|DGKZ_uc001ncm.2_Intron|DGKZ_uc009yky.1_Intron|DGKZ_uc010rgs.1_Intron|DGKZ_uc001nci.1_Intron	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GACTCCAGGGCTCCCTAGGGTG	0.624													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55118429	55118429	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55118429delT								OR4A16 (6768 upstream) : OR4A15 (16931 downstream)																							ggctctctgcttttttccatt	0.000													4	2	---	---	---	---	
OR9Q1	219956	broad.mit.edu	37	11	57813751	57813752	+	Intron	INS	-	CT	CT	rs148474759	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57813751_57813752insCT	uc001nmj.2	+							NM_001005212	NP_001005212	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)				TTTGTTCCCTCCTCTCAGGGTG	0.470													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	58504419	58504420	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58504419_58504420insA								GLYAT (4972 upstream) : GLYATL2 (97122 downstream)																							gctgctgtgacaaaaatactat	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59716849	59716849	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59716849delA	uc001nok.1	+											Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit01-13-09-F.																		ggcatcagggaaggcatccgt	0.000													4	2	---	---	---	---	
C11orf64	283197	broad.mit.edu	37	11	60383617	60383617	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60383617delG	uc001npt.2	+						C11orf64_uc001npu.2_Intron	NR_026946				Homo sapiens cDNA FLJ25394 fis, clone TST02552.												0						GTAGTGAATTGGGGATCCCAG	0.393													4	2	---	---	---	---	
STIP1	10963	broad.mit.edu	37	11	63965695	63965695	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63965695delT	uc001nyk.1	+						STIP1_uc010rnb.1_Intron	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1						axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						gtccagctaattttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69899117	69899117	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69899117delT								FGF3 (264925 upstream) : ANO1 (25291 downstream)																							atgcatttaatttttttaatg	0.000													4	2	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	70026385	70026385	+	Intron	DEL	T	-	-	rs35515891		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70026385delT	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						TTTCTGCAAGttttttttttt	0.244													5	3	---	---	---	---	
CTTN	2017	broad.mit.edu	37	11	70260451	70260451	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70260451delA	uc001opv.3	+						CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_Intron	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		actctgtctcaaaaaaaaaaa	0.269													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	75144837	75144837	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75144837delT								KLHL35 (3604 upstream) : GDPD5 (849 downstream)																							GGCTCTTTTCTTTTTTACCTA	0.463													4	2	---	---	---	---	
UVRAG	7405	broad.mit.edu	37	11	75557875	75557875	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75557875delT	uc001oxc.2	+						UVRAG_uc010rrw.1_Intron	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated						DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						tgttctttcattttttttttt	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	76541265	76541265	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76541265delT								TSKU (32068 upstream) : ACER3 (30652 downstream)																							CTCAGCCttctttttttttag	0.269													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78860597	78860598	+	Intron	INS	-	A	A	rs147675914	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78860597_78860598insA	uc001ozl.3	-						ODZ4_uc009yvc.2_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						tataggtttttaaaaaacatct	0.000													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	79036154	79036157	+	Intron	DEL	AGAG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79036154_79036157delAGAG	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GGCACGTGGAAGAGAGAGAGAGAG	0.485													4	3	---	---	---	---	
ME3	10873	broad.mit.edu	37	11	86372874	86372878	+	Intron	DEL	GTATT	-	-	rs148971814		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86372874_86372878delGTATT	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron|ME3_uc010rtr.1_Intron	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	tcaaggcagagtattgtattgtatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	102380044	102380044	+	IGR	DEL	G	-	-	rs34693579		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102380044delG								TMEM123 (56269 upstream) : MMP7 (11196 downstream)																							gattccttttgaagggcttgg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	106522572	106522572	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106522572delT								AASDHPPT (553153 upstream) : GUCY1A2 (35338 downstream)																							gtctgtgttctttttttatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109647937	109647937	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109647937delG								C11orf87 (348099 upstream) : ZC3H12C (315989 downstream)																							tctgcttcctggggatctgtt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110643328	110643328	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110643328delT								ARHGAP20 (59416 upstream) : C11orf53 (483379 downstream)																							aaacttggagtttttttgact	0.000													4	2	---	---	---	---	
CADM1	23705	broad.mit.edu	37	11	115228933	115228936	+	Intron	DEL	TCAT	-	-	rs67243460		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115228933_115228936delTCAT	uc001ppi.3	-						CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001ppl.2_Intron	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1						adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		cttctctcactcattgtcatttat	0.000													2	5	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116912626	116912626	+	Intron	DEL	T	-	-	rs112471203		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116912626delT	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						ATCCCTACTCTTTTTTTTCAT	0.358													4	2	---	---	---	---	
TECTA	7007	broad.mit.edu	37	11	121008918	121008918	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121008918delA	uc010rzo.1	+							NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		aggctcagagaaaaaaatgat	0.109													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131913429	131913429	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131913429delG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ggccccacatggagccacaga	0.000													2	4	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2196236	2196236	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2196236delT	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CCAGGCTGGGTTTTTTTATCT	0.502													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2323140	2323141	+	Intron	INS	-	T	T	rs145458266	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2323140_2323141insT	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TGAATCGCGAGTTTGGGAGAGG	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5610419	5610419	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5610419delG								NTF3 (5956 upstream) : ANO2 (61398 downstream)																							ggaacagcctgggggaaaagt	0.095													4	2	---	---	---	---	
CD163	9332	broad.mit.edu	37	12	7652026	7652030	+	Intron	DEL	TGTTT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7652026_7652030delTGTTT	uc001qsz.3	-						CD163_uc001qta.3_Intron|CD163_uc009zfw.2_Intron	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a						acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TTAAACTTTCTGTTTTGTTTTGTTT	0.249													4	2	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11276713	11276713	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11276713delT	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						TATAAGTAGCTTTTTTGGGAT	0.368										HNSCC(22;0.051)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	11740568	11740568	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11740568delT								PRB2 (192070 upstream) : ETV6 (62220 downstream)																							TACATTTTCCTTTTTTTTCTT	0.398													4	2	---	---	---	---	
DUSP16	80824	broad.mit.edu	37	12	12708052	12708052	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12708052delC	uc001rao.1	-							NM_030640	NP_085143	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16						inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		AAAGAGCACACAGCTCAGCTG	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	12854874	12854875	+	IGR	DEL	AG	-	-	rs71064309		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12854874_12854875delAG								GPR19 (5753 upstream) : CDKN1B (15427 downstream)																							aaaaaaaaaaagaaTGGACAAA	0.173													4	2	---	---	---	---	
EMP1	2012	broad.mit.edu	37	12	13365147	13365147	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13365147delA	uc001rbr.2	+						EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Intron	NM_001423	NP_001414	P54849	EMP1_HUMAN	epithelial membrane protein 1						cell growth|cell proliferation|epidermis development	integral to membrane|membrane fraction					0		Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		ACAAAACGAGAAAAAAAAAAT	0.408											OREG0021686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17506424	17506424	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17506424delA								LMO3 (743666 upstream) : RERGL (727380 downstream)																							TCCTAAGCAGAAAAAAAGCAG	0.408													4	2	---	---	---	---	
AEBP2	121536	broad.mit.edu	37	12	19623391	19623391	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19623391delT	uc001ref.2	+						AEBP2_uc001ree.2_Intron|AEBP2_uc001reg.1_Intron	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN	AE binding protein 2 isoform b						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					acaccaggccTTTTTTGGATC	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22108682	22108682	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22108682delA								ABCC9 (14346 upstream) : CMAS (90477 downstream)																							aacaatgtggaatatcttctc	0.000													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24375314	24375315	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24375314_24375315insT	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						tgaatgtggaatttttttttct	0.000													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26684604	26684605	+	Intron	INS	-	CG	CG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26684604_26684605insCG	uc001rhg.2	-							NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					acacacacacacacacacacac	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27239446	27239447	+	IGR	DEL	TG	-	-	rs10562422		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27239446_27239447delTG								C12orf71 (3991 upstream) : STK38L (157631 downstream)																							CTCTACAATCTGTGTGTGTGTG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	28186301	28186301	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28186301delT								PTHLH (61385 upstream) : CCDC91 (145909 downstream)																							TCTCCCCCACTTTTTTTTTCC	0.428													4	2	---	---	---	---	
AMN1	196394	broad.mit.edu	37	12	31841753	31841754	+	Intron	INS	-	TAAAA	TAAAA	rs141586589	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31841753_31841754insTAAAA	uc001rkq.3	-						AMN1_uc001rko.3_Intron|AMN1_uc010skc.1_Intron|AMN1_uc001rkp.3_Intron|AMN1_uc009zjs.2_Intron|AMN1_uc009zjt.1_Intron	NM_001113402	NP_001106873	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog												0	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			tcCCAAAaaattaaaataaaat	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37877083	37877084	+	IGR	INS	-	A	A	rs76079002		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37877083_37877084insA								None (None upstream) : ALG10B (833473 downstream)																							tcagtgaaacgaatgttgtact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38639246	38639247	+	IGR	INS	-	TGTG	TGTG	rs145990662	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38639246_38639247insTGTG								None (None upstream) : ALG10B (71310 downstream)																							TTCATAAGGGTtgtgtgtgtgt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	39027310	39027310	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39027310delA								ALG10B (303783 upstream) : CPNE8 (18692 downstream)																							TCTATGTAGGAaaaaaaaaaa	0.333													3	3	---	---	---	---	
YAF2	10138	broad.mit.edu	37	12	42570398	42570398	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42570398delC	uc001rmv.2	-						YAF2_uc001rmw.2_Intron|YAF2_uc010sko.1_Intron|YAF2_uc010skp.1_Intron	NM_005748	NP_005739	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|zinc ion binding				0	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		tgctttccatccccaccttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48042536	48042537	+	IGR	INS	-	TG	TG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48042536_48042537insTG								FAM113B (412095 upstream) : RPAP3 (13179 downstream)																							ATGGCTGGATTTGTGTGTGTGT	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54605923	54605924	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54605923_54605924delCA								SMUG1 (23166 upstream) : CBX5 (18808 downstream)																							cactcacactcacacacacacc	0.069													4	2	---	---	---	---	
CBX5	23468	broad.mit.edu	37	12	54631608	54631608	+	3'UTR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54631608delA	uc001sfh.3	-	5					CBX5_uc001sfk.3_3'UTR|CBX5_uc001sfi.3_3'UTR|CBX5_uc001sfj.3_3'UTR	NM_001127322	NP_001120794	P45973	CBX5_HUMAN	heterochromatin protein 1-alpha						blood coagulation|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|nuclear centromeric heterochromatin|nuclear envelope|nucleolus|transcriptional repressor complex	methylated histone residue binding|protein binding, bridging|repressing transcription factor binding				0						ACTGGAATTTAAAAAAAATTG	0.353													4	2	---	---	---	---	
GTSF1	121355	broad.mit.edu	37	12	54865104	54865104	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54865104delT	uc001sgb.2	-							NM_144594	NP_653195	Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1								metal ion binding				0		Myeloproliferative disorder(1001;0.00452)				AGAAATAAAATGTACCAAAAG	0.373													100	48	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56064201	56064202	+	IGR	DEL	CC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56064201_56064202delCC								OR10P1 (32585 upstream) : METTL7B (11128 downstream)																							ccagtccctgccccagccccag	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56294484	56294484	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56294484delA								MMP19 (57749 upstream) : WIBG (713 downstream)																							TTTCTAAGAGAAAAAAAAAAA	0.308													5	3	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56565988	56565989	+	Intron	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56565988_56565989insA	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			acttagcctcctgagtagctgg	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67559435	67559435	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67559435delA								GRIP1 (361541 upstream) : CAND1 (103626 downstream)																							gagattgcagatgatggtttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68509018	68509019	+	IGR	INS	-	A	A	rs148554147		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68509018_68509019insA								DYRK2 (452575 upstream) : IFNG (39531 downstream)																							CAAGCTAGTGTAAAAAATCCCA	0.470													4	4	---	---	---	---	
MDM1	56890	broad.mit.edu	37	12	68694979	68694980	+	Intron	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68694979_68694980delTG	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		ttaaaaagtctgaaagagcaca	0.000													4	2	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69252512	69252512	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69252512delG	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GAATTTTTGTGGTTTTTTTTT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77076252	77076252	+	IGR	DEL	T	-	-	rs11370356		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77076252delT								OSBPL8 (122663 upstream) : ZDHHC17 (81602 downstream)																							ACAAAATTAAttttttttttt	0.184													5	3	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78392511	78392511	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78392511delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAACAGGTCCTTCCAAATGCA	0.264										HNSCC(70;0.22)			5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	82203822	82203822	+	IGR	DEL	A	-	-	rs148085869		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82203822delA								PPFIA2 (50713 upstream) : CCDC59 (542268 downstream)																							acttctagggaaaaaaagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85339326	85339326	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85339326delT								SLC6A15 (32720 upstream) : TSPAN19 (68769 downstream)																							TGCATTTATATATCACATTTT	0.303													4	2	---	---	---	---	
MGAT4C	25834	broad.mit.edu	37	12	86561383	86561383	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86561383delT	uc001tai.3	-						MGAT4C_uc001tal.3_Intron|MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron|MGAT4C_uc010sum.1_Intron|MGAT4C_uc001tah.3_Intron	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						tagcagaaggtttaaagtaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88049499	88049499	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88049499delT								MGAT4C (816818 upstream) : C12orf50 (324317 downstream)																							AAATTTTGCCTTTTTAAATGG	0.353													4	2	---	---	---	---	
EEA1	8411	broad.mit.edu	37	12	93209722	93209723	+	Intron	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93209722_93209723delAG	uc001tck.2	-							NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD						early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						agacagagacagagagagagag	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	96665566	96665567	+	IGR	INS	-	GT	GT	rs10664100		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96665566_96665567insGT								ELK3 (3960 upstream) : CDK17 (6473 downstream)																							aggataaagaagagcaaaatgc	0.064													5	3	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	99620538	99620538	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99620538delT	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GACTAAGAACTTTTTGTACCG	0.214													4	2	---	---	---	---	
C12orf42	374470	broad.mit.edu	37	12	103731642	103731642	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103731642delT	uc001tjt.2	-						C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Intron|C12orf42_uc001tju.2_Intron	NM_198521	NP_940923	Q96LP6	CL042_HUMAN	hypothetical protein LOC374470											ovary(1)|central_nervous_system(1)	2						ACTTACCCACTTTTTTTTTCT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	104540400	104540400	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104540400delA								NFYB (8360 upstream) : TXNRD1 (66088 downstream)																							CATAGAATACAAAAAACCATA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105983675	105983679	+	IGR	DEL	CTGTC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105983675_105983679delCTGTC								C12orf75 (218380 upstream) : NUAK1 (473446 downstream)																							GGACCCATCACTGTCCTGGGGCATA	0.478													1	6	---	---	---	---	
ANAPC7	51434	broad.mit.edu	37	12	110840138	110840138	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110840138delT	uc001tqo.2	-						ANAPC7_uc001tqp.3_Intron	NM_016238	NP_057322	Q9UJX3	APC7_HUMAN	anaphase-promoting complex subunit 7 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0						caataaaggattttttttttt	0.000													4	2	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116481242	116481242	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116481242delC	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CATGCTGCCTCCCATTTGATG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119298597	119298597	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119298597delA								SUDS3 (442758 upstream) : SRRM4 (120799 downstream)																							gaatttctggaggtagaacct	0.045													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130300352	130300353	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130300352_130300353insT	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ATTACTTTGTATTTTTTAATAA	0.292													4	2	---	---	---	---	
GJB6	10804	broad.mit.edu	37	13	20798360	20798360	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20798360delA	uc001umz.3	-						GJB6_uc001unc.3_Intron|GJB6_uc001una.3_Intron|GJB6_uc001und.3_Intron|GJB6_uc001unb.3_Intron	NM_006783	NP_006774	O95452	CXB6_HUMAN	gap junction protein, beta 6						cell communication|sensory perception of sound	connexon complex|integral to membrane|intracellular membrane-bounded organelle				ovary(1)	1		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		ATTCAGGGGGAAAAAAAACTT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21899277	21899277	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21899277delC	uc001unz.1	+											Homo sapiens cDNA FLJ33446 fis, clone BRAMY1000095.																		ttcccaccatccactgtccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22458128	22458129	+	IGR	INS	-	TG	TG	rs149801924	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22458128_22458129insTG								FGF9 (179488 upstream) : None (None downstream)																							GTGTCTGCCATtgtgtgtgtgt	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23508598	23508599	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23508598_23508599delCA								None (None upstream) : SGCG (246461 downstream)																							ccacCCCCATCACAGCCCCCAC	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25312594	25312594	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25312594delC								ATP12A (26677 upstream) : RNF17 (25707 downstream)																							CCTAGACCTACCTCAGTTGTC	0.577													4	2	---	---	---	---	
ATP8A2	51761	broad.mit.edu	37	13	26479553	26479554	+	Intron	INS	-	CT	CT	rs147569942	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26479553_26479554insCT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATTTTTATATGctctctctctc	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31924162	31924163	+	IGR	DEL	CC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31924162_31924163delCC								B3GALTL (17753 upstream) : RXFP2 (389516 downstream)																							catcacccgtccctgcttcaAC	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33371196	33371197	+	IGR	DEL	GG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33371196_33371197delGG								PDS5B (19041 upstream) : KL (219004 downstream)																							AGGAAGGCCTGGGGTCACTGAA	0.540													4	2	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	34007628	34007629	+	Intron	DEL	GC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34007628_34007629delGC	uc001uux.2	-							NM_052851	NP_443083	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GAATCACCTTGCAGGAGTCAAC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34617678	34617678	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34617678delA								RFC3 (76984 upstream) : NBEA (898778 downstream)																							gtcttgggggaaaaaaaaaaT	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	35081251	35081252	+	IGR	INS	-	G	G	rs147285256	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35081251_35081252insG								RFC3 (540557 upstream) : NBEA (435204 downstream)																							tctcgatgaatggaagcacatc	0.000													1	7	---	---	---	---	
DCLK1	9201	broad.mit.edu	37	13	36580921	36580921	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36580921delA	uc001uvf.2	-							NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ggtttagggcaaaagctagct	0.109													4	2	---	---	---	---	
LHFP	10186	broad.mit.edu	37	13	39919865	39919865	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39919865delA	uc001uxf.2	-							NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		AACCTTTCATAAAGACGTTTA	0.438			T	HMGA2	lipoma								4	2	---	---	---	---	
DGKH	160851	broad.mit.edu	37	13	42764376	42764376	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42764376delA	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTTGATCTTTAGTTCTTCGGA	0.279													24	12	---	---	---	---	
DGKH	160851	broad.mit.edu	37	13	42779733	42779733	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42779733delC	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTTCACCAGTCCCCAGGTGGT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	44767081	44767081	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44767081delT								LOC121838 (162483 upstream) : SERP2 (180897 downstream)																							TGCTTTTGCCTTTTTTTCCTG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45645051	45645051	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45645051delT								KIAA1704 (37309 upstream) : GTF2F2 (49580 downstream)																							cattgcagtattttatgtatt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	48073725	48073725	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48073725delA								HTR2A (602675 upstream) : SUCLA2 (443067 downstream)																							AGTGGCAATGAAAGAGGAATG	0.398													13	6	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50369608	50369608	+	5'Flank	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50369608delT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		AGGGCTGCCCTTTTGCCTGGA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	50482015	50482015	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50482015delT								LOC220429 (14499 upstream) : C13orf1 (4827 downstream)																							ttttttttggttttttttttt	0.000													6	3	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50841933	50841934	+	Intron	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50841933_50841934delAG	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						GCTCCGAGACAGAGAGAGAGAG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59799378	59799378	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59799378delT								None (None upstream) : DIAPH3 (440347 downstream)																							GAATGAGAAATTTAGAAAAAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	62600085	62600085	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62600085delT								PCDH20 (598006 upstream) : None (None downstream)																							TAGGAATTACTTTTTTTGCAC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	62833209	62833209	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62833209delC								PCDH20 (831130 upstream) : None (None downstream)																							ataaggtctaccaccaccaat	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66866424	66866424	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66866424delT								None (None upstream) : PCDH9 (10543 downstream)																							TAGAGGGCACTTATGCTTTGA	0.269													4	2	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76348063	76348063	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76348063delT	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vju.1_Intron	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CTGGTGTTGCtttttttttgt	0.353													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81919759	81919760	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81919759_81919760insT								None (None upstream) : None (None downstream)																							TATAACTGGAGTTTTTtttttt	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82790489	82790490	+	IGR	INS	-	TTCT	TTCT	rs143119594	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82790489_82790490insTTCT								None (None upstream) : None (None downstream)																							attctggaaaattctatctggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86049330	86049331	+	IGR	DEL	AA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86049330_86049331delAA								None (None upstream) : SLITRK6 (317591 downstream)																							TGATGAAGTGAAAAAAAAAAAA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89463739	89463740	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89463739_89463740delAC								None (None upstream) : None (None downstream)																							gctgaaccctacaaagtcacat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89885604	89885604	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89885604delA								None (None upstream) : MIR622 (997832 downstream)																							atactttgagagagagaccac	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89885606	89885606	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89885606delA								None (None upstream) : MIR622 (997830 downstream)																							actttgagagagagaccacag	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	90738662	90738662	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90738662delA								None (None upstream) : MIR622 (144774 downstream)																							gtaaaaaaagaaaaaaaaaag	0.000													3	3	---	---	---	---	
TGDS	23483	broad.mit.edu	37	13	95228830	95228830	+	Intron	DEL	A	-	-	rs116036564	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95228830delA	uc001vlw.2	-						TGDS_uc001vlx.2_Intron	NM_014305	NP_055120	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase						cellular metabolic process		coenzyme binding|dTDP-glucose 4,6-dehydratase activity|protein binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					GTATATATTTAAAAAAAAAAA	0.348													4	4	---	---	---	---	
HS6ST3	266722	broad.mit.edu	37	13	96793609	96793609	+	Intron	DEL	C	-	-	rs640357	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96793609delC	uc001vmw.2	+							NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					ctttttttttctcttttaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	99439015	99439015	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99439015delT								SLC15A1 (34086 upstream) : DOCK9 (6726 downstream)																							ctctcctttcttttagtggat	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101349870	101349870	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101349870delT								TMTC4 (22767 upstream) : NALCN (356260 downstream)																							CTCAAGGTCCTGCTAAGGGGC	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101555505	101555505	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101555505delT								TMTC4 (228402 upstream) : NALCN (150625 downstream)																							tttttctttcttttttttttt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106612489	106612489	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106612489delG								DAOA (469107 upstream) : EFNB2 (529609 downstream)																							GTGGGAGACTGGGGGCAAGAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107539676	107539676	+	IGR	DEL	A	-	-	rs11365329		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107539676delA								ARGLU1 (319162 upstream) : FAM155A (281204 downstream)																							CAGAGATGGCAAAGGATACCA	0.448													6	3	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	107841697	107841697	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107841697delA	uc001vql.2	-							NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						TTTAATTATGAAAAATGTATT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	108589912	108589912	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108589912delA								FAM155A (70452 upstream) : LIG4 (269882 downstream)																							gagaaccaggacagggggcaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	108986478	108986478	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108986478delA								TNFSF13B (27114 upstream) : MYO16 (262022 downstream)																							cataagcaagaaaaaaacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	110402341	110402341	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110402341delA								MYO16 (541986 upstream) : IRS2 (3845 downstream)																							TAACAAAAGCAAAGATACGTG	0.269													4	2	---	---	---	---	
ING1	3621	broad.mit.edu	37	13	111367630	111367630	+	5'UTR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111367630delA	uc001vri.2	+	1					CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D						cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGTGGGGGCAAAAAAAAAAA	0.517													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112769367	112769367	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112769367delA								SOX1 (43347 upstream) : C13orf28 (261302 downstream)																							tgaaacaaggaggcaagggcg	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	113005697	113005697	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113005697delG								SOX1 (279677 upstream) : C13orf28 (24972 downstream)																							GAATATGCATGGTTGCACATG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114627752	114627752	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114627752delT								FLJ44054 (1267 upstream) : RASA3 (119443 downstream)																							caatagcttatttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35161084	35161084	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35161084delT								SNX6 (61718 upstream) : CFL2 (18504 downstream)																							ttttcttttcttttttttgag	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	42723227	42723227	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42723227delC								LRFN5 (349477 upstream) : None (None downstream)																							ATACAAACAACCCCCCCTCCC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56542606	56542606	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56542606delG								C14orf34 (279214 upstream) : PELI2 (42487 downstream)																							AGGATGAGATGGAATGCTTTG	0.428													4	2	---	---	---	---	
PAPLN	89932	broad.mit.edu	37	14	73721556	73721557	+	Intron	DEL	TC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73721556_73721557delTC	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCCCTCAGCATCTCTCTCTCTC	0.688													6	3	---	---	---	---	
YLPM1	56252	broad.mit.edu	37	14	75230717	75230717	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75230717delC	uc001xqj.3	+	1	649	c.525delC	c.(523-525)TACfs	p.Y175fs		NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CCTCTTACTACCCCCCGACCT	0.627													78	41	---	---	---	---	
TTC8	123016	broad.mit.edu	37	14	89343511	89343511	+	Intron	DEL	A	-	-	rs34301947		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89343511delA	uc010ath.2	+						TTC8_uc001xxl.2_Intron|TTC8_uc010ati.2_Intron|TTC8_uc001xxm.2_Intron|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Intron|TTC8_uc001xxj.2_Intron|TTC8_uc001xxk.2_Intron	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B						cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						TGGGTTTGTTAAAAAAAAAAG	0.279									Bardet-Biedl_syndrome				3	3	---	---	---	---	
CCDC85C	317762	broad.mit.edu	37	14	100031184	100031184	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100031184delT	uc010avr.2	-							NM_001144995	NP_001138467	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C												0						ACAGACTGAGTTCAGCTTAGA	0.532													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107099093	107099094	+	Intron	INS	-	G	G	rs140761011	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107099093_107099094insG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						GGTACCCTGCAGGAGGTTTGTG	0.540													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20565391	20565392	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20565391_20565392insA								None (None upstream) : GOLGA6L6 (171702 downstream)																							AACAAAAATGGAAAAAAATCTT	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20603090	20603093	+	Intron	DEL	CAGA	-	-	rs143149870		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20603090_20603093delCAGA	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		TCTAATGTCTCAGACAGACGGAAT	0.304													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21920451	21920451	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21920451delA								NF1P1 (785826 upstream) : LOC646214 (12063 downstream)																							AGGAGAACATAAAACATAAAT	0.274													4	2	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33931805	33931805	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33931805delG	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTGTTCTTCTGGTCACCAGCA	0.488													4	2	---	---	---	---	
ZNF770	54989	broad.mit.edu	37	15	35280182	35280182	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35280182delA	uc001ziw.2	-							NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		CAGCAACAACAAAAAAAAATC	0.488													4	2	---	---	---	---	
MEIS2	4212	broad.mit.edu	37	15	37391375	37391376	+	Intron	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37391375_37391376delCA	uc001zjr.2	-						MEIS2_uc001zjl.2_5'Flank|MEIS2_uc010ucj.1_5'Flank|MEIS2_uc001zjm.2_5'UTR|MEIS2_uc001zjn.2_Intron|MEIS2_uc001zjo.2_Intron|MEIS2_uc001zjp.2_Intron|MEIS2_uc001zjs.2_Intron|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		ATTGCACACGCACACACACACA	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	37986391	37986392	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37986391_37986392delAC								MEIS2 (592891 upstream) : TMCO5A (240435 downstream)																							TCCACCCACAACACACACACAC	0.342													4	2	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40291265	40291265	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40291265delA	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TTAGCTGTTGAAAAAAAAAAA	0.338													3	3	---	---	---	---	
LOC729082	729082	broad.mit.edu	37	15	41586561	41586561	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41586561delA	uc001znm.3	+						LOC729082_uc001znn.1_Intron	NR_026757				Homo sapiens cDNA FLJ26241 fis, clone DMC00738.												0						agagcaggataaagggcagtg	0.000													4	2	---	---	---	---	
TP53BP1	7158	broad.mit.edu	37	15	43761853	43761854	+	Intron	INS	-	A	A	rs67668483		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43761853_43761854insA	uc001zrs.2	-						TP53BP1_uc010udp.1_Intron|TP53BP1_uc001zrq.3_Intron|TP53BP1_uc001zrr.3_Intron|TP53BP1_uc010udq.1_Intron	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGTTTAAACATAAAAAAAAATC	0.144								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					3	3	---	---	---	---	
SERINC4	619189	broad.mit.edu	37	15	44091964	44091964	+	5'Flank	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44091964delT	uc010bds.1	-						ELL3_uc001zsx.1_5'Flank|C15orf63_uc001ztb.2_Intron|SERINC4_uc001ztc.1_5'Flank|SERINC4_uc001ztd.1_5'Flank|SERINC4_uc001zte.1_Intron|C15orf63_uc001ztf.2_5'Flank|C15orf63_uc001ztg.1_5'Flank	NM_001033517	NP_001028689	A6NH21	SERC4_HUMAN	serine incorporator 4						phospholipid biosynthetic process	integral to membrane					0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		GATTTACAGATTATACCTGGG	0.488													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	47697068	47697068	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47697068delC	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ctcctgcactccagaaatctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	55068337	55068337	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55068337delC								UNC13C (147532 upstream) : RSL24D1 (405184 downstream)																							cctttcctttccccacacccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60517361	60517361	+	IGR	DEL	C	-	-	rs34874907		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60517361delC								FOXB1 (188953 upstream) : ANXA2 (121990 downstream)																							TGCTTTTTTTCCTCTGGCAAA	0.338													2	4	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	60909054	60909054	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60909054delC	uc002agv.2	-						RORA_uc002agw.2_Intron|RORA_uc002agx.2_Intron	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GTCCTCAAAACCCCCCTTGTT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61808757	61808757	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61808757delA								RORA (287255 upstream) : VPS13C (335835 downstream)																							TTTTTTCTTTAAGTGCTGTCT	0.318													4	2	---	---	---	---	
IGDCC4	57722	broad.mit.edu	37	15	65694924	65694924	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65694924delA	uc002aou.1	-							NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member							integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3						ctaagataccaggctgggcgc	0.209													9	9	---	---	---	---	
CORO2B	10391	broad.mit.edu	37	15	69020047	69020047	+	3'UTR	DEL	T	-	-	rs71747415		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69020047delT	uc002arj.3	+	12					CORO2B_uc010bic.2_3'UTR|CORO2B_uc002ark.2_3'UTR	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						TTTCTGGAGCTTTTTTTTTTC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69026414	69026414	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69026414delT								CORO2B (6272 upstream) : ANP32A (44463 downstream)																							atttgaaacattttttaatag	0.100													4	2	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73343576	73343578	+	5'Flank	DEL	ACC	-	-	rs148096264		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73343576_73343578delACC	uc002avm.3	+						NEO1_uc010ukx.1_5'Flank|NEO1_uc010uky.1_5'Flank|NEO1_uc010ukz.1_5'Flank	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						ACGCCTATCAACCACCAAACGTG	0.365													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	81776692	81776692	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81776692delC								TMC3 (110274 upstream) : MEX3B (557436 downstream)																							TTCAAGCCTTCCCATCAGAAG	0.493													4	2	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85476156	85476156	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85476156delT	uc002blg.2	+						SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			cattcctaacttagggagcac	0.045													4	2	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89366645	89366645	+	Intron	DEL	T	-	-	rs111670752		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89366645delT	uc010upo.1	+						ACAN_uc002bmx.2_Intron|ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TTTTTGGTGGTTTTTTTTTTT	0.443													4	2	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90597387	90597387	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90597387delG	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AAAGGACAGAGGGGGATTTGG	0.488													4	2	---	---	---	---	
CRTC3	64784	broad.mit.edu	37	15	91114945	91114945	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91114945delC	uc002bpp.2	+						CRTC3_uc002bpn.2_Intron|CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TTCACACCCTCCCCCCAGTTC	0.398			T	MAML2	salivary gland mucoepidermoid								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91221682	91221683	+	IGR	DEL	TC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91221682_91221683delTC								CRTC3 (33106 upstream) : BLM (38896 downstream)																							TCTCTTTCTATCTCTCTCTTTC	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92304483	92304483	+	IGR	DEL	G	-	-	rs11298754		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92304483delG								SV2B (465835 upstream) : SLCO3A1 (92455 downstream)																							GTGAGGAGCAGGGGGTTGCTA	0.527													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94514197	94514197	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94514197delT	uc002btf.1	+											Homo sapiens cDNA clone IMAGE:4827883.																		tgtgttctgattttttttaat	0.000													4	2	---	---	---	---	
TSC2	7249	broad.mit.edu	37	16	2120287	2120287	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2120287delT	uc002con.2	+						TSC2_uc010bsd.2_Intron|TSC2_uc002coo.2_Intron|TSC2_uc010uvv.1_Intron|TSC2_uc010uvw.1_Intron|TSC2_uc002cop.2_Intron	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1						cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				TGGGTTTTACTTTTTGCTGCT	0.572			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3221475	3221476	+	IGR	INS	-	C	C	rs150115049	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3221475_3221476insC								ZNF213 (28671 upstream) : OR1F1 (32771 downstream)																							CCGCAAAACCACAGCGCCTGGA	0.535													2	4	---	---	---	---	
NMRAL1	57407	broad.mit.edu	37	16	4523926	4523926	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4523926delA	uc002cwm.2	-						NMRAL1_uc002cwn.2_Intron|NMRAL1_uc002cwo.2_Intron|NMRAL1_uc002cwp.2_Intron|HMOX2_uc010bts.2_5'Flank|HMOX2_uc002cwr.3_5'Flank|HMOX2_uc002cwq.3_5'Flank|HMOX2_uc002cws.3_5'Flank	NM_020677	NP_065728	Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1							nucleus|perinuclear region of cytoplasm	binding			kidney(1)	1						aactccgtccaaaaaaaaaaa	0.279													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8055424	8055425	+	IGR	DEL	TT	-	-	rs148051995	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8055424_8055425delTT								A2BP1 (292084 upstream) : TMEM114 (564078 downstream)																							GCCTCTTCTGTTTACTCTCCCT	0.446													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8055428	8055431	+	IGR	DEL	CTCT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8055428_8055431delCTCT								A2BP1 (292088 upstream) : TMEM114 (564072 downstream)																							CTTCTGTTTACTCTCCCTCATTTT	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9584574	9584575	+	IGR	INS	-	GAGA	GAGA	rs147115162	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9584574_9584575insGAGA								C16orf72 (371029 upstream) : GRIN2A (262692 downstream)																							agagagaaagggagagagagag	0.277													4	3	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12515767	12515770	+	Intron	DEL	GCCG	-	-	rs112552372		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12515767_12515770delGCCG	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						accatcaccagccgtccatcacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15053924	15053924	+	IGR	DEL	T	-	-	rs78217806		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15053924delT								NPIP (7994 upstream) : PDXDC1 (14675 downstream)																							ttttctatccttttttttttg	0.194													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15318039	15318039	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15318039delT								PDXDC1 (84844 upstream) : MPV17L (171572 downstream)																							tctttctttgttttttttttc	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27183010	27183011	+	IGR	DEL	TC	-	-	rs138767479	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27183010_27183011delTC								C16orf82 (102524 upstream) : JMJD5 (31796 downstream)																							AGCTGTCTTTTCTTTTTTGCTT	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32118199	32118200	+	IGR	DEL	AT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32118199_32118200delAT								ZNF267 (189573 upstream) : HERC2P4 (44410 downstream)																							acaaaataacataaaccgggtg	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32452969	32452970	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32452969_32452970insT								HERC2P4 (289095 upstream) : TP53TG3B (231871 downstream)																							AAACAGAAACCTTTTTTTTTTT	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33387797	33387798	+	IGR	INS	-	C	C	rs71158810		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33387797_33387798insC								SLC6A10P (491334 upstream) : MIR1826 (577710 downstream)																							tttttttttttagatgaagtct	0.050													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33492738	33492738	+	IGR	DEL	T	-	-	rs71378056		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33492738delT								SLC6A10P (596275 upstream) : MIR1826 (472770 downstream)																							cacccagggatcccccagcag	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33571507	33571507	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33571507delG								SLC6A10P (675044 upstream) : MIR1826 (394001 downstream)																							AGGGTAAGCTGGGACAAAGGG	0.657													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33915835	33915836	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33915835_33915836insT								None (None upstream) : MIR1826 (49672 downstream)																							tctgagaaacctctttgtgatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33960735	33960735	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960735delT								None (None upstream) : MIR1826 (4773 downstream)																							GCTAGCACTATTTTTTTTGGC	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33960743	33960743	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960743delG								None (None upstream) : MIR1826 (4765 downstream)																							TATTTTTTTTGGCAATCTTTC	0.308													4	2	---	---	---	---	
ABCC11	85320	broad.mit.edu	37	16	48252916	48252916	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48252916delA	uc002eff.1	-						ABCC11_uc002efg.1_Intron|ABCC11_uc002efh.1_Intron|ABCC11_uc010vgl.1_Intron	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				TCATTGATGTAAAAAATCCCC	0.378									Cerumen_Type				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48679607	48679608	+	IGR	INS	-	TCT	TCT	rs150430298	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48679607_48679608insTCT								N4BP1 (35487 upstream) : CBLN1 (632603 downstream)																							tgtttaactgatctattttttt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48944287	48944290	+	IGR	DEL	CACA	-	-	rs112743166	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48944287_48944290delCACA								N4BP1 (300167 upstream) : CBLN1 (367921 downstream)																							cactgactctcacacacacacaca	0.294													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52663417	52663418	+	IGR	DEL	GT	-	-	rs72076797		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52663417_52663418delGT								TOX3 (81703 upstream) : CHD9 (425527 downstream)																							gtgtgtgtgagtgtgtgtgtgg	0.302													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54582836	54582836	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54582836delT								IRX3 (262458 upstream) : IRX5 (382275 downstream)																							GCTGAtttgattttttgaaac	0.189													4	2	---	---	---	---	
CIAPIN1	57019	broad.mit.edu	37	16	57466224	57466224	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57466224delA	uc002ell.1	-						CIAPIN1_uc002elk.1_Intron|CIAPIN1_uc002elm.1_Intron|CIAPIN1_uc002eln.1_Intron|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Intron	NM_020313	NP_064709	Q6FI81	CPIN1_HUMAN	cytokine induced apoptosis inhibitor 1						anti-apoptosis|apoptosis	cytoplasm|nucleolus					0						gactgtctccaaaaaaaaaGC	0.194													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59078323	59078323	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59078323delA								GOT2 (310077 upstream) : None (None downstream)																							gctagacatgaaagtgtgcat	0.000													4	2	---	---	---	---	
CDH11	1009	broad.mit.edu	37	16	65090950	65090951	+	Intron	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65090950_65090951insA	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Intron	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		ATGTTTCTTACAAAAAAAAATG	0.347			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66457104	66457104	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66457104delT								CDH5 (18416 upstream) : BEAN (4136 downstream)																							ttccacatccttttttttttc	0.030													3	3	---	---	---	---	
FA2H	79152	broad.mit.edu	37	16	74764441	74764442	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74764441_74764442delAC	uc002fde.1	-						FA2H_uc010vmy.1_Intron	NM_024306	NP_077282	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase						cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0						AGGTCTGTAAACACACACACAC	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80873872	80873872	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80873872delT	uc002fft.1	-											Homo sapiens cDNA FLJ35683 fis, clone SPLEN2019131.																		ttttttcaaatttttttccag	0.090													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83504317	83504317	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83504317delC	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ACACGCCTAGCCCAGAGCTGC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86833201	86833202	+	IGR	INS	-	CAC	CAC			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86833201_86833202insCAC								FOXL1 (217898 upstream) : FBXO31 (529742 downstream)																							attaccaccatcaccaccacca	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6053465	6053466	+	IGR	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6053465_6053466delCA								WSCD1 (25720 upstream) : AIPL1 (273594 downstream)																							gcatttaattcacaggttgttc	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14572063	14572063	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14572063delC								HS3ST3B1 (322571 upstream) : PMP22 (561034 downstream)																							tagcttctgtccccatctctc	0.000													4	2	---	---	---	---	
PMP22	5376	broad.mit.edu	37	17	15154035	15154035	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15154035delT	uc002goj.2	-						PMP22_uc002gok.2_Intron|PMP22_uc002gol.2_Intron	NM_153322	NP_696997	Q01453	PMP22_HUMAN	peripheral myelin protein 22						peripheral nervous system development|synaptic transmission	integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		tcttctctacttcccctccct	0.000													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15578678	15578678	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15578678delC	uc002gox.2	-						TRIM16_uc002goy.2_Intron	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GTGGATTTGTCCAGACATTCA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16717193	16717193	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16717193delA								LOC162632 (9374 upstream) : TNFRSF13B (115656 downstream)																							caccctgttcaaaaaaagaga	0.000													4	2	---	---	---	---	
LLGL1	3996	broad.mit.edu	37	17	18146961	18146961	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18146961delA	uc002gsp.2	+							NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1						cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					TGTAGGCCATAGCCTCACCCT	0.602													4	2	---	---	---	---	
LLGL1	3996	broad.mit.edu	37	17	18146966	18146966	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18146966delC	uc002gsp.2	+							NM_004140	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1						cortical actin cytoskeleton organization|exocytosis|protein complex assembly	cortical actin cytoskeleton	protein kinase binding|structural molecule activity			breast(2)|skin(2)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)	6	all_neural(463;0.228)					GCCATAGCCTCACCCTGCACA	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19504275	19504275	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19504275delT								SLC47A1 (21929 upstream) : ALDH3A2 (47789 downstream)																							CTCTTACttcttttttttttt	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21223476	21223477	+	IGR	DEL	GC	-	-	rs33962626		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223476_21223477delGC								MAP2K3 (4927 upstream) : KCNJ12 (56222 downstream)																							TGACAGCAGGGCCTTATCTGGG	0.381													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21223480	21223481	+	IGR	INS	-	G	G	rs2885712		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223480_21223481insG								MAP2K3 (4931 upstream) : KCNJ12 (56218 downstream)																							AGCAGGGCCTTATCTGGGTTGT	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21223481	21223482	+	IGR	INS	-	CCCC	CCCC	rs78552764		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223481_21223482insCCCC								MAP2K3 (4932 upstream) : KCNJ12 (56217 downstream)																							GCAGGGCCTTATCTGGGTTGTT	0.366													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21234160	21234160	+	IGR	DEL	T	-	-	rs5819756		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21234160delT								MAP2K3 (15611 upstream) : KCNJ12 (45539 downstream)																							agttatctggtgacTGTAAGG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21339354	21339355	+	IGR	INS	-	GCAG	GCAG	rs34586616		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21339354_21339355insGCAG								KCNJ12 (16175 upstream) : C17orf51 (92217 downstream)																							aggcacagcaagcaggcaggca	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518703	21518704	+	IGR	INS	-	A	A	rs150372573	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518703_21518704insA								C17orf51 (40972 upstream) : FAM27L (306666 downstream)																							TTCAAGGAATCAAAAAATGAAA	0.218													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289395	25289395	+	IGR	DEL	T	-	-	rs113949263		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289395delT								None (None upstream) : WSB1 (331711 downstream)																							TATTTACATCTTTTTTTGTCT	0.433													5	4	---	---	---	---	
SSH2	85464	broad.mit.edu	37	17	27989650	27989651	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27989650_27989651insT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						CAATTTGAGGAtttttttttaa	0.153													4	2	---	---	---	---	
SSH2	85464	broad.mit.edu	37	17	28234373	28234374	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28234373_28234374insT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron|SSH2_uc002her.2_Intron|SSH2_uc010csc.1_Intron	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						cctgttgggggtggagtggggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32561027	32561028	+	IGR	DEL	CA	-	-	rs67060397		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32561027_32561028delCA								ACCN1 (77202 upstream) : CCL2 (21268 downstream)																							cacgcgcgcgcacacacacaca	0.376													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48952009	48952009	+	IGR	DEL	A	-	-	rs111577581		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48952009delA								TOB1 (6670 upstream) : SPAG9 (87527 downstream)																							ATAAATGCTTAAAAAAAAAAA	0.184													3	4	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50166027	50166027	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50166027delA	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			GGAACAAAGGAAAATGCACTT	0.338													4	2	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55693624	55693625	+	Intron	DEL	GT	-	-	rs58964883	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55693624_55693625delGT	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		ttaagtgtgggtgtgtgtgtgt	0.094			T	HOXA9	CML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56377696	56377696	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56377696delT								MPO (19400 upstream) : BZRAP1 (900 downstream)																							TCCTCAAATATTTTTTGAGTC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	57934296	57934297	+	IGR	INS	-	A	A	rs146586584	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57934296_57934297insA								TMEM49 (15588 upstream) : TUBD1 (2554 downstream)																							AGAGACATTTCAACACTTAAGC	0.416													4	2	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60129590	60129590	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60129590delA	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						CACAAATACTAAAAAAAAGAT	0.323													4	2	---	---	---	---	
SMURF2	64750	broad.mit.edu	37	17	62547477	62547477	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62547477delA	uc002jep.1	-						SMURF2_uc002jeq.1_Intron|SMURF2_uc002jer.1_Intron	NM_022739	NP_073576	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			cctgtctcagaaaaaaaaaaa	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63243858	63243859	+	IGR	INS	-	A	A	rs144087103	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63243858_63243859insA								RGS9 (20039 upstream) : AXIN2 (280826 downstream)																							tggtttgcattaaaaAAAAGAA	0.193													3	3	---	---	---	---	
CASKIN2	57513	broad.mit.edu	37	17	73504562	73504563	+	Intron	INS	-	TGC	TGC	rs141311420	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73504562_73504563insTGC	uc002joc.2	-						CASKIN2_uc010wsc.1_Intron|CASKIN2_uc002jod.2_Intron	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a							cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGAGGGCAGGATGCTGCTGCGG	0.683													5	8	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75159588	75159588	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75159588delT	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TCCTCTTTGGTTTTATACTTT	0.259													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79639371	79639371	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639371delA	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ctgtgtcaagaaaaaaaaaaa	0.269													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	545779	545779	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:545779delC								COLEC12 (45050 upstream) : CETN1 (34590 downstream)																							TCTCTGAAAACCCCAGTAAAC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5874732	5874732	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5874732delT								EPB41L3 (244090 upstream) : TMEM200C (15452 downstream)																							AATAGGGgtgtgtgtgtgtgt	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5874734	5874734	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5874734delT								EPB41L3 (244092 upstream) : TMEM200C (15450 downstream)																							TAGGGgtgtgtgtgtgtgtgt	0.368													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	6953509	6953510	+	Intron	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6953509_6953510insG	uc002knm.2	-						LAMA1_uc002knk.2_Intron|LAMA1_uc002knl.2_Intron|LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	aggcaaccactgggggtcctga	0.015													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7031878	7031879	+	Intron	INS	-	A	A	rs141608614	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7031878_7031879insA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TAACTTTTTTCAAAAAAAAAAC	0.287													5	4	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8273945	8273945	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8273945delT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TCCAGTAACATTTTTTTTTCA	0.463													3	3	---	---	---	---	
TUBB6	84617	broad.mit.edu	37	18	12312675	12312675	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12312675delC	uc002kqw.2	+						TUBB6_uc002kqv.2_Intron|TUBB6_uc010dld.2_Intron|TUBB6_uc002kqx.2_Intron|TUBB6_uc002kqy.2_Intron	NM_032525	NP_115914	Q9BUF5	TBB6_HUMAN	tubulin, beta 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0				READ - Rectum adenocarcinoma(1;0.0649)		TTTTCTGACTCCCAGCAGGAA	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	13125518	13125518	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13125518delA								CEP192 (469 upstream) : C18orf1 (93268 downstream)																							GGAGGAACGTAGTTATTTATT	0.498													4	2	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13327091	13327091	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13327091delC	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		AGTGTCTTGTCCTGGGCTGTT	0.517													4	2	---	---	---	---	
ESCO1	114799	broad.mit.edu	37	18	19131400	19131400	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19131400delA	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						tcaaaaaaagaaaaaaaaaag	0.174													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19812419	19812419	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19812419delC								GATA6 (30192 upstream) : CTAGE1 (181145 downstream)																							atacatctatccatacatacc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22067670	22067670	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22067670delG								HRH4 (7750 upstream) : ZNF521 (574218 downstream)																							tctcaaaaaagaaaaaacaac	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28426695	28426695	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28426695delT								MIR302F (547769 upstream) : DSC3 (143358 downstream)																							aaattttttatttttgttgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	31349483	31349483	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31349483delG								ASXL3 (22084 upstream) : NOL4 (81587 downstream)																							attccaccctgcaatctcctg	0.000													4	2	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	34048559	34048560	+	Intron	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34048559_34048560insG	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGGGAATTTCAGGGGCAGTGGG	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39972509	39972509	+	Intron	DEL	T	-	-	rs112066600		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39972509delT	uc002las.1	+						uc002lat.2_Intron|uc002lau.2_Intron					Homo sapiens hypothetical gene supported by BC011527; BC021928; BC011527; BC021928, mRNA (cDNA clone IMAGE:3872963), with apparent retained intron.																		GTAGCTGTGCTTTTTTTTTTT	0.398													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	40129995	40129996	+	Intron	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40129995_40129996insG	uc002lau.2	+											Homo sapiens hypothetical gene supported by BC011527; BC021928; BC011527; BC021928, mRNA (cDNA clone IMAGE:3872963), with apparent retained intron.																		ctcaccaaagtggggaaataca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	42728440	42728440	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42728440delA								SETBP1 (79967 upstream) : SLC14A2 (19533 downstream)																							CTCATGCAGGAAAAAAAAAAG	0.214													4	2	---	---	---	---	
ZBTB7C	201501	broad.mit.edu	37	18	45604443	45604443	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45604443delC	uc010dnv.2	-						ZBTB7C_uc002ldb.2_Intron|ZBTB7C_uc010dnu.2_Intron|ZBTB7C_uc010dnw.2_Intron|ZBTB7C_uc010dnx.1_Intron|ZBTB7C_uc010dny.1_Intron|ZBTB7C_uc010dnz.1_Intron|ZBTB7C_uc010dob.1_Intron|ZBTB7C_uc010doc.1_Intron|ZBTB7C_uc010dod.1_Intron|ZBTB7C_uc010doe.1_Intron|ZBTB7C_uc010dof.1_Intron|ZBTB7C_uc010dog.1_Intron|ZBTB7C_uc010doh.1_Intron|ZBTB7C_uc010doi.1_Intron|ZBTB7C_uc010doj.1_Intron|ZBTB7C_uc010dok.1_Intron|ZBTB7C_uc010dol.1_Intron|ZBTB7C_uc010doa.1_Intron|ZBTB7C_uc010don.1_Intron|ZBTB7C_uc010doo.1_Intron|ZBTB7C_uc010dop.1_Intron|ZBTB7C_uc010doq.1_Intron|ZBTB7C_uc010dor.1_Intron|ZBTB7C_uc010dos.1_Intron|ZBTB7C_uc010dot.1_Intron|ZBTB7C_uc010dou.1_Intron|ZBTB7C_uc010dom.1_Intron	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						gagtagaaggccagaagctag	0.030													4	2	---	---	---	---	
LIPG	9388	broad.mit.edu	37	18	47096075	47096076	+	Intron	INS	-	T	T	rs35711840		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47096075_47096076insT	uc002ldv.2	+						LIPG_uc002ldu.1_Intron|LIPG_uc010xdh.1_Intron	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor						cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						TCACAAGaaacttttttttttt	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	58136661	58136661	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58136661delT								MC4R (96660 upstream) : CDH20 (864327 downstream)																							attgtcagtcttttttttttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59420254	59420254	+	RNA	DEL	T	-	-	rs12962384	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59420254delT	uc002lig.1	+	4		c.1543delT								Homo sapiens cDNA FLJ30274 fis, clone BRACE2002695.																		GAGACCAGGGTGGGCACCAAC	0.582													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60114167	60114167	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60114167delG								TNFRSF11A (60665 upstream) : ZCCHC2 (76491 downstream)																							tcctggcatagggggattatc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65242252	65242252	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65242252delA								DSEL (58285 upstream) : None (None downstream)																							TTTGCCTCTTACGTGCATGCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	67894516	67894516	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67894516delT								RTTN (21554 upstream) : SOCS6 (61621 downstream)																							atagcttgcctttctataatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69358148	69358148	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69358148delC								None (None upstream) : CBLN2 (845767 downstream)																							tttattttttccccatatgaa	0.000													4	2	---	---	---	---	
ARID3A	1820	broad.mit.edu	37	19	966476	966476	+	Intron	DEL	G	-	-	rs28533500		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:966476delG	uc002lql.2	+							NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aaaaaaaaaagaaaagaaaag	0.244													5	3	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3035083	3035083	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3035083delC	uc010dti.2	-							NM_001144761	NP_001138233	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCACAAGACCACACACGCA	0.547													4	2	---	---	---	---	
FARSA	2193	broad.mit.edu	37	19	13044117	13044117	+	Intron	DEL	A	-	-	rs33919090		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13044117delA	uc002mvs.2	-						FARSA_uc002mvt.2_Intron|FARSA_uc010xmv.1_Intron|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit						phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	agcaaccgcgacttcctcgtc	0.114													3	5	---	---	---	---	
NFIX	4784	broad.mit.edu	37	19	13177550	13177551	+	Intron	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13177550_13177551delTG	uc010xmx.1	+						NFIX_uc002mwd.2_Intron|NFIX_uc002mwe.2_Intron|NFIX_uc002mwf.2_Intron|NFIX_uc002mwg.1_Intron			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			tgtgtgtgcatgtgtgtgtgtg	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	18782727	18782728	+	IGR	DEL	CA	-	-	rs34161998		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18782727_18782728delCA								KLHL26 (1425 upstream) : CRTC1 (11697 downstream)																							cgctcacccgcacacagtgaaa	0.188													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20446104	20446104	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20446104delT								LOC284441 (75601 upstream) : ZNF826 (4974 downstream)																							TCACATCACATTTTTTTTTCC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22096758	22096759	+	IGR	DEL	CT	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22096758_22096759delCT								ZNF43 (61928 upstream) : ZNF208 (19001 downstream)																							tgtgggactcctctctactgca	0.000													4	2	---	---	---	---	
RPSAP58	388524	broad.mit.edu	37	19	23990451	23990452	+	Intron	DEL	AG	-	-	rs140725153		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23990451_23990452delAG	uc002nrn.2	+							NM_002295	NP_002286			ribosomal protein SA												0						CTCTTTTCTCAGAGTTAGAGAA	0.322													8	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24533719	24533719	+	IGR	DEL	C	-	-	rs10432315	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24533719delC								LOC100101266 (187470 upstream) : None (None downstream)																							tctggaaacactttttttgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28779320	28779321	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28779320_28779321delAC								LOC148189 (494472 upstream) : LOC148145 (676719 downstream)																							atatacaaatacacacacacat	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31203335	31203336	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31203335_31203336insA								ZNF536 (154370 upstream) : DKFZp566F0947 (437447 downstream)																							CATTCAGACTTAAAAAAAAAAA	0.361													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31670636	31670638	+	IGR	DEL	GGT	-	-	rs139984397		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31670636_31670638delGGT								DKFZp566F0947 (29327 upstream) : TSHZ3 (95215 downstream)																							gatgatggtaggtggtggtggtg	0.015													1	7	---	---	---	---	
CD22	933	broad.mit.edu	37	19	35822750	35822750	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35822750delA	uc010edt.2	+						CD22_uc010xst.1_Intron|CD22_uc010edu.2_Intron|CD22_uc010edv.2_Intron|CD22_uc002nzb.3_5'Flank	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor						cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	actctgtctcaaaaaaaaaga	0.259													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37251443	37251444	+	Intron	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37251443_37251444insT	uc010efc.2	-						uc010xtm.1_Intron					Homo sapiens zinc finger protein 850 pseudogene, mRNA (cDNA clone IMAGE:6082150).																		AGGCTTTATGATTTTTTTTTTA	0.168													4	2	---	---	---	---	
ZNF780A	284323	broad.mit.edu	37	19	40595525	40595528	+	Intron	DEL	ACAC	-	-	rs10537216		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40595525_40595528delACAC	uc002omy.2	-						ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Intron|ZNF780A_uc010xvh.1_Intron	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTCTCACAGTacacacacacacac	0.167													4	3	---	---	---	---	
LTBP4	8425	broad.mit.edu	37	19	41135157	41135158	+	Intron	DEL	CA	-	-	rs35487927		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41135157_41135158delCA	uc002ooh.1	+						LTBP4_uc002oog.1_Intron|LTBP4_uc002ooi.1_Intron|LTBP4_uc002ooj.1_Intron|LTBP4_uc002ool.1_Intron|LTBP4_uc010xvp.1_Intron	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding						growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			tggccgggctcacacagttagc	0.109													1	5	---	---	---	---	
ATP1A3	478	broad.mit.edu	37	19	42490603	42490603	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42490603delT	uc002osg.2	-						ATP1A3_uc010xwf.1_Intron|ATP1A3_uc010xwg.1_Intron|ATP1A3_uc010xwh.1_Intron|ATP1A3_uc002osh.2_Intron	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit						ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						GGTCTGTCGAttttttttttg	0.239													4	2	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43456727	43456728	+	Intron	INS	-	A	A	rs139896117	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43456727_43456728insA	uc002ovh.1	-						PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				agaggcctcagaaacttgcaat	0.000													3	6	---	---	---	---	
BSPH1	100131137	broad.mit.edu	37	19	48478046	48478047	+	Intron	DEL	TG	-	-	rs11270104	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48478046_48478047delTG	uc002phs.1	-							NM_001128326	NP_001121798	Q075Z2	BSPH1_HUMAN	bovine seminal plasma protein-like 1 precursor						single fertilization	extracellular region					0						CTACCCAATTTGAGCGTGCAGT	0.450													2	4	---	---	---	---	
BSPH1	100131137	broad.mit.edu	37	19	48478049	48478051	+	Intron	DEL	GCG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48478049_48478051delGCG	uc002phs.1	-							NM_001128326	NP_001121798	Q075Z2	BSPH1_HUMAN	bovine seminal plasma protein-like 1 precursor						single fertilization	extracellular region					0						CCCAATTTGAGCGTGCAGTAAGC	0.448													2	4	---	---	---	---	
BSPH1	100131137	broad.mit.edu	37	19	48478053	48478054	+	Intron	DEL	GC	-	-	rs11272869		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48478053_48478054delGC	uc002phs.1	-							NM_001128326	NP_001121798	Q075Z2	BSPH1_HUMAN	bovine seminal plasma protein-like 1 precursor						single fertilization	extracellular region					0						ATTTGAGCGTGCAGTAAGCTTC	0.446													2	4	---	---	---	---	
KCNC3	3748	broad.mit.edu	37	19	50823673	50823674	+	Intron	INS	-	AT	AT			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50823673_50823674insAT	uc002pru.1	-						KCNC3_uc002prt.1_Intron	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel						cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		GGTGAAGGGTCAGTGGTGAGGA	0.634													4	2	---	---	---	---	
TMEM86B	255043	broad.mit.edu	37	19	55738223	55738225	+	3'UTR	DEL	AGC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55738223_55738225delAGC	uc002qju.2	-	3					TMEM86B_uc002qjt.2_3'UTR	NM_173804	NP_776165	Q8N661	TM86B_HUMAN	transmembrane protein 86B						ether lipid metabolic process	cytoplasmic part|integral to membrane	alkenylglycerophosphocholine hydrolase activity|alkenylglycerophosphoethanolamine hydrolase activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		ACGGATTCAGAGCAGCAGCAGGG	0.611													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55959412	55959413	+	IGR	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55959412_55959413delAC								SHISA7 (5182 upstream) : ISOC2 (4935 downstream)																							gaccacacatacacacacacac	0.248													4	2	---	---	---	---	
ZSCAN18	65982	broad.mit.edu	37	19	58623149	58623149	+	Intron	DEL	C	-	-	rs35578076		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58623149delC	uc010yht.1	-						ZSCAN18_uc002qrm.2_Intron	NM_001145542	NP_001139014	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		caaagccaggcaagcacacta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1821487	1821487	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1821487delA								SIRPG (183062 upstream) : SIRPA (53326 downstream)																							agttttaaacaggagagtcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2129595	2129595	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2129595delG								STK35 (399 upstream) : TGM3 (147018 downstream)																							GAGCTAAAAAGGGGGGGTCTC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	7832335	7832335	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7832335delA								None (None upstream) : HAO1 (31296 downstream)																							TTGGGAGTGGAAAAAAAAATC	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12689208	12689208	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12689208delC								BTBD3 (781966 upstream) : SPTLC3 (300419 downstream)																							CAGCCTGTGACCCCTGTCGAC	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961024	23961025	+	IGR	INS	-	AC	AC	rs146633246	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961024_23961025insAC								CST5 (100644 upstream) : GGTLC1 (4666 downstream)																							cactcacacatacacacacaaa	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29527652	29527653	+	IGR	INS	-	AC	AC			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29527652_29527653insAC								None (None upstream) : FRG1B (84226 downstream)																							TGAAAAAAAAATCGTGCTTCCA	0.460													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636453	29636454	+	Intron	INS	-	TTG	TTG	rs140764657		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636453_29636454insTTG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATTTTGTTTGATTTTTTTTCTA	0.114													4	2	---	---	---	---	
BCL2L1	598	broad.mit.edu	37	20	30269550	30269550	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30269550delA	uc002wwl.2	-						BCL2L1_uc002wwk.2_Intron|BCL2L1_uc002wwm.2_Intron|BCL2L1_uc002wwn.2_Intron	NM_138578	NP_612815	Q07817	B2CL1_HUMAN	BCL2-like 1 isoform 1						induction of apoptosis by intracellular signals|negative regulation of establishment of protein localization in plasma membrane|negative regulation of survival gene product expression|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|release of cytochrome c from mitochondria|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nuclear membrane	BH3 domain binding|identical protein binding			lung(1)|central_nervous_system(1)	2	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			tcccatctataaaaggcgaga	0.090													4	2	---	---	---	---	
PLAGL2	5326	broad.mit.edu	37	20	30784139	30784139	+	3'UTR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30784139delT	uc002wxn.2	-	3						NM_002657	NP_002648	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GACACTGGAATTTTTTTTTTT	0.498													8	4	---	---	---	---	
CBFA2T2	9139	broad.mit.edu	37	20	32190161	32190161	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32190161delC	uc002wzg.1	+						CBFA2T2_uc010zug.1_Intron|CBFA2T2_uc002wze.1_Intron|CBFA2T2_uc002wzf.1_Intron|CBFA2T2_uc002wzh.1_Intron|CBFA2T2_uc002wzi.1_Intron|CBFA2T2_uc002wzj.1_Intron	NM_005093	NP_005084	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						TTTCCAATTGCTTGGGAGTAG	0.383													4	2	---	---	---	---	
MANBAL	63905	broad.mit.edu	37	20	35941414	35941415	+	Intron	DEL	CA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35941414_35941415delCA	uc002xgu.2	+						MANBAL_uc002xgv.2_Intron|MANBAL_uc002xgw.2_Intron|MANBAL_uc010gfx.2_Intron|MANBAL_uc010gfy.2_Intron	NM_022077	NP_071360	Q9NQG1	MANBL_HUMAN	mannosidase, beta A, lysosomal-like							integral to membrane					0		Myeloproliferative disorder(115;0.00878)				ttcattcattcactcattcatt	0.317													4	2	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36408554	36408555	+	Intron	DEL	AA	-	-	rs78254013		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36408554_36408555delAA	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				GTTGAGATTTaaaaaaaaaaaa	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37251790	37251791	+	IGR	INS	-	GG	GG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37251790_37251791insGG								ADIG (34686 upstream) : SLC32A1 (101314 downstream)																							ctggccctgctctgtcCCCTGC	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38202695	38202695	+	IGR	DEL	A	-	-	rs34093275		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38202695delA								LOC339568 (349304 upstream) : None (None downstream)																							CTCAAGTGACAAAAAAAATCC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38343025	38343025	+	IGR	DEL	T	-	-	rs292879	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38343025delT								LOC339568 (489634 upstream) : MAFB (971494 downstream)																							AGTTTTTTGGTTTTTTTTTTA	0.313													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38691748	38691749	+	IGR	DEL	AA	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38691748_38691749delAA								LOC339568 (838357 upstream) : MAFB (622770 downstream)																							tgggggagagaaaacaaatgtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39005485	39005486	+	IGR	DEL	AG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39005485_39005486delAG								None (None upstream) : MAFB (309033 downstream)																							tagATTAGACAGAGAGAGAGAA	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39293401	39293402	+	IGR	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39293401_39293402insA								None (None upstream) : MAFB (21117 downstream)																							TAAAATTCAGGAAAAAAAATAG	0.361													4	2	---	---	---	---	
WFDC3	140686	broad.mit.edu	37	20	44417845	44417845	+	Intron	DEL	A	-	-	rs11478994		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44417845delA	uc002xpf.1	-						DNTTIP1_uc002xpk.2_5'Flank|WFDC3_uc002xpj.1_Intron|WFDC3_uc002xph.1_Intron|WFDC3_uc010ghh.1_Intron	NM_080614	NP_542181	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				cctgtctcttaaaaaaaaaaa	0.124													4	3	---	---	---	---	
NCOA5	57727	broad.mit.edu	37	20	44706303	44706303	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44706303delG	uc002xrd.2	-						NCOA5_uc002xre.2_Intron	NM_020967	NP_066018	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				CCACACTCCTGGTAAGTCACC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47082584	47082584	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47082584delC								LOC284749 (83203 upstream) : PREX1 (158209 downstream)																							CCTCTGGAAACCTTGAACTGT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51014769	51014769	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51014769delT								ZFP64 (206245 upstream) : TSHZ2 (574108 downstream)																							aaaggtatgattttaggcaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52481717	52481717	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52481717delC								ZNF217 (270916 upstream) : SUMO1P1 (9325 downstream)																							TGGAAAGCCACCCCGGGGCTG	0.433													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54142883	54142884	+	IGR	DEL	AC	-	-	rs111677935		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54142883_54142884delAC								DOK5 (875174 upstream) : CBLN4 (429613 downstream)																							GAATAATGCTacacacacacac	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10141126	10141127	+	IGR	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10141126_10141127insG								None (None upstream) : TPTE (765616 downstream)																							atgtaaaaaaaaaatcagcaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10764005	10764005	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10764005delA								None (None upstream) : TPTE (142738 downstream)																							caactctgtgagttgaatgca	0.000													4	2	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10918246	10918246	+	Intron	DEL	G	-	-	rs113499448		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10918246delG	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCATAGGCTGGGAAAGAGCA	0.478													6	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11034269	11034273	+	Intron	DEL	TAAAG	-	-	rs151154737		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11034269_11034273delTAAAG	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCTTATAATATAAAGTAAACTTCTA	0.273													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11036712	11036713	+	Intron	INS	-	AA	AA	rs113731517		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11036712_11036713insAA	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTGACTTTAACAAAAAAATAGC	0.337													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11051168	11051168	+	Intron	DEL	T	-	-	rs139496343		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11051168delT	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agaccttttgtttttatttac	0.100													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11088497	11088497	+	Intron	DEL	G	-	-	rs56256692	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11088497delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tgttgttgttgttttttttga	0.104													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11099982	11099982	+	5'Flank	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11099982delG	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ggtagacggagggggaaaaga	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11113534	11113534	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11113534delC								BAGE (14597 upstream) : None (None downstream)																							AGAAACAGGTCTTTTTGAATc	0.224													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15461399	15461399	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15461399delT	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																		ttgttttttgtttttttagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18535825	18535826	+	IGR	INS	-	A	A	rs111679275	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18535825_18535826insA								C21orf34 (553731 upstream) : CXADR (349504 downstream)																							CAAAGTGAACCAAAAAAAATCC	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20184572	20184572	+	IGR	DEL	A	-	-	rs78563908		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20184572delA								TMPRSS15 (408602 upstream) : None (None downstream)																							agcctagtggaaaaaaaaata	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28109808	28109808	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28109808delA								CYYR1 (164227 upstream) : ADAMTS1 (98800 downstream)																							TTTTACGATTAAAAAAATGAA	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28590270	28590271	+	IGR	DEL	TC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28590270_28590271delTC								ADAMTS5 (250831 upstream) : NCRNA00113 (504427 downstream)																							tctccctctatctctctgtttt	0.000													4	4	---	---	---	---	
GRIK1	2897	broad.mit.edu	37	21	30918293	30918293	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30918293delT	uc011acs.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011act.1_Intron	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	tccacatcccttctctcttct	0.000													4	2	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32877746	32877746	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32877746delA	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						AGAGATCAAGAAAAAAAAAAG	0.323													3	3	---	---	---	---	
URB1	9875	broad.mit.edu	37	21	33756019	33756019	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33756019delA	uc002ypn.2	-							NM_014825	NP_055640	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog							nucleolus	protein binding				0						AAGGAAAAAGAAAAAAAAAAG	0.328													5	3	---	---	---	---	
ITSN1	6453	broad.mit.edu	37	21	35127910	35127910	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35127910delA	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Intron|ITSN1_uc010gmi.2_Intron|ITSN1_uc010gmj.2_Intron|ITSN1_uc002ysy.2_Intron|ITSN1_uc002ysx.2_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytc.1_Intron|ITSN1_uc002ytd.2_Intron|ITSN1_uc010gmk.2_Intron|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron|ITSN1_uc002yte.2_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						GGTAAAATGGAATATAGACCA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40462613	40462614	+	IGR	INS	-	G	G	rs148274319	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40462613_40462614insG								ETS2 (265737 upstream) : PSMG1 (84776 downstream)																							ATCAGCAACCTGGGAGGGGAAA	0.470													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	41307380	41307380	+	IGR	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41307380delG								PCP4 (6060 upstream) : DSCAM (76963 downstream)																							TCTCTTGCCCGCCCCAACATC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17352555	17352556	+	IGR	DEL	GT	-	-	rs140967896		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17352555_17352556delGT								HSFYL1 (42330 upstream) : GAB4 (90273 downstream)																							TTGAATGCTGGTAAGTAATGTT	0.386													4	3	---	---	---	---	
POM121L8P	29797	broad.mit.edu	37	22	21643633	21643633	+	Intron	DEL	C	-	-	rs4819737		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21643633delC	uc010gtd.2	+						uc002zuo.1_RNA	NR_024583				Homo sapiens cDNA FLJ76361 complete cds.												0						CCTCTGCCTGCCCCAAGCCCC	0.512													4	2	---	---	---	---	
YPEL1	29799	broad.mit.edu	37	22	22065295	22065295	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22065295delG	uc002zvl.2	-						YPEL1_uc002zvm.2_Intron	NM_013313	NP_037445	O60688	YPEL1_HUMAN	yippee-like 1							nucleus					0	Colorectal(54;0.105)					CACGCGGGGTGGGGGGGTGGC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27484710	27484710	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27484710delC								MIAT (369761 upstream) : MN1 (659556 downstream)																							CTGGTCACCTCCCCAATATAC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27929178	27929179	+	IGR	INS	-	A	A	rs144784664	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27929178_27929179insA								MIAT (814229 upstream) : MN1 (215087 downstream)																							TGAGAAAGAATAAAAAATACTT	0.233													3	4	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28496055	28496055	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28496055delT	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						GATATTTTCCTTTTTTTTCCC	0.398													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29161761	29161761	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29161761delA								HSCB (8273 upstream) : CCDC117 (6901 downstream)																							ACATTGTTTTAAAAAAAGGTA	0.378													4	2	---	---	---	---	
ZNRF3	84133	broad.mit.edu	37	22	29420409	29420409	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29420409delT	uc003aeg.2	+						ZNRF3_uc003aeh.1_Intron	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1						TGTTTTAATATTTGCTGAGGG	0.403													4	2	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29516378	29516379	+	Intron	DEL	AC	-	-	rs72119453		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29516378_29516379delAC	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						gataatggaaacagggaggagg	0.000													4	2	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29516407	29516408	+	Intron	DEL	AC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29516407_29516408delAC	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						gatgaaggaaacagggaggagg	0.000													4	2	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32269069	32269069	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32269069delC	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc011alw.1_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						AAATAGGAAACCCCCTATGAG	0.244													8	4	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34090529	34090529	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34090529delT	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				tggtggaatattttttttttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36100281	36100281	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36100281delT								APOL6 (35826 upstream) : APOL5 (13638 downstream)																							GAGATCTTAATTTTGTTAGAT	0.448													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39698033	39698034	+	IGR	INS	-	T	T	rs72574460		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39698033_39698034insT								PDGFB (57076 upstream) : RPL3 (10854 downstream)																							TCACTGCCTGCGTGCCTGAAGT	0.356													4	2	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	39997619	39997620	+	Intron	INS	-	TG	TG			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39997619_39997620insTG	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	gtatgtgtgtatgtgtgtgACC	0.228													4	2	---	---	---	---	
ENTHD1	150350	broad.mit.edu	37	22	40208029	40208030	+	Intron	INS	-	G	G	rs145029127	by1000genomes	TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40208029_40208030insG	uc003ayg.2	-							NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1											ovary(2)|skin(1)	3	Melanoma(58;0.0749)					acaaaaaaaaaacgacatagat	0.000													4	2	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44055653	44055653	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44055653delG	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzj.1_Intron|EFCAB6_uc010gzk.1_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				ATGGTAGTGAGTAAAGAGCAG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48669271	48669271	+	5'Flank	DEL	G	-	-	rs35174761		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48669271delG	hsa-mir-3201|MI0014250	+																													TCTTCTGATAGGGAGAGGACC	0.318													2	5	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	48980096	48980097	+	Intron	INS	-	CA	CA			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48980096_48980097insCA	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		cacacacacaccacacacagca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	958822	958823	+	IGR	DEL	GC	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:958822_958823delGC								SHOX (338677 upstream) : CRLF2 (356064 downstream)																							TTTCCAAGCAGCGACTCTGAGA	0.332													7	5	---	---	---	---	
ARSF	416	broad.mit.edu	37	X	3002107	3002108	+	Intron	INS	-	A	A			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3002107_3002108insA	uc004cre.1	+						ARSF_uc004crf.1_Intron	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor							extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TAAAGAAGAACAAAAAAAATGT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	27311776	27311776	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27311776delG	uc004dbt.2	-											Homo sapiens cDNA clone IMAGE:4824334.																		acttggggttgggactgaggg	0.000													4	2	---	---	---	---	
IL1RAPL1	11141	broad.mit.edu	37	X	28791563	28791563	+	Intron	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28791563delC	uc004dby.2	+							NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						tgttaattctcctctatcttt	0.000													4	2	---	---	---	---	
MID1IP1	58526	broad.mit.edu	37	X	38659625	38659625	+	5'Flank	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38659625delA	uc004dei.3	+						MID1IP1_uc010ngz.2_5'Flank	NM_001098790	NP_001092260	Q9NPA3	M1IP1_HUMAN	MID1 interacting G12-like protein						lipid biosynthetic process|negative regulation of microtubule depolymerization|positive regulation of fatty acid biosynthetic process|positive regulation of ligase activity|protein polymerization	cytosol|microtubule|nucleus					0						ACTTTCTTGCACCAGTTTACT	0.418													4	2	---	---	---	---	
CASK	8573	broad.mit.edu	37	X	41381261	41381261	+	Intron	DEL	G	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41381261delG	uc004dfl.3	-						CASK_uc004dfj.3_Intron|CASK_uc004dfk.3_Intron|CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein						cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						CCAGGAAATTGGGGCCCTGGG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	50221106	50221106	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50221106delA								DGKK (7369 upstream) : SHROOM4 (113537 downstream)																							atatctggggaaagggattcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	55949944	55949944	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55949944delA								RRAGB (164738 upstream) : KLF8 (308878 downstream)																							gttggaaattaaaaaaaaAAC	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	68826487	68826488	+	IGR	INS	-	T	T			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68826487_68826488insT								FAM155B (74138 upstream) : EDA (9423 downstream)																							ctgggcctgtctttttttttac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	78105416	78105417	+	IGR	DEL	TG	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78105416_78105417delTG								LPAR4 (92840 upstream) : P2RY10 (95412 downstream)																							TACTCtgtgttgtgtgtgtgtg	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	84816880	84816880	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84816880delT								POF1B (182132 upstream) : MIR1321 (273905 downstream)																							cccccTGTTATTTTTTTTTTA	0.020													4	2	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107614705	107614705	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107614705delA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron|COL4A6_uc004enx.2_Intron|COL4A6_uc004eny.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						TTAAAACATTAAAAAAATTCT	0.050									Alport_syndrome_with_Diffuse_Leiomyomatosis				4	2	---	---	---	---	
AMMECR1	9949	broad.mit.edu	37	X	109441522	109441522	+	3'UTR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109441522delA	uc004eoo.2	-	6					AMMECR1_uc004eop.2_3'UTR|AMMECR1_uc004eoq.2_3'UTR	NM_015365	NP_056180	Q9Y4X0	AMER1_HUMAN	AMMECR1 protein isoform 1												0						TATATGCTGCAAAAAAAAAAT	0.289													6	3	---	---	---	---	
GRIA3	2892	broad.mit.edu	37	X	122456418	122456418	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122456418delT	uc004etq.3	+						GRIA3_uc004etr.3_Intron|GRIA3_uc004ets.3_Intron|GRIA3_uc011muf.1_Intron	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform						glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AATTTTTCTCTTTTTTTTTCT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	124158279	124158279	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124158279delA								ODZ1 (60613 upstream) : None (None downstream)																							actcagccataaaaaaagtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	127889691	127889691	+	IGR	DEL	C	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127889691delC								ACTRT1 (703309 upstream) : SMARCA1 (690789 downstream)																							acgtttgtaaccccactgaat	0.100													4	2	---	---	---	---	
RBMX2	51634	broad.mit.edu	37	X	129546261	129546261	+	Intron	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129546261delT	uc004evt.2	+							NM_016024	NP_057108	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2								nucleotide binding|RNA binding			breast(3)|ovary(1)	4						AGAAAGGTGCTTTTTTTTTTT	0.219													4	3	---	---	---	---	
USP26	83844	broad.mit.edu	37	X	132219867	132219867	+	Intron	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132219867delA	uc010nrm.1	-							NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26						protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					attgatgaggaaaaaaaaaaa	0.075													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	141091586	141091587	+	IGR	INS	-	G	G			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141091586_141091587insG								MAGEC1 (94404 upstream) : MAGEC2 (198543 downstream)																							CCAATCCAAGAGGGAAAGAGGA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	146000898	146000898	+	IGR	DEL	T	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146000898delT								CXorf51 (108974 upstream) : MIR513C (270324 downstream)																							TTTAGACATCTTTAGAAAAAT	0.323													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9992152	9992152	+	IGR	DEL	A	-	-			TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9992152delA								TTTY22 (341298 upstream) : None (None downstream)																							tttttcaaatattttttcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13270122	13270122	+	IGR	DEL	T	-	-	rs75692746		TCGA-B0-5692-01A-11D-1534-10	TCGA-B0-5692-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13270122delT								None (None upstream) : None (None downstream)																							atttcttttctttttcttttg	0.000													2	5	---	---	---	---	
