Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PER3	8863	broad.mit.edu	37	1	7890053	7890053	+	Missense_Mutation	SNP	G	A	A	rs57875989		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7890053G>A	uc001aoo.2	+	18	3194	c.3019G>A	c.(3019-3021)GCT>ACT	p.A1007T	PER3_uc009vmg.1_Missense_Mutation_p.A1015T|PER3_uc009vmh.1_Missense_Mutation_p.A1008T|PER3_uc001aop.2_Missense_Mutation_p.A1016T|PER3_uc010nzw.1_Missense_Mutation_p.A696T	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	1007	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGCCAGCGCTCTGTCCAC	0.587													11	131	---	---	---	---	PASS
KIAA2013	90231	broad.mit.edu	37	1	11982556	11982556	+	Intron	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11982556G>A	uc001atk.2	-						KIAA2013_uc001atl.1_3'UTR	NM_138346	NP_612355	Q8IYS2	K2013_HUMAN	hypothetical protein LOC90231 precursor							integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CGCGCTCTCTGGTGTCAAGGG	0.607													3	5	---	---	---	---	PASS
SEPN1	57190	broad.mit.edu	37	1	26138019	26138019	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26138019T>C	uc010oer.1	+	10	1140	c.1085T>C	c.(1084-1086)ATA>ACA	p.I362T	SEPN1_uc010oes.1_Missense_Mutation_p.I328T	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor	362						endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		ATCGGCTACATACCCCAGGTG	0.612											OREG0013258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	48	---	---	---	---	PASS
FNBP1L	54874	broad.mit.edu	37	1	93987691	93987691	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93987691C>T	uc001dpw.2	+	3	193	c.193C>T	c.(193-195)CGG>TGG	p.R65W	FNBP1L_uc001dpv.2_Missense_Mutation_p.R65W	NM_001024948	NP_001020119	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like isoform 1	65	FCH.|Induction of membrane tubulation (By similarity).				endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		TGAAGAGCCACGGTAAATTAC	0.204													16	20	---	---	---	---	PASS
DNTTIP2	30836	broad.mit.edu	37	1	94341965	94341965	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94341965T>C	uc001dqf.2	-	2	1564	c.1526A>G	c.(1525-1527)GAC>GGC	p.D509G	DNTTIP2_uc010otm.1_RNA	NM_014597	NP_055412	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal,	509	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		ACTTGCCTTGTCTTCCTCTTC	0.308													6	279	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144931265	144931265	+	Intron	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144931265G>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Silent_p.I148I|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GTGGCTCCTGGATCTGATCCT	0.552			T	PDGFRB	MPD								27	154	---	---	---	---	PASS
ZNF687	57592	broad.mit.edu	37	1	151259628	151259628	+	Missense_Mutation	SNP	A	T	T	rs149043825		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151259628A>T	uc001exq.2	+	2	959	c.861A>T	c.(859-861)GAA>GAT	p.E287D	ZNF687_uc001exp.1_Missense_Mutation_p.E296D|ZNF687_uc009wmo.2_Missense_Mutation_p.E287D|ZNF687_uc009wmp.2_Missense_Mutation_p.E287D	NM_020832	NP_065883	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	287	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding			central_nervous_system(3)|ovary(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGAAGGAAGAAGATGATGATG	0.607													10	29	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155317517	155317517	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155317517T>C	uc009wqq.2	-	20	8228	c.7748A>G	c.(7747-7749)GAC>GGC	p.D2583G	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.D2578G|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2583					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AATAACATCGTCGTCCTTCTC	0.498													6	371	---	---	---	---	PASS
CRP	1401	broad.mit.edu	37	1	159683413	159683413	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683413A>G	uc001ftw.2	-	2	681	c.577T>C	c.(577-579)TAT>CAT	p.Y193H	CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	193	Pentaxin.				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	CCGCCAAGATAGATGGTGTTA	0.527													4	57	---	---	---	---	PASS
SLAMF1	6504	broad.mit.edu	37	1	160607007	160607007	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160607007C>T	uc001fwl.3	-	2	735	c.389G>A	c.(388-390)CGC>CAC	p.R130H	SLAMF1_uc010pjk.1_RNA|SLAMF1_uc010pjl.1_RNA|SLAMF1_uc010pjm.1_RNA|SLAMF1_uc001fwm.2_Missense_Mutation_p.R130H	NM_003037	NP_003028	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family	130	Extracellular (Potential).				interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CAGGCAAAAGCGCTGAACTGA	0.478													34	159	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216052254	216052254	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216052254C>T	uc001hku.1	-	42	8797	c.8410G>A	c.(8410-8412)GGA>AGA	p.G2804R		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2804	Fibronectin type-III 14.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGCACCCTCCAAGGTACCCA	0.443										HNSCC(13;0.011)			16	86	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242451717	242451717	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242451717C>A	uc001hzn.1	-	3	569	c.442G>T	c.(442-444)GAC>TAC	p.D148Y	PLD5_uc001hzl.3_Missense_Mutation_p.D86Y|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Missense_Mutation_p.D56Y			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	148						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GACACTATGTCAACAGACTTT	0.393													7	243	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752125	247752125	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752125G>A	uc010pyy.1	+	1	464	c.464G>A	c.(463-465)GGA>GAA	p.G155E		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	155	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TGGCTCAGTGGAATAGCCACC	0.552													54	209	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21256376	21256376	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21256376C>T	uc002red.2	-	9	1047	c.919G>A	c.(919-921)GGC>AGC	p.G307S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	307	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AATGCGAGGCCCATCTTCTTA	0.443													5	287	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25972876	25972876	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25972876T>C	uc002rgs.2	-	11	1770	c.1549A>G	c.(1549-1551)AGC>GGC	p.S517G	ASXL2_uc002rgt.1_Missense_Mutation_p.S257G	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	517					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATTCTTGGCTTTCACTTTTG	0.463													6	271	---	---	---	---	PASS
C2orf28	51374	broad.mit.edu	37	2	27439991	27439991	+	3'UTR	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27439991G>A	uc002rjf.2	+	7					C2orf28_uc002rjg.2_3'UTR|C2orf28_uc002rjh.2_RNA|CAD_uc002rji.2_5'Flank|CAD_uc010eyw.2_5'Flank	NM_080592	NP_542159	Q6UW56	APR3_HUMAN	apoptosis related protein 3 isoform b							integral to membrane|plasma membrane				skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTCCCATTGGTGTTGTTGCC	0.443													3	7	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46605874	46605874	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46605874G>A	uc002ruv.2	+	11	2010	c.1522G>A	c.(1522-1524)GAC>AAC	p.D508N	EPAS1_uc002ruw.2_5'Flank	NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	508	NTAD.				angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CTTCGCCATGGACACAGAGGC	0.537													59	136	---	---	---	---	PASS
C2orf65	130951	broad.mit.edu	37	2	74867311	74867311	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74867311A>G	uc002smy.2	-	2	209	c.92T>C	c.(91-93)CTA>CCA	p.L31P	C2orf65_uc010ysa.1_Missense_Mutation_p.L31P|C2orf65_uc002smz.2_Missense_Mutation_p.L31P	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	31					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						CCAGGACGGTAGAGCAATGTG	0.557													5	297	---	---	---	---	PASS
C2orf27A	29798	broad.mit.edu	37	2	132508382	132508382	+	5'UTR	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132508382C>T	uc002ttf.1	+	2						NM_013310	NP_037442	Q580R0	CB027_HUMAN	hypothetical protein LOC29798												0						TTGTGCATTCCCAACATGCTC	0.378													4	13	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160194250	160194250	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160194250C>A	uc002uao.2	-	32	5840	c.5488G>T	c.(5488-5490)GAG>TAG	p.E1830*	BAZ2B_uc002uap.2_Nonsense_Mutation_p.E1794*	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1830					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						ACCAAGTCCTCCCTTTCTGAT	0.388													18	114	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	169995117	169995117	+	Silent	SNP	A	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169995117A>C	uc002ues.2	-	75	13701	c.13488T>G	c.(13486-13488)CCT>CCG	p.P4496P		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4496	Cytoplasmic (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TAGCAGTCTCAGGTCCAAAAC	0.393													40	136	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179457765	179457765	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179457765C>A	uc010zfg.1	-	249	51601	c.51377G>T	c.(51376-51378)TGC>TTC	p.C17126F	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.C10821F|TTN_uc010zfi.1_Missense_Mutation_p.C10754F|TTN_uc010zfj.1_Missense_Mutation_p.C10629F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18053							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTGAATTGCATGTTGTATC	0.378													28	122	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182376495	182376495	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182376495T>C	uc002unu.2	+	17	2678	c.1915T>C	c.(1915-1917)TTT>CTT	p.F639L	ITGA4_uc010frj.1_Missense_Mutation_p.F121L	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	639	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AAAGATTGGGTTTTTGAAGTA	0.343													5	128	---	---	---	---	PASS
STK17B	9262	broad.mit.edu	37	2	197021293	197021293	+	Missense_Mutation	SNP	T	C	C	rs144100898	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197021293T>C	uc002utk.2	-	3	529	c.205A>G	c.(205-207)AGA>GGA	p.R69G	STK17B_uc010fsh.2_Missense_Mutation_p.R69G	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B	69	Protein kinase.				apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			TCCTGTCCTCTTCTTCTCTTT	0.383													6	277	---	---	---	---	PASS
RPE	6120	broad.mit.edu	37	2	210881255	210881255	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210881255A>G	uc002vdn.2	+	4	372	c.367A>G	c.(367-369)ACC>GCC	p.T123A	RPE_uc002vdm.2_Missense_Mutation_p.T123A|RPE_uc002vdo.2_Missense_Mutation_p.T73A|RPE_uc010zjf.1_Missense_Mutation_p.T123A|RPE_uc002vdp.2_Missense_Mutation_p.T70A|RPE_uc010fup.2_Missense_Mutation_p.T55A|RPE_uc002vdq.2_Missense_Mutation_p.T73A|RPE_uc002vdr.2_Missense_Mutation_p.T73A	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1	123					pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		CAAACCAGGAACCTCAGTTGA	0.423													6	352	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225727461	225727461	+	Silent	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225727461A>G	uc010fwz.1	-	14	1844	c.1605T>C	c.(1603-1605)TAT>TAC	p.Y535Y	DOCK10_uc002vob.2_Silent_p.Y529Y|DOCK10_uc002vod.1_Silent_p.Y535Y	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	535							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTTTTGTGCATACTAAAGAA	0.289													4	86	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52702514	52702514	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52702514C>T	uc003des.2	-	3	396	c.384G>A	c.(382-384)AAG>AAA	p.K128K	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Silent_p.K128K|PBRM1_uc003der.2_Silent_p.K128K|PBRM1_uc003det.2_Silent_p.K128K|PBRM1_uc003deu.2_Silent_p.K128K|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Silent_p.K128K|PBRM1_uc010hmk.1_Silent_p.K128K|PBRM1_uc003dey.2_Silent_p.K128K|PBRM1_uc003dez.1_Silent_p.K128K|PBRM1_uc003dfb.1_Silent_p.K26K	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	128	Bromo 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATTTCTTACCTTATAATAGG	0.234			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								50	145	---	---	---	---	PASS
CEP97	79598	broad.mit.edu	37	3	101476746	101476746	+	Silent	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101476746T>C	uc003dvk.1	+	9	1323	c.1296T>C	c.(1294-1296)GAT>GAC	p.D432D	CEP97_uc010hpm.1_Silent_p.D398D|CEP97_uc011bhf.1_Silent_p.D373D|CEP97_uc003dvl.1_Silent_p.D128D|CEP97_uc003dvm.1_Silent_p.D270D	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	432	CEP110 binding.					centrosome|nucleus	protein binding			ovary(2)	2						GCCTAGAAGATGATGGTGTTG	0.463													42	97	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505833	195505833	+	Silent	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505833G>A	uc011bto.1	-	3	12694	c.12234C>T	c.(12232-12234)GCC>GCT	p.A4078A	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGGGGTGGCGTGACCTG	0.602													5	98	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509122	195509122	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509122G>A	uc011bto.1	-	3	9405	c.8945C>T	c.(8944-8946)CCT>CTT	p.P2982L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGGGCTAGTGAC	0.587													4	48	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195509180	195509180	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195509180C>G	uc011bto.1	-	3	9347	c.8887G>C	c.(8887-8889)GTC>CTC	p.V2963L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.597													9	95	---	---	---	---	PASS
MUC7	4589	broad.mit.edu	37	4	71346891	71346891	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71346891A>T	uc011cat.1	+	4	718	c.430A>T	c.(430-432)AAT>TAT	p.N144Y	MUC7_uc011cau.1_Missense_Mutation_p.N144Y|MUC7_uc003hfj.2_Missense_Mutation_p.N144Y|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	144	Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			TTCAAGAGAAAATGTTAACAC	0.463													138	296	---	---	---	---	PASS
SDAD1	55153	broad.mit.edu	37	4	76897076	76897076	+	Splice_Site	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76897076C>T	uc003hje.3	-	5	596	c.477_splice	c.e5+1	p.V159_splice	SDAD1_uc003hjf.3_Splice_Site_p.V62_splice|SDAD1_uc011cbr.1_Splice_Site_p.V122_splice	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1						protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGAGTACTTACTACATTCACT	0.323													42	99	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	106601237	106601237	+	3'UTR	SNP	G	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106601237G>C	uc003hxv.1	+	5										Homo sapiens cDNA FLJ43963 fis, clone TESTI4016882.																		ATCCACTGTAGACTTGAAGGA	0.323													20	39	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125631530	125631530	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125631530C>G	uc003ifg.3	-	1	403	c.137G>C	c.(136-138)AGT>ACT	p.S46T	ANKRD50_uc011cgo.1_Intron|ANKRD50_uc010inw.2_Missense_Mutation_p.S46T	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	46										central_nervous_system(1)	1						ATTGACAGCACTATTGCAGCA	0.483													36	98	---	---	---	---	PASS
PALLD	23022	broad.mit.edu	37	4	169433483	169433483	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169433483G>C	uc011cjx.1	+	2	1039	c.828G>C	c.(826-828)AAG>AAC	p.K276N	PALLD_uc003iru.2_Missense_Mutation_p.K276N	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	276	Ig-like C2-type 1.				cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TCATCCAAAAGCTGAGGAGCC	0.532									Pancreatic_Cancer_Familial_Clustering_of				3	3	---	---	---	---	PASS
MIR449A	554213	broad.mit.edu	37	5	54466429	54466429	+	RNA	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54466429A>G	hsa-mir-449a|MI0001648	-			c.22A>G			CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc003jpo.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron|uc011cqh.1_RNA																	0						CTAACAATACACTGCCAGCTC	0.428													6	186	---	---	---	---	PASS
C5orf13	9315	broad.mit.edu	37	5	111066724	111066724	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111066724T>C	uc003kpl.2	-	3	580	c.101A>G	c.(100-102)AAG>AGG	p.K34R	C5orf13_uc011cvr.1_Missense_Mutation_p.K78R|C5orf13_uc011cvs.1_Missense_Mutation_p.K68R|C5orf13_uc003kpk.2_Intron|C5orf13_uc003kpm.2_Missense_Mutation_p.K34R|C5orf13_uc011cvk.1_Missense_Mutation_p.K34R|C5orf13_uc011cvl.1_Missense_Mutation_p.K34R|C5orf13_uc011cvm.1_Missense_Mutation_p.K34R|C5orf13_uc011cvn.1_Missense_Mutation_p.K34R|C5orf13_uc011cvo.1_Missense_Mutation_p.K34R|C5orf13_uc011cvp.1_Missense_Mutation_p.K34R|C5orf13_uc011cvq.1_Missense_Mutation_p.K34R	NM_001142483	NP_001135955	Q16612	NP311_HUMAN	neuronal protein 3.1 isoform a	34						cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		GTTCACTTCCTTTGGGACAGG	0.473													6	402	---	---	---	---	PASS
WNT8A	7478	broad.mit.edu	37	5	137426629	137426629	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137426629T>C	uc003lcd.1	+	6	928	c.923T>C	c.(922-924)GTC>GCC	p.V308A	BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Missense_Mutation_p.V326A|WNT8A_uc011cyk.1_Missense_Mutation_p.V326A	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family,	308					brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			ovary(1)|lung(1)|breast(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAAACTGAGGTCATAAGCAGC	0.557													6	185	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140514900	140514900	+	5'UTR	SNP	T	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140514900T>G	uc003liq.2	+	1						NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCTTCAGGGTGGGCTTCGTT	0.458													4	3	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140797646	140797646	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140797646C>T	uc003lkn.1	+	1	365	c.220C>T	c.(220-222)CAC>TAC	p.H74Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.H74Y|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	74	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGAAGCTGCACTTCAGCGT	0.562													100	183	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140869478	140869478	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140869478G>T	uc003lla.1	+	1	671	c.671G>T	c.(670-672)GGG>GTG	p.G224V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.G224V	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	224	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCGCTCAGGGACCACCCTT	0.552													32	54	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149505045	149505045	+	Silent	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149505045G>A	uc003lro.2	-	12	2239	c.1770C>T	c.(1768-1770)GAC>GAT	p.D590D	PDGFRB_uc010jhd.2_Silent_p.D429D	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	590	Cytoplasmic (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCCACGTGGAGTCATAGGGCA	0.433			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								19	52	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149505046	149505046	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149505046T>G	uc003lro.2	-	12	2238	c.1769A>C	c.(1768-1770)GAC>GCC	p.D590A	PDGFRB_uc010jhd.2_Missense_Mutation_p.D429A	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	590	Cytoplasmic (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCACGTGGAGTCATAGGGCAG	0.438			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								18	50	---	---	---	---	PASS
MAPK9	5601	broad.mit.edu	37	5	179668101	179668101	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179668101C>T	uc003mls.3	-	9	1197	c.926G>A	c.(925-927)CGG>CAG	p.R309Q	MAPK9_uc003mlt.3_Missense_Mutation_p.R309Q|MAPK9_uc010jlc.2_Missense_Mutation_p.R309Q|MAPK9_uc003mlv.3_Missense_Mutation_p.R309Q	NM_002752	NP_002743	P45984	MK09_HUMAN	mitogen-activated protein kinase 9 isoform JNK2	309	Protein kinase.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACAGAGATCCGCTTGTCAGG	0.393													66	129	---	---	---	---	PASS
RIPK1	8737	broad.mit.edu	37	6	3081296	3081296	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3081296A>G	uc010jni.2	+	4	637	c.405A>G	c.(403-405)ATA>ATG	p.I135M	RIPK1_uc003muv.3_Translation_Start_Site|RIPK1_uc003muw.3_Missense_Mutation_p.I70M|RIPK1_uc011dhs.1_Intron|RIPK1_uc003mux.2_Missense_Mutation_p.I135M	NM_003804	NP_003795	Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine	135	Protein kinase.				activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				AAGGCGTGATACACAAGGACC	0.373													4	186	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17624932	17624932	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17624932G>A	uc003ncd.1	-	20	4234	c.4034C>T	c.(4033-4035)TCA>TTA	p.S1345L	NUP153_uc011dje.1_Missense_Mutation_p.S1376L|NUP153_uc010jpl.1_Missense_Mutation_p.S1303L	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	1345					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGTGGAAGATGATATAGATCC	0.527													79	151	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17783914	17783914	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17783914C>T	uc003ncg.3	-	29	3612	c.3507G>A	c.(3505-3507)ATG>ATA	p.M1169I	KIF13A_uc003ncf.2_Missense_Mutation_p.M1156I|KIF13A_uc003nch.3_Missense_Mutation_p.M1169I|KIF13A_uc003nci.3_Missense_Mutation_p.M1156I	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1169					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TGTGGGTTTCCATTCCAGGAG	0.343													62	184	---	---	---	---	PASS
DPCR1	135656	broad.mit.edu	37	6	30917885	30917885	+	Silent	SNP	C	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30917885C>G	uc003nsg.2	+	2	1644	c.1644C>G	c.(1642-1644)GCC>GCG	p.A548A		NM_080870	NP_543146	Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane					0						AAAGGACAGCCAATGAGAAGA	0.532													84	162	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70944246	70944246	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70944246T>C	uc003pfg.3	-	35	2469	c.2310A>G	c.(2308-2310)ATA>ATG	p.I770M	COL9A1_uc003pfe.3_Missense_Mutation_p.I319M|COL9A1_uc003pff.3_Missense_Mutation_p.I527M	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	770	Nonhelical region (NC2).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						ATTTACCTTGTATGACTCTCA	0.368													6	538	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73001656	73001656	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73001656C>G	uc003pga.2	+	26	3834	c.3757C>G	c.(3757-3759)CCA>GCA	p.P1253A	RIMS1_uc011dyb.1_Missense_Mutation_p.P650A|RIMS1_uc003pgc.2_Missense_Mutation_p.P702A|RIMS1_uc010kaq.2_Missense_Mutation_p.P573A|RIMS1_uc011dyc.1_Missense_Mutation_p.P550A|RIMS1_uc010kar.2_Missense_Mutation_p.P493A|RIMS1_uc011dyd.1_Missense_Mutation_p.P559A|RIMS1_uc003pgf.2_Missense_Mutation_p.P262A|RIMS1_uc003pgg.2_Missense_Mutation_p.P321A|RIMS1_uc003pgi.2_Missense_Mutation_p.P241A|RIMS1_uc003pgh.2_Missense_Mutation_p.P292A|RIMS1_uc003pgd.2_Missense_Mutation_p.P319A|RIMS1_uc003pge.2_Missense_Mutation_p.P293A|RIMS1_uc011dye.1_Missense_Mutation_p.P49A|RIMS1_uc011dyf.1_Missense_Mutation_p.P49A	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1253					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACAGAGAAGTCCAACACAATC	0.488													24	56	---	---	---	---	PASS
HMGN3	9324	broad.mit.edu	37	6	79911484	79911484	+	Intron	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79911484G>T	uc003pit.2	-						HMGN3_uc003pis.2_Intron|HMGN3_uc003piu.1_3'UTR	NM_004242	NP_004233	Q15651	HMGN3_HUMAN	high mobility group nucleosomal binding domain 3						chromatin modification	chromatin|cytoplasm|nucleus	DNA binding|thyroid hormone receptor binding				0		all_cancers(76;0.000116)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0393)		BRCA - Breast invasive adenocarcinoma(397;0.125)		AGTTACTACTGAAACTACTAT	0.333													32	63	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143095215	143095215	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143095215G>T	uc003qjd.2	-	5	1404	c.661C>A	c.(661-663)CCT>ACT	p.P221T		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	221	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		AAACCACAAGGTATACATGGA	0.458													7	212	---	---	---	---	PASS
TCP10L2	401285	broad.mit.edu	37	6	167590534	167590534	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167590534A>G	uc010kkp.2	+	4	541	c.410A>G	c.(409-411)GAG>GGG	p.E137G		NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN	t-complex 10-like 2	137											0						GCTGATGAAGAGACAACGCCC	0.453													8	619	---	---	---	---	PASS
HGC6.3	100128124	broad.mit.edu	37	6	168377071	168377071	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168377071G>A	uc010kks.1	-	1	549	c.262C>T	c.(262-264)CCC>TCC	p.P88S		NM_001129895	NP_001123367	Q9UM08	Q9UM08_HUMAN	hypothetical protein LOC100128124	88											0						AAGACAGTGGGGGTCATTCCC	0.642													5	39	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2255571	2255571	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2255571C>T	uc003slh.1	-	9	1139	c.873G>A	c.(871-873)GGG>GGA	p.G291G	MAD1L1_uc003sle.1_Silent_p.G20G|MAD1L1_uc003slf.1_Silent_p.G291G|MAD1L1_uc003slg.1_Silent_p.G291G|MAD1L1_uc010ksh.1_Silent_p.G291G|MAD1L1_uc003sli.1_Silent_p.G199G|MAD1L1_uc010ksi.1_Silent_p.G244G|MAD1L1_uc010ksj.2_Silent_p.G291G	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	291	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TCTCCTGGCGCCCCAGCTTCC	0.617													63	110	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82582155	82582155	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82582155A>G	uc003uhx.2	-	5	8403	c.8114T>C	c.(8113-8115)CTA>CCA	p.L2705P	PCLO_uc003uhv.2_Missense_Mutation_p.L2705P|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2636					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TATGTTATCTAGAGCAAGAGG	0.403													51	89	---	---	---	---	PASS
TFR2	7036	broad.mit.edu	37	7	100238672	100238672	+	Silent	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100238672G>A	uc003uvv.1	-	2	254	c.213C>T	c.(211-213)CTC>CTT	p.L71L	TFR2_uc003uvw.1_Silent_p.L71L	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2	71	Cytoplasmic (Potential).				cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCAGGGAATGAGGTTTGGCT	0.582													6	11	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100349547	100349547	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100349547A>G	uc003uwj.2	+	14	1984	c.1819A>G	c.(1819-1821)ATT>GTT	p.I607V	ZAN_uc003uwk.2_Missense_Mutation_p.I607V|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	607	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AAAACCCACCATTCCTTCAGA	0.473													30	821	---	---	---	---	PASS
TSGA13	114960	broad.mit.edu	37	7	130365840	130365840	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130365840C>T	uc003vqi.2	-	4	575	c.118G>A	c.(118-120)GGG>AGG	p.G40R	TSGA13_uc003vqj.2_Missense_Mutation_p.G40R	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13	40										ovary(2)	2	Melanoma(18;0.0435)					TTTGATTGCCCGACTGCATCA	0.408													5	257	---	---	---	---	PASS
SLC37A3	84255	broad.mit.edu	37	7	140051159	140051159	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140051159T>G	uc003vvo.2	-	9	962	c.796A>C	c.(796-798)AAT>CAT	p.N266H	SLC37A3_uc003vvp.2_Missense_Mutation_p.N266H|SLC37A3_uc010lnh.2_Missense_Mutation_p.N266H|SLC37A3_uc011kqz.1_RNA|SLC37A3_uc011kra.1_3'UTR|SLC37A3_uc011krb.1_3'UTR	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate	266					carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)					ATTGAATAATTCGGCTCATAT	0.428													7	241	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151927113	151927113	+	Splice_Site	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927113C>A	uc003wla.2	-	18	3091	c.2872_splice	c.e18-1	p.D958_splice	MLL3_uc003wkz.2_Splice_Site_p.D19_splice	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CACACATATCCTGAAGTTAAG	0.353			N		medulloblastoma								5	230	---	---	---	---	PASS
AGPAT6	137964	broad.mit.edu	37	8	41456755	41456755	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41456755C>T	uc003xnz.2	+	2	1036	c.97C>T	c.(97-99)CCA>TCA	p.P33S		NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta	33					acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			CATCATAGTGCCAGCCATTTT	0.443													17	501	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86044062	86044062	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86044062G>T	uc003ycw.2	+	12	1988	c.1834G>T	c.(1834-1836)GCC>TCC	p.A612S	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.A313S|LRRCC1_uc003ycx.2_Missense_Mutation_p.A519S|LRRCC1_uc003ycy.2_Missense_Mutation_p.A592S	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	612	Potential.				cell division|mitosis	centriole|nucleus					0						TAAAGAAATAGCCAAAGAAGA	0.348													18	196	---	---	---	---	PASS
C8orf47	203111	broad.mit.edu	37	8	99105579	99105579	+	3'UTR	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99105579C>T	uc003yih.1	+	3						NM_173549	NP_775820	Q6P6B1	CH047_HUMAN	hypothetical protein LOC203111												0	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			AGTGAACCGACACAGTGTGTT	0.403													5	231	---	---	---	---	PASS
ZNF250	58500	broad.mit.edu	37	8	146112256	146112256	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146112256A>T	uc003zeq.3	-	5	447	c.330T>A	c.(328-330)TGT>TGA	p.C110*	COMMD5_uc010mgf.2_5'UTR|ZNF250_uc003zer.3_Nonsense_Mutation_p.C105*|ZNF250_uc010mgg.2_Nonsense_Mutation_p.C105*	NM_021061	NP_066405	P15622	ZN250_HUMAN	zinc finger protein 250 isoform a	110					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		CTTGTTGTGTACAGGCTGTAG	0.363													6	392	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2039524	2039524	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2039524G>A	uc003zhc.2	+	4	513	c.414G>A	c.(412-414)ATG>ATA	p.M138I	SMARCA2_uc003zhd.2_Missense_Mutation_p.M138I|SMARCA2_uc010mha.2_Missense_Mutation_p.M129I	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	138					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCAGCCCTATGTCTGGAGGAG	0.572													45	97	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5920515	5920515	+	Silent	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5920515A>G	uc003zjq.3	-	8	5697	c.5481T>C	c.(5479-5481)GCT>GCC	p.A1827A	KIAA2026_uc010mht.2_Silent_p.A1002A	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	1827										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTGGCAGAGAAGCAAAATTGG	0.418													8	408	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18905843	18905843	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18905843C>T	uc003zne.3	+	27	5042	c.4915C>T	c.(4915-4917)CGG>TGG	p.R1639W	ADAMTSL1_uc003znf.3_Missense_Mutation_p.R340W|ADAMTSL1_uc003zng.1_Missense_Mutation_p.R30W	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1639						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CTGCCAGACACGGGATGGCAT	0.522													4	124	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35310690	35310690	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35310690G>T	uc003zwq.2	+	9	1280	c.988G>T	c.(988-990)GAA>TAA	p.E330*	UNC13B_uc010mkl.1_Nonsense_Mutation_p.E330*|UNC13B_uc003zwr.2_Nonsense_Mutation_p.E330*	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	330					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGCAGCATGTGAACCCAAGGA	0.547													54	139	---	---	---	---	PASS
OR1B1	347169	broad.mit.edu	37	9	125391779	125391779	+	Silent	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125391779C>A	uc011lyz.1	-	1	36	c.36G>T	c.(34-36)CCG>CCT	p.P12P		NM_001004450	NP_001004450	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B,	12	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCAAAAAAACCGGAGAGTGTG	0.463													4	124	---	---	---	---	PASS
MAPKAP1	79109	broad.mit.edu	37	9	128284008	128284008	+	Intron	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128284008G>T	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_3'UTR	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						ACACAGCCTTGACAGCCAGTG	0.408													80	201	---	---	---	---	PASS
FAM166A	401565	broad.mit.edu	37	9	140140165	140140165	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140140165T>C	uc004cmi.1	-	2	252	c.197A>G	c.(196-198)GAG>GGG	p.E66G		NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565	66										ovary(1)	1						GCTGAAGTCCTCAATGAACTT	0.617													4	44	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55568846	55568846	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55568846G>A	uc010qhs.1	-	37	5374	c.4979C>T	c.(4978-4980)GCA>GTA	p.A1660V	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qht.1_Missense_Mutation_p.A1653V|PCDH15_uc010qhu.1_3'UTR	NM_001142769	NP_001136241	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-1 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GTTTTTCCTTGCTTTTTCTCC	0.408										HNSCC(58;0.16)			68	213	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89725042	89725042	+	Splice_Site	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89725042A>G	uc001kfb.2	+	10	2058	c.1027_splice	c.e10-2	p.V343_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(6)|p.R55fs*1(4)|p.Y27fs*1(2)|p.N212fs*1(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCTTTCTCTAGGTGAAGCTG	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			7	127	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115962900	115962900	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115962900A>T	uc001lbg.1	+	7	919	c.766A>T	c.(766-768)AGA>TGA	p.R256*	TDRD1_uc001lbf.2_Nonsense_Mutation_p.R247*|TDRD1_uc001lbh.1_Nonsense_Mutation_p.R247*|TDRD1_uc001lbi.1_Nonsense_Mutation_p.R247*|TDRD1_uc010qsc.1_5'Flank|TDRD1_uc001lbj.2_5'Flank	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	256					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTCTGATTTGAGAAGTCTACA	0.358													32	105	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	116880014	116880014	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116880014C>A	uc001lcg.2	+	2	745	c.359C>A	c.(358-360)ACT>AAT	p.T120N	ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.T120N|ATRNL1_uc009xyq.2_Missense_Mutation_p.T120N	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	120	CUB.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACTAAATGTACTTGGCTCATT	0.284													13	19	---	---	---	---	PASS
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5617916	5617916	+	5'UTR	SNP	G	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5617916G>C	uc001mbf.2	+	1					HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Intron|TRIM6_uc010qzj.1_Intron|TRIM6_uc001mbc.1_Intron|TRIM6_uc001mbe.2_5'UTR|TRIM6_uc010qzk.1_5'UTR|TRIM6_uc010qzl.1_5'UTR|TRIM6_uc001mbd.2_5'UTR	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite							intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		CTGTGGGTCCGTCCGTTCAAC	0.607													6	10	---	---	---	---	PASS
DNHD1	144132	broad.mit.edu	37	11	6524146	6524146	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6524146C>T	uc001mdw.3	+	4	1474	c.910C>T	c.(910-912)CGG>TGG	p.R304W	DNHD1_uc001mdp.2_Missense_Mutation_p.R304W	NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1	304					microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCTCCCAGCCGGTACTTTAG	0.323													4	128	---	---	---	---	PASS
RPL27A	6157	broad.mit.edu	37	11	8704319	8704319	+	5'UTR	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8704319G>A	uc001mgs.3	+	1					SNORA3_uc001mgq.1_5'Flank|SNORA45_uc001mgr.1_5'Flank	NM_000990	NP_000981	P46776	RL27A_HUMAN	ribosomal protein L27a						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				Epithelial(150;3.24e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GATACCTCGCGAGACTTGGCG	0.642													85	141	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15257193	15257193	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15257193T>C	uc001mly.2	+	10	1403	c.1357T>C	c.(1357-1359)TCT>CCT	p.S453P	INSC_uc001mlz.2_Missense_Mutation_p.S406P|INSC_uc001mma.2_Missense_Mutation_p.S406P|INSC_uc010rcs.1_Missense_Mutation_p.S441P|INSC_uc001mmb.2_Missense_Mutation_p.S406P|INSC_uc001mmc.2_Missense_Mutation_p.S364P	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	453					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						ACAGTGTGCCTCTGACATCAT	0.413													6	318	---	---	---	---	PASS
SSRP1	6749	broad.mit.edu	37	11	57094257	57094257	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57094257A>G	uc001njt.2	-	16	2245	c.1978T>C	c.(1978-1980)TTC>CTC	p.F660L	TNKS1BP1_uc001njs.2_5'Flank|TNKS1BP1_uc009ymd.1_5'Flank	NM_003146	NP_003137	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	660	Ser-rich.				DNA repair|DNA replication|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|cytoplasm|nucleoplasm	DNA binding|protein binding			ovary(2)	2						TTGCTCTTGAAGCTCTCGCTT	0.493													6	329	---	---	---	---	PASS
BIRC3	330	broad.mit.edu	37	11	102195403	102195403	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102195403T>C	uc001pgx.2	+	3	385	c.163T>C	c.(163-165)TTC>CTC	p.F55L		NM_182962	NP_892007	Q13489	BIRC3_HUMAN	baculoviral IAP repeat-containing protein 3	55	BIR 1.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TCGTGCTGGTTTCTATTACAC	0.438			T	MALT1	MALT								4	82	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6619964	6619964	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6619964C>T	uc001qoo.2	+	5	478	c.432C>T	c.(430-432)GAC>GAT	p.D144D	NCAPD2_uc009zen.1_Intron|NCAPD2_uc010sfd.1_Silent_p.D99D	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	144	Interactions with SMC2 and SMC4.				cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						TGGACCTGGACCTTGGTGGGA	0.473													4	134	---	---	---	---	PASS
USP5	8078	broad.mit.edu	37	12	6974371	6974371	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6974371C>T	uc001qri.3	+	19	2501	c.2442C>T	c.(2440-2442)ACC>ACT	p.T814T	USP5_uc001qrh.3_Silent_p.T791T|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	814					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4						GCACCTCTACCATGTGTGGTC	0.502													5	237	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8083142	8083142	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8083142G>T	uc001qtr.2	-	5	869	c.607C>A	c.(607-609)CCA>ACA	p.P203T	SLC2A3_uc001qts.2_Missense_Mutation_p.P203T	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	203	Helical; Name=6; (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GGGCAAAATGGAAGGGCTGCA	0.438													95	164	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384888	8384888	+	RNA	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384888C>A	uc010sgk.1	-	5		c.900G>T				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						ATTTATGGTGCTTTTCTTAAG	0.413													4	55	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18762521	18762521	+	Silent	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18762521G>A	uc001rdt.2	+	30	4133	c.4017G>A	c.(4015-4017)GAG>GAA	p.E1339E	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Silent_p.E1380E|PIK3C2G_uc010sic.1_Silent_p.E1158E	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1339	C2.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TATCCTACGAGGATGTGAAGC	0.363													24	67	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21032479	21032479	+	Silent	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21032479G>T	uc001rek.2	+	10	1371	c.1245G>T	c.(1243-1245)TCG>TCT	p.S415S	SLCO1B3_uc001rel.2_Silent_p.S415S|SLCO1B3_uc010sil.1_Silent_p.S415S|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Silent_p.S240S	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	415	Helical; Name=9; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TTCTTACTTCGATGATATCCT	0.348													96	199	---	---	---	---	PASS
LDHB	3945	broad.mit.edu	37	12	21788538	21788538	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21788538C>T	uc001rfc.2	-	7	961	c.943G>A	c.(943-945)GCT>ACT	p.A315T	LDHB_uc001rfd.2_Missense_Mutation_p.A315T|LDHB_uc001rfe.2_Missense_Mutation_p.A315T	NM_002300	NP_002291	P07195	LDHB_HUMAN	L-lactate dehydrogenase B	315					glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity			breast(2)|ovary(1)	3					NADH(DB00157)	TTGAGCTGAGCAACCTCATCA	0.448													5	214	---	---	---	---	PASS
LDHB	3945	broad.mit.edu	37	12	21807564	21807564	+	Silent	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21807564T>C	uc001rfc.2	-	1	60	c.42A>G	c.(40-42)GAA>GAG	p.E14E	LDHB_uc001rfd.2_Silent_p.E14E|LDHB_uc001rfe.2_Silent_p.E14E	NM_002300	NP_002291	P07195	LDHB_HUMAN	L-lactate dehydrogenase B	14					glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity			breast(2)|ovary(1)	3					NADH(DB00157)	TTGCCTCTTCTTCCGCAACTG	0.403													6	260	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48369167	48369167	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48369167C>A	uc001rqu.2	-	51	4000	c.3819G>T	c.(3817-3819)GAG>GAT	p.E1273D	COL2A1_uc001rqt.2_Missense_Mutation_p.E54D|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.E1204D	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1273	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TGCGGGAGCCCTCGGGGCTGC	0.632													29	52	---	---	---	---	PASS
PRPH	5630	broad.mit.edu	37	12	49690246	49690246	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49690246A>G	uc001rtu.2	+	3	713	c.638A>G	c.(637-639)GAA>GGA	p.E213G		NM_006262	NP_006253	P41219	PERI_HUMAN	peripherin	213	Coil 1B.|Rod.						structural molecule activity				0						TCCCGCCTGGAACTAGAGCGC	0.567													44	112	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49717964	49717964	+	Intron	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49717964T>C	uc001rtx.3	+						TROAP_uc001rtv.2_Intron|TROAP_uc001rtw.3_Missense_Mutation_p.F122L|TROAP_uc009zlh.2_Intron|TROAP_uc001rty.2_5'Flank	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1						cell adhesion	cytoplasm				ovary(1)	1						TGGAAAGCTCTTTGCTCTTAG	0.358													5	217	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50037386	50037386	+	3'UTR	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50037386C>T	uc001ruv.1	-	26					FMNL3_uc001ruw.1_3'UTR|PRPF40B_uc001rup.1_Intron|PRPF40B_uc001ruq.1_Intron|PRPF40B_uc001rur.1_Intron|PRPF40B_uc001rus.1_Intron|FMNL3_uc001rut.1_3'UTR|FMNL3_uc001ruu.1_3'UTR	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						AGGTTCCTGCCTGTGAAGAAT	0.468													32	106	---	---	---	---	PASS
BIN2	51411	broad.mit.edu	37	12	51690950	51690950	+	Splice_Site	SNP	T	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51690950T>A	uc001ryg.2	-	8	655	c.603_splice	c.e8-1	p.S201_splice	BIN2_uc009zlz.2_Splice_Site_p.S169_splice|BIN2_uc001ryh.2_Splice_Site_p.S77_splice|BIN2_uc010sng.1_Splice_Site_p.S175_splice	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						CCAATACGACTATTAGGAAGC	0.433													76	135	---	---	---	---	PASS
NTN4	59277	broad.mit.edu	37	12	96104315	96104315	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96104315A>T	uc001tei.2	-	5	1533	c.1084T>A	c.(1084-1086)TGT>AGT	p.C362S	NTN4_uc009ztf.2_Missense_Mutation_p.C362S|NTN4_uc009ztg.2_Missense_Mutation_p.C325S	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	362	Laminin EGF-like 2.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						TTGTGCTGACAGTCATCACAG	0.512													5	157	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116549250	116549250	+	Silent	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116549250G>T	uc001tvw.2	-	3	433	c.378C>A	c.(376-378)ATC>ATA	p.I126I		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	126					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		ACAGATTGTGGATCGCTTTGA	0.358													14	77	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41515228	41515228	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41515228G>A	uc001uxs.2	-	8	1458	c.1085C>T	c.(1084-1086)GCA>GTA	p.A362V	ELF1_uc010tfc.1_Missense_Mutation_p.A338V|ELF1_uc010acd.2_Missense_Mutation_p.A255V	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	362					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TGATGGTTGTGCAACTTCCAC	0.488													78	184	---	---	---	---	PASS
LOC643677	643677	broad.mit.edu	37	13	103400197	103400197	+	Silent	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103400197T>C	uc001vpm.2	-	4	2990	c.2850A>G	c.(2848-2850)AAA>AAG	p.K950K		NM_001146197	NP_001139669			hypothetical protein LOC643677												0						TATTTGGGGCTTTACTACTTC	0.403													5	165	---	---	---	---	PASS
OR11H12	440153	broad.mit.edu	37	14	19378146	19378146	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19378146G>A	uc010tkp.1	+	1	553	c.553G>A	c.(553-555)GGC>AGC	p.G185S		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCCTTCTGTGGCCCAAACAT	0.483													22	255	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64514782	64514782	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64514782A>G	uc001xgm.2	+	46	7516	c.7286A>G	c.(7285-7287)AAC>AGC	p.N2429S	SYNE2_uc001xgl.2_Missense_Mutation_p.N2429S	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2429	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGCATGAAAAACACTGAAGAT	0.328													6	157	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88416261	88416261	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88416261C>T	uc001xvt.2	-	12	1665	c.1266G>A	c.(1264-1266)GAG>GAA	p.E422E	GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.E396E|GALC_uc010tvy.1_Silent_p.E399E|GALC_uc010tvz.1_Silent_p.E366E	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	422				E -> G (in Ref. 1; BAG64110).	carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						ATACCTGTAGCTCTGGTATTT	0.333													4	98	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106877562	106877562	+	Intron	SNP	A	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877562A>C	uc010tyt.1	-						uc010tyu.1_Silent_p.A130A					Parts of antibodies, mostly variable regions.												0						CCGCCCCCTCAGCCTCCCTGC	0.652													6	22	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936308	21936308	+	RNA	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936308G>T	uc010tzj.1	-	1		c.4432C>A				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						CCTGATAGGCGGTTTGCTGAA	0.373													3	10	---	---	---	---	PASS
CHRNA3	1136	broad.mit.edu	37	15	78885491	78885491	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78885491T>C	uc002beb.2	-	6	1618	c.1432A>G	c.(1432-1434)AAG>GAG	p.K478E	CHRNA3_uc002bea.2_RNA|CHRNA5_uc002bdy.2_Missense_Mutation_p.F435L|CHRNA5_uc002bdz.2_3'UTR|CHRNA3_uc010blg.1_RNA	NM_000743	NP_000734	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3	Error:Variant_position_missing_in_P32297_after_alignment					activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(3)|ovary(1)	4						TCTGTGGACTTTTCTTTTCGT	0.303													8	783	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053137	85053137	+	RNA	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053137C>T	uc002bkm.2	-	9		c.1910G>A			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						TTTTTTTTTTCAATTCCTTGA	0.378													5	74	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16101778	16101778	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16101778T>C	uc010bvi.2	+	2	329	c.154T>C	c.(154-156)TTC>CTC	p.F52L	ABCC1_uc010bvj.2_Missense_Mutation_p.F52L|ABCC1_uc010bvk.2_Missense_Mutation_p.F52L|ABCC1_uc010bvl.2_Missense_Mutation_p.F52L|ABCC1_uc010bvm.2_Missense_Mutation_p.F52L|ABCC1_uc002del.3_5'Flank	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	52	Helical; Name=1.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CTGTTTCCCCTTCTACTTCCT	0.512													8	691	---	---	---	---	PASS
CSDAP1	440359	broad.mit.edu	37	16	31579772	31579772	+	3'UTR	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31579772T>C	uc010vfr.1	-	1						NR_027011				SubName: Full=CSDA protein variant; Flags: Fragment;												0						TGCCGTGGCCTCTTTGCCATC	0.602													5	123	---	---	---	---	PASS
COQ9	57017	broad.mit.edu	37	16	57490689	57490689	+	Intron	SNP	A	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57490689A>T	uc002elq.2	+						COQ9_uc010vhn.1_3'UTR|COQ9_uc010vho.1_Intron|COQ9_uc010vhp.1_Intron|COQ9_uc002elr.2_Intron|COQ9_uc002els.2_5'Flank	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor						ubiquinone biosynthetic process	mitochondrion				breast(1)	1						TGCTGCTGTGATGGGACTGAA	0.597													7	17	---	---	---	---	PASS
MYBBP1A	10514	broad.mit.edu	37	17	4442824	4442824	+	Silent	SNP	T	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4442824T>A	uc002fyb.3	-	26	3935	c.3873A>T	c.(3871-3873)CCA>CCT	p.P1291P	MYBBP1A_uc002fxz.3_Silent_p.P1291P|SPNS2_uc002fxx.2_3'UTR|SPNS2_uc002fxy.2_3'UTR|MYBBP1A_uc002fya.3_Silent_p.P236P|MYBBP1A_uc010vsa.1_Silent_p.P333P	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2	1291	Required for nuclear and nucleolar localization (By similarity).				nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						GCGCGGACAGTGGTGATTTGC	0.587													27	79	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7415174	7415174	+	Silent	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7415174G>T	uc002ghf.3	+	25	4380	c.4146G>T	c.(4144-4146)CTG>CTT	p.L1382L		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1382					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				AGCGGGAGCTGTACCACGTCA	0.587													20	69	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33521402	33521402	+	5'UTR	SNP	T	C	C	rs143247346	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33521402T>C	uc002hjd.2	-	1						NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		TGTGACCTCATTGGAGTGGGG	0.522													5	113	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36499492	36499492	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36499492C>T	uc002hpz.2	-	1	202	c.181G>A	c.(181-183)GCT>ACT	p.A61T		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	61	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TAGAGATAAGCGAGGGCGGCC	0.637													12	13	---	---	---	---	PASS
LOXHD1	125336	broad.mit.edu	37	18	44069072	44069072	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44069072T>G	uc010xcw.1	-	37	5726	c.5726A>C	c.(5725-5727)GAT>GCT	p.D1909A	LOXHD1_uc002lcd.3_Missense_Mutation_p.D210A|LOXHD1_uc002lce.3_Missense_Mutation_p.D764A|LOXHD1_uc002lcf.3_Missense_Mutation_p.D860A|LOXHD1_uc010xcv.1_Missense_Mutation_p.D842A|LOXHD1_uc010xcu.1_Missense_Mutation_p.D210A	NM_144612	NP_653213	Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1 isoform 1	1693	PLAT 12.				sensory perception of sound	stereocilium	protein binding				0						GTCCTTCACATCGACATAGCT	0.547													24	57	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2339789	2339789	+	Intron	SNP	C	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2339789C>A	uc002lvs.2	+						SPPL2B_uc010dsw.1_Intron|SPPL2B_uc010dsy.1_Intron|SPPL2B_uc010dsz.1_Intron|SPPL2B_uc002lvr.2_Intron|SPPL2B_uc010dta.1_Intron|SPPL2B_uc002lvu.2_5'UTR	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGCCGGCCCCAGGGCCCC	0.697													19	74	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8201371	8201371	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8201371T>G	uc002mjf.2	-	10	1267	c.1246A>C	c.(1246-1248)ACC>CCC	p.T416P		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	416	EGF-like 3.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CACAGGTTGGTGAAGTGTCGG	0.647													12	37	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8998753	8998753	+	Silent	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8998753G>T	uc002mkp.2	-	58	41034	c.40830C>A	c.(40828-40830)ACC>ACA	p.T13610T	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.T427T|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13612	Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCACTGTGGGGGTCCCAGGAA	0.502													44	83	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15559003	15559003	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15559003C>T	uc002nbb.3	-	2	330	c.116G>A	c.(115-117)GGG>GAG	p.G39E	MIR1470_hsa-mir-1470|MI0007075_5'Flank	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						nucleus	zinc ion binding				0						GCCACCTTCCCCCTCAGCAGC	0.642													5	16	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15565475	15565475	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15565475G>A	uc002nbe.2	-	12	2037	c.1951C>T	c.(1951-1953)CGT>TGT	p.R651C	RASAL3_uc002nbd.2_5'Flank|RASAL3_uc010eaa.1_Missense_Mutation_p.R139C	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	651					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						TACGGGGCACGGTTGGCGAGG	0.662											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	27	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16552734	16552734	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16552734T>C	uc002ndz.1	-	3	140	c.134A>G	c.(133-135)AAG>AGG	p.K45R	EPS15L1_uc002ndx.2_Missense_Mutation_p.K45R|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpf.1_5'UTR|EPS15L1_uc002nea.1_Missense_Mutation_p.K45R|EPS15L1_uc010eah.1_Missense_Mutation_p.K45R|EPS15L1_uc002nec.1_Missense_Mutation_p.K45R	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	45	EH 1.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						GAGGCCAGACTTCTTTAGAAA	0.517											OREG0025335	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	126	---	---	---	---	PASS
SARS2	54938	broad.mit.edu	37	19	39412767	39412767	+	Intron	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39412767C>T	uc002oka.2	-						SARS2_uc002ojz.2_Intron|SARS2_uc010xup.1_Intron|SARS2_uc002okb.2_Intron|SARS2_uc010xuq.1_Intron|SARS2_uc010xur.1_Intron|SARS2_uc010xus.1_3'UTR	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor						seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ttttttttttccccttaaacc	0.184													7	62	---	---	---	---	PASS
LYPD3	27076	broad.mit.edu	37	19	43969649	43969649	+	Silent	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43969649G>A	uc002owl.1	-	1	183	c.75C>T	c.(73-75)CGC>CGT	p.R25R	LYPD3_uc002owm.2_Silent_p.R25R	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein	25						anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)				ACCCACCTCCGCGAAGCAGCA	0.667													11	21	---	---	---	---	PASS
ZNF221	7638	broad.mit.edu	37	19	44469419	44469419	+	Silent	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44469419C>T	uc002oxx.2	+	5	571	c.243C>T	c.(241-243)TTC>TTT	p.F81F	ZNF221_uc010ejb.1_Silent_p.F81F|ZNF221_uc010xws.1_Silent_p.F81F	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	81	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Prostate(69;0.0352)				CTTTCCACTTCTTAGGGAAGG	0.403													53	127	---	---	---	---	PASS
PPP1R15A	23645	broad.mit.edu	37	19	49379159	49379159	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49379159G>A	uc002pky.3	+	3	2223	c.1954G>A	c.(1954-1956)GCT>ACT	p.A652T		NM_014330	NP_055145	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	652					apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding			lung(1)	1		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CTTGAGCCAAGCTGTGGCCAC	0.607													9	22	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57929298	57929298	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57929298G>T	uc002qoo.1	+	2	265	c.34G>T	c.(34-36)GAC>TAC	p.D12Y	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.D14Y	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	12	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		GGTTTTTGAGGACGTGGCCAT	0.338													8	423	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20243669	20243669	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243669C>T	uc002wru.2	+	21	2474	c.2398C>T	c.(2398-2400)CGG>TGG	p.R800W	C20orf26_uc010zse.1_Missense_Mutation_p.R780W|C20orf26_uc002wrw.2_RNA|C20orf26_uc002wrv.2_Missense_Mutation_p.R156W	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	800										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CAGCAGTCAGCGGCGGTACAC	0.473													32	96	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20493403	20493403	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20493403G>A	uc002wrz.2	-	32	4753	c.4610C>T	c.(4609-4611)CCG>CTG	p.P1537L	RALGAPA2_uc010gcx.2_Missense_Mutation_p.P1241L|RALGAPA2_uc010zsg.1_Missense_Mutation_p.P985L|RALGAPA2_uc002wsa.1_Missense_Mutation_p.P309L	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1537					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						TAGCTGTGACGGTAAAAGGCA	0.418													5	314	---	---	---	---	PASS
TOMM34	10953	broad.mit.edu	37	20	43577461	43577461	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43577461A>G	uc002xmy.2	-	5	748	c.608T>C	c.(607-609)CTT>CCT	p.L203P	PABPC1L_uc002xmx.2_Intron|TOMM34_uc002xmz.2_Intron	NM_006809	NP_006800	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	203	TPR 4.				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	heat shock protein binding|signal sequence binding				0		Myeloproliferative disorder(115;0.0122)				CTTCTTTACAAGCTCATTGCC	0.443													7	503	---	---	---	---	PASS
PCMTD2	55251	broad.mit.edu	37	20	62896633	62896633	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62896633T>C	uc002yil.3	+	4	633	c.433T>C	c.(433-435)TTT>CTT	p.F145L	PCMTD2_uc002yim.3_Missense_Mutation_p.F145L	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate)	145						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TGAACCTTCCTTTGTTACTGG	0.413													6	354	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	17395338	17395338	+	IGR	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17395338T>C								HSFYL1 (85113 upstream) : GAB4 (47491 downstream)																							ATCATCAGTATCCAAGAGGCT	0.532													6	191	---	---	---	---	PASS
PI4KAP1	728233	broad.mit.edu	37	22	20385733	20385733	+	RNA	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20385733A>G	uc010gse.1	-	12		c.1968T>C			PI4KAP1_uc010gsf.1_RNA|PI4KAP1_uc010gsg.1_RNA|PI4KAP1_uc010gsh.1_RNA|PI4KAP1_uc002zsc.3_RNA					Homo sapiens cDNA FLJ11279 fis, clone PLACE1009444, highly similar to PHOSPHATIDYLINOSITOL 4-KINASE ALPHA (EC 2.7.1.67).												0						TACTTCAAGAACTTGATTGTC	0.537													4	15	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25150039	25150039	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25150039T>C	uc003abd.1	-	8	1336	c.919A>G	c.(919-921)ACA>GCA	p.T307A	PIWIL3_uc011ajx.1_Missense_Mutation_p.T198A|PIWIL3_uc011ajy.1_Missense_Mutation_p.T198A|PIWIL3_uc010gut.1_Missense_Mutation_p.T307A	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	307	PAZ.				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						ATGTTTCCTGTCTGGGCCTGG	0.393													7	209	---	---	---	---	PASS
ADRBK2	157	broad.mit.edu	37	22	26114290	26114290	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26114290G>T	uc003abx.3	+	19	1880	c.1733G>T	c.(1732-1734)CGT>CTT	p.R578L	ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	578	PH.						ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	CAGTGGCAGCGTCGCTATTTT	0.483													28	124	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32439139	32439139	+	5'UTR	SNP	G	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32439139G>T	uc003amc.2	+	1						NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						GCAAGGCATCGCAGGGGCCCC	0.682											OREG0003498	type=REGULATORY REGION|Gene=SLC5A1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	3	2	---	---	---	---	PASS
TEF	7008	broad.mit.edu	37	22	41794473	41794473	+	3'UTR	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41794473G>A	uc003azy.2	+	4					TEF_uc003azx.2_3'UTR|TEF_uc011apa.1_3'UTR	NM_003216	NP_003207	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 1						rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TAAGCATCCTGTCTAAAGCTT	0.448													81	214	---	---	---	---	PASS
AMELX	265	broad.mit.edu	37	X	11316960	11316960	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11316960T>C	uc004cut.2	+	5	505	c.437T>C	c.(436-438)GTG>GCG	p.V146A	ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.V160A|AMELX_uc004cuu.2_Missense_Mutation_p.V130A	NM_001142	NP_001133	Q99217	AMELX_HUMAN	amelogenin (X chromosome) isoform 1 precursor	146					cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel				0						CAGCCACCTGTGCACCCCATG	0.667													4	39	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40573155	40573155	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40573155T>C	uc004dex.3	-	5	667	c.527A>G	c.(526-528)AAA>AGA	p.K176R	MED14_uc010nhe.1_Missense_Mutation_p.K60R	NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	176					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						AGGAATAATTTTGTCCTGCAA	0.343													225	131	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65259890	65259890	+	5'UTR	SNP	A	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65259890A>G	uc004dwh.2	-	1					VSIG4_uc004dwi.2_5'UTR|VSIG4_uc010nkq.1_5'UTR|VSIG4_uc004dwj.2_5'UTR|VSIG4_uc011moy.1_5'UTR|VSIG4_uc004dwk.2_5'UTR	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4						complement activation, alternative pathway	integral to membrane	protein binding				0						GCTACCAAAGAGGCTCAAACT	0.532													4	52	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101098158	101098158	+	Translation_Start_Site	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101098158G>A	uc011mrk.1	-	2	193	c.-167C>T	c.(-169--165)CACGC>CATGC		NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TCCTGGCAGCGTGAAGGCAGA	0.483													15	223	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9287	9287	+	RNA	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9287G>A	uc011mfi.1	+	1		c.625G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		GCCCTCCTAATGACCTCCGGC	0.502													46	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9343	9343	+	RNA	SNP	G	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9343G>A	uc011mfi.1	+	1		c.681G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		CCTCATACTAGGCCTACTAAC	0.532													29	28	---	---	---	---	PASS
ARHGEF16	27237	broad.mit.edu	37	1	3380717	3380717	+	Intron	DEL	G	-	-	rs145831755		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3380717delG	uc001akg.3	+						ARHGEF16_uc001aki.2_5'Flank|ARHGEF16_uc001akj.2_5'Flank	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16						activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CATTCCCTCTGTACACAGAGC	0.647													4	2	---	---	---	---	
ARHGEF16	27237	broad.mit.edu	37	1	3380719	3380719	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3380719delA	uc001akg.3	+						ARHGEF16_uc001aki.2_5'Flank|ARHGEF16_uc001akj.2_5'Flank	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16						activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TTCCCTCTGTACACAGAGCCC	0.647													4	2	---	---	---	---	
PER3	8863	broad.mit.edu	37	1	7879649	7879649	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7879649delA	uc001aoo.2	+						PER3_uc009vmg.1_Intron|PER3_uc009vmh.1_Intron|PER3_uc001aop.2_Intron|PER3_uc010nzw.1_Intron	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CAGAAGGCACAAAAAGCTAGA	0.343													4	2	---	---	---	---	
AADACL3	126767	broad.mit.edu	37	1	12782608	12782609	+	Intron	INS	-	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12782608_12782609insG	uc009vnn.1	+						AADACL3_uc001aug.1_Intron	NM_001103170	NP_001096640	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3 isoform 1								hydrolase activity				0	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCCTGAAATGGGGGTATGGA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22477649	22477650	+	IGR	INS	-	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22477649_22477650insT								WNT4 (7264 upstream) : ZBTB40 (300694 downstream)																							TTCTGCTTGAAtcttttttttt	0.252													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	23971524	23971525	+	IGR	INS	-	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23971524_23971525insA								MDS2 (4468 upstream) : RPL11 (46769 downstream)																							ccccagcttagaaatgaagcct	0.010													4	2	---	---	---	---	
KIAA0319L	79932	broad.mit.edu	37	1	35976870	35976870	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35976870delA	uc001byx.2	-						KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron|KIAA0319L_uc010ohx.1_Intron	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACTGGGGGGAAAAAAAAACA	0.383													5	3	---	---	---	---	
EPHA10	284656	broad.mit.edu	37	1	38197921	38197921	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38197921delT	uc009vvi.2	-						EPHA10_uc009vvh.1_5'Flank|EPHA10_uc001cbu.2_Intron|EPHA10_uc001cbv.1_Intron	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3							extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ttccatctcctttttaggtga	0.259													4	2	---	---	---	---	
RRAGC	64121	broad.mit.edu	37	1	39333533	39333533	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39333533delG	uc001ccr.2	-						MYCBP_uc001ccs.2_Intron	NM_022157	NP_071440	Q9HB90	RRAGC_HUMAN	Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				gtagcacactggaagaacacc	0.000													4	2	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	42970885	42970886	+	Intron	INS	-	A	A	rs140202726	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42970885_42970886insA	uc001chn.2	+						CCDC30_uc001chm.2_Intron|CCDC30_uc010oju.1_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						ttttcctaaagaaatttctgcg	0.000													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46915985	46915985	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46915985delA								FAAH (36465 upstream) : DMBX1 (56683 downstream)																							taagattgctaagtcattttg	0.000													4	2	---	---	---	---	
ROR1	4919	broad.mit.edu	37	1	64504041	64504043	+	Intron	DEL	CCA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64504041_64504043delCCA	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						CTCCCTTTCTCCACCCTATCTTG	0.493													4	2	---	---	---	---	
INSL5	10022	broad.mit.edu	37	1	67266531	67266531	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67266531delT	uc001dcw.2	-							NM_005478	NP_005469	Q9Y5Q6	INSL5_HUMAN	insulin-like 5 precursor							extracellular region	hormone activity				0						GAGGTAGTTATTTTTTGAAAG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74418756	74418756	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74418756delA								None (None upstream) : LRRIQ3 (72948 downstream)																							aaaggacaccaaaaaaaatgt	0.000													4	2	---	---	---	---	
BCAR3	8412	broad.mit.edu	37	1	94312554	94312555	+	Intron	INS	-	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94312554_94312555insG	uc001dqb.2	-							NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GCGCAGGTCCAGCCGCGGCTGG	0.614													4	3	---	---	---	---	
CCDC76	54482	broad.mit.edu	37	1	100614443	100614443	+	3'UTR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100614443delA	uc001dsv.2	+	11					CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_3'UTR|LRRC39_uc001dsw.1_3'UTR|LRRC39_uc001dsx.1_3'UTR|LRRC39_uc001dsy.1_3'UTR|LRRC39_uc001dsz.1_3'UTR	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76						tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		tttttatatcaaaaaaatata	0.239													4	2	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147096960	147096960	+	3'UTR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147096960delT	uc001epq.2	+	10						NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9						Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					AACAGGTGTGttttttttaag	0.373			T	IGH@|IGL@	B-ALL								4	2	---	---	---	---	
UBAP2L	9898	broad.mit.edu	37	1	154227047	154227049	+	Intron	DEL	TTG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154227047_154227049delTTG	uc001fep.3	+						UBAP2L_uc009wot.2_Intron|UBAP2L_uc010pek.1_Intron|UBAP2L_uc010pel.1_Intron|UBAP2L_uc010pen.1_Intron|UBAP2L_uc001feq.2_5'Flank|UBAP2L_uc001fer.2_5'Flank	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a						binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGTTTTAGGTTTGGGGTGTCTTC	0.419													6	5	---	---	---	---	
IFI16	3428	broad.mit.edu	37	1	159002155	159002155	+	Intron	DEL	T	-	-	rs856058	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159002155delT	uc001ftg.2	+						IFI16_uc010pis.1_Intron|IFI16_uc001fth.2_5'Flank|IFI16_uc010pit.1_5'Flank	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16						cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					gcaaaaaaaatattctgacaa	0.109													9	5	---	---	---	---	
VANGL2	57216	broad.mit.edu	37	1	160373455	160373455	+	Intron	DEL	A	-	-	rs5778162		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160373455delA	uc001fwb.1	+						VANGL2_uc001fwc.1_Intron	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2						apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGTTTTAGGGAACTCCAGTCT	0.468													7	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178907216	178907216	+	IGR	DEL	A	-	-	rs111835283		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178907216delA								RALGPS2 (17981 upstream) : FAM20B (87858 downstream)																							TTCTTCCTTTAaaaaaaaaag	0.393													4	4	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197715618	197715618	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197715618delT	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						TCTATACAAATAAATAAACAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213818570	213818570	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213818570delA								RPS6KC1 (371763 upstream) : PROX1 (342716 downstream)																							TGAGTGTGCCAAAAAGAACGT	0.448													4	2	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235616773	235616773	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235616773delT	uc001hxc.2	-							NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GGGACTATACttttttttttt	0.224													5	3	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241415350	241415350	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241415350delT	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			tttctttttcttttttttttt	0.234													4	2	---	---	---	---	
OR2M7	391196	broad.mit.edu	37	1	248488129	248488132	+	5'Flank	DEL	TACA	-	-	rs61292885		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248488129_248488132delTACA	uc010pzk.1	-							NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATTGAAAAATTACAATAACAATAT	0.309													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2513892	2513892	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2513892delA								MYT1L (178847 upstream) : TSSC1 (678849 downstream)																							tcccaacagcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20165396	20165397	+	Intron	DEL	AG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20165396_20165397delAG	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					tgttttcagcagagttccccca	0.000													4	3	---	---	---	---	
DNAJC27	51277	broad.mit.edu	37	2	25180475	25180475	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180475delA	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						ATGGCACCAGAAAAAAAAAAA	0.383													4	3	---	---	---	---	
LRPPRC	10128	broad.mit.edu	37	2	44133096	44133096	+	Intron	DEL	T	-	-	rs78439170		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44133096delT	uc002rtr.2	-						LRPPRC_uc010yob.1_Intron	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein						mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGAAGGATAATTTTTTTTTGC	0.303													4	2	---	---	---	---	
SLC3A1	6519	broad.mit.edu	37	2	44502504	44502504	+	5'Flank	DEL	T	-	-	rs75346091		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44502504delT	uc002ruc.3	+						SLC3A1_uc002rty.2_5'Flank|SLC3A1_uc002rtz.2_5'Flank|SLC3A1_uc002rua.2_5'Flank|SLC3A1_uc002rub.2_5'Flank	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1						carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AGTCCCGAGATTTTTTTTTTA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	53223873	53223873	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53223873delT								None (None upstream) : ASB3 (673245 downstream)																							GTCTACCCTATCCCTATCCCT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54279486	54279486	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54279486delT								PSME4 (81509 upstream) : ACYP2 (62924 downstream)																							CCTGGTGGCATTTTCAATAGC	0.363													4	2	---	---	---	---	
HK2	3099	broad.mit.edu	37	2	75113157	75113157	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75113157delA	uc002snd.2	+							NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2						apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						tatagagtTTAAAAAAAAAAA	0.005													8	6	---	---	---	---	
USP39	10713	broad.mit.edu	37	2	85848346	85848346	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85848346delG	uc002sqe.2	+						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_Intron|USP39_uc010ysv.1_Intron|USP39_uc010fgn.1_Intron|USP39_uc002sqf.2_Intron|USP39_uc002sqg.2_Intron|USP39_uc010fgo.2_Intron	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39						spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						TGACTGCAATGGAAAGTCCTG	0.463													7	4	---	---	---	---	
SMYD1	150572	broad.mit.edu	37	2	88405600	88405600	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88405600delT	uc002ssr.2	+						SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Intron	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						TACCTATTGATTTTGGAAACT	0.308													4	2	---	---	---	---	
CREG2	200407	broad.mit.edu	37	2	102000476	102000476	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102000476delC	uc002tba.2	-							NM_153836	NP_722578	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2							extracellular region	FMN binding			ovary(1)	1						atttcatgttcttttggggag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127648911	127648911	+	IGR	DEL	T	-	-	rs113309019		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127648911delT								GYPC (194666 upstream) : BIN1 (156696 downstream)																							GGAGGGCAGATTTTTTTTTTT	0.522													4	2	---	---	---	---	
ARHGEF4	50649	broad.mit.edu	37	2	131769443	131769443	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131769443delG	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		cgtgaagtgtgggggcggcgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	150997382	150997382	+	IGR	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150997382delC								MMADHC (553052 upstream) : RND3 (327330 downstream)																							ttcctaatttcctagctgtgg	0.095													4	2	---	---	---	---	
SSB	6741	broad.mit.edu	37	2	170663807	170663807	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170663807delT	uc002ufk.2	+						SSB_uc002ufl.2_Intron|SSB_uc002ufm.2_Intron	NM_003142	NP_003133	P05455	LA_HUMAN	autoantigen La						histone mRNA metabolic process|tRNA modification	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding|tRNA binding			skin(3)|pancreas(1)	4						tttctttttcttttttttttg	0.124													6	4	---	---	---	---	
SUMO1	7341	broad.mit.edu	37	2	203104173	203104173	+	5'Flank	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203104173delA	uc002uyz.1	-						SUMO1_uc002uza.1_5'Flank	NM_001005781	NP_001005781	P63165	SUMO1_HUMAN	SMT3 suppressor of mif two 3 homolog 1 isoform a						DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0						actccctctcaaaaaaaaaaa	0.323													9	7	---	---	---	---	
UNC80	285175	broad.mit.edu	37	2	210699818	210699823	+	Intron	DEL	TTTGTT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210699818_210699823delTTTGTT	uc010zjc.1	+						UNC80_uc002vdk.2_Intron	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1							integral to membrane					0						CTGCTATTTGTTTGTTTTTCATCTCC	0.413													67	40	---	---	---	---	
IQSEC1	9922	broad.mit.edu	37	3	13005193	13005193	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13005193delG	uc003bxt.2	-						IQSEC1_uc003bxu.3_Intron|IQSEC1_uc011auw.1_Intron	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						aggaagaggtggagtcagggt	0.045													4	2	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14486951	14486954	+	Intron	DEL	AAAG	-	-	rs66645026		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14486951_14486954delAAAG	uc010heg.2	+						SLC6A6_uc003byp.2_Intron|SLC6A6_uc010hef.1_Intron|SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						aaaaagaaaaaaagaaagaaagaa	0.201													3	5	---	---	---	---	
PRSS50	29122	broad.mit.edu	37	3	46757719	46757721	+	Intron	DEL	CTT	-	-	rs146454327	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46757719_46757721delCTT	uc003cqe.1	-						PRSS50_uc003cqf.1_Intron	NM_013270	NP_037402	Q9UI38	TSP50_HUMAN	testes-specific protease 50 precursor						proteolysis	endoplasmic reticulum	serine-type endopeptidase activity|threonine-type endopeptidase activity				0						atgcagactGCTTCTTCTTCTTT	0.034													4	2	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47079180	47079181	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47079180_47079181insG	uc003cqs.2	-	18	7378_7379	c.7325_7326insC	c.(7324-7326)CCAfs	p.P2442fs	SETD2_uc003cqv.2_Frame_Shift_Ins_p.P2509fs|SETD2_uc003cqr.2_Frame_Shift_Ins_p.P41fs	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2442					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CATCATATGTTGGAGTTCCCAG	0.500			N|F|S|Mis		clear cell renal carcinoma								135	109	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	59851844	59851846	+	Intron	DEL	CAT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59851844_59851846delCAT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		gaccagcaagcatgatgatgaga	0.044			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
KIAA2018	205717	broad.mit.edu	37	3	113391360	113391360	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113391360delA	uc003eam.2	-						KIAA2018_uc003eal.2_5'Flank	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717						regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						TTTATACAGCAAAAAAAAATC	0.299													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117328808	117328809	+	IGR	DEL	TC	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117328808_117328809delTC								LOC285194 (892923 upstream) : None (None downstream)																							GCTTTCTGCTTCTCTCTCTCTC	0.342													4	2	---	---	---	---	
RPN1	6184	broad.mit.edu	37	3	128363500	128363500	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128363500delA	uc003ekr.1	-						RPN1_uc011bkq.1_Intron	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		ctgtctcaagaaaaaaaaaaa	0.015			T	EVI1	AML								7	5	---	---	---	---	
DZIP1L	199221	broad.mit.edu	37	3	137786199	137786199	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137786199delA	uc003erq.2	-							NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						GCTATCCCACAAAAAAATATC	0.403													4	2	---	---	---	---	
PCOLCE2	26577	broad.mit.edu	37	3	142566846	142566846	+	Intron	DEL	T	-	-	rs116710084	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142566846delT	uc003evd.2	-							NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						AAGCTCCACATTTTTACTCTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4075661	4075664	+	Intron	DEL	GAGA	-	-	rs71241259		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4075661_4075664delGAGA	uc003gho.2	+											Homo sapiens cDNA clone IMAGE:5275587.																		tgagactggggagagagagagtgt	0.196													4	2	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6936955	6936955	+	Intron	DEL	T	-	-	rs78741274		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6936955delT	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						agtggtgtgattttttttttt	0.000													5	3	---	---	---	---	
RBPJ	3516	broad.mit.edu	37	4	26422485	26422485	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26422485delT	uc003grx.1	+						RBPJ_uc003gry.1_Intron|RBPJ_uc003grz.1_Intron|RBPJ_uc011bxt.1_Intron|RBPJ_uc003gsa.1_Intron|RBPJ_uc003gsb.1_Intron|RBPJ_uc003gsc.1_Intron	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of						DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				ATTGTCTCTCTTTTTTTAATC	0.184													4	2	---	---	---	---	
SRP72	6731	broad.mit.edu	37	4	57336139	57336139	+	Intron	DEL	T	-	-	rs34334701		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57336139delT	uc003hbv.2	+						SRP72_uc010ihe.2_Intron	NM_006947	NP_008878	O76094	SRP72_HUMAN	signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)					CCTTAGAGAGTTTTTTTTTTT	0.373													4	2	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114274067	114274068	+	Intron	DEL	CC	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114274067_114274068delCC	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCTACCATTCCCAGCCCATTT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190655269	190655271	+	IGR	DEL	ATA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190655269_190655271delATA								None (None upstream) : FRG1 (206703 downstream)																							ctgcaccatcataatgtcatcca	0.000													7	4	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1320547	1320547	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1320547delC	uc003jch.2	-						CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CAGTTTCTTGCCAGGACATAT	0.438													4	2	---	---	---	---	
MTMR12	54545	broad.mit.edu	37	5	32311473	32311473	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32311473delA	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						AACTAGGACTAAAAATAAGAC	0.403													4	2	---	---	---	---	
ZFR	51663	broad.mit.edu	37	5	32402970	32402970	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32402970delT	uc003jhr.1	-							NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		tgtgcagatctttttttttta	0.000													5	3	---	---	---	---	
ISL1	3670	broad.mit.edu	37	5	50680250	50680253	+	Intron	DEL	AAAG	-	-	rs61652519		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50680250_50680253delAAAG	uc003jor.2	+						uc003joq.1_5'Flank	NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1						generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				aaaaaaaaaaaaagaaagaaagaa	0.314													3	3	---	---	---	---	
ELOVL7	79993	broad.mit.edu	37	5	60068156	60068156	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60068156delT	uc003jsi.3	-						ELOVL7_uc011cqo.1_Intron|ELOVL7_uc010iwk.2_Intron|ELOVL7_uc003jsj.3_Intron	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				catgatggtattagtgccctt	0.179													4	2	---	---	---	---	
FSTL4	23105	broad.mit.edu	37	5	132808925	132808925	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132808925delA	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAAAGAAAAGAAAAAAAAAAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165133343	165133345	+	IGR	DEL	CCA	-	-	rs34826078		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165133343_165133345delCCA								None (None upstream) : None (None downstream)																							aagacagcatccaccacagcttt	0.000													2	4	---	---	---	---	
BTNL8	79908	broad.mit.edu	37	5	180351438	180351438	+	Intron	DEL	C	-	-	rs77715528		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180351438delC	uc003mmp.2	+						BTNL8_uc003mmq.2_Intron|BTNL8_uc011dhg.1_Intron|BTNL8_uc010jll.2_Intron|BTNL8_uc010jlm.2_Intron|BTNL8_uc011dhh.1_Intron	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor							integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ttccaaacaacagtaccatct	0.119													1	5	---	---	---	---	
EDN1	1906	broad.mit.edu	37	6	12296593	12296594	+	3'UTR	DEL	GA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12296593_12296594delGA	uc003nae.3	+	5					EDN1_uc003nad.2_3'UTR|EDN1_uc003naf.3_3'UTR	NM_001955	NP_001946	P05305	EDN1_HUMAN	endothelin 1 precursor						artery smooth muscle contraction|calcium-mediated signaling|leukocyte activation|negative regulation of blood coagulation|negative regulation of cellular protein metabolic process|negative regulation of nitric-oxide synthase biosynthetic process|negative regulation of transcription from RNA polymerase II promoter|nitric oxide transport|peptide hormone secretion|phosphatidylinositol 3-kinase cascade|positive regulation of cardiac muscle hypertrophy|positive regulation of cell size|positive regulation of endothelial cell migration|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of JUN kinase activity|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of sarcomere organization|positive regulation of smooth muscle cell proliferation|prostaglandin biosynthetic process|protein kinase C deactivation|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	cytoplasm|extracellular space	cytokine activity|endothelin A receptor binding|endothelin B receptor binding|hormone activity			skin(1)	1	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)				GCATCCTCCGGAGAGAGAGAGA	0.515													4	2	---	---	---	---	
VARS	7407	broad.mit.edu	37	6	31752484	31752485	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31752484_31752485delGA	uc003nxe.2	-	11	1777_1778	c.1354_1355delTC	c.(1354-1356)TCAfs	p.S452fs	VARS_uc011doi.1_RNA	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	452					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	CACAGCTGCTGAGAGTTTCTGG	0.594													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32521545	32521546	+	Intron	INS	-	AAGG	AAGG	rs70993877		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521545_32521546insAAGG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TTGGGGAAAGACTTTATCCAGG	0.436													10	5	---	---	---	---	
ANKS1A	23294	broad.mit.edu	37	6	35046580	35046580	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35046580delA	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						GGAGCTCCGGAAGGGCCGCAC	0.617													4	2	---	---	---	---	
ZNF318	24149	broad.mit.edu	37	6	43319918	43319919	+	Intron	INS	-	CAC	CAC	rs3078977		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43319918_43319919insCAC	uc003oux.2	-						ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			atcatcatcatcatcaccacca	0.000													5	3	---	---	---	---	
GSTA3	2940	broad.mit.edu	37	6	52765063	52765064	+	Intron	DEL	TT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52765063_52765064delTT	uc003pbb.2	-						GSTA3_uc010jzq.2_Intron	NM_000847	NP_000838	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3						glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity				0	Lung NSC(77;0.0912)				Glutathione(DB00143)	tttctttttctttttttttttt	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66499403	66499404	+	IGR	INS	-	T	T	rs147431347		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66499403_66499404insT								MCART3P (28 upstream) : None (None downstream)																							tttgttttctgttttttttttt	0.272													3	3	---	---	---	---	
ORC3L	23595	broad.mit.edu	37	6	88367528	88367531	+	Intron	DEL	CTGT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88367528_88367531delCTGT	uc003pmh.2	+						ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		TCTGTACATCCTGTCTTATGGAAA	0.377													30	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	110836121	110836121	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110836121delA								SLC22A16 (38277 upstream) : CDK19 (95060 downstream)																							cggttttcttatgtttagtag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112646702	112646702	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112646702delT								LAMA4 (70874 upstream) : RFPL4B (21830 downstream)																							ccagagactatttttttTTTC	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127357002	127357003	+	Intron	DEL	AA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127357002_127357003delAA	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		ATACTATTTTAAGTAAAACCCT	0.351													4	2	---	---	---	---	
OLIG3	167826	broad.mit.edu	37	6	137815792	137815793	+	5'Flank	INS	-	T	T	rs150555422	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137815792_137815793insT	uc003qhp.1	-							NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CGCCTTCCTGATTTTTTTTTTA	0.554													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145160073	145160075	+	Intron	DEL	TGT	-	-	rs117816885	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145160073_145160075delTGT	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ATAAAAATGGTGTTGATAAATGA	0.379													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	148061419	148061419	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148061419delT								SAMD5 (170262 upstream) : SASH1 (602310 downstream)																							AATAGGATGGTTCTCTACTGC	0.264													4	2	---	---	---	---	
SLC22A1	6580	broad.mit.edu	37	6	160554761	160554762	+	Intron	DEL	CG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160554761_160554762delCG	uc003qtc.2	+						SLC22A1_uc003qtd.2_Intron	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a							basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTGATGGGTCCGGGGCCCCAGA	0.644													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164263411	164263412	+	IGR	INS	-	C	C	rs143827344	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164263411_164263412insC								QKI (268519 upstream) : None (None downstream)																							GCCTACATCCACCCCCCGCATT	0.500													4	4	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27606802	27606802	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27606802delT	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_Intron	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	attctgctagtttttatttca	0.000													4	2	---	---	---	---	
CDK13	8621	broad.mit.edu	37	7	40134281	40134281	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40134281delC	uc003thh.3	+	14	4523	c.4241delC	c.(4240-4242)GCTfs	p.A1414fs	CDK13_uc003thi.3_Frame_Shift_Del_p.A1354fs|CDK13_uc003thj.2_Frame_Shift_Del_p.A465fs|CDK13_uc003thk.2_Frame_Shift_Del_p.A347fs	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1414					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						TACCTCAATGCTGGTCCCATG	0.483													136	63	---	---	---	---	
C7orf72	100130988	broad.mit.edu	37	7	50181230	50181230	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50181230delA	uc011kcj.1	+							NM_001161834	NP_001155306			hypothetical protein LOC100130988											ovary(1)	1						aacttgtgagaaaaaaaatgc	0.154													4	2	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56089056	56089056	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56089056delT	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CACAGATTCATTTTTTTTTCC	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65085750	65085750	+	IGR	DEL	A	-	-	rs67664163		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65085750delA								ZNF92 (219753 upstream) : INTS4L2 (27027 downstream)																							aaagtaaaggaaaaaaaaaat	0.000													4	8	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69114501	69114501	+	Intron	DEL	T	-	-	rs74531286		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69114501delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CACTGTATGCTTTTTTTTTTG	0.458													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95349986	95349986	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95349986delA								PDK4 (124061 upstream) : DYNC1I1 (51832 downstream)																							aattcctactaaaaaaaaatt	0.055													4	2	---	---	---	---	
EPHB4	2050	broad.mit.edu	37	7	100405271	100405271	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100405271delT	uc003uwn.1	-						EPHB4_uc003uwm.1_Intron|EPHB4_uc010lhj.1_Intron	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CATCCACAtctttttttttta	0.294													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123661445	123661445	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123661445delC	uc003vlg.2	+						uc010lkv.1_Intron					Homo sapiens cDNA clone IMAGE:5301388.																		tgctacactgcctcctctctc	0.000													4	2	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128309962	128309962	+	5'Flank	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128309962delT	uc003vnk.3	+						FAM71F2_uc010llm.1_5'Flank|FAM71F2_uc003vnl.2_5'Flank|FAM71F2_uc010lln.1_5'Flank	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						tttttctttcttttttttttt	0.100													4	4	---	---	---	---	
AHCYL2	23382	broad.mit.edu	37	7	129019300	129019300	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129019300delA	uc011kov.1	+						AHCYL2_uc003vot.2_Intron|AHCYL2_uc003vov.2_Intron|AHCYL2_uc011kow.1_Intron|AHCYL2_uc011kox.1_Intron	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform						one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						atctctatttaaaaaaaaaaa	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	129138646	129138646	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129138646delA								FAM40B (10409 upstream) : NRF1 (112909 downstream)																							tcaaaaaaagaaaaaaaaaaa	0.124													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20585350	20585353	+	IGR	DEL	TAAG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20585350_20585353delTAAG								LZTS1 (472547 upstream) : GFRA2 (964177 downstream)																							TGAAAGCTCTTAAGTGAGACATCC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65034503	65034504	+	IGR	DEL	AA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65034503_65034504delAA								YTHDF3 (909158 upstream) : MIR124-2 (257202 downstream)																							tgtttgtaacaaaaaaaaagga	0.000													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	69086323	69086323	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69086323delT	uc003xxv.1	+							NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CCTTCAGTGATTTTTTTCCTA	0.323													4	2	---	---	---	---	
C8orf47	203111	broad.mit.edu	37	8	99101674	99101674	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99101674delA	uc003yih.1	+	2	577	c.429delA	c.(427-429)CTAfs	p.L143fs		NM_173549	NP_775820	Q6P6B1	CH047_HUMAN	hypothetical protein LOC203111	143											0	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CCGAGTCTCTAAAAGGAAATG	0.552													87	45	---	---	---	---	
TG	7038	broad.mit.edu	37	8	133995973	133995973	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133995973delC	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AATGACTAGACACACACAATC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142521287	142521288	+	IGR	INS	-	C	C	rs150803579	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142521287_142521288insC								FLJ43860 (3957 upstream) : MIR1302-7 (346315 downstream)																							ACACAGAGTGTCCCCCCGACCT	0.460													2	4	---	---	---	---	
SCRT1	83482	broad.mit.edu	37	8	145558933	145558934	+	Intron	DEL	CA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145558933_145558934delCA	uc003zbw.1	-							NM_031309	NP_112599	Q9BWW7	SCRT1_HUMAN	scratch							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			cacaggcaagcacacacacaca	0.317													4	2	---	---	---	---	
CHMP5	51510	broad.mit.edu	37	9	33270366	33270367	+	Intron	DEL	TC	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33270366_33270367delTC	uc003zsl.3	+						SUGT1P1_uc010mjq.1_Intron|CHMP5_uc003zsm.3_Intron|CHMP5_uc011lnv.1_Intron|CHMP5_uc003zsn.2_5'Flank	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5						cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			acaacatatttctcagaacata	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38615324	38615324	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38615324delA	uc004abg.3	-						uc010mme.2_Intron					RecName: Full=Ankyrin repeat domain-containing protein 18B;																		CACTAATTAGAAAAAAAATAC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	47202619	47202619	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:47202619delA								KGFLP1 (454234 upstream) : None (None downstream)																							AAACTTCTCCAAAAAAAAAGT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66456605	66456606	+	Intron	DEL	AC	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66456605_66456606delAC	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		ATGCGCGCAGacacacacacac	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68424948	68424948	+	IGR	DEL	A	-	-	rs111946108		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68424948delA								FAM27B (630759 upstream) : MIR1299 (577291 downstream)																							CATTTAGAGCATTTTAACTAT	0.249													4	2	---	---	---	---	
CTSL2	1515	broad.mit.edu	37	9	99799402	99799402	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99799402delA	uc004awt.2	-						CTSL2_uc010msi.2_Intron|CTSL2_uc004awu.2_Intron|CTSL2_uc010msj.1_Intron|CTSL2_uc010msk.2_Intron	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein							lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				acaagcaaacaaaaaaaaCAC	0.194													5	3	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133364632	133364632	+	Intron	DEL	A	-	-	rs543048	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133364632delA	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_Intron|ASS1_uc010mzc.2_Intron	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	tattattattatttttttttt	0.443													3	5	---	---	---	---	
FUBP3	8939	broad.mit.edu	37	9	133493583	133493584	+	Intron	DEL	TG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133493583_133493584delTG	uc004bzr.1	+						FUBP3_uc010mzd.1_Intron|FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		tgttttggactgtgtgtgtgca	0.203													4	2	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135426670	135426670	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135426670delT	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						CTGGGTGCCCttttttttttt	0.259													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5577517	5577518	+	IGR	DEL	CG	-	-	rs11444255		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5577517_5577518delCG								CALML3 (9292 upstream) : ASB13 (103302 downstream)																							aaaaaaaaaacgaaaaaaaaaa	0.327													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10099763	10099764	+	5'Flank	INS	-	CTC	CTC	rs145339341	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10099763_10099764insCTC	uc001ikd.1	+											Homo sapiens cDNA clone IMAGE:5265675.																		TGCCCCTGCTTCTCCTGTATCA	0.223													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10775400	10775400	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10775400delA								None (None upstream) : SFTA1P (51002 downstream)																							GGAGGTAGTGAAAAAAAAAAG	0.413													5	4	---	---	---	---	
BMS1	9790	broad.mit.edu	37	10	43288761	43288761	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43288761delT	uc001jaj.2	+							NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein						ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						AAAATAATACTTTTTTTTTCA	0.383													5	3	---	---	---	---	
COL13A1	1305	broad.mit.edu	37	10	71694835	71694835	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71694835delT	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	gtttTTTTTGTTTTTTTTTTT	0.189													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86948852	86948863	+	IGR	DEL	CAACACAGAAAA	-	-	rs59347857		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86948852_86948863delCAACACAGAAAA								FAM190B (670576 upstream) : GRID1 (410449 downstream)																							aagtacccctcaacacagaaaaacgaattaat	0.000													6	3	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87893082	87893083	+	Intron	DEL	TG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87893082_87893083delTG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	catgtgtgcatgtgtgtgtgtg	0.243										Multiple Myeloma(13;0.14)			6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120326689	120326689	+	IGR	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120326689delG								C10orf84 (224850 upstream) : PRLHR (26227 downstream)																							ggagcagcgtgggggtcagcg	0.000													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121177166	121177166	+	Intron	DEL	T	-	-	rs76047351		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121177166delT	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ATCCCAGAGGTTTCTGCTCTG	0.403											OREG0020576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
LDHAL6A	160287	broad.mit.edu	37	11	18500107	18500107	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18500107delA	uc001mop.1	+						LDHAL6A_uc001moq.2_Intron	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	agtccgtctcaaaaaaaaaag	0.174													9	4	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31561000	31561001	+	Intron	INS	-	A	A	rs79720068		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31561000_31561001insA	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					gactccgtctcaaaaaaaaaGT	0.183													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33854311	33854311	+	IGR	DEL	G	-	-	rs10836117	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33854311delG								FBXO3 (58240 upstream) : LMO2 (25814 downstream)																							aaagtttaaagaaaaaacatc	0.000													4	2	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47187258	47187258	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47187258delT	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						CTGCCTGGCCTCACAGAAGCT	0.652													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48365907	48365907	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48365907delA								OR4C3 (18427 upstream) : OR4C45 (995 downstream)																							GCTGGCATCTAAAACCAGATT	0.289													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70611942	70611943	+	Intron	DEL	TT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70611942_70611943delTT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TTCCCAACACTTTTCTTGAATG	0.307													2	5	---	---	---	---	
IL18BP	10068	broad.mit.edu	37	11	71710115	71710115	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71710115delG	uc001ore.1	+						IL18BP_uc001orf.1_Intron|IL18BP_uc009ysu.1_Intron|IL18BP_uc001org.1_5'UTR|IL18BP_uc001orh.1_5'UTR|IL18BP_uc001ori.2_5'Flank|IL18BP_uc009ysv.1_5'Flank	NM_001039659	NP_001034748	O95998	I18BP_HUMAN	interleukin 18 binding protein isoform a						T-helper 1 type immune response	extracellular region	interleukin-18 binding|receptor antagonist activity				0						TCTGGCCAGAGGGGCTAGGAT	0.592													4	2	---	---	---	---	
CTSC	1075	broad.mit.edu	37	11	88035225	88035226	+	Intron	DEL	CT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88035225_88035226delCT	uc001pck.3	-						CTSC_uc001pcl.3_Intron	NM_001814	NP_001805	P53634	CATC_HUMAN	cathepsin C isoform a preproprotein						immune response	lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACTCACTTCCTCTCTCTCTCT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	97455799	97455799	+	IGR	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97455799delC								None (None upstream) : None (None downstream)																							tctatcctgaccagatgggtc	0.000													4	2	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103041991	103041991	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103041991delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTCATTAttctttttttttgg	0.159													3	4	---	---	---	---	
BACE1	23621	broad.mit.edu	37	11	117160082	117160082	+	3'UTR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117160082delT	uc001pqz.2	-	9					BACE1_uc001pqw.2_3'UTR|BACE1_uc001pqx.2_3'UTR|BACE1_uc001pqy.2_3'UTR|BACE1_uc010rxg.1_3'UTR|BACE1_uc010rxh.1_3'UTR|uc010rxi.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A						beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		CTTTCTTCTCTTTTCTGTTTC	0.507													4	2	---	---	---	---	
LOC399959	399959	broad.mit.edu	37	11	122102737	122102737	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122102737delT	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0						gctctccttctttccgtcggt	0.000													4	2	---	---	---	---	
ROBO4	54538	broad.mit.edu	37	11	124767376	124767376	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124767376delT	uc001qbg.2	-						ROBO4_uc010sas.1_Intron|ROBO4_uc001qbh.2_Intron|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout						angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		Gctctctctctctctctctct	0.328													4	2	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6145360	6145363	+	Intron	DEL	GCAG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6145360_6145363delGCAG	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TAGTGTCTATGCAGGATGGACACA	0.083													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6379629	6379629	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6379629delT								CD9 (32202 upstream) : PLEKHG6 (39973 downstream)																							ttttcttttcttttttttttt	0.209													15	7	---	---	---	---	
CDKN1B	1027	broad.mit.edu	37	12	12869110	12869110	+	5'Flank	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12869110delA	uc001rat.2	+							NM_004064	NP_004055	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B						autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity			ovary(1)|lung(1)	2		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		TTCCAGCTGCAAAAGGGAGAA	0.488									Multiple_Endocrine_Neoplasia_type_1|Multiple_Endocrine_Neoplasia_type_4				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	56051728	56051728	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56051728delA								OR10P1 (20112 upstream) : METTL7B (23602 downstream)																							AGAAGGAAGGAATGAAGGAAG	0.458													4	2	---	---	---	---	
ANO4	121601	broad.mit.edu	37	12	101279992	101279992	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101279992delC	uc010svm.1	+						ANO4_uc010svl.1_Intron|ANO4_uc001thw.2_Intron	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4							chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GATTATGCAACCCCCACCCCC	0.373										HNSCC(74;0.22)			4	2	---	---	---	---	
C12orf34	84915	broad.mit.edu	37	12	110167379	110167379	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110167379delA	uc001tpd.1	+							NM_032829	NP_116218	Q5U5X8	CL034_HUMAN	hypothetical protein LOC84915											ovary(1)	1						CCTGCAAGGGAAAAAAAACAC	0.522													4	2	---	---	---	---	
OAS1	4938	broad.mit.edu	37	12	113355746	113355746	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113355746delA	uc001tud.2	+						OAS1_uc001tub.2_3'UTR|OAS1_uc001tuc.2_Intron|OAS1_uc009zwf.2_Intron	NM_016816	NP_058132	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 1						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						aataatctctaacaccattta	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116759131	116759131	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116759131delT								MED13L (44140 upstream) : NCRNA00173 (212096 downstream)																							AAGCATCttctttttttttta	0.239													9	4	---	---	---	---	
LOC144742	144742	broad.mit.edu	37	12	119739237	119739237	+	Intron	DEL	A	-	-	rs80069588		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119739237delA	uc009zwt.1	-							NR_024246				Homo sapiens cDNA FLJ32935 fis, clone TESTI2007502.												0						tttacagattaaaaaaAAAAA	0.338													2	4	---	---	---	---	
DHX37	57647	broad.mit.edu	37	12	125470374	125470374	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125470374delA	uc001ugy.2	-							NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		aatttaaattaaaaaaaaaaa	0.169													4	3	---	---	---	---	
CDX2	1045	broad.mit.edu	37	13	28542702	28542703	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28542702_28542703insG	uc001urv.2	-	1	615_616	c.441_442insC	c.(439-444)CCCGCCfs	p.P147fs		NM_001265	NP_001256	Q99626	CDX2_HUMAN	caudal type homeobox 2	147_148					organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		GCGGTGGCGGCGGGCCCAGGAG	0.619			T	ETV6	AML								17	10	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43898886	43898887	+	Intron	INS	-	T	T	rs150111341	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43898886_43898887insT	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron|ENOX1_uc010tfm.1_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AGCAAGCAGGCTCCTTAGACCT	0.545													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	78711660	78711661	+	Intron	INS	-	TT	TT	rs141114382	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78711660_78711661insTT	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																		ATTGGAAGGTCTTTGAAGATTT	0.480											OREG0022453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
CLYBL	171425	broad.mit.edu	37	13	100265950	100265951	+	Intron	DEL	TG	-	-	rs145015784		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100265950_100265951delTG	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TAAACATGACTGAGATGGAAAA	0.257													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101422497	101422498	+	IGR	INS	-	T	T			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101422497_101422498insT								TMTC4 (95394 upstream) : NALCN (283632 downstream)																							ATTTCCACTACTTTTTTTTTTG	0.431													4	2	---	---	---	---	
PROZ	8858	broad.mit.edu	37	13	113817042	113817043	+	Intron	INS	-	ACCCC	ACCCC	rs148908213		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113817042_113817043insACCCC	uc001vta.1	+						PROZ_uc010agr.1_Intron	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	ccacctccccacatcctcctcc	0.139													4	2	---	---	---	---	
GAS6	2621	broad.mit.edu	37	13	114538718	114538719	+	Intron	DEL	CT	-	-	rs71105205		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114538718_114538719delCT	uc001vud.2	-						GAS6_uc001vug.2_5'Flank|GAS6_uc001vuf.2_5'UTR	NM_000820	NP_000811	Q14393	GAS6_HUMAN	growth arrest-specific 6 isoform 1 precursor						cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CGCATCCAGACTCTGTGGGGCC	0.688													4	4	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114807736	114807738	+	Intron	DEL	CAT	-	-	rs67872263		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114807736_114807738delCAT	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ATGGCACCACCATGTCAACCCTG	0.660													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97832009	97832010	+	IGR	DEL	GT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97832009_97832010delGT								VRK1 (484059 upstream) : C14orf64 (559937 downstream)																							tgtgggcttggtgtgtgtgtgt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99270688	99270689	+	IGR	INS	-	G	G	rs150220230	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99270688_99270689insG								C14orf177 (86591 upstream) : BCL11B (364938 downstream)																							AAGAATTCACATACCTGGTACT	0.421													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106015709	106015709	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106015709delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ccaccagaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106881532	106881533	+	Intron	INS	-	TAGA	TAGA	rs149406887	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106881532_106881533insTAGA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						tgattgacacttagattatttg	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39156933	39156939	+	IGR	DEL	AAAGCCA	-	-	rs58651946		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39156933_39156939delAAAGCCA								C15orf53 (164694 upstream) : C15orf54 (385946 downstream)																							ttaagtgaataaagccacccaggtggt	0.150													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39156940	39156941	+	IGR	INS	-	T	T	rs66807263		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39156940_39156941insT								C15orf53 (164701 upstream) : C15orf54 (385944 downstream)																							aataaagccacccaggtggtaa	0.153													5	5	---	---	---	---	
THBS1	7057	broad.mit.edu	37	15	39873841	39873842	+	Intron	DEL	CT	-	-	rs35376187		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39873841_39873842delCT	uc001zkh.2	+							NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor						activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	TTTCCTCCACctctctctctct	0.441											OREG0023050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MYO9A	4649	broad.mit.edu	37	15	72168255	72168256	+	Intron	INS	-	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72168255_72168256insA	uc002atl.3	-						MYO9A_uc002atk.2_Intron|MYO9A_uc002atm.1_Intron	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TTGCAAATGTTAAGATACTTGC	0.317													59	30	---	---	---	---	
DNAJA4	55466	broad.mit.edu	37	15	78563236	78563236	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78563236delA	uc002bdj.1	+						DNAJA4_uc002bdi.2_Intron|DNAJA4_uc002bdk.2_Intron|DNAJA4_uc002bdl.2_Intron	NM_001130182	NP_001123654	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4						protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1						tccccatctcaaaaaaaataa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78653925	78653925	+	IGR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78653925delA								CRABP1 (13353 upstream) : IREB2 (76593 downstream)																							aagctaagccaatcagagccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102036087	102036088	+	IGR	INS	-	CT	CT	rs145834939	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102036087_102036088insCT								PCSK6 (5900 upstream) : TM2D3 (137092 downstream)																							GGTGACTCTGACTTTCCCCACC	0.436													6	10	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10754519	10754532	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs5815594		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10754519_10754532delTGTGTGTGTGTGTG	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						AGTGCAAGGCtgtgtgtgtgtgtgtgtgtgtgtg	0.168													9	5	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11195220	11195220	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11195220delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						CTTCCTCATATCCCAGCCCCA	0.557													4	2	---	---	---	---	
GSPT1	2935	broad.mit.edu	37	16	11976657	11976657	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11976657delA	uc002dbr.2	-						GSPT1_uc002dbu.2_Intron|GSPT1_uc002dbt.2_Intron|GSPT1_uc010bux.2_Intron	NM_001130007	NP_001123479	P15170	ERF3A_HUMAN	G1 to S phase transition 1 isoform 3						G1/S transition of mitotic cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation	intracellular	GTP binding|GTPase activity|protein binding|translation release factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						atttttatttaaaaaaaaaaa	0.000													3	5	---	---	---	---	
ARL6IP1	23204	broad.mit.edu	37	16	18807117	18807120	+	Intron	DEL	GAGT	-	-	rs146265293	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18807117_18807120delGAGT	uc002dfl.1	-						ARL6IP1_uc010van.1_Intron|ARL6IP1_uc010bvz.1_Intron	NM_015161	NP_055976	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting							integral to membrane	protein binding				0						gtgagagagagagtgtgtgtgtgt	0.275													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33570427	33570427	+	IGR	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33570427delC								SLC6A10P (673964 upstream) : MIR1826 (395081 downstream)																							TCAAACCCAGCCCCATCCCAC	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49470636	49470637	+	IGR	DEL	CA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49470636_49470637delCA								C16orf78 (37319 upstream) : ZNF423 (53885 downstream)																							tctctctctcCACACACACACT	0.252													4	2	---	---	---	---	
SPIRE2	84501	broad.mit.edu	37	16	89909766	89909766	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89909766delC	uc002foz.1	+						SPIRE2_uc010civ.1_Intron|SPIRE2_uc010ciw.1_Intron	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2						transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TCCCGGGCCTCCCTCAGGGCC	0.448													4	2	---	---	---	---	
MNT	4335	broad.mit.edu	37	17	2299415	2299416	+	Intron	INS	-	C	C	rs139167972	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2299415_2299416insC	uc002fur.2	-							NM_020310	NP_064706	Q99583	MNT_HUMAN	MAX binding protein						multicellular organismal development|negative regulation of cell proliferation|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			skin(1)	1				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		cctcacaagagccccacgtcac	0.282													7	6	---	---	---	---	
ZBTB4	57659	broad.mit.edu	37	17	7363094	7363094	+	3'UTR	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7363094delA	uc002ghc.3	-	5					ZBTB4_uc002ghd.3_3'UTR	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CATATTTAAGAAAAAAAAAAT	0.358													5	5	---	---	---	---	
PIK3R6	146850	broad.mit.edu	37	17	8721970	8721971	+	Intron	INS	-	A	A			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8721970_8721971insA	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						ccgtcttgaggaaaaaaaaaaT	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13695982	13695983	+	5'Flank	INS	-	T	T	rs148322250	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13695982_13695983insT	uc002goc.1	-											Homo sapiens cDNA FLJ41269 fis, clone BRAMY2036079.																		CAGCAACACAGTGCCATGTCAG	0.416													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21225034	21225035	+	IGR	INS	-	AG	AG	rs77521218		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21225034_21225035insAG								MAP2K3 (6485 upstream) : KCNJ12 (54664 downstream)																							TGGTTCCCCACAGTCTGAGGTC	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21553361	21553361	+	IGR	DEL	C	-	-	rs75992433		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21553361delC								C17orf51 (75630 upstream) : FAM27L (272009 downstream)																							GCTACCTCCTCTCCTTTTCCT	0.294													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35118294	35118295	+	IGR	INS	-	GTGT	GTGT	rs141414153	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35118294_35118295insGTGT								MRM1 (152888 upstream) : LHX1 (176204 downstream)																							gtgtgtagtgagctggtgtgtg	0.000													4	2	---	---	---	---	
G6PC3	92579	broad.mit.edu	37	17	42145121	42145121	+	5'Flank	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42145121delA	uc002iex.2	+						LSM12_uc010wit.1_5'Flank|LSM12_uc002iev.2_5'Flank|G6PC3_uc002iey.2_5'Flank|G6PC3_uc010czo.2_5'Flank	NM_138387	NP_612396	Q9BUM1	G6PC3_HUMAN	glucose-6-phosphatase catalytic subunit 3						gluconeogenesis|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity			skin(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTTAGAAGTCAAGACACTTCC	0.343													4	2	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42937010	42937011	+	Intron	DEL	CA	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42937010_42937011delCA	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				cacaaatacgcacacacacaca	0.287													5	3	---	---	---	---	
PTRH2	51651	broad.mit.edu	37	17	57776512	57776513	+	Intron	DEL	GC	-	-	rs148629488		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57776512_57776513delGC	uc002ixt.2	-						PTRH2_uc002ixs.2_RNA	NM_016077	NP_057161	Q9Y3E5	PTH2_HUMAN	Bcl-2 inhibitor of transcription precursor						apoptosis|translation	mitochondrion	aminoacyl-tRNA hydrolase activity				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					tcctgtatctgcgcctgtcaac	0.000													4	3	---	---	---	---	
FADS6	283985	broad.mit.edu	37	17	72879130	72879133	+	Intron	DEL	AATG	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72879130_72879133delAATG	uc002jmd.1	-						FADS6_uc010wrn.1_5'Flank	NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6						fatty acid biosynthetic process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)					CTGCCCAGGCAATGAGTCTCAGAG	0.529													3	3	---	---	---	---	
CDK3	1018	broad.mit.edu	37	17	73999641	73999641	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73999641delC	uc010dgt.2	+						CDK3_uc002jqg.3_Intron	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3						cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						CCGGAAGCCTCCCCCAGGATA	0.483													4	2	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42418798	42418799	+	Intron	INS	-	C	C	rs142940851	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42418798_42418799insC	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GACCCCCTCAGCCCCACCCCAC	0.460									Schinzel-Giedion_syndrome				1	5	---	---	---	---	
ZNF532	55205	broad.mit.edu	37	18	56642314	56642314	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56642314delC	uc002lho.2	+						ZNF532_uc002lhp.2_Intron|ZNF532_uc010xeg.1_Intron|ZNF532_uc002lhr.2_Intron|ZNF532_uc002lhs.2_Intron|ZNF532_uc010xeh.1_Intron	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GAATAGATTGCCCAGTGGAAG	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57851459	57851460	+	IGR	INS	-	CCTCCCCCTCACCAAACTTAA	CCTCCCCCTCACCAAACTTAA			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57851459_57851460insCCTCCCCCTCACCAAACTTAA								PMAIP1 (279921 upstream) : MC4R (187104 downstream)																							AAGGTCATTTGCCCGCTCTTTC	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8258153	8258153	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8258153delT								FBN3 (45772 upstream) : LASS4 (16064 downstream)																							ACACAGTGTCTTTTTTTTTTT	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9804225	9804225	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9804225delT	uc010xkx.1	-											RecName: Full=Zinc finger protein 562;																		atttttatgatttttttttta	0.005													9	4	---	---	---	---	
SSBP4	170463	broad.mit.edu	37	19	18542001	18542024	+	Intron	DEL	GTCCTGGTGACCACTGGTGCCTGA	-	-	rs2891673		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18542001_18542024delGTCCTGGTGACCACTGGTGCCTGA	uc002niy.2	+						SSBP4_uc010ebp.2_Intron|SSBP4_uc002niz.2_Intron	NM_032627	NP_116016	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4 isoform a							nucleus	single-stranded DNA binding				0						AGCCACAGTGGTCCTGGTGACCACTGGTGCCTGAGTCCTGCCCT	0.656													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30631685	30631685	+	IGR	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30631685delT								C19orf2 (125074 upstream) : ZNF536 (231643 downstream)																							TGAGACGGAGttttctctctt	0.174													5	3	---	---	---	---	
HPN	3249	broad.mit.edu	37	19	35555723	35555726	+	Intron	DEL	TTTG	-	-	rs75410006		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35555723_35555726delTTTG	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	TTGTGGCttttttgtttgtttgtt	0.113													2	4	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991640	39991640	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991640delT	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TTATGTGAAGttttttttttt	0.224													4	2	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45847099	45847102	+	Intron	DEL	CTTT	-	-	rs35251178		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45847099_45847102delCTTT	uc002pbf.1	+						KLC3_uc002pbe.2_Intron|KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_5'Flank	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		TTATGCTGTCCtttctttctttct	0.152													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50696494	50696495	+	IGR	INS	-	C	C	rs144753012	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50696494_50696495insC								C19orf41 (29956 upstream) : MYH14 (10390 downstream)																							tctaagagggtcctctgactgc	0.000													4	2	---	---	---	---	
POLD1	5424	broad.mit.edu	37	19	50910085	50910086	+	Intron	INS	-	C	C			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50910085_50910086insC	uc002psb.3	+						POLD1_uc002psc.3_Intron|POLD1_uc010enx.2_Intron|POLD1_uc010eny.2_Intron	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		cctacctccatccccacccaga	0.272								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
ZNF135	7694	broad.mit.edu	37	19	58571252	58571252	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58571252delC	uc010yhq.1	+						ZNF135_uc002qre.2_Intron|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Intron|ZNF135_uc002qrg.2_Intron|ZNF135_uc010yhr.1_Intron	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCGCGGAGCTCCCCAGGCTCT	0.701													4	2	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9453218	9453219	+	Intron	INS	-	G	G			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9453218_9453219insG	uc002wnf.2	+						PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron|PLCB4_uc002wnh.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TAAACATGGCAAAACATTAAAA	0.163													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24499175	24499175	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24499175delG	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						CTTTTTGTCTGGGGGTTCAGC	0.458													4	2	---	---	---	---	
MYLK2	85366	broad.mit.edu	37	20	30414936	30414936	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30414936delG	uc002wwq.2	+						MYLK2_uc002wws.2_Intron	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase						cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			aagagagagagggggggaaaa	0.114													4	2	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	34969708	34969708	+	Intron	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34969708delC	uc002xff.2	+							NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ttttctctgtcccaggccctt	0.000													4	2	---	---	---	---	
SDC4	6385	broad.mit.edu	37	20	43976869	43976870	+	Intron	INS	-	T	T	rs5841587		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43976869_43976870insT	uc002xnu.2	-						SDC4_uc010zws.1_Intron	NM_002999	NP_002990	P31431	SDC4_HUMAN	syndecan 4 precursor							extracellular region|integral to plasma membrane	cytoskeletal protein binding|thrombospondin receptor activity				0		Myeloproliferative disorder(115;0.0122)				AGCGTACCCCCGATCTGCCCCC	0.698													5	6	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45918376	45918376	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45918376delA	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			aatcagcaacaaaaaaaaagg	0.000													5	4	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46251243	46251243	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46251243delT	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						GTAATAGAAGTTTTTTTTTTA	0.338													5	3	---	---	---	---	
BCAS1	8537	broad.mit.edu	37	20	52681447	52681447	+	Intron	DEL	C	-	-	rs5841973		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52681447delC	uc002xws.2	-						BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron|BCAS1_uc010zzc.1_Intron	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			cttttattttcccagttgtct	0.124													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58035123	58035123	+	IGR	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58035123delG								EDN3 (134077 upstream) : PHACTR3 (117441 downstream)																							GCTTCTTTGTGGCTTCACCTT	0.567													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11088890	11088891	+	Intron	INS	-	A	A	rs148198939		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11088890_11088891insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GAAAAATATACAAAAAAAGTTT	0.292													4	2	---	---	---	---	
UBASH3A	53347	broad.mit.edu	37	21	43826184	43826185	+	Intron	INS	-	TT	TT	rs117834816	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43826184_43826185insTT	uc002zbe.2	+						UBASH3A_uc002zbf.2_Intron|UBASH3A_uc010gpc.2_Intron|UBASH3A_uc010gpd.2_Intron|UBASH3A_uc010gpe.2_Intron	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,							cytosol|nucleus				ovary(3)	3						GGGCTGAAGCGGGTAGCCAGGG	0.658													4	4	---	---	---	---	
ADORA2A	135	broad.mit.edu	37	22	24829496	24829496	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24829496delA	uc002zzx.2	+	4	887	c.124delA	c.(124-126)AACfs	p.N42fs	ADORA2A_uc002zzy.3_Frame_Shift_Del_p.N42fs|ADORA2A_uc011ajs.1_Intron|C22orf45_uc003aaa.1_5'Flank|ADORA2A_uc010guo.1_Frame_Shift_Del_p.Q61fs|ADORA2A_uc010gup.2_Frame_Shift_Del_p.N42fs|ADORA2A_uc010guq.2_Frame_Shift_Del_p.N42fs|ADORA2A_uc003aab.2_Frame_Shift_Del_p.N42fs|ADORA2A_uc003aac.2_Intron	NM_000675	NP_000666	P29274	AA2AR_HUMAN	adenosine A2a receptor	42	Cytoplasmic.				apoptosis|blood coagulation|cAMP biosynthetic process|cellular defense response|inflammatory response|nerve growth factor receptor signaling pathway|phagocytosis|sensory perception	integral to plasma membrane|membrane fraction	enzyme binding				0	Colorectal(2;0.196)				Caffeine(DB00201)|Defibrotide(DB04932)|Pegademase bovine(DB00061)|Theophylline(DB00277)	GAACGTCACCAACTACTTTGT	0.617													36	20	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44131077	44131077	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44131077delA	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TAGGAGGCTCAAAAAAATGCC	0.493													4	2	---	---	---	---	
KIAA1644	85352	broad.mit.edu	37	22	44695066	44695066	+	Intron	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44695066delG	uc003bet.2	-							NM_001099294	NP_001092764	Q3SXP7	K1644_HUMAN	hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				CTTCTGCTCTGGGGCATGGCG	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48733482	48733483	+	IGR	DEL	TT	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48733482_48733483delTT								None (None upstream) : FAM19A5 (151805 downstream)																							CAGGCTGTGGTTTTAGGACATG	0.376													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49069868	49069869	+	Intron	INS	-	TT	TT	rs140358066	by1000genomes	TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49069868_49069869insTT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		CTGGACTCCTCTGCCCGCCTCA	0.619													4	5	---	---	---	---	
ARSE	415	broad.mit.edu	37	X	2856294	2856294	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2856294delC	uc004crc.3	-	9	1381	c.1131delG	c.(1129-1131)GGGfs	p.G377fs	ARSE_uc011mhi.1_Frame_Shift_Del_p.G323fs|ARSE_uc011mhh.1_Frame_Shift_Del_p.G402fs	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	377					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCATGCCCTTCCCACCTGGGT	0.547													4	2	---	---	---	---	
APOO	79135	broad.mit.edu	37	X	23854742	23854743	+	Intron	INS	-	T	T	rs137891693		TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23854742_23854743insT	uc004dax.2	-						APOO_uc004daw.2_Intron|APOO_uc004day.3_Intron	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor						lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						AGCCTAATTTCTTTTTTTTTTT	0.183													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	44336190	44336190	+	IGR	DEL	G	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44336190delG								EFHC2 (133267 upstream) : FUNDC1 (46696 downstream)																							aaaaaaaaaagaaagaaagaa	0.184													4	2	---	---	---	---	
TEX11	56159	broad.mit.edu	37	X	70053122	70053122	+	Intron	DEL	A	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70053122delA	uc004dyl.2	-						TEX11_uc004dym.2_Intron	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1								protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					tccatctcagaaaaaaaaaaa	0.090													3	3	---	---	---	---	
RGAG1	57529	broad.mit.edu	37	X	109652418	109652418	+	Intron	DEL	T	-	-			TCGA-BP-4161-01A-02D-1386-10	TCGA-BP-4161-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109652418delT	uc011msr.1	+						AMMECR1_uc004eoq.2_Intron	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1											lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						AGATGGGGACTTTTTTTTTTG	0.428													6	3	---	---	---	---	
