Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
SMUG1	23583	broad.mit.edu	37	12	54576295	54576295	+	Missense_Mutation	SNP	T	A	A			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr12:54576295T>A	uc001sff.1	-	4	527	c.398A>T	c.(397-399)CAG>CTG	p.Q133L	SMUG1_uc001sfa.1_5'Flank|SMUG1_uc001sfe.1_3'UTR|SMUG1_uc001sfg.1_Missense_Mutation_p.Q133L|SMUG1_uc009znf.1_Missense_Mutation_p.Q133L|SMUG1_uc001sfb.3_Missense_Mutation_p.Q133L|SMUG1_uc001sfc.3_Missense_Mutation_p.Q133L|SMUG1_uc001sfd.3_Missense_Mutation_p.Q133L	NM_014311	NP_055126	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional	133				Missing (in Ref. 3; BAC03670).	depyrimidination	nucleolus|nucleoplasm	DNA binding|protein binding|single-strand selective uracil DNA N-glycosylase activity				0						CACTTCTGACTGTGGGCACTC	0.562000								BER_DNA_glycosylases					20	313	---	---	---	---	0	0	0.007413	0	0
ANO4	121601	broad.mit.edu	37	12	101520843	101520843	+	Missense_Mutation	SNP	C	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr12:101520843C>T	uc010svm.1	+	27	3435	c.2863C>T	c.(2863-2865)CCG>TCG	p.P955S	ANO4_uc001thw.2_Missense_Mutation_p.P920S|ANO4_uc001thx.2_Missense_Mutation_p.P955S|ANO4_uc001thy.2_Missense_Mutation_p.P475S	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	955	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CAACGAGTGGCCGTGACCATG	0.488000										HNSCC(74;0.22)			3	46	---	---	---	---	0	0	0.004672	0	0
TRMT5	57570	broad.mit.edu	37	14	61442344	61442344	+	Silent	SNP	A	C	C			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr14:61442344A>C	uc001xff.3	-	4	1384	c.1293T>G	c.(1291-1293)GTT>GTG	p.V431V		NM_020810	NP_065861	Q32P41	TRMT5_HUMAN	tRNA methyltransferase 5	431						cytoplasm	tRNA (guanine-N1-)-methyltransferase activity			central_nervous_system(2)|large_intestine(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0873)		CCCTTTGCCGAACATCCTCAG	0.483000													8	148	---	---	---	---	0	0	0.006214	0	0
MYO5C	55930	broad.mit.edu	37	15	52486124	52486124	+	Missense_Mutation	SNP	T	C	C			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr15:52486124T>C	uc010bff.2	-	41	5341	c.5204A>G	c.(5203-5205)AAG>AGG	p.K1735R	GNB5_uc002abt.1_5'Flank|MYO5C_uc010uga.1_RNA|uc002abv.2_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1735						myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		AAAGCCTAGCTTGAAACTGCT	0.383000													21	221	---	---	---	---	0	0	0.002299	0	0
C15orf51	196968	broad.mit.edu	37	15	100340147	100340147	+	RNA	SNP	T	G	G			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr15:100340147T>G	uc010urx.1	-	4		c.780A>C			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|C15orf51_uc010bow.2_Intron|uc002bvt.1_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TTGGTCTGCCTGCTCTGCCGA	0.607000													3	36	---	---	---	---	0	0	0.004672	0	0
HERC2P4	440362	broad.mit.edu	37	16	32163872	32163872	+	RNA	SNP	G	A	A			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr16:32163872G>A	uc002ecx.2	-	1		c.3C>T				NR_002827				Homo sapiens hect domain and RLD 2 pseudogene 4, mRNA (cDNA clone IMAGE:5416019).												0						AGTGCAGCGTGCACAGCAGTG	0.612000													6	103	---	---	---	---	0	0	0.004482	0	0
CHD9	80205	broad.mit.edu	37	16	53243396	53243396	+	Silent	SNP	T	C	C			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr16:53243396T>C	uc002ehb.2	+	2	1619	c.1455T>C	c.(1453-1455)CCT>CCC	p.P485P	CHD9_uc002egy.2_Silent_p.P485P|CHD9_uc002egz.1_Silent_p.P485P|CHD9_uc002eha.1_Silent_p.P485P|CHD9_uc002ehc.2_Silent_p.P485P|CHD9_uc002ehd.2_Silent_p.P11P	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	485					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTCTGTAGCCTCCATCTTCCA	0.343000													3	33	---	---	---	---	0	0	0.000248	0	0
CLIP3	25999	broad.mit.edu	37	19	36509847	36509847	+	Missense_Mutation	SNP	C	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr19:36509847C>T	uc010eeq.1	-	8	1418	c.1136G>A	c.(1135-1137)CGG>CAG	p.R379Q	uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.R379Q	NM_015526	NP_056341	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	379					chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GAAGTCCATCCGGGGGGTCCG	0.612000													19	135	---	---	---	---	0	0	0.001882	0	0
ZNF790	388536	broad.mit.edu	37	19	37309574	37309574	+	Missense_Mutation	SNP	C	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr19:37309574C>T	uc002oew.2	-	5	1791	c.1672G>A	c.(1672-1674)GAT>AAT	p.D558N	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	558					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GGTTCTGCATCAGTATGAATT	0.358000													8	239	---	---	---	---	0	0	0.003080	0	0
KRTAP13-4	284827	broad.mit.edu	37	21	31802980	31802980	+	Silent	SNP	C	A	A			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr21:31802980C>A	uc011acw.1	+	1	387	c.387C>A	c.(385-387)TCC>TCA	p.S129S		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	129						intermediate filament					0						GTTACGGATCCAGATTCTGCT	0.473000													8	105	---	---	---	---	5.18039e-06	6.04379e-06	0.003080	1	0
TTC14	151613	broad.mit.edu	37	3	180324339	180324339	+	Missense_Mutation	SNP	C	G	G			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr3:180324339C>G	uc003fkk.2	+	9	1252	c.1120C>G	c.(1120-1122)CAC>GAC	p.H374D	TTC14_uc003fkl.2_Missense_Mutation_p.H374D|TTC14_uc003fkm.2_Missense_Mutation_p.H374D	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	374	TPR 3.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTGTCCAACTCACAGAAATGC	0.383000													4	196	---	---	---	---	0	0	0.000248	0	0
CPE	1363	broad.mit.edu	37	4	166403472	166403472	+	Missense_Mutation	SNP	G	A	A			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr4:166403472G>A	uc003irg.3	+	4	1028	c.751G>A	c.(751-753)GAC>AAC	p.D251N		NM_001873	NP_001864	P16870	CBPE_HUMAN	carboxypeptidase E preproprotein	251					cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCATGGAGGAGACCTTGTGGC	0.403000													4	151	---	---	---	---	0	0	0.000248	0	0
MICAL1	64780	broad.mit.edu	37	6	109769507	109769507	+	Missense_Mutation	SNP	A	G	G			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr6:109769507A>G	uc003ptj.2	-	12	2008	c.1754T>C	c.(1753-1755)GTG>GCG	p.V585A	MICAL1_uc003ptk.2_Missense_Mutation_p.V585A|MICAL1_uc010kdr.2_Missense_Mutation_p.V499A|MICAL1_uc011eaq.1_Missense_Mutation_p.V604A	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	585	CH.				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TGCAGACACCACCGGTGTGAT	0.607000													7	392	---	---	---	---	0	0	0.006214	0	0
GNGT1	2792	broad.mit.edu	37	7	93540201	93540201	+	Missense_Mutation	SNP	G	C	C			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr7:93540201G>C	uc003unc.1	+	3	344	c.196G>C	c.(196-198)GAG>CAG	p.E66Q	GNGT1_uc003umx.1_RNA	NM_021955	NP_068774	P63211	GBG1_HUMAN	guanine nucleotide binding protein (G protein),	66					G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TCCCTTCAAGGAGCTCAAAGG	0.348000													5	84	---	---	---	---	0	0	0.000602	0	0
PPP1R3B	79660	broad.mit.edu	37	8	8998408	8998408	+	Missense_Mutation	SNP	A	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr8:8998408A>T	uc003wsn.3	-	2	919	c.754T>A	c.(754-756)TTG>ATG	p.L252M	PPP1R3B_uc003wso.3_Missense_Mutation_p.L251M	NM_024607	NP_078883	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	252					glycogen metabolic process					ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		GATATTCCCAAATCCGGTCCA	0.498000													14	90	---	---	---	---	0	0	0.003163	0	0
EIF1AX	1964	broad.mit.edu	37	X	20156731	20156731	+	Missense_Mutation	SNP	C	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chrX:20156731C>T	uc004czt.2	-	2	234	c.26G>A	c.(25-27)GGT>GAT	p.G9D	SCARNA9L_uc010nfp.2_5'Flank	NM_001412	NP_001403	P47813	IF1AX_HUMAN	X-linked eukaryotic translation initiation	9						cytosol	translation initiation factor activity			ovary(1)	1						TCTGTTTTTACCTCCTTTACC	0.313000													63	38	---	---	---	---	0	0	0.003610	0	0
ABCD1	215	broad.mit.edu	37	X	152991197	152991197	+	Missense_Mutation	SNP	C	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chrX:152991197C>T	uc004fif.2	+	1	875	c.476C>T	c.(475-477)GCC>GTC	p.A159V	BCAP31_uc004fid.2_5'Flank|BCAP31_uc011myz.1_5'Flank|BCAP31_uc011mza.1_5'Flank|BCAP31_uc004fie.2_5'Flank	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	159	ABC transmembrane type-1.|Interaction with PEX19.				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCCAACTGGCCCTGTCGTTC	0.647000													3	39	---	---	---	---	0	0	0.004672	0	0
Unknown	0	broad.mit.edu	37	10	13199671	13199672	+	IGR	INS	-	G	G	rs113702003		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr10:13199671_13199672insG								OPTN (19395 upstream) : MCM10 (3909 downstream)																							tttttttttttttttttttttg	0.183													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													3	5	---	---	---	---					
Unknown	0	broad.mit.edu	37	12	94894281	94894281	+	IGR	DEL	A	-	-			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr12:94894281delA								LOC144486 (37939 upstream) : TMCC3 (66619 downstream)																							CTATTTCTTTAAAAAAAAAGA	0.085													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	13	95390518	95390519	+	IGR	INS	-	T	T			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr13:95390518_95390519insT								SOX21 (26129 upstream) : ABCC4 (281565 downstream)																							ttctttctttctttttcttttt	0.005													3	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	14	85281016	85281023	+	IGR	DEL	CCTCCCTC	-	-	rs76839618		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr14:85281016_85281023delCCTCCCTC								None (None upstream) : FLRT2 (715465 downstream)																							tcccttccttcctccctccctccctccc	0.125													4	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	16	21946474	21946475	+	IGR	INS	-	TG	TG	rs67591643		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr16:21946474_21946475insTG								RRN3P1 (114743 upstream) : UQCRC2 (18134 downstream)																							CTCTCTCTCTCtgtgtgtgtgt	0.470													3	4	---	---	---	---					
LOC595101	595101	broad.mit.edu	37	16	30347983	30347983	+	5'Flank	DEL	T	-	-	rs143972983		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr16:30347983delT	uc002dxp.1	-							NR_002453				Homo sapiens cDNA FLJ39663 fis, clone SMINT2007187.												0						TCTGtttctattttttttttt	0.229													3	5	---	---	---	---					
Unknown	0	broad.mit.edu	37	17	25279521	25279521	+	IGR	DEL	G	-	-			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr17:25279521delG								None (None upstream) : WSB1 (341585 downstream)																							aaaataaagaggaaaaggaag	0.000													3	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	19	7440265	7440273	+	IGR	DEL	AAGAAAAGG	-	-	rs10692421		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr19:7440265_7440273delAAGAAAAGG								INSR (146254 upstream) : ARHGEF18 (7447 downstream)																							ggaaggaagaaagaaaaggaaggaaggaa	0.053													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	2	156126552	156126552	+	IGR	DEL	A	-	-	rs77418096		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr2:156126552delA								KCNJ3 (413538 upstream) : None (None downstream)																							ccataatggcaaaaaaaaaaa	0.000													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	2	228614557	228614558	+	IGR	INS	-	TCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCT	rs141805638	by1000genomes	TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr2:228614557_228614558insTCCTTCCTTCCTTCCT								SLC19A3 (31812 upstream) : CCL20 (64000 downstream)																							ACTTAAATGAAtccttccttcc	0.030													3	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	22	29819372	29819372	+	IGR	DEL	T	-	-	rs67350067		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr22:29819372delT								AP1B1 (34803 upstream) : RFPL1S (13634 downstream)																							ATCTATCAACttttttttttt	0.174													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	4	136806779	136806782	+	IGR	DEL	TGTG	-	-			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr4:136806779_136806782delTGTG								None (None upstream) : None (None downstream)																							GAATACATCCtgtgtgtgtgtgtg	0.284													2	4	---	---	---	---					
KCNN2	3781	broad.mit.edu	37	5	113698631	113698632	+	In_Frame_Ins	INS	-	GCC	GCC	rs151038013	by1000genomes	TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr5:113698631_113698632insGCC	uc003kqo.2	+	1	616_617	c.159_160insGCC	c.(157-162)insGCC	p.58_59insA		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	58_59						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		CTGCAGCCGCTGCCGCCGCCGC	0.658													3	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	5	138926403	138926418	+	IGR	DEL	CTTCCTTCCTTCCTTC	-	-	rs142505515	by1000genomes	TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr5:138926403_138926418delCTTCCTTCCTTCCTTC								TMEM173 (64111 upstream) : UBE2D2 (14333 downstream)																							ttctttctttcttccttccttccttccttccttcct	0.000													3	6	---	---	---	---					
Unknown	0	broad.mit.edu	37	6	101557311	101557330	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTT	-	-	rs71028063	by1000genomes	TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr6:101557311_101557330delCTTCCTTCCTTCCTTCCTTT								ASCC3 (228087 upstream) : GRIK2 (289575 downstream)																							tccttccttccttccttccttccttcctttctttctttct	0.000													4	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	6	148619848	148619849	+	IGR	INS	-	G	G			TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr6:148619848_148619849insG								SAMD5 (728691 upstream) : SASH1 (43880 downstream)																							gaaggaaggaagaaggaaggga	0.015													4	2	---	---	---	---					
Unknown	0	broad.mit.edu	37	9	68380404	68380405	+	IGR	INS	-	G	G	rs144187147		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr9:68380404_68380405insG								FAM27B (586215 upstream) : MIR1299 (621834 downstream)																							CTCCTTTGCCAGGGGCTGGGCA	0.728													3	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	9	68430364	68430365	+	IGR	INS	-	A	A	rs140332329		TCGA-BJ-A0ZG-01A-11D-A10S-08	TCGA-BJ-A0ZG-10A-01D-A10S-08									Somatic	Phase_I	Capture				Illumina GAIIx	36359097-f78d-46ea-9944-0f763b96f6dc	00b180fc-6158-4ed3-a8b3-2ef314e66bd1	g.chr9:68430364_68430365insA								FAM27B (636175 upstream) : MIR1299 (571874 downstream)																							TTATGCAGAAGAAAAAATTAAC	0.322													3	6	---	---	---	---					
