Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC9A1	6548	broad.mit.edu	37	1	27440565	27440565	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27440565T>G	uc001bnm.2	-	2	1191	c.565A>C	c.(565-567)ATC>CTC	p.I189L	SLC9A1_uc010ofk.1_Intron|SLC9A1_uc001bnn.2_Missense_Mutation_p.I189L	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1	189	Cytoplasmic (Potential).				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	AAGATCAGGATGGTGCCCAGG	0.607													22	32	---	---	---	---	PASS
C1orf216	127703	broad.mit.edu	37	1	36181316	36181316	+	Missense_Mutation	SNP	C	A	A	rs147956029	byFrequency	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36181316C>A	uc001bzh.1	-	2	1095	c.607G>T	c.(607-609)GAC>TAC	p.D203Y		NM_152374	NP_689587	Q8TAB5	CA216_HUMAN	hypothetical protein LOC127703	203										skin(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AGGATGGTGTCGAAGCTCTCC	0.612											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	199	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39877427	39877427	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39877427C>T	uc009vvt.1	+	1	2252	c.1490C>T	c.(1489-1491)GCA>GTA	p.A497V	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	361											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGGCTGGCTGCATCCCAGGAT	0.408													28	39	---	---	---	---	PASS
EBNA1BP2	10969	broad.mit.edu	37	1	43630343	43630343	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43630343G>A	uc001cin.2	-	8	1038	c.841C>T	c.(841-843)CTC>TTC	p.L281F	EBNA1BP2_uc001cio.2_Missense_Mutation_p.L336F|EBNA1BP2_uc001cim.2_Missense_Mutation_p.L176F|EBNA1BP2_uc010ojx.1_Missense_Mutation_p.L336F	NM_006824	NP_006815	Q99848	EBP2_HUMAN	EBNA1 binding protein 2 isoform 2	281					ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCCTCTTGAGGCCTCTGCCA	0.567													3	98	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76252797	76252797	+	Intron	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76252797A>C	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|SNORD45C_uc001dgz.2_RNA|RABGGTB_uc001dha.1_5'Flank|SNORD45A_uc009wbu.1_5'Flank|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						TCTAAAGTTGATTATTACTAC	0.318													22	24	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76252833	76252833	+	Intron	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76252833C>T	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|SNORD45C_uc001dgz.2_RNA|RABGGTB_uc001dha.1_5'Flank|SNORD45A_uc009wbu.1_5'Flank|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						ACTCTGAGACCTGAAAATTAC	0.294													13	21	---	---	---	---	PASS
AKNAD1	254268	broad.mit.edu	37	1	109369917	109369917	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109369917T>A	uc001dwa.2	-	11	2115	c.1846A>T	c.(1846-1848)AAC>TAC	p.N616Y	AKNAD1_uc010ovb.1_Missense_Mutation_p.N323Y|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	616										ovary(3)	3						TTCTCCACGTTTTGCTTCCTA	0.368													74	156	---	---	---	---	PASS
PHGDH	26227	broad.mit.edu	37	1	120254648	120254648	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120254648G>A	uc001ehz.2	+	1	230	c.3G>A	c.(1-3)ATG>ATA	p.M1I	PHGDH_uc009whl.2_5'UTR|PHGDH_uc009whm.2_5'UTR|PHGDH_uc001eia.2_Missense_Mutation_p.M1I|PHGDH_uc009whn.2_Missense_Mutation_p.M1I	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	1					brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	CTCCAGCAATGGCTTTTGCAA	0.557													19	41	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149903193	149903193	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149903193G>C	uc001etl.3	-	13	1500	c.1249C>G	c.(1249-1251)CCC>GCC	p.P417A	SF3B4_uc001etk.1_5'Flank|MTMR11_uc001etm.1_Missense_Mutation_p.P345A|MTMR11_uc010pbm.1_Intron|MTMR11_uc010pbn.1_Missense_Mutation_p.S243C	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	417	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GTCAGGAAGGGATGTCCAGCT	0.547													34	63	---	---	---	---	PASS
LCE1F	353137	broad.mit.edu	37	1	152749010	152749010	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152749010A>C	uc010pdv.1	+	1	163	c.163A>C	c.(163-165)AGC>CGC	p.S55R		NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	55					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTGGCTCCAGCTCTGGGGG	0.502													4	70	---	---	---	---	PASS
SLC39A1	27173	broad.mit.edu	37	1	153934708	153934708	+	Silent	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153934708G>T	uc001fdh.2	-	3	475	c.306C>A	c.(304-306)GCC>GCA	p.A102A	SLC39A1_uc001fdi.2_Silent_p.A102A|SLC39A1_uc001fdj.2_Silent_p.A102A|SLC39A1_uc001fdk.2_Silent_p.A102A|SLC39A1_uc010pee.1_Intron|SLC39A1_uc001fdl.2_Silent_p.A102A	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter),	102	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		TCACGTGCAAGGCTGCCAGGG	0.582													100	208	---	---	---	---	PASS
RPS27	6232	broad.mit.edu	37	1	153963625	153963625	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153963625A>C	uc001fdv.2	+	2	75	c.41A>C	c.(40-42)GAG>GCG	p.E14A		NM_001030	NP_001021	P42677	RS27_HUMAN	ribosomal protein S27	14					cell proliferation|endocrine pancreas development|mitotic prometaphase|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleus	DNA binding|structural constituent of ribosome|zinc ion binding				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTCCAGAAGAGGAGAAGAGG	0.498													4	15	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155207294	155207294	+	Silent	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155207294C>T	uc001fjh.2	-	7	987	c.837G>A	c.(835-837)CTG>CTA	p.L279L	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Silent_p.L166L|GBA_uc010pfx.1_Silent_p.L230L|GBA_uc001fji.2_Silent_p.L279L|GBA_uc001fjj.2_Silent_p.L279L|GBA_uc001fjk.2_Silent_p.L279L|GBA_uc001fjl.2_Silent_p.L279L|GBA_uc010pfy.1_Silent_p.L192L|GBA_uc009wqk.1_Silent_p.L192L	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	279					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	ATCCACTCAACAGCCCAGCAG	0.537									Gaucher_disease_type_I				24	36	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165414253	165414253	+	5'UTR	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165414253C>T	uc001gda.2	-	1					RXRG_uc001gdb.1_5'UTR	NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	CGCTTCCTAGCAGCCCGGGGA	0.582													4	5	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183102612	183102612	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183102612G>A	uc001gpy.3	+	22	4033	c.3776G>A	c.(3775-3777)AGG>AAG	p.R1259K		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1259	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAGGCCAAAAGGGCCGGTGAC	0.517													69	152	---	---	---	---	PASS
RGS2	5997	broad.mit.edu	37	1	192780790	192780790	+	3'UTR	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192780790A>C	uc001gsl.2	+	5						NM_002923	NP_002914	P41220	RGS2_HUMAN	regulator of G-protein signaling 2						cell cycle|negative regulation of cardiac muscle hypertrophy|negative regulation of G-protein coupled receptor protein signaling pathway|negative regulation of MAP kinase activity|negative regulation of phospholipase activity|positive regulation of cardiac muscle contraction|regulation of adrenergic receptor signaling pathway|regulation of translation|relaxation of cardiac muscle	cytosol|internal side of plasma membrane|mitochondrion|nucleolus	calmodulin binding|GTPase activator activity|signal transducer activity				0						AAGGACTGTGACCTGCCATAA	0.443													11	25	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163137878	163137878	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163137878C>A	uc002uce.2	-	7	1706	c.1484G>T	c.(1483-1485)GGG>GTG	p.G495V		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	495	Helicase ATP-binding.				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						CTTCGTGGCCCCTCCAACACC	0.393													4	121	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166930140	166930140	+	5'UTR	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166930140C>T	uc010zcz.1	-	1						NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	ATCTTGTCATCCTGCACATTT	0.358													13	127	---	---	---	---	PASS
SGPP2	130367	broad.mit.edu	37	2	223386656	223386656	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223386656C>G	uc010zlo.1	+	3	549	c.549C>G	c.(547-549)GAC>GAG	p.D183E	SGPP2_uc010zlp.1_Missense_Mutation_p.D55E	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	183					sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		CTACTATGGACAGATACCAGG	0.493													5	103	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52620362	52620362	+	Intron	SNP	T	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620362T>C	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfa.1_3'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTCTAAGTTTGAATACTTTA	0.284			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								31	22	---	---	---	---	PASS
MBNL1	4154	broad.mit.edu	37	3	152018067	152018067	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152018067C>T	uc003ezm.2	+	1	874	c.85C>T	c.(85-87)CGG>TGG	p.R29W	MBNL1_uc003ezh.2_Missense_Mutation_p.R29W|MBNL1_uc003ezi.2_Missense_Mutation_p.R29W|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Missense_Mutation_p.R29W|MBNL1_uc003ezp.2_Missense_Mutation_p.R29W|MBNL1_uc003ezn.2_Missense_Mutation_p.R29W|MBNL1_uc003ezo.2_Missense_Mutation_p.R29W|MBNL1_uc003ezg.1_RNA|MBNL1_uc003ezk.1_RNA	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	29	C3H1-type 1.				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GACTTGCTCACGGCCAGACAC	0.438													11	153	---	---	---	---	PASS
OTOL1	131149	broad.mit.edu	37	3	161214803	161214803	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161214803A>T	uc011bpb.1	+	1	208	c.208A>T	c.(208-210)ACC>TCC	p.T70S		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	70						collagen					0						AGAACCAATTACCAAACCCTC	0.468													9	184	---	---	---	---	PASS
LOC348926	348926	broad.mit.edu	37	4	3944160	3944160	+	RNA	SNP	T	A	A	rs139111672	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3944160T>A	uc011bvu.1	-	6		c.2922A>T			LOC348926_uc003ghn.2_RNA	NR_024253				Homo sapiens hypothetical protein LOC348926, mRNA (cDNA clone IMAGE:4546485), partial cds.												0						AAGCTAAACCTGTTCCGGAAG	0.537													3	36	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56884018	56884018	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56884018G>T	uc003hbi.2	+	22	3241	c.3007G>T	c.(3007-3009)GAG>TAG	p.E1003*	CEP135_uc003hbj.2_Nonsense_Mutation_p.E709*	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	1003	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					CCTTGAGTTTGAGAGGGTAAG	0.328													17	27	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106156445	106156445	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106156445T>A	uc003hxk.2	+	3	1732	c.1346T>A	c.(1345-1347)GTG>GAG	p.V449E	TET2_uc011cez.1_Missense_Mutation_p.V470E|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.V449E|TET2_uc003hxi.1_Missense_Mutation_p.V449E	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	449					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTAAGGGAAGTGAAAATAGAG	0.458			Mis N|F		MDS								23	27	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125631792	125631792	+	5'UTR	SNP	A	C	C	rs139864599	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125631792A>C	uc003ifg.3	-	1					ANKRD50_uc011cgo.1_Intron|ANKRD50_uc010inw.2_5'UTR	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50											central_nervous_system(1)	1						GTAAAATTCAACAGCCACAGA	0.373													9	26	---	---	---	---	PASS
GYPB	2994	broad.mit.edu	37	4	144940457	144940457	+	5'UTR	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144940457G>T	uc003ijm.1	-	1					GYPA_uc003ijn.2_Intron|GYPB_uc011chs.1_RNA|GYPB_uc011cht.1_RNA|GYPB_uc011chu.1_RNA|GYPB_uc010ioo.1_RNA|GYPB_uc010iop.2_RNA|GYPB_uc011chv.1_RNA|GYPB_uc011chw.1_RNA|GYPB_uc011chx.1_RNA|GYPB_uc011chy.1_RNA|GYPB_uc011chz.1_RNA	NM_002100	NP_002091	P06028	GLPB_HUMAN	glycophorin B precursor							integral to plasma membrane					0	all_hematologic(180;0.158)					ATCATGAGCTGGTTCCTGAAG	0.398													21	28	---	---	---	---	PASS
KIAA1191	57179	broad.mit.edu	37	5	175782579	175782579	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175782579C>T	uc003mdw.2	-	4	574	c.202G>A	c.(202-204)GCC>ACC	p.A68T	KIAA1191_uc003mdx.2_Missense_Mutation_p.A49T|KIAA1191_uc003mdy.2_Missense_Mutation_p.A68T|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177	Q96A73	K1191_HUMAN	hypothetical protein LOC57179 isoform a	68							protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GATACCTTGGCGAGGTGCTGA	0.592													4	188	---	---	---	---	PASS
RPS18	6222	broad.mit.edu	37	6	33240470	33240470	+	Silent	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33240470G>A	uc003odp.1	+	2	114	c.69G>A	c.(67-69)CGG>CGA	p.R23R	VPS52_uc003odm.1_5'Flank|VPS52_uc003odn.1_5'Flank|VPS52_uc003odo.1_5'Flank|VPS52_uc011dqy.1_5'Flank|VPS52_uc011dqz.1_5'Flank|RPS18_uc010jum.1_RNA|RPS18_uc003odq.1_RNA	NM_022551	NP_072045	P62269	RS18_HUMAN	ribosomal protein S18	23					endocrine pancreas development|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	rRNA binding|structural constituent of ribosome				0						TCGATGGGCGGCGGAAAATAG	0.423													65	88	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34100944	34100944	+	Silent	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34100944G>T	uc003oir.3	-	1	500	c.330C>A	c.(328-330)TCC>TCA	p.S110S	GRM4_uc011dsn.1_Silent_p.S110S|GRM4_uc010jvh.2_Silent_p.S110S|GRM4_uc010jvi.2_5'UTR|GRM4_uc010jvk.1_Silent_p.S29S	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	110	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GGGTGTCCCTGGAGCAGGTGT	0.642													19	33	---	---	---	---	PASS
UNC5CL	222643	broad.mit.edu	37	6	41002579	41002579	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41002579A>T	uc003opi.2	-	2	324	c.235T>A	c.(235-237)TTC>ATC	p.F79I	UNC5CL_uc010jxe.1_Missense_Mutation_p.F79I	NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like	79	Cytoplasmic (Potential).				signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCCTGGTAGAAGGCAACCATC	0.562													79	134	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43402469	43402469	+	Silent	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43402469G>A	uc003ouy.1	+	4	1706	c.1491G>A	c.(1489-1491)CGG>CGA	p.R497R	ABCC10_uc003ouz.1_Silent_p.R454R|ABCC10_uc010jyo.1_5'Flank	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	497	ABC transmembrane type-1 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GGCGACTCCGGGTCATCAAAT	0.602													66	115	---	---	---	---	PASS
YIPF3	25844	broad.mit.edu	37	6	43479853	43479853	+	3'UTR	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43479853C>A	uc003ovl.1	-	9					C6orf154_uc003ovk.1_5'Flank|YIPF3_uc011dvk.1_3'UTR|YIPF3_uc010jyr.1_3'UTR|YIPF3_uc010jys.1_3'UTR|YIPF3_uc003ovm.1_3'UTR|YIPF3_uc010jyt.1_3'UTR	NM_015388	NP_056203	Q9GZM5	YIPF3_HUMAN	natural killer cell-specific antigen KLIP1						cell differentiation	integral to membrane|plasma membrane|transport vesicle					0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TAATAGTCTTCCTCCTCTCTG	0.547													49	73	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71266647	71266647	+	Intron	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71266647G>A	uc003pfj.2	+						FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_3'UTR|FAM135A_uc010kan.1_Intron|FAM135A_uc003pfp.2_Intron	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						ACTTTCTCTCGTATCTGTCAC	0.363													7	8	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157520041	157520041	+	Silent	SNP	G	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157520041G>C	uc003qqn.2	+	17	4208	c.4056G>C	c.(4054-4056)CCG>CCC	p.P1352P	ARID1B_uc003qqo.2_Silent_p.P1312P|ARID1B_uc003qqp.2_Silent_p.P1299P	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1357					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CACAGCAGCCGGTGAGTTGGC	0.567													5	8	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	160969596	160969596	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160969596A>G	uc003qtl.2	-	32	5189	c.5069T>C	c.(5068-5070)CTG>CCG	p.L1690P		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	4198	Kringle 37.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCATCGCGTCAGGTTGCAGTA	0.547													36	85	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87179833	87179833	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87179833A>G	uc003uiz.1	-	12	1593	c.1175T>C	c.(1174-1176)TTG>TCG	p.L392S	ABCB1_uc011khc.1_Missense_Mutation_p.L328S	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	392	ABC transporter 1.|Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TCTGAATTCCAAATTTCCCTT	0.318													4	133	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87179868	87179868	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87179868C>A	uc003uiz.1	-	12	1558	c.1140G>T	c.(1138-1140)AAG>AAT	p.K380N	ABCB1_uc011khc.1_Missense_Mutation_p.K316N	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	380	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TGTGCCCACTCTTCGAATAGC	0.338													4	120	---	---	---	---	PASS
CPA2	1358	broad.mit.edu	37	7	129906711	129906711	+	5'UTR	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129906711C>A	uc003vpq.2	+	1					CPA2_uc011kpc.1_5'UTR	NM_001869	NP_001860	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic) precursor						proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					TTCTGGACTCCAGGAAAACCC	0.468													60	91	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138252356	138252356	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138252356A>C	uc003vuc.2	+	10	1876	c.1661A>C	c.(1660-1662)AAC>ACC	p.N554T	TRIM24_uc003vub.2_Missense_Mutation_p.N520T	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	554					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						ATAAAGCCAAACCCCCTACAG	0.423													8	103	---	---	---	---	PASS
VPS37A	137492	broad.mit.edu	37	8	17137538	17137538	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17137538G>T	uc003wxj.2	+	7	1068	c.715G>T	c.(715-717)GTG>TTG	p.V239L	VPS37A_uc003wxk.2_Missense_Mutation_p.V214L|VPS37A_uc003wxl.2_Missense_Mutation_p.V16L	NM_152415	NP_689628	Q8NEZ2	VP37A_HUMAN	hepatocellular carcinoma related protein 1	239					cellular membrane organization|endosome transport|protein transport	centrosome|late endosome membrane|nucleus					0				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		TGTTTCTAGTGTGTCACAACT	0.323													42	76	---	---	---	---	PASS
TMEM70	54968	broad.mit.edu	37	8	74888490	74888490	+	5'UTR	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74888490C>T	uc003yab.2	+	1					TMEM70_uc003yac.2_5'UTR	NM_017866	NP_060336	Q9BUB7	TMM70_HUMAN	transmembrane protein 70 isoform a						mitochondrial proton-transporting ATP synthase complex assembly	integral to mitochondrial membrane|mitochondrial inner membrane				ovary(1)	1	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			GCAGCTGGGGCGTCCGCAGCC	0.687													6	8	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361731	105361731	+	Silent	SNP	G	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361731G>C	uc003ylx.1	+	2	1000	c.951G>C	c.(949-951)CTG>CTC	p.L317L		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	317					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATTATCTGCTGTATCGGCTCA	0.493													20	379	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131073178	131073178	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131073178C>G	uc003yta.1	-	27	2867	c.2839G>C	c.(2839-2841)GCC>CCC	p.A947P	ASAP1_uc003ysz.1_Missense_Mutation_p.A758P|ASAP1_uc011liw.1_Missense_Mutation_p.A940P	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	947	Pro-rich.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GGCTTGGGGGCCAGTTCTGTG	0.577													46	142	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131073179	131073179	+	Silent	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131073179C>G	uc003yta.1	-	27	2866	c.2838G>C	c.(2836-2838)CTG>CTC	p.L946L	ASAP1_uc003ysz.1_Silent_p.L757L|ASAP1_uc011liw.1_Silent_p.L939L	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	946	Pro-rich.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GCTTGGGGGCCAGTTCTGTGG	0.577													46	142	---	---	---	---	PASS
MTAP	4507	broad.mit.edu	37	9	21837965	21837965	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21837965T>C	uc003zph.2	+	5	519	c.406T>C	c.(406-408)TGC>CGC	p.C136R	MTAP_uc003zpi.1_Intron|MTAP_uc010mit.2_RNA|MTAP_uc011lnk.1_Missense_Mutation_p.C153R|MTAP_uc011lnl.1_Missense_Mutation_p.C69R	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase	136					nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	CAGAGGAGTGTGCCATATTCC	0.428													32	323	---	---	---	---	PASS
ALDH1A1	216	broad.mit.edu	37	9	75540461	75540461	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75540461A>G	uc004ajd.2	-	6	625	c.572T>C	c.(571-573)GTT>GCT	p.V191A	ALDH1A1_uc011lsh.1_Missense_Mutation_p.V112A|ALDH1A1_uc011lsg.1_Missense_Mutation_p.V17A	NM_000689	NP_000680	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1A1	191					cellular aldehyde metabolic process|ethanol oxidation|xenobiotic metabolic process	cytosol	aldehyde dehydrogenase (NAD) activity|androgen binding|Ras GTPase activator activity|retinal dehydrogenase activity			ovary(3)|lung(1)	4					NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	TGGTTTGACAACCACTGTGTT	0.423													45	100	---	---	---	---	PASS
OMD	4958	broad.mit.edu	37	9	95179200	95179200	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95179200A>T	uc004asd.3	-	2	1010	c.641T>A	c.(640-642)CTA>CAA	p.L214Q	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron	NM_005014	NP_005005	Q99983	OMD_HUMAN	osteomodulin precursor	214	LRR 6.				cell adhesion	proteinaceous extracellular matrix				ovary(2)	2						GAGCTGCATTAGTTTTTCCAT	0.353			T	USP6	aneurysmal bone cysts								61	124	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98220440	98220440	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98220440C>T	uc004avk.3	-	18	3211	c.3023G>A	c.(3022-3024)AGT>AAT	p.S1008N	PTCH1_uc010mro.2_Missense_Mutation_p.S857N|PTCH1_uc010mrp.2_Missense_Mutation_p.S857N|PTCH1_uc010mrq.2_Missense_Mutation_p.S857N|PTCH1_uc004avl.3_Missense_Mutation_p.S857N|PTCH1_uc010mrr.2_Missense_Mutation_p.S942N|PTCH1_uc004avm.3_Missense_Mutation_p.S1007N	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	1008	Extracellular (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	p.I963fs*2(1)		skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GTTGGGGTAACTGGACAGCCC	0.562									Basal_Cell_Nevus_syndrome				31	55	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119460313	119460313	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119460313C>A	uc004bjx.2	+	2	450	c.292C>A	c.(292-294)CTC>ATC	p.L98I	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.L98I	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	98					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						TGTGGGGCTGCTCATGTGTCG	0.587									Bardet-Biedl_syndrome				4	130	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140904474	140904474	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140904474A>T	uc004cog.2	+	17	2250	c.2105A>T	c.(2104-2106)AAT>ATT	p.N702I	CACNA1B_uc011mfd.1_Missense_Mutation_p.N233I	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	702	Helical; Name=S6 of repeat II; (Potential).|II.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	ACTCTGCTGAATGTCTTTCTG	0.602													6	56	---	---	---	---	PASS
CELF2	10659	broad.mit.edu	37	10	11047307	11047307	+	5'UTR	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11047307C>A	uc001iki.3	+	1					CELF2_uc010qbi.1_5'UTR|CELF2_uc010qbj.1_5'UTR	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						GATGTTTGAGCATACTTCTGA	0.313													13	153	---	---	---	---	PASS
SAMD8	142891	broad.mit.edu	37	10	76928376	76928376	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76928376C>T	uc001jwx.1	+	4	855	c.752C>T	c.(751-753)TCC>TTC	p.S251F	SAMD8_uc001jwy.1_Missense_Mutation_p.S251F	NM_144660	NP_653261	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	251	Helical; (Potential).				sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TTTGTGACCTCCCTCTCCGTG	0.463													55	120	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105166476	105166476	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105166476G>A	uc001kwy.1	+	7	886	c.799G>A	c.(799-801)GCT>ACT	p.A267T		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	267					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TACGGCCATTGCTACTGAACA	0.453													33	71	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1258216	1258216	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1258216G>A	uc009ycr.1	+	41	5324	c.5198G>A	c.(5197-5199)CGT>CAT	p.R1733H	MUC5B_uc009yct.1_Missense_Mutation_p.R1040H|MUC5B_uc001ltb.2_Missense_Mutation_p.R1043H|MUC5B_uc001lta.2_Missense_Mutation_p.R708H	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1040	VWFD 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TTTGCCACGCGTAGCCGGTCC	0.677													9	16	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20673985	20673985	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20673985C>G	uc001mqd.2	+	15	2494	c.2221C>G	c.(2221-2223)CCT>GCT	p.P741A	SLC6A5_uc009yic.2_Missense_Mutation_p.P506A	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	741	Cytoplasmic (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	GCATCTGGCCCCTGGAAGATT	0.438													4	209	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602672	47602672	+	Intron	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602672A>T	uc001nga.2	+						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_3'UTR	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	ctgccactaaatggctgtggg	0.075													6	7	---	---	---	---	PASS
KIRREL3	84623	broad.mit.edu	37	11	126294453	126294453	+	3'UTR	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126294453C>A	uc001qea.2	-	17					KIRREL3_uc001qeb.2_3'UTR|ST3GAL4_uc001qdx.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CCTGGCCCGTCCCCACCCGCG	0.632													18	30	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6710859	6710859	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6710859T>G	uc001qpo.2	-	5	676	c.512A>C	c.(511-513)GAT>GCT	p.D171A	CHD4_uc001qpn.2_Missense_Mutation_p.D164A|CHD4_uc001qpp.2_Missense_Mutation_p.D168A	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	171					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GGTTCGATAATCCTCCTCTGA	0.488													25	490	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546588	11546588	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546588G>T	uc010shk.1	-	3	459	c.424C>A	c.(424-426)CCA>ACA	p.P142T		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGTGGGGGTGGTCCTTGTGGC	0.597													162	436	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32369298	32369298	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32369298G>T	uc001rku.2	+	2	412	c.331G>T	c.(331-333)GAG>TAG	p.E111*	BICD1_uc001rkv.2_Nonsense_Mutation_p.E111*|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	111	Potential.				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GAAGATCTTGGAGATGCAGAA	0.537													27	49	---	---	---	---	PASS
ORMDL2	29095	broad.mit.edu	37	12	56213245	56213245	+	Silent	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56213245C>T	uc001shw.1	+	3	386	c.294C>T	c.(292-294)TCC>TCT	p.S98S	SARNP_uc009zoa.2_5'Flank|SARNP_uc001shs.3_5'Flank|SARNP_uc001sht.2_5'Flank|DNAJC14_uc001shu.1_Intron|SARNP_uc001shv.3_5'Flank	NM_014182	NP_054901	Q53FV1	ORML2_HUMAN	ORMDL2	98					ceramide metabolic process	endoplasmic reticulum membrane|integral to membrane					0						TTACCTCTTCCCGCAAGTTCC	0.512													65	157	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70983898	70983898	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70983898A>C	uc001swb.3	-	6	1272	c.1242T>G	c.(1240-1242)AAT>AAG	p.N414K	PTPRB_uc010sto.1_Missense_Mutation_p.N414K|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Missense_Mutation_p.N632K|PTPRB_uc001swa.3_Missense_Mutation_p.N632K|PTPRB_uc001swd.3_Missense_Mutation_p.N631K|PTPRB_uc009zrr.1_Missense_Mutation_p.N511K	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	414	Fibronectin type-III 5.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CCACAGAATCATTGAAGAGTA	0.517											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	65	110	---	---	---	---	PASS
GALNT4	8693	broad.mit.edu	37	12	89917616	89917616	+	Silent	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89917616C>T	uc001tbd.2	-	1	920	c.711G>A	c.(709-711)CTG>CTA	p.L237L	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Silent_p.L234L|GALNT4_uc010suo.1_Intron	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	237	Lumenal (Potential).|Catalytic subdomain A.				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0						AAAGCGGTTCCAGCCAACCGG	0.483													41	71	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95546763	95546763	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95546763C>A	uc001tdp.3	-	4	2817	c.2593G>T	c.(2593-2595)GAT>TAT	p.D865Y	FGD6_uc009zsx.2_5'UTR	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	865					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						ATTCCATTATCTTCATCCTGT	0.353													32	66	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454272	84454272	+	Silent	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454272G>A	uc001vlk.2	-	1	2257	c.1371C>T	c.(1369-1371)AAC>AAT	p.N457N		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	457	Extracellular (Potential).|LRR 10.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GCTGGATAGCGTTGTACTCCA	0.537													4	76	---	---	---	---	PASS
DNAJC3	5611	broad.mit.edu	37	13	96438228	96438228	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96438228G>A	uc001vmq.2	+	10	1219	c.1111G>A	c.(1111-1113)GAA>AAA	p.E371K	DNAJC3_uc001vmr.2_Missense_Mutation_p.E320K	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	371	TPR 9.				protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			GGAACACAATGAAAATGATCA	0.318													25	53	---	---	---	---	PASS
FAM155A	728215	broad.mit.edu	37	13	108518289	108518289	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518289G>A	uc001vql.2	-	1	1172	c.656C>T	c.(655-657)TCG>TTG	p.S219L		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	219						integral to membrane	binding			skin(1)	1						GTAAAAATCCGACAAGTTCCA	0.577													7	161	---	---	---	---	PASS
DCUN1D2	55208	broad.mit.edu	37	13	114112239	114112239	+	3'UTR	SNP	T	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114112239T>G	uc001vtr.1	-	7					DCUN1D2_uc001vts.1_RNA|DCUN1D2_uc010agw.1_3'UTR	NM_001014283	NP_001014305	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain												0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			TCATGGCTGGTCAAGAATGAC	0.522											OREG0022535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	60	---	---	---	---	PASS
CMA1	1215	broad.mit.edu	37	14	24975760	24975760	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24975760G>C	uc001wpp.1	-	3	290	c.260C>G	c.(259-261)ACA>AGA	p.T87R	CMA1_uc010alx.1_5'UTR	NM_001836	NP_001827	P23946	CMA1_HUMAN	chymase 1, mast cell preproprotein	87	Peptidase S1.				interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.0271)		CTTCTGCCATGTGTCTTCTTC	0.438													62	139	---	---	---	---	PASS
SCFD1	23256	broad.mit.edu	37	14	31122776	31122776	+	Silent	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31122776A>T	uc001wqm.1	+	10	861	c.837A>T	c.(835-837)GCA>GCT	p.A279A	SCFD1_uc001wqn.1_Silent_p.A212A|SCFD1_uc010tpg.1_Silent_p.A220A|SCFD1_uc010tph.1_Silent_p.A94A|SCFD1_uc010amf.1_Silent_p.A94A|SCFD1_uc010tpi.1_Silent_p.A187A|SCFD1_uc010amd.1_Silent_p.A111A|SCFD1_uc010ame.1_Silent_p.A212A	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	279					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		CATATCAAGCATTGGTGCACG	0.348													50	90	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106054550	106054550	+	RNA	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106054550C>T	uc010tyt.1	-	3650		c.62936G>A			uc001yrs.2_RNA|uc001yrt.2_Silent_p.G67G					Parts of antibodies, mostly variable regions.												0						TGTACAGGTCCCCGGAGGCAT	0.622													25	62	---	---	---	---	PASS
MAN2C1	4123	broad.mit.edu	37	15	75654746	75654746	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75654746G>A	uc002baf.2	-	8	963	c.946C>T	c.(946-948)CGC>TGC	p.R316C	MAN2C1_uc002bag.2_Missense_Mutation_p.R316C|MAN2C1_uc002bah.2_Missense_Mutation_p.R316C|MAN2C1_uc010bkk.2_Missense_Mutation_p.R217C|MAN2C1_uc010umi.1_Missense_Mutation_p.R98C|MAN2C1_uc010umj.1_RNA	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	316					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0						TCCTGGATGCGGGAGTACAGG	0.627													14	35	---	---	---	---	PASS
FES	2242	broad.mit.edu	37	15	91432628	91432628	+	Missense_Mutation	SNP	G	A	A	rs145351114		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91432628G>A	uc002bpv.2	+	6	857	c.761G>A	c.(760-762)CGC>CAC	p.R254H	FES_uc010uqj.1_Missense_Mutation_p.R196H|FES_uc010uqk.1_Missense_Mutation_p.R236H|FES_uc002bpw.2_RNA|FES_uc010bny.2_Missense_Mutation_p.R196H|FES_uc002bpx.2_Missense_Mutation_p.R254H|FES_uc002bpy.2_Missense_Mutation_p.R196H	NM_002005	NP_001996	P07332	FES_HUMAN	feline sarcoma oncogene isoform 1	254	Important for interaction with membranes containing phosphoinositides.				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCTGCTGCCCGCATCCAGCCT	0.632													4	81	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	8996027	8996027	+	Silent	SNP	A	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8996027A>G	uc002czl.2	-	18	2158	c.1959T>C	c.(1957-1959)GAT>GAC	p.D653D	USP7_uc010uyk.1_Silent_p.D554D|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Silent_p.D554D|USP7_uc002czk.2_Silent_p.D637D|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	653	Interaction with ICP0/VMW110.				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						GGTTTTCATTATCACTGAGCT	0.423													12	165	---	---	---	---	PASS
RRN3P3	100131998	broad.mit.edu	37	16	22441236	22441236	+	RNA	SNP	G	A	A	rs114681793	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22441236G>A	uc002dkp.2	-	5		c.1170C>T			RRN3P3_uc010vbu.1_RNA	NR_027460				Homo sapiens cDNA FLJ31180 fis, clone KIDNE2000266.												0						TGTTCCTCTCGATGATGGTGT	0.507													10	38	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51171323	51171323	+	Silent	SNP	T	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51171323T>C	uc010vgs.1	-	3	3706	c.3675A>G	c.(3673-3675)TCA>TCG	p.S1225S	SALL1_uc010vgr.1_Silent_p.S1128S|SALL1_uc010cbv.2_Silent_p.S77S	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	1225					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.S1225L(1)		skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCCCACTTCCTGATCTTGCCG	0.562													35	50	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53320220	53320220	+	Silent	SNP	T	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53320220T>G	uc002ehb.2	+	25	5318	c.5154T>G	c.(5152-5154)GTT>GTG	p.V1718V	CHD9_uc002egy.2_Silent_p.V1718V|CHD9_uc002ehc.2_Silent_p.V1718V|CHD9_uc002ehf.2_Silent_p.V832V|CHD9_uc010cbw.2_Silent_p.V86V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1718					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				AGAAAGCAGTTGCTGCTGAAC	0.363													16	28	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64981435	64981435	+	3'UTR	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64981435C>T	uc002eoi.2	-	13					CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_3'UTR|CDH11_uc010vin.1_3'UTR	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AAAAAAATACCTGTTTACACA	0.338			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			11	47	---	---	---	---	PASS
DHX38	9785	broad.mit.edu	37	16	72137588	72137588	+	Silent	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72137588G>T	uc002fcb.2	+	13	2080	c.1725G>T	c.(1723-1725)ACG>ACT	p.T575T	DHX38_uc010vmp.1_Intron	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	575	Helicase ATP-binding.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)				ATGGTTACACGGACTATGGGA	0.562													3	77	---	---	---	---	PASS
CBFA2T3	863	broad.mit.edu	37	16	88958664	88958664	+	Silent	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88958664C>T	uc002fmm.1	-	4	795	c.609G>A	c.(607-609)GTG>GTA	p.V203V	CBFA2T3_uc002fml.1_Silent_p.V117V|CBFA2T3_uc010cif.1_Silent_p.V142V|CBFA2T3_uc002fmn.1_Silent_p.V178V	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16	203	TAFH.|Mediates localization to the nucleus (By similarity).|Mediates interaction with PDE7A (in isoform 2).				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CCAGGCCCAGCACCAGTGTGC	0.627			T	RUNX1	AML								19	47	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1560044	1560044	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1560044C>A	uc002fte.2	-	35	5631	c.5517G>T	c.(5515-5517)TGG>TGT	p.W1839C		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1839	Involved in interaction with pre-mRNA 5' splice site.					catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CAGCTGTCTTCCACTTAGCCA	0.483													4	52	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630635	44630635	+	3'UTR	SNP	A	G	G	rs150521815	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630635A>G	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						TACACAGCATACAATTCCTGT	0.239													4	34	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57109286	57109286	+	Missense_Mutation	SNP	C	T	T	rs112762655	byFrequency	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57109286C>T	uc002iwy.3	-	18	2363	c.1919G>A	c.(1918-1920)CGC>CAC	p.R640H	TRIM37_uc002iwz.3_Missense_Mutation_p.R640H|TRIM37_uc002ixa.3_Missense_Mutation_p.R518H|TRIM37_uc010woc.1_Missense_Mutation_p.R606H	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	640						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AGCAGGTGGGCGAGGCTGTAA	0.373									Mulibrey_Nanism				14	199	---	---	---	---	PASS
MAP3K3	4215	broad.mit.edu	37	17	61762880	61762880	+	Silent	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61762880C>T	uc002jbg.2	+	8	959	c.640C>T	c.(640-642)CTG>TTG	p.L214L	MAP3K3_uc002jbe.2_Silent_p.L245L|MAP3K3_uc002jbf.2_Silent_p.L245L|MAP3K3_uc002jbh.2_Silent_p.L245L|MAP3K3_uc010wpo.1_Silent_p.L129L|MAP3K3_uc010wpp.1_Silent_p.L214L	NM_002401	NP_002392	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	214					MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						CTTACAGATGCTGGATCCCCT	0.537													23	44	---	---	---	---	PASS
MC4R	4160	broad.mit.edu	37	18	58039328	58039328	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58039328G>T	uc002lie.1	-	1	674	c.255C>A	c.(253-255)AGC>AGA	p.S85R		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	85	Helical; Name=2; (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)				CCACAGCCAAGCTGCAGATGA	0.433													46	69	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67872495	67872495	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67872495C>A	uc002lkp.2	-	2	156	c.88G>T	c.(88-90)GAG>TAG	p.E30*	RTTN_uc010xfb.1_5'UTR|RTTN_uc002lkq.1_Nonsense_Mutation_p.E30*	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	30							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AAGTTGTGCTCAATCTTGCAG	0.463													59	120	---	---	---	---	PASS
CLEC4M	10332	broad.mit.edu	37	19	7833849	7833849	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7833849C>T	uc002mih.2	+	8	1224	c.1106C>T	c.(1105-1107)CCC>CTC	p.P369L	CLEC4M_uc010xjw.1_Missense_Mutation_p.P325L|CLEC4M_uc010dvt.2_Missense_Mutation_p.P346L|CLEC4M_uc010dvs.2_Missense_Mutation_p.P368L|CLEC4M_uc010xjx.1_Missense_Mutation_p.P341L|CLEC4M_uc002mhz.2_3'UTR|CLEC4M_uc002mic.2_3'UTR|CLEC4M_uc002mia.2_Missense_Mutation_p.P256L	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	392	Extracellular (Probable).				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						TGCAAAAAGCCCGCAGCCTGC	0.498													33	57	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8616987	8616987	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8616987T>C	uc002mkg.2	-	7	680	c.566A>G	c.(565-567)AAC>AGC	p.N189S	MYO1F_uc002mkh.2_Missense_Mutation_p.N189S|MYO1F_uc010xkf.1_Missense_Mutation_p.N189S	NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	189	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						CAGCAAGAAGTTGGAGATCTT	0.562													8	167	---	---	---	---	PASS
ZNF121	7675	broad.mit.edu	37	19	9677482	9677482	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9677482G>A	uc010xkp.1	-	4	539	c.307C>T	c.(307-309)CTT>TTT	p.L103F	ZNF121_uc010dwt.2_Missense_Mutation_p.L103F|ZNF121_uc010xkq.1_Missense_Mutation_p.L103F	NM_001008727	NP_001008727	P58317	ZN121_HUMAN	zinc finger protein 121	103	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTTGCCTGAAGATGTGACTGA	0.438													6	106	---	---	---	---	PASS
ZNF121	7675	broad.mit.edu	37	19	9677483	9677483	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9677483A>T	uc010xkp.1	-	4	538	c.306T>A	c.(304-306)CAT>CAA	p.H102Q	ZNF121_uc010dwt.2_Missense_Mutation_p.H102Q|ZNF121_uc010xkq.1_Missense_Mutation_p.H102Q	NM_001008727	NP_001008727	P58317	ZN121_HUMAN	zinc finger protein 121	102	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTGCCTGAAGATGTGACTGAT	0.438													6	104	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21106092	21106092	+	5'UTR	SNP	T	C	C			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21106092T>C	uc002npg.3	+	1					ZNF85_uc002npf.2_RNA|ZNF85_uc002nph.1_5'Flank	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						GCTCTAGGTCTTGTTTTCCCT	0.622													6	13	---	---	---	---	PASS
WDR62	284403	broad.mit.edu	37	19	36574074	36574074	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36574074G>A	uc002odc.2	+	11	1572	c.1481G>A	c.(1480-1482)GGG>GAG	p.G494E	WDR62_uc002odd.2_Missense_Mutation_p.G494E	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	494	WD 7.				cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GTGAAAGCCGGGGTGCGGGTC	0.592													9	13	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39967115	39967115	+	3'UTR	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39967115G>A	uc002olo.3	+	30					SUPT5H_uc002olp.3_3'UTR|SUPT5H_uc002olq.3_3'UTR|SUPT5H_uc002oln.3_3'UTR|SUPT5H_uc002olr.3_3'UTR	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a						cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGTGACACAAGATCCTCCTGC	0.532													20	27	---	---	---	---	PASS
MAP3K10	4294	broad.mit.edu	37	19	40698354	40698354	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40698354C>A	uc002ona.2	+	1	704	c.416C>A	c.(415-417)GCG>GAG	p.A139E		NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase	139	Protein kinase.				activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						GCAGTGACAGCGGAGCAGGTG	0.667													20	38	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41594486	41594486	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41594486C>G	uc002opt.2	+	1	119	c.110C>G	c.(109-111)CCC>CGC	p.P37R		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	37					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	CCTCCGGGACCCACCCCATTG	0.582													32	65	---	---	---	---	PASS
AXL	558	broad.mit.edu	37	19	41763495	41763495	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41763495G>A	uc010ehj.2	+	19	2484	c.2294G>A	c.(2293-2295)GGA>GAA	p.G765E	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehk.2_Missense_Mutation_p.G756E	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	765	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						CTGCGCCAGGGAAATCGCCTG	0.562													49	137	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49963012	49963012	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963012G>A	uc002pnt.2	+	4	522	c.406G>A	c.(406-408)GAC>AAC	p.D136N	ALDH16A1_uc010yar.1_Missense_Mutation_p.D136N|ALDH16A1_uc010yas.1_5'UTR|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	136							oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		AGAGGTTCGAGACGGGGACGT	0.642													26	45	---	---	---	---	PASS
ETFB	2109	broad.mit.edu	37	19	51848472	51848472	+	Missense_Mutation	SNP	C	T	T	rs145173884		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51848472C>T	uc002pwh.2	-	6	853	c.761G>A	c.(760-762)CGG>CAG	p.R254Q	ETFB_uc002pwg.2_Missense_Mutation_p.R345Q	NM_001985	NP_001976	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	254					respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		GGCTCAAATCCGCCCAATCTC	0.488													27	67	---	---	---	---	PASS
FPR2	2358	broad.mit.edu	37	19	52272624	52272624	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52272624G>A	uc002pxr.2	+	2	758	c.713G>A	c.(712-714)CGT>CAT	p.R238H	FPR2_uc002pxs.3_Missense_Mutation_p.R238H|FPR2_uc010epf.2_Missense_Mutation_p.R238H	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	238	Cytoplasmic (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4						AAATCCAGCCGTCCCTTACGG	0.507													5	67	---	---	---	---	PASS
KIR3DP1	768329	broad.mit.edu	37	19	55297923	55297923	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55297923G>T	uc010yfi.1	+	3	80	c.79G>T	c.(79-81)GAC>TAC	p.D27Y	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Intron	NM_001015070	NP_001015070			killer-cell Ig-like receptor												0				GBM - Glioblastoma multiforme(193;0.0192)		AGGTGGTCAGGACAAGCCCTT	0.567													27	46	---	---	---	---	PASS
ZNF547	284306	broad.mit.edu	37	19	57876543	57876543	+	Intron	SNP	T	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57876543T>G	uc002qol.2	+						TRAPPC2P1_uc002qok.1_RNA|ZNF547_uc010ygx.1_Intron	NM_173631	NP_775902	Q8IVP9	ZN547_HUMAN	zinc finger protein 547						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAATCCATTTTATGAACCCA	0.299													6	10	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5903113	5903113	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5903113G>T	uc002wmg.2	+	4	629	c.323G>T	c.(322-324)GGG>GTG	p.G108V	CHGB_uc010zqz.1_Intron	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	108						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GGAGCCCCAGGGGAGGAGGAC	0.582													3	33	---	---	---	---	PASS
C20orf132	140699	broad.mit.edu	37	20	35772198	35772198	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35772198C>A	uc010zvu.1	-	13	1378	c.1287G>T	c.(1285-1287)TTG>TTT	p.L429F	C20orf132_uc002xgk.2_Missense_Mutation_p.L102F|C20orf132_uc002xgm.2_Missense_Mutation_p.L429F|C20orf132_uc002xgn.2_Missense_Mutation_p.L394F	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	304											0		Myeloproliferative disorder(115;0.00878)				GACATTTTGTCAATGCTCTTT	0.333													8	12	---	---	---	---	PASS
MC3R	4159	broad.mit.edu	37	20	54824503	54824503	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54824503C>A	uc002xxb.2	+	1	716	c.604C>A	c.(604-606)CTC>ATC	p.L202I		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	239	Helical; Name=5; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			CATGATGCTCCTCATGGGCAC	0.592													51	73	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60904899	60904899	+	Silent	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60904899C>G	uc002ycq.2	-	32	4120	c.4053G>C	c.(4051-4053)CTG>CTC	p.L1351L		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1351	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCACGTCCAGCAGGGCCTGGC	0.677													14	16	---	---	---	---	PASS
C21orf99	149992	broad.mit.edu	37	21	14414855	14414855	+	RNA	SNP	A	G	G	rs141732548	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14414855A>G	uc002yiy.3	+	2		c.292A>G			C21orf99_uc002yja.3_RNA					Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						GCCAATGGCCATGCAGAAGTA	0.448													7	68	---	---	---	---	PASS
NF2	4771	broad.mit.edu	37	22	30074218	30074218	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30074218G>A	uc003age.3	+	14	1923	c.1480G>A	c.(1480-1482)GAC>AAC	p.D494N	NF2_uc003afy.3_Missense_Mutation_p.D494N|NF2_uc003afz.3_Missense_Mutation_p.D411N|NF2_uc003agf.3_Missense_Mutation_p.D494N|NF2_uc003agb.3_Missense_Mutation_p.D417N|NF2_uc003agc.3_Missense_Mutation_p.D456N|NF2_uc003agd.3_RNA|NF2_uc003agg.3_Missense_Mutation_p.D494N|NF2_uc003aga.3_Missense_Mutation_p.D452N|NF2_uc003agh.3_Missense_Mutation_p.D453N|NF2_uc003agi.3_Missense_Mutation_p.D411N|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Missense_Mutation_p.D456N|NF2_uc010gvp.2_Missense_Mutation_p.D158N|NF2_uc011akq.1_Missense_Mutation_p.D120N	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1	494					actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.P483fs*17(1)|p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GTTGCCTCCTGACATACCAAG	0.448			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				52	114	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50902833	50902833	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50902833G>T	uc003blh.2	-	15	1869	c.1674C>A	c.(1672-1674)AAC>AAA	p.N558K	SBF1_uc011arx.1_Missense_Mutation_p.N222K|SBF1_uc003bli.2_Missense_Mutation_p.N559K	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	558					protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GCCGGGCGCTGTTGACATGCA	0.637													4	68	---	---	---	---	PASS
CA5B	11238	broad.mit.edu	37	X	15768234	15768234	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15768234C>G	uc004cxe.2	+	2	205	c.88C>G	c.(88-90)CCA>GCA	p.P30A		NM_007220	NP_009151	Q9Y2D0	CAH5B_HUMAN	carbonic anhydrase VB, mitochondrial precursor	30					one-carbon metabolic process	mitochondrion	carbonate dehydratase activity|zinc ion binding				0	Hepatocellular(33;0.183)					GAGATTCATGCCAGCGAGGCC	0.458													12	129	---	---	---	---	PASS
S100A10	6281	broad.mit.edu	37	1	151955955	151955955	+	Intron	DEL	T	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151955955delT	uc001ezl.2	-							NM_002966	NP_002957	P60903	S10AA_HUMAN	S100 calcium binding protein A10						signal transduction		calcium ion binding|receptor binding				0	Melanoma(130;0.0648)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCTAAATGTATTTTTTTTTTT	0.333													3	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800931	153800932	+	Intron	INS	-	AC	AC	rs144104082	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800931_153800932insAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTCTcacacatacacacacaca	0.233													6	4	---	---	---	---	
KCNT2	343450	broad.mit.edu	37	1	196434544	196434544	+	Intron	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196434544delA	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc009wyv.1_Intron	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						AAAAAGTTGTAAATTTTGATA	0.274													43	27	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	220091955	220091955	+	Intron	DEL	T	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220091955delT	uc001hlw.2	-						SLC30A10_uc001hlu.1_Intron|SLC30A10_uc001hlv.2_5'UTR|SLC30A10_uc001hlx.2_Intron	NM_018713	NP_061183	Q6XR72	ZNT10_HUMAN	solute carrier family 30 (zinc transporter),						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TTGGTTTTTGTTTTGGTTAGA	0.438													16	11	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71816962	71816963	+	Intron	DEL	TG	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71816962_71816963delTG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GCtgtgtgtatgtgtgtgtgtg	0.351													4	2	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112767558	112767559	+	Frame_Shift_Ins	INS	-	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112767558_112767559insA	uc002thk.1	+	15	2116_2117	c.1994_1995insA	c.(1993-1995)CCAfs	p.P665fs	MERTK_uc002thl.1_Frame_Shift_Ins_p.P489fs	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	665	Protein kinase.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						CAAGGCATCCCAAAGCCCATGG	0.426													151	88	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166870175	166870175	+	Intron	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166870175delA	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TAAGACAATGAAACAAAGGAT	0.308													16	11	---	---	---	---	
USP40	55230	broad.mit.edu	37	2	234442438	234442438	+	Intron	DEL	A	-	-	rs11332355		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234442438delA	uc010zmr.1	-						USP40_uc010zmt.1_Intron	NM_018218	NP_060688	Q9NVE5	UBP40_HUMAN	ubiquitin thioesterase 40						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		ACACAGAAACAAAAAAAAAAA	0.294													6	4	---	---	---	---	
ZNF148	7707	broad.mit.edu	37	3	124951653	124951653	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124951653delA	uc003ehx.3	-	9	2403	c.1917delT	c.(1915-1917)AATfs	p.N639fs	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Frame_Shift_Del_p.N639fs|ZNF148_uc010hsa.2_Frame_Shift_Del_p.N639fs|ZNF148_uc003eia.3_Frame_Shift_Del_p.N639fs|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	639					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						ATGCTGGCTGATTTGGGAGGG	0.453													187	102	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184552423	184552423	+	Intron	DEL	T	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184552423delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc003fpc.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGTTTTTCTTTTTTTTTTT	0.343													4	2	---	---	---	---	
TFRC	7037	broad.mit.edu	37	3	195802340	195802340	+	Intron	DEL	C	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195802340delC	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225	P02786	TFR1_HUMAN	transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)		GCTATATATTCCTTAGGGTGT	0.423			T	BCL6	NHL								8	4	---	---	---	---	
CTNNA1	1495	broad.mit.edu	37	5	138253221	138253224	+	Intron	DEL	TTTA	-	-	rs66467400		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138253221_138253224delTTTA	uc003ldh.2	+						CTNNA1_uc011cyx.1_Intron|CTNNA1_uc011cyy.1_Intron|CTNNA1_uc003ldi.2_Intron|CTNNA1_uc003ldj.2_Intron|CTNNA1_uc003ldl.2_Intron	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1						adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAGTACAGTTTTTATTTGTTTTAT	0.314													4	2	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17783812	17783812	+	Intron	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17783812delA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			AAATAATGTGAATCTGGATAG	0.328													3	6	---	---	---	---	
TAPBP	6892	broad.mit.edu	37	6	33280796	33280796	+	Intron	DEL	T	-	-	rs67868917		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33280796delT	uc003odx.1	-						TAPBP_uc010jus.1_Intron|TAPBP_uc003ody.2_Intron|TAPBP_uc003odz.2_Intron|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Intron	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						TTTTTTTTTGTTTTTTTTTTT	0.303													4	3	---	---	---	---	
ARHGAP18	93663	broad.mit.edu	37	6	129962770	129962770	+	Intron	DEL	T	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129962770delT	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050	Q8N392	RHG18_HUMAN	Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		CTAAGCTAACTTACTTATGCC	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158195269	158195270	+	IGR	INS	-	G	G	rs150472202	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158195269_158195270insG								ZDHHC14 (100293 upstream) : SNX9 (49024 downstream)																							gaggtggaggagtggaggaggt	0.322													4	2	---	---	---	---	
TMEM130	222865	broad.mit.edu	37	7	98457692	98457692	+	Intron	DEL	A	-	-	rs67317732		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98457692delA	uc003upo.2	-						TMEM130_uc011kiq.1_Intron|TMEM130_uc011kir.1_Intron|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			actgcatctcaaaaaaaaaaa	0.249													12	8	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38090491	38090492	+	Intron	DEL	TC	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38090491_38090492delTC	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_5'Flank	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			CTGATAGTTTTCTTTTGTCTTT	0.421													19	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55243463	55243464	+	IGR	INS	-	A	A	rs143800844		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55243463_55243464insA								MRPL15 (182389 upstream) : SOX17 (127031 downstream)																							AGTTTAGTTTGAAAAAAAAAAA	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99491538	99491538	+	IGR	DEL	C	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99491538delC								LOC441455 (1789 upstream) : ZNF510 (26609 downstream)																							CCATGGGGTTCCCTCCAGAGT	0.393													14	12	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69797906	69797908	+	In_Frame_Del	DEL	TCT	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69797906_69797908delTCT	uc001jng.3	-	5	716_718	c.405_407delAGA	c.(403-408)TCAGAT>TCT	p.D136del	HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_In_Frame_Del_p.D136del|HERC4_uc009xpr.2_In_Frame_Del_p.D136del|HERC4_uc001jni.3_5'UTR|HERC4_uc001jnj.2_In_Frame_Del_p.D136del	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a	136	RCC1 3.				cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						AATCTGGATATCTGACAAACTTT	0.271													59	34	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	atctaaaaaagaaaaaaaaAAA	0.188													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262702	130262703	+	IGR	INS	-	A	A	rs66538679		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262702_130262703insA								MKI67 (338234 upstream) : None (None downstream)																							cctcctcctccccatccttccc	0.040													5	4	---	---	---	---	
MRE11A	4361	broad.mit.edu	37	11	94203462	94203462	+	Intron	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94203462delA	uc001peu.2	-						MRE11A_uc001pev.2_Intron|MRE11A_uc009ywj.2_Intron	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				TCAATGACTTAAAAAAAAAAA	0.318								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109858919	109858919	+	Intron	DEL	T	-	-	rs76061626		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109858919delT	uc010sxn.1	+							NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H							myosin complex	motor activity				0						GCCTTCTGGATTTTTTTTTTT	0.333													8	4	---	---	---	---	
ATP8A2	51761	broad.mit.edu	37	13	26411562	26411565	+	Intron	DEL	CACA	-	-	rs72194516	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26411562_26411565delCACA	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACCCCACCACcacacacacacaca	0.382													4	2	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77643002	77643002	+	Intron	DEL	G	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77643002delG	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron|MYCBP2_uc001vke.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TAAAAATATAGGGTTAGTTTG	0.338													73	36	---	---	---	---	
NUMB	8650	broad.mit.edu	37	14	73750635	73750636	+	Intron	INS	-	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73750635_73750636insT	uc001xny.1	-						NUMB_uc010aro.1_Intron|NUMB_uc010arp.1_Intron|NUMB_uc010arq.1_Intron|NUMB_uc010arr.1_Intron|NUMB_uc001xoa.1_Intron|NUMB_uc001xnz.1_Intron|NUMB_uc001xob.1_Intron|NUMB_uc001xod.1_Intron|NUMB_uc001xoc.1_Intron|NUMB_uc010ars.1_Intron|NUMB_uc010ttz.1_Intron	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1						axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		ACGGACCTTAGTTTTCCCACTA	0.421													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106899139	106899140	+	Splice_Site	INS	-	T	T			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106899139_106899140insT	uc010tyt.1	-	267		c.10989_splice	c.e267+1		uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						GTGAATCGGCCCTTCACAGAGT	0.500													17	20	---	---	---	---	
TUBGCP5	114791	broad.mit.edu	37	15	22867122	22867123	+	Intron	INS	-	AAG	AAG	rs79823960		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22867122_22867123insAAG	uc001yur.3	+						TUBGCP5_uc001yuq.2_Intron	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AAAAAAAAAAAAAGTTGGTGGT	0.322													6	5	---	---	---	---	
TPSAB1	7177	broad.mit.edu	37	16	1291717	1291718	+	Intron	INS	-	G	G			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1291717_1291718insG	uc002ckz.2	+						TPSAB1_uc010uux.1_Intron	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor						defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				CTGGGGACAGTGGAGGTGGGGC	0.703													6	4	---	---	---	---	
ACSM5	54988	broad.mit.edu	37	16	20442103	20442104	+	Intron	INS	-	GGAAAGAAGGAAG	GGAAAGAAGGAAG	rs140995429	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20442103_20442104insGGAAAGAAGGAAG	uc002dhe.2	+							NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						gaaagaggaaaggaaggagtga	0.064													4	2	---	---	---	---	
ZKSCAN2	342357	broad.mit.edu	37	16	25264515	25264516	+	Intron	INS	-	TA	TA			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25264515_25264516insTA	uc002dod.3	-						ZKSCAN2_uc010vcl.1_Intron|ZKSCAN2_uc002doe.2_Intron	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		ACACAGTACCCTAAAGCTggga	0.178													6	4	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701506	85701507	+	Intron	INS	-	GTCCA	GTCCA	rs148610400	by1000genomes	TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701506_85701507insGTCCA	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CAACAAAAATGGTCCACGTACC	0.436													4	2	---	---	---	---	
ATP5G1	516	broad.mit.edu	37	17	46970877	46970877	+	Intron	DEL	T	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46970877delT	uc002iog.2	+						ATP5G1_uc002ioh.2_Intron	NM_005175	NP_005166	P05496	AT5G1_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP hydrolysis coupled proton transport|mitochondrial ATP synthesis coupled proton transport|respiratory electron transport chain	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding				0						ACGCCATCAGTGTTTAATGAA	0.527													13	12	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482169	59482169	+	Intron	DEL	C	-	-	rs35619711		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482169delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R354fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						GAGGTGGCGGCGGGGGGTCCT	0.706													1	5	---	---	---	---	
MPPE1	65258	broad.mit.edu	37	18	11886304	11886304	+	Intron	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11886304delA	uc002kqf.2	-						MPPE1_uc002kqn.2_Intron|MPPE1_uc002kqg.2_Intron|MPPE1_uc002kqh.2_Intron|MPPE1_uc002kqi.2_Intron|MPPE1_uc002kqj.2_Intron|MPPE1_uc002kqk.2_Intron|MPPE1_uc002kql.2_Intron|MPPE1_uc002kqm.2_Intron|MPPE1_uc010dla.1_3'UTR	NM_023075	NP_075563	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1 precursor						ER to Golgi vesicle-mediated transport|GPI anchor biosynthetic process	cis-Golgi network|endoplasmic reticulum exit site|ER-Golgi intermediate compartment membrane|integral to membrane	GPI anchor binding|manganese ion binding|phosphoric diester hydrolase activity				0						GGTTTACTGGAAAAAAAAAAA	0.378													7	4	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11168782	11168783	+	Intron	INS	-	A	A			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11168782_11168783insA	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc002mqh.3_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				aactccgtctcaaaaaaaaaaa	0.228			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	2	---	---	---	---	
GIPR	2696	broad.mit.edu	37	19	46177121	46177122	+	Intron	INS	-	A	A	rs10641507		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46177121_46177122insA	uc002pcu.1	+						GIPR_uc002pct.1_Intron|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_Intron|MIR642_hsa-mir-642|MI0003657_5'Flank	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		gaccatgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADAMTS5	11096	broad.mit.edu	37	21	28338273	28338273	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28338273delA	uc002ymg.2	-	1	1167	c.438delT	c.(436-438)TTTfs	p.F146fs		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	146					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						CACAGAGGTCAAAGACAGCCA	0.672													34	15	---	---	---	---	
C21orf45	54069	broad.mit.edu	37	21	33642573	33642574	+	Intron	INS	-	A	A	rs11397095		TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33642573_33642574insA	uc002ypi.2	-							NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						GAGGTCAAAGCAAAAAAAAAAA	0.287													9	6	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-B8-4153-01B-11D-1669-08	TCGA-B8-4153-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			7	4	---	---	---	---	
