Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12566928	12566928	+	Silent	SNP	T	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12566928T>A	uc001atv.2	+	69	12957	c.12816T>A	c.(12814-12816)ATT>ATA	p.I4272I	VPS13D_uc001atw.2_Silent_p.I4247I|VPS13D_uc001atx.2_Silent_p.I3459I|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_Silent_p.I270I|SNORA59B_uc001atz.1_5'Flank	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	4271					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGGAGAACATTGACAGCTACT	0.537													43	122	---	---	---	---	PASS
MRPS21	54460	broad.mit.edu	37	1	150266811	150266811	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150266811G>A	uc001euk.2	+	2	107	c.25G>A	c.(25-27)GCC>ACC	p.A9T	MRPS21_uc001eul.2_Missense_Mutation_p.A9T	NM_031901	NP_114107	P82921	RT21_HUMAN	mitochondrial ribosomal protein S21	9					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	Lung NSC(24;5.57e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAGTTCATCGCCAGGACTGT	0.473													27	58	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201845133	201845133	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201845133G>T	uc001gwz.2	+	24	3127	c.3077G>T	c.(3076-3078)GGC>GTC	p.G1026V		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	1026					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						ATGTTTTCAGGCCACCTTAAT	0.483											OREG0014090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	136	341	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136882	80136882	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136882C>T	uc010ysh.1	+	6	1020	c.1015C>T	c.(1015-1017)CGG>TGG	p.R339W	CTNNA2_uc010yse.1_Missense_Mutation_p.R339W|CTNNA2_uc010ysf.1_Missense_Mutation_p.R339W|CTNNA2_uc010ysg.1_Missense_Mutation_p.R339W	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	339					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CAACGCCGTGCGGCAGGCGCT	0.597													49	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96521777	96521777	+	Missense_Mutation	SNP	T	C	C	rs77768218		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96521777T>C	uc002suz.1	-	31	2790	c.1313A>G	c.(1312-1314)CAT>CGT	p.H438R						SubName: Full=Putative uncharacterized protein ENSP00000312008; Flags: Fragment;																		AAGGTCTTCATGCTTTCTTTT	0.383													3	64	---	---	---	---	PASS
RPL31	6160	broad.mit.edu	37	2	101622534	101622534	+	Splice_Site	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101622534G>C	uc002taq.3	+	4	433	c.346_splice	c.e4+1	p.N116_splice	RPL31_uc002tar.3_Missense_Mutation_p.S116T|RPL31_uc010yvu.1_Splice_Site_p.S116_splice|RPL31_uc010yvv.1_Splice_Site_p.N116_splice|RPL31_uc010fiu.1_Splice_Site_p.I116_splice|RPL31_uc002tat.1_3'UTR	NM_000993	NP_000984	P62899	RL31_HUMAN	ribosomal protein L31 isoform 1						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						ACTTTCAAAAGTAAGTTCTCC	0.378													15	55	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133541011	133541011	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133541011C>A	uc002ttp.2	-	14	3747	c.3373G>T	c.(3373-3375)GCC>TCC	p.A1125S	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1125	Ser-rich.						protein binding				0						TGGCTTTTGGCGGGTGATGAG	0.502													113	264	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135887596	135887596	+	Silent	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135887596C>T	uc002tuj.2	+	12	1030	c.1005C>T	c.(1003-1005)TGC>TGT	p.C335C	RAB3GAP1_uc010fnf.2_Silent_p.C335C|RAB3GAP1_uc010fng.2_Silent_p.C160C|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	335						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		TTAAAATTTGCCGTCGAAAGG	0.299													4	142	---	---	---	---	PASS
SCRN3	79634	broad.mit.edu	37	2	175289230	175289230	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175289230G>A	uc002uiq.2	+	7	1033	c.945G>A	c.(943-945)GTG>GTA	p.V315V	SCRN3_uc010zen.1_Silent_p.V308V|SCRN3_uc010zeo.1_Silent_p.V113V|SCRN3_uc002uis.2_Silent_p.V57V	NM_024583	NP_078859	Q0VDG4	SCRN3_HUMAN	secernin 3	315					proteolysis		dipeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TCATATTTGTGCCACATATTT	0.299													28	86	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202122823	202122823	+	Intron	SNP	T	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202122823T>A	uc002uxr.1	+						CASP8_uc010ftc.1_Intron|CASP8_uc002uxo.1_Intron|CASP8_uc002uxp.1_Intron|CASP8_uc002uxq.1_Intron|CASP8_uc002uxs.1_5'UTR|CASP8_uc002uxt.1_5'UTR|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_5'UTR|CASP8_uc002uxv.1_5'UTR|CASP8_uc002uxw.1_5'Flank	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor						activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						TGAAGTTTTCTCTTTCTCTCG	0.418										HNSCC(4;0.00038)			27	64	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211476961	211476961	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211476961G>A	uc002vee.3	+	20	2644	c.2512G>A	c.(2512-2514)GAT>AAT	p.D838N	CPS1_uc010fur.2_Missense_Mutation_p.D844N|CPS1_uc010fus.2_Missense_Mutation_p.D387N	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	838					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ATCTAATTTAGATCTTAGAAA	0.453													80	206	---	---	---	---	PASS
UGT1A10	54575	broad.mit.edu	37	2	234545563	234545563	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234545563A>C	uc002vur.2	+	1	441	c.395A>C	c.(394-396)AAA>ACA	p.K132T	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.K132T	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	132					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		AATGACCGAAAATTAGTAGAA	0.353													7	405	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47376246	47376246	+	Silent	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47376246C>A	uc003crd.2	+	6	961	c.835C>A	c.(835-837)CGG>AGG	p.R279R	KLHL18_uc003crc.2_Silent_p.R279R|KLHL18_uc011bav.1_Silent_p.R167R|KLHL18_uc010hjq.1_Silent_p.R130R	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	279											0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		TTTCAGAACCCGGCCACGCTG	0.577													3	72	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74474063	74474063	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74474063C>A	uc003dpm.1	-	4	467	c.387G>T	c.(385-387)AGG>AGT	p.R129S		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	129	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ACACTGTACTCCTCATTTTGG	0.398													17	14	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182871600	182871600	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182871600G>A	uc003flh.3	-	2	853	c.629C>T	c.(628-630)ACG>ATG	p.T210M		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	210	Lumenal (Potential).|Thr-rich.				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			CCCAGGAACCGTGGAGGCAGG	0.557													59	84	---	---	---	---	PASS
BCL6	604	broad.mit.edu	37	3	187446848	187446848	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187446848T>C	uc003frp.3	-	5	1802	c.1345A>G	c.(1345-1347)ATC>GTC	p.I449V	BCL6_uc011bsf.1_Missense_Mutation_p.I449V|BCL6_uc010hza.2_Missense_Mutation_p.I347V|BCL6_uc003frq.1_Missense_Mutation_p.I449V	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	449					negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CTGTTAACGATGTTATTGAGC	0.557			T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								21	71	---	---	---	---	PASS
RBM47	54502	broad.mit.edu	37	4	40434807	40434807	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40434807C>T	uc003gvc.2	-	6	2113	c.1403G>A	c.(1402-1404)GGC>GAC	p.G468D	RBM47_uc003gvd.2_Missense_Mutation_p.G399D|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.G430D	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	468						nucleus	nucleotide binding|RNA binding			breast(3)	3						GTGGATTTTGCCATCTTCAAT	0.413													3	46	---	---	---	---	PASS
SCD5	79966	broad.mit.edu	37	4	83719638	83719638	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83719638T>G	uc003hna.2	-	1	373	c.53A>C	c.(52-54)GAA>GCA	p.E18A	SCD5_uc003hnb.3_Missense_Mutation_p.E18A|SCD5_uc003hnc.2_Missense_Mutation_p.E18A	NM_001037582	NP_001032671	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5 isoform a	18					fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				ACGGATTTCTTCCTTGGCGTC	0.721													8	32	---	---	---	---	PASS
PLA2G12A	81579	broad.mit.edu	37	4	110650931	110650931	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110650931A>G	uc003hzp.2	-	1	312	c.35T>C	c.(34-36)CTG>CCG	p.L12P	PLA2G12A_uc010img.2_Missense_Mutation_p.L12P	NM_030821	NP_110448	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA precursor	12					lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity				0				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		GAGGAGGAGCAGGAGGGTGAG	0.701													9	11	---	---	---	---	PASS
TRPC3	7222	broad.mit.edu	37	4	122853762	122853762	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122853762G>A	uc003ieg.2	-	2	725	c.651C>T	c.(649-651)GAC>GAT	p.D217D	TRPC3_uc010inr.2_Silent_p.D144D|TRPC3_uc003ief.2_Silent_p.D144D|TRPC3_uc011cgl.1_Translation_Start_Site	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN	transient receptor potential cation channel,	132	Cytoplasmic (Potential).				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						AGAAGTCGTCGTCCTGCAGCT	0.627													32	60	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184614128	184614128	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184614128C>G	uc003ivx.2	+	20	2241	c.2065C>G	c.(2065-2067)CTT>GTT	p.L689V	C4orf41_uc003ivw.2_Missense_Mutation_p.L689V|C4orf41_uc010isc.2_Missense_Mutation_p.L33V|C4orf41_uc003ivy.2_Missense_Mutation_p.L295V	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	689											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		TTCAGTGGATCTTGCTCTGGG	0.458													4	236	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140174870	140174870	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140174870G>A	uc003lhd.2	+	1	427	c.321G>A	c.(319-321)GAG>GAA	p.E107E	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.E107E|PCDHA2_uc011czy.1_Silent_p.E107E	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	107	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACGTGGAGGTGATCGTGG	0.517													159	193	---	---	---	---	PASS
LSM11	134353	broad.mit.edu	37	5	157170976	157170976	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157170976G>A	uc003lxe.1	+	1	222	c.218G>A	c.(217-219)GGG>GAG	p.G73E		NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	73					histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ggcgggcgcgggcgcgggcgg	0.547													3	7	---	---	---	---	PASS
CCHCR1	54535	broad.mit.edu	37	6	31122472	31122472	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31122472C>T	uc003nsr.3	-	4	458	c.335G>A	c.(334-336)CGG>CAG	p.R112Q	CCHCR1_uc011dne.1_Missense_Mutation_p.R112Q|CCHCR1_uc003nsq.3_Missense_Mutation_p.R165Q|CCHCR1_uc003nsp.3_Missense_Mutation_p.R201Q|CCHCR1_uc010jsk.1_Missense_Mutation_p.R112Q	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	112	Potential.				cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						CGAGGTCTCCCGCAGGAGCCG	0.692													20	30	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56373344	56373344	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56373344G>C	uc003pdf.2	-	69	12893	c.12865C>G	c.(12865-12867)CAG>GAG	p.Q4289E	DST_uc003pcz.3_Missense_Mutation_p.Q4111E|DST_uc011dxj.1_Missense_Mutation_p.Q4140E|DST_uc011dxk.1_Missense_Mutation_p.Q4151E|DST_uc003pcy.3_Missense_Mutation_p.Q3785E	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6197	Spectrin 13.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTTCTTGCTGTTGTTTTACT	0.373													11	275	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168297599	168297599	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168297599C>T	uc003qwd.2	+	10	1403	c.1261C>T	c.(1261-1263)CAG>TAG	p.Q421*	MLLT4_uc003qwb.1_Nonsense_Mutation_p.Q406*|MLLT4_uc003qwc.1_Nonsense_Mutation_p.Q422*|MLLT4_uc003qwf.2_Nonsense_Mutation_p.Q107*	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	422					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TTACCGCCTTCAGTTAAGTGT	0.428			T	MLL	AL								31	99	---	---	---	---	PASS
ADAP1	11033	broad.mit.edu	37	7	944856	944856	+	Intron	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944856G>A	uc003sjo.3	-						ADAP1_uc003sjm.3_5'UTR|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						ATGGGGGGGAGGAAACAAAAG	0.622													15	32	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180449	20180449	+	3'UTR	SNP	G	C	C	rs113534252		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180449G>C	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacacagacacacacac	0.164													3	64	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180451	20180451	+	3'UTR	SNP	C	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180451C>G	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacagacacacacacac	0.159													5	68	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38803128	38803128	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38803128G>C	uc003tgy.2	-	17	1375	c.1349C>G	c.(1348-1350)CCA>CGA	p.P450R	VPS41_uc003tgz.2_Missense_Mutation_p.P425R|VPS41_uc010kxn.2_Missense_Mutation_p.P361R	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	450					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						ATCACCTCTTGGCAAATAAGG	0.333													44	102	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82585902	82585902	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82585902G>C	uc003uhx.2	-	5	4656	c.4367C>G	c.(4366-4368)TCT>TGT	p.S1456C	PCLO_uc003uhv.2_Missense_Mutation_p.S1456C	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1387					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CAAGGTTTCAGATAAACTCTG	0.368													3	161	---	---	---	---	PASS
SERPINE1	5054	broad.mit.edu	37	7	100780352	100780352	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100780352G>A	uc003uxt.2	+	8	1306	c.1158G>A	c.(1156-1158)CGG>CGA	p.R386R	SERPINE1_uc011kkj.1_Silent_p.R371R|SERPINE1_uc003uxu.1_3'UTR	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1	386					angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	TTGTGGTCCGGCACAACCCCA	0.542													4	195	---	---	---	---	PASS
AGPAT5	55326	broad.mit.edu	37	8	6614716	6614716	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6614716C>T	uc003wqo.2	+	8	1214	c.902C>T	c.(901-903)CCA>CTA	p.P301L	AGPAT5_uc011kwm.1_3'UTR	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	301					phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		TCACCAGATCCAGAAAGAAGA	0.323													25	60	---	---	---	---	PASS
ZMAT4	79698	broad.mit.edu	37	8	40532282	40532282	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40532282G>A	uc003xnr.2	-	5	664	c.518C>T	c.(517-519)GCG>GTG	p.A173V	ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	173	Matrin-type 3.					nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			AACTCTTGCCGCATTCTTTTT	0.478													5	377	---	---	---	---	PASS
TP53INP1	94241	broad.mit.edu	37	8	95942776	95942776	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95942776G>A	uc003yhg.2	-	4	1038	c.654C>T	c.(652-654)TGC>TGT	p.C218C	C8orf38_uc003yhe.1_Intron|C8orf38_uc003yhf.2_Intron|TP53INP1_uc003yhh.2_3'UTR	NM_033285	NP_150601	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	218					apoptosis	PML body					0	Breast(36;8.75e-07)					GCCGAGGGTGGCAATCCCTGG	0.468													5	284	---	---	---	---	PASS
GAS1	2619	broad.mit.edu	37	9	89561010	89561010	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89561010G>A	uc004aox.3	-	1	1095	c.685C>T	c.(685-687)CGG>TGG	p.R229W	uc004aoy.2_5'Flank	NM_002048	NP_002039	P54826	GAS1_HUMAN	growth arrest-specific 1 precursor	229					cell cycle arrest|negative regulation of S phase of mitotic cell cycle	anchored to plasma membrane					0						CAGATGGGCCGCTCGAGGCCG	0.701													4	47	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	430563	430563	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:430563A>G	uc001ifp.2	-	15	1769	c.1679T>C	c.(1678-1680)ATG>ACG	p.M560T	DIP2C_uc009xhj.1_Missense_Mutation_p.M256T	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	560						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GATCACATGCATCATGTTCAT	0.517													54	133	---	---	---	---	PASS
FUT11	170384	broad.mit.edu	37	10	75533416	75533416	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75533416G>C	uc001jva.2	+	2	1220	c.1177G>C	c.(1177-1179)GAC>CAC	p.D393H	FUT11_uc001juy.1_3'UTR|FUT11_uc001juz.1_Missense_Mutation_p.D393H	NM_173540	NP_775811	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3)	393	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity				0	Prostate(51;0.0112)					TTTCGTCTGTGACTACGAACT	0.572													39	89	---	---	---	---	PASS
ACTA2	59	broad.mit.edu	37	10	90750746	90750746	+	5'UTR	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90750746C>T	uc001kfq.2	-	1					FAS_uc010qna.1_Intron|FAS_uc001kfr.2_Intron|FAS_uc001kfs.2_Intron|FAS_uc001kft.2_Intron|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_5'Flank	NM_001141945	NP_001135417	P62736	ACTA_HUMAN	alpha 2 actin						response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		GGGACGCGTGCGGGATTGCGG	0.721													9	27	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1017647	1017647	+	Silent	SNP	G	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1017647G>T	uc001lsw.2	-	31	5205	c.5154C>A	c.(5152-5154)CCC>CCA	p.P1718P		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1718	Thr-rich.|1; truncated.|Approximate repeats.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGTACTGGTGGGGTTGGGGG	0.517													112	694	---	---	---	---	PASS
CD6	923	broad.mit.edu	37	11	60785461	60785461	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60785461G>A	uc001nqq.2	+	11	2036	c.1813G>A	c.(1813-1815)GCC>ACC	p.A605T	CD6_uc001nqp.2_Missense_Mutation_p.A605T|CD6_uc001nqr.2_Missense_Mutation_p.A573T|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.A564T	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	605	Cytoplasmic (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						CTTGGAGCTGGCCGGCACCCA	0.572													36	93	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46245701	46245701	+	Silent	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46245701C>A	uc001ros.1	+	15	3795	c.3795C>A	c.(3793-3795)GTC>GTA	p.V1265V	ARID2_uc001ror.2_Silent_p.V1265V|ARID2_uc009zkg.1_Silent_p.V721V|ARID2_uc009zkh.1_Silent_p.V892V|ARID2_uc001rou.1_Silent_p.V599V	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1265					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AAATTGAAGTCATGGAGAACC	0.433													20	48	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101477464	101477464	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101477464A>G	uc010svm.1	+	16	1976	c.1404A>G	c.(1402-1404)ATA>ATG	p.I468M	ANO4_uc001thw.2_Missense_Mutation_p.I433M|ANO4_uc001thx.2_Missense_Mutation_p.I468M|ANO4_uc001thy.2_Intron	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	468	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						AGGAAGAAATACGACCCCAGT	0.383										HNSCC(74;0.22)			3	231	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	118020150	118020150	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118020150G>C	uc001two.2	-	6	1154	c.1099C>G	c.(1099-1101)CCA>GCA	p.P367A		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	396					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACCAGCGTGGCACTGACAGT	0.582													45	144	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38154095	38154095	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38154095C>A	uc001uwo.3	-	12	1681	c.1563G>T	c.(1561-1563)TTG>TTT	p.L521F	POSTN_uc010tet.1_Missense_Mutation_p.L49F|POSTN_uc001uwp.3_Missense_Mutation_p.L521F|POSTN_uc001uwr.2_Missense_Mutation_p.L521F|POSTN_uc001uwq.2_Missense_Mutation_p.L521F|POSTN_uc010teu.1_Missense_Mutation_p.L521F|POSTN_uc010tev.1_Missense_Mutation_p.L521F|POSTN_uc010tew.1_Missense_Mutation_p.L521F|POSTN_uc010tex.1_Missense_Mutation_p.L436F	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1	521	FAS1 4.				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GGAGCTCTTTCAAGTCTGCAG	0.398													58	149	---	---	---	---	PASS
GAS6	2621	broad.mit.edu	37	13	114549554	114549554	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114549554T>G	uc001vud.2	-	4	442	c.289A>C	c.(289-291)AAC>CAC	p.N97H		NM_000820	NP_000811	Q14393	GAS6_HUMAN	growth arrest-specific 6 isoform 1 precursor	97					cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CCATACTTGTTGATGCAGTCT	0.542													43	98	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69445875	69445875	+	5'UTR	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69445875G>C	uc001xkl.2	-	1					ACTN1_uc010ttb.1_5'Flank|ACTN1_uc001xkm.2_5'UTR|ACTN1_uc001xkn.2_5'UTR|ACTN1_uc001xko.1_5'Flank|ACTN1_uc010ttd.1_5'Flank	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b						focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ggctgggctgggctggcgggg	0.582													5	6	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89163289	89163289	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89163289C>A	uc001xxg.2	-	16	2432	c.2246G>T	c.(2245-2247)AGA>ATA	p.R749I	EML5_uc001xxh.1_5'UTR	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	749	WD 11.					cytoplasm|microtubule				ovary(3)	3						TGAGGGATCTCTACCAACCTA	0.323													3	47	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369272	22369272	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369272G>T	uc010tzu.1	+	1	697	c.697G>T	c.(697-699)GAG>TAG	p.E233*	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGGCTCAGGTGAGAATACCAA	0.463													62	257	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													4	56	---	---	---	---	PASS
FAM154B	283726	broad.mit.edu	37	15	82575053	82575053	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82575053A>G	uc002bgv.2	+	3	916	c.847A>G	c.(847-849)AGC>GGC	p.S283G	FAM154B_uc010unr.1_Missense_Mutation_p.S268G|FAM154B_uc010uns.1_RNA	NM_001008226	NP_001008227	Q658L1	F154B_HUMAN	hypothetical protein LOC283726	283										skin(2)	2						CCAAGGAAAAAGCATCATGAA	0.403													3	171	---	---	---	---	PASS
POLR2C	5432	broad.mit.edu	37	16	57503693	57503693	+	Intron	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57503693C>T	uc002elt.1	+						POLR2C_uc010vhq.1_3'UTR	NM_032940	NP_116558	P19387	RPB3_HUMAN	DNA directed RNA polymerase II polypeptide C						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity				0						CCTGACCTGTCACCGTGTGGG	0.547													17	32	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65016234	65016234	+	Intron	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016234C>T	uc002eoi.2	-						CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GATTGACAACCAATTCCTTGA	0.408			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			32	51	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70064913	70064913	+	Intron	SNP	G	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70064913G>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						CAAGCAACAGGGGCAGTCTTC	0.403													39	100	---	---	---	---	PASS
MINK1	50488	broad.mit.edu	37	17	4794820	4794820	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4794820G>A	uc010vsl.1	+	16	2006	c.1810G>A	c.(1810-1812)GAC>AAC	p.D604N	MINK1_uc010vsk.1_Missense_Mutation_p.D604N|MINK1_uc010vsm.1_Missense_Mutation_p.D584N|MINK1_uc010vsn.1_Missense_Mutation_p.D604N|MINK1_uc010vso.1_Missense_Mutation_p.D549N|MINK1_uc010vsp.1_Missense_Mutation_p.D94N	NM_153827	NP_722549	Q8N4C8	MINK1_HUMAN	misshapen-like kinase 1 isoform 3	604					JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6						GTCCCTGCAGGACCAGCCCAC	0.677													5	16	---	---	---	---	PASS
ELAC2	60528	broad.mit.edu	37	17	12920219	12920219	+	Silent	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12920219G>A	uc002gnz.3	-	3	422	c.327C>T	c.(325-327)TTC>TTT	p.F109F	ELAC2_uc010vvp.1_Silent_p.F90F|ELAC2_uc010vvq.1_Silent_p.F109F|ELAC2_uc010vvr.1_Silent_p.F109F	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1	109					tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						TTCGTGTCAGGAATATGTTGT	0.413									Hereditary_Prostate_Cancer				49	99	---	---	---	---	PASS
KRT27	342574	broad.mit.edu	37	17	38933946	38933946	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38933946A>T	uc002hvg.2	-	6	1052	c.1011T>A	c.(1009-1011)AGT>AGA	p.S337R		NM_181537	NP_853515	Q7Z3Y8	K1C27_HUMAN	keratin 27	337	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.000812)				CACAGTAGTTACTCTCGGTCT	0.527													120	304	---	---	---	---	PASS
STAT5B	6777	broad.mit.edu	37	17	40359634	40359634	+	Silent	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40359634C>T	uc002hzh.2	-	16	2188	c.2019G>A	c.(2017-2019)CGG>CGA	p.R673R		NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription	673	SH2.				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CATCTTTTGGCCGATCAGGAA	0.423													4	233	---	---	---	---	PASS
GRB2	2885	broad.mit.edu	37	17	73316420	73316420	+	3'UTR	SNP	A	C	C			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73316420A>C	uc002jnx.3	-	6					GRB2_uc002jny.3_3'UTR	NM_002086	NP_002077	P62993	GRB2_HUMAN	growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	TACATTTTTCACTTTCTTTAA	0.493													71	160	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67869203	67869203	+	Silent	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67869203A>G	uc002lkp.2	-	4	482	c.414T>C	c.(412-414)CCT>CCC	p.P138P	RTTN_uc010xfb.1_5'UTR|RTTN_uc002lkq.1_Silent_p.P138P	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	138							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTAAGATTTCAGGGTTTTTTG	0.363													3	99	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9009312	9009312	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9009312G>A	uc002mkp.2	-	40	39365	c.39161C>T	c.(39160-39162)TCC>TTC	p.S13054F	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCCGACACTGGAGTTCTTGAA	0.517													26	74	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9009313	9009313	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9009313A>T	uc002mkp.2	-	40	39364	c.39160T>A	c.(39160-39162)TCC>ACC	p.S13054T	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCGACACTGGAGTTCTTGAAC	0.522													26	74	---	---	---	---	PASS
PEPD	5184	broad.mit.edu	37	19	33902626	33902626	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33902626C>A	uc002nur.3	-	11	905	c.770G>T	c.(769-771)GGA>GTA	p.G257V	PEPD_uc010xrr.1_Missense_Mutation_p.G216V|PEPD_uc010xrs.1_Missense_Mutation_p.G193V	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1	257					cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					TCCGGCGTGTCCGTAGTGTAG	0.597													15	21	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36219945	36219945	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36219945C>T	uc010eei.2	+	22	4747	c.4747C>T	c.(4747-4749)CTC>TTC	p.L1583F		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1583					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCAGTGTGCACTCTGCCTCAA	0.592													40	110	---	---	---	---	PASS
TMEM149	79713	broad.mit.edu	37	19	36231433	36231433	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36231433C>T	uc002obc.2	-	3	291	c.190G>A	c.(190-192)GAC>AAC	p.D64N	TMEM149_uc002obb.2_Intron|TMEM149_uc002obd.3_Missense_Mutation_p.D64N|TMEM149_uc010xsy.1_RNA|TMEM149_uc010eej.2_Missense_Mutation_p.D144N	NM_024660	NP_078936	Q9H665	IGFR1_HUMAN	transmembrane protein 149 precursor	64	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding|receptor activity				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCGCCGTGGTCATTGAGTCCG	0.657													26	56	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11014987	11014987	+	RNA	SNP	A	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11014987A>G	uc002yis.1	-	7		c.1459T>C						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTATAGTTTCAATAGCAGACT	0.388													3	89	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11098863	11098863	+	5'UTR	SNP	A	G	G	rs75318310	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098863A>G	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccagcctccaactcccccttc	0.000													5	19	---	---	---	---	PASS
AIRE	326	broad.mit.edu	37	21	45710997	45710997	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45710997C>T	uc002zei.2	+	8	1026	c.899C>T	c.(898-900)GCC>GTC	p.A300V	AIRE_uc010gpq.2_RNA|AIRE_uc002zej.2_Missense_Mutation_p.A103V|AIRE_uc010gpr.2_Missense_Mutation_p.A103V	NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1	300	PHD-type 1.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		GACGAGTGTGCCGTGTGTCGG	0.657									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				4	144	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53228204	53228204	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53228204T>G	uc004drz.2	-	15	2731	c.2198A>C	c.(2197-2199)CAC>CCC	p.H733P	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.H666P|KDM5C_uc004dsa.2_Missense_Mutation_p.H732P	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	733					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						ATCATTGATGTGGGAAAGGCA	0.577			N|F|S		clear cell renal carcinoma								29	25	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75004670	75004670	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75004670C>A	uc004ecj.1	-	1	402	c.217G>T	c.(217-219)GAC>TAC	p.D73Y		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	73										ovary(1)|skin(1)	2						GACTGCTCGTCGATCAGGACC	0.557													29	27	---	---	---	---	PASS
HCFC1	3054	broad.mit.edu	37	X	153236256	153236256	+	Silent	SNP	C	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153236256C>A	uc004fjp.2	-	1	564	c.36G>T	c.(34-36)GCG>GCT	p.A12A	TMEM187_uc004fjq.2_5'Flank	NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	12					cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGAAGCACCGCTGGCAAGT	0.677													6	3	---	---	---	---	PASS
RBMY1A3P	286557	broad.mit.edu	37	Y	9160470	9160470	+	RNA	SNP	C	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9160470C>T	uc004frl.1	-	1		c.14G>A				NR_001547				Homo sapiens RBMY1A3P pseudogene, mRNA sequence.												0						GATGATCTGCCTCTACCATTG	0.333													3	67	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19474752	19474752	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19474752delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAAAGAGAAAAAAAAAAA	0.448													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20200621	20200623	+	IGR	DEL	CAC	-	-	rs144954291		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200621_20200623delCAC								RNF186 (58850 upstream) : OTUD3 (8265 downstream)																							ccaccaccatcaccaccaccacc	0.202													5	3	---	---	---	---	
ARID1A	8289	broad.mit.edu	37	1	27087177	27087178	+	Intron	INS	-	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27087177_27087178insA	uc001bmv.1	+						ARID1A_uc001bmt.1_Intron|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Intron	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a						androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		aacactgtctcaaaaaaaaaaa	0.124			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								5	3	---	---	---	---	
CYP4Z1	199974	broad.mit.edu	37	1	47571591	47571592	+	Intron	DEL	GG	-	-	rs10567873		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47571591_47571592delGG	uc001cqu.1	+							NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1							endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1						CTATATCTGCGGGGGGGGGAGA	0.416													6	3	---	---	---	---	
LRRC7	57554	broad.mit.edu	37	1	70218979	70218980	+	Intron	INS	-	TG	TG	rs71581202		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70218979_70218980insTG	uc001deo.1	+									Q96NW7	LRRC7_HUMAN	SubName: Full=Leucine rich repeat containing 7; SubName: Full=cDNA FLJ54846, highly similar to Leucine-rich repeat-containing protein 7;							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						gtgtgtgtgtatgtgtgtgtgt	0.252													4	2	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669702	+	Intron	DEL	TT	-	-	rs77020055		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701_94669702delTT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCtttttttttttt	0.149													5	3	---	---	---	---	
PRUNE	58497	broad.mit.edu	37	1	151000258	151000259	+	Intron	DEL	GC	-	-	rs71090119	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151000258_151000259delGC	uc001ewh.1	+						PRUNE_uc001ewi.1_Intron|PRUNE_uc010pco.1_Intron|PRUNE_uc001ewj.1_Intron|PRUNE_uc001ewk.1_Intron	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	prune							cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			gtgtgtgtgtgcgcgcgcgtgt	0.000													4	2	---	---	---	---	
RPTN	126638	broad.mit.edu	37	1	152126934	152126934	+	3'UTR	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152126934delA	uc001ezs.1	-	3						NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin							proteinaceous extracellular matrix	calcium ion binding				0						ACATAGTCATAGGGGGGGTTG	0.507													4	3	---	---	---	---	
TBCE	6905	broad.mit.edu	37	1	235605323	235605324	+	Intron	INS	-	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235605323_235605324insT	uc001hwz.1	+						TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_003193	NP_003184	Q15813	TBCE_HUMAN	beta-tubulin cofactor E						'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			TTAAATGAAAAttttttttttt	0.163													4	2	---	---	---	---	
ITGB1BP1	9270	broad.mit.edu	37	2	9554563	9554563	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9554563delA	uc002qzj.2	-						ITGB1BP1_uc002qzk.2_Intron|ITGB1BP1_uc002qzl.2_Intron|ITGB1BP1_uc002qzm.2_Intron|ITGB1BP1_uc010yiy.1_Intron|ITGB1BP1_uc002qzn.1_Intron	NM_004763	NP_004754	O14713	ITBP1_HUMAN	integrin cytoplasmic domain-associated protein 1						cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		AACAAACTTCAAAAAAAAAAC	0.343													2	4	---	---	---	---	
CAPN13	92291	broad.mit.edu	37	2	30999024	30999024	+	Intron	DEL	T	-	-	rs11318503		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30999024delT	uc002rnn.2	-						CAPN13_uc002rnp.1_Intron	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					AAATAATGCATTTTTTTTTCC	0.473													4	9	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54163724	54163725	+	Intron	INS	-	AAATA	AAATA	rs146083561	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54163724_54163725insAAATA	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TAGAATACAACAAATAATATAA	0.267													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71004413	71004414	+	IGR	INS	-	A	A	rs55926232		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004413_71004414insA								ADD2 (9084 upstream) : FIGLA (28 downstream)																							aactctatctcaaaaaaaaaaa	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89868040	89868040	+	IGR	DEL	G	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89868040delG								FLJ40330 (761915 upstream) : None (None downstream)																							attccaatcaggttgattcca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766815	91766816	+	IGR	INS	-	T	T	rs148718335		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766815_91766816insT								None (None upstream) : LOC654342 (38376 downstream)																							AGATAGACTCCttttttttgag	0.193													6	3	---	---	---	---	
NPAS2	4862	broad.mit.edu	37	2	101591538	101591540	+	Intron	DEL	CTC	-	-	rs3217562		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101591538_101591540delCTC	uc002tap.1	+						NPAS2_uc010yvt.1_Intron|NPAS2_uc010fit.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						GCAGTTTATACTCCTCCTTTCCT	0.557													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104267482	104267493	+	IGR	DEL	GAAGGAAGGAAT	-	-	rs74180251	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104267482_104267493delGAAGGAAGGAAT								TMEM182 (833346 upstream) : LOC150568 (783312 downstream)																							gggagggagggaaggaaggaatgaaggaagga	0.000													7	4	---	---	---	---	
MARCO	8685	broad.mit.edu	37	2	119727001	119727003	+	Intron	DEL	AAG	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119727001_119727003delAAG	uc002tln.1	+						MARCO_uc010yyf.1_Intron	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure						cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GAGAGGAGCAAAGAAGGAGTGTA	0.532													5	4	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153493154	153493155	+	Intron	INS	-	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153493154_153493155insT	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TCCATTAAAGCTGCCTGTGGTG	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162135308	162135309	+	IGR	DEL	TT	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162135308_162135309delTT								TANK (42626 upstream) : PSMD14 (29477 downstream)																							gacataacacttttagcacaat	0.119													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216365496	216365497	+	IGR	INS	-	CTTT	CTTT	rs147349945	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216365496_216365497insCTTT								FN1 (64705 upstream) : MREG (441818 downstream)																							ttccttccttcctttctttcct	0.139													2	4	---	---	---	---	
USP40	55230	broad.mit.edu	37	2	234398195	234398196	+	5'UTR	INS	-	A	A	rs146443538	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234398195_234398196insA	uc002vul.2	-	1					USP40_uc010zmr.1_Intron|USP40_uc010zms.1_Intron|USP40_uc002vun.2_Intron			Q9NVE5	UBP40_HUMAN	Homo sapiens mRNA for ubiquitin specific proteinase 40 (USP40 gene).						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TACTGTTTTAGAAAAAAAAAAT	0.366													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241579571	241579574	+	IGR	DEL	TCCC	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241579571_241579574delTCCC								GPR35 (8896 upstream) : AQP12B (36262 downstream)																							cctccttccttccctccttccctg	0.000													6	3	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242343091	242343091	+	Intron	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242343091delT	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TGCTTCAGACTTTTTTTTTTA	0.284													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10183715	10183716	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183715_10183716delGT	uc003bvc.2	+	1	397_398	c.184_185delGT	c.(184-186)GTGfs	p.V62fs	VHL_uc003bvd.2_Frame_Shift_Del_p.V62fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	62					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V62fs*5(9)|p.V62fs*68(2)|p.E52_S65del(1)|p.?(1)|p.R60fs*35(1)|p.P61fs*70(1)|p.P61fs*61(1)|p.R60fs*70(1)|p.V62fs*3(1)|p.V62fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GCCGCGGCCCGTGCTGCGCTCG	0.733		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32676649	32676649	+	IGR	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32676649delT								DYNC1LI1 (64299 upstream) : CNOT10 (50049 downstream)																							catctcaatcttTTTTTTTTT	0.154													4	2	---	---	---	---	
RBM5	10181	broad.mit.edu	37	3	50142740	50142740	+	Intron	DEL	A	-	-	rs77676195		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50142740delA	uc003cyg.2	+						RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		actcCGTCTCAAAAAAAAAAA	0.209													6	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52651299	52651299	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651299delG	uc003des.2	-	14	1809	c.1797delC	c.(1795-1797)CACfs	p.H599fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.H599fs|PBRM1_uc003der.2_Frame_Shift_Del_p.H567fs|PBRM1_uc003det.2_Frame_Shift_Del_p.H614fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.H614fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.H599fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.H599fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.H599fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.H599fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.H512fs|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	599	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CCTCATTATAGTGCCTGGCAT	0.463			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								40	28	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57493928	57493928	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493928delA	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						aaaaaaaaacaaaaaaaaaaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126981715	126981716	+	IGR	DEL	TG	-	-	rs66753389		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126981715_126981716delTG								PLXNA1 (225487 upstream) : TPRA1 (310192 downstream)																							ACTGTTTGCAtgtgtgtgtgtg	0.277													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184392109	184392112	+	IGR	DEL	GTGT	-	-	rs72143935		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184392109_184392112delGTGT								EPHB3 (91914 upstream) : MAGEF1 (36044 downstream)																							ctcctttgtcgtgtgtgtgtgtgt	0.113													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194712128	194712130	+	IGR	DEL	TCC	-	-	rs9838410		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194712128_194712130delTCC								FAM43A (302364 upstream) : C3orf21 (76885 downstream)																							ctcctcctcttcctcctcctcct	0.172													5	4	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494387	195494401	+	Intron	DEL	TCACCACCACCATCG	-	-	rs113621843	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494387_195494401delTCACCACCACCATCG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		accatcaccatcaccaccaccatcgccaccaccat	0.000													7	4	---	---	---	---	
NMU	10874	broad.mit.edu	37	4	56475551	56475552	+	Intron	INS	-	A	A	rs35666427		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56475551_56475552insA	uc003hbc.2	-						NMU_uc003hbd.1_Intron|NMU_uc010igv.1_Intron|NMU_uc010igw.1_Intron|NMU_uc010igx.1_Intron	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		CTTCTAACCAGAAAAAAAAAAA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	63695969	63695972	+	IGR	DEL	TTCT	-	-	rs71213100		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63695969_63695972delTTCT								LPHN3 (757802 upstream) : None (None downstream)																							ccttccttccttctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112920468	112920472	+	IGR	DEL	GGGAG	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112920468_112920472delGGGAG								None (None upstream) : C4orf32 (146081 downstream)																							aggaaggaaagggaggggaggggag	0.049													3	3	---	---	---	---	
RXFP1	59350	broad.mit.edu	37	4	159462502	159462503	+	Intron	INS	-	CA	CA	rs141533782	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159462502_159462503insCA	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AGAGCTTCATGcacacacacac	0.282													4	2	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169715657	169715658	+	Intron	INS	-	CACA	CACA	rs61011663		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169715657_169715658insCACA	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		acacacacacgcacacacacac	0.208									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
TRIML1	339976	broad.mit.edu	37	4	189063270	189063271	+	Intron	DEL	AA	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189063270_189063271delAA	uc003izm.1	+						TRIML1_uc003izn.1_5'Flank	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1						multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		actccatctcaaaaaaaaaaaa	0.109													4	3	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1052736	1052740	+	Intron	DEL	GAGCA	-	-	rs142533833		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1052736_1052740delGAGCA	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGGCGGGGAGGAGCAGGGCAGGGGA	0.605													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17350388	17350389	+	IGR	INS	-	CTTTCTTTCTTTCTTT	CTTTCTTTCTTTCTTT	rs13169339		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17350388_17350389insCTTTCTTTCTTTCTTT								BASP1 (73453 upstream) : None (None downstream)																							ctccctccctCctttctttctt	0.045													8	4	---	---	---	---	
VDAC1	7416	broad.mit.edu	37	5	133316326	133316326	+	Intron	DEL	A	-	-	rs72518208		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133316326delA	uc003kyp.1	-						VDAC1_uc003kyq.1_Intron|VDAC1_uc003kyr.1_Intron	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GGGCTTTCttaaaaaaaaaaa	0.443													6	3	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139343943	139343944	+	Intron	DEL	AC	-	-	rs3056591		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139343943_139343944delAC	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			aaatacagatacacacacacac	0.337													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166706520	166706523	+	IGR	DEL	TTCC	-	-	rs56332524		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166706520_166706523delTTCC								None (None upstream) : ODZ2 (5320 downstream)																							cttccttcctttccttccttcctt	0.000													8	4	---	---	---	---	
PHACTR1	221692	broad.mit.edu	37	6	13000846	13000847	+	Intron	INS	-	AGGAAGGAAGGA	AGGAAGGAAGGA	rs113550993		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13000846_13000847insAGGAAGGAAGGA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ggagggaagggaggaaggaagg	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16858477	16858477	+	IGR	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16858477delA								ATXN1 (96756 upstream) : RBM24 (423332 downstream)																							ggaaggaaggaaggaaggaag	0.144													4	2	---	---	---	---	
HCRTR2	3062	broad.mit.edu	37	6	55147362	55147362	+	3'UTR	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55147362delT	uc003pcl.2	+	7					HCRTR2_uc010jzv.2_RNA	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CTTGTGGATCTTTTTTTTTTT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	79024108	79024109	+	IGR	DEL	TG	-	-	rs71683667		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79024108_79024109delTG								HTR1B (850988 upstream) : IRAK1BP1 (553080 downstream)																							AGTTTTCATCtgtgtgtgtgtg	0.312													4	3	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102074992	102074993	+	Intron	INS	-	TGTG	TGTG	rs139071226	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102074992_102074993insTGTG	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	gtgtgtgtctctgtgtgtgtgt	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140955635	140955635	+	IGR	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140955635delT								None (None upstream) : None (None downstream)																							CTCTGGGGGgtttttttttgg	0.209													4	2	---	---	---	---	
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTCCCAAGGTTTaaaaaaaaa	0.317													3	3	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33977125	33977126	+	Intron	INS	-	GTGTGTGTGTGT	GTGTGTGTGTGT			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977125_33977126insGTGTGTGTGTGT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GGAGAAGTAGGgtgtgtgtgtg	0.391													7	4	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38565046	38565049	+	Intron	DEL	GTGT	-	-	rs146505083		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38565046_38565049delGTGT	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						tcatttgtgcgtgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
CDK13	8621	broad.mit.edu	37	7	40031084	40031085	+	Intron	DEL	GT	-	-	rs71560153		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40031084_40031085delGT	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc011kbf.1_Intron	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						ATTAGCAAAAgtgtgtgtgtgt	0.282													3	3	---	---	---	---	
LOC729156	729156	broad.mit.edu	37	7	66280797	66280797	+	Intron	DEL	C	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66280797delC	uc003tvj.1	-							NR_003934				Homo sapiens cDNA FLJ36054 fis, clone TESTI2018290.												0						TCCAGCCTGGCCCTCCAATCC	0.612													9	5	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73974113	73974114	+	Intron	INS	-	T	T	rs112974956		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73974113_73974114insT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CCCTGCCtttcttttttttttt	0.312													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131319257	131319260	+	IGR	DEL	TTCT	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131319257_131319260delTTCT								PODXL (77881 upstream) : PLXNA4 (488832 downstream)																							ccttctttccttctttctttcttt	0.000													1	5	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144380279	144380279	+	Intron	DEL	T	-	-	rs137896700		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380279delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	tttctgcatcttttttttttt	0.129													2	4	---	---	---	---	
LOC100128542	100128542	broad.mit.edu	37	7	150451253	150451253	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150451253delA	uc011kuw.1	+							NM_001162367	NP_001155839			hypothetical protein LOC100128542												0						ggagggaaggaaaggaaggaa	0.100													4	2	---	---	---	---	
RBPMS	11030	broad.mit.edu	37	8	30407259	30407260	+	Intron	INS	-	TTTCTTTGCT	TTTCTTTGCT	rs139991132	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30407259_30407260insTTTCTTTGCT	uc003xic.1	+						RBPMS_uc003xid.1_Intron|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron	NM_006867	NP_006858	Q93062	RBPMS_HUMAN	RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)		ttctttctttctttctttcctt	0.272													6	3	---	---	---	---	
SFRP1	6422	broad.mit.edu	37	8	41166638	41166640	+	In_Frame_Del	DEL	GCT	-	-	rs3055861		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41166638_41166640delGCT	uc003xnt.2	-	1	341_343	c.39_41delAGC	c.(37-42)GCAGCC>GCC	p.13_14AA>A		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	13_14				Missing (in Ref. 1 and 3).	brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CACGCCCAGGGCTGCCCCGCGGC	0.764													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	48144963	48144963	+	IGR	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48144963delA								BEYLA (377556 upstream) : KIAA0146 (28579 downstream)																							agcaagactcaaaaaaaaaaa	0.000													8	5	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113505056	113505057	+	Intron	INS	-	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113505056_113505057insT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						tatatacagactttttttgtca	0.000										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			10	6	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75193182	75193183	+	Intron	DEL	GT	-	-	rs71855970		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75193182_75193183delGT	uc004aiz.1	+						TMC1_uc010moz.1_Intron	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						GCGCGCACGCgtgtgtgtgtgt	0.337													2	5	---	---	---	---	
PFKP	5214	broad.mit.edu	37	10	3174816	3174819	+	Intron	DEL	AACT	-	-	rs72145058		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3174816_3174819delAACT	uc001igp.2	+						PFKP_uc001igq.2_Intron|PFKP_uc009xhr.2_Intron|PFKP_uc009xht.2_Intron|PFKP_uc009xhu.2_Intron	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet						glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GCATTTAGACAACTAATATTTTTG	0.387													8	4	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	195956	195957	+	5'Flank	INS	-	A	A	rs111730765		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:195956_195957insA	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTTGGTGAGGGGACCTGGTGA	0.653													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	8390842	8390843	+	IGR	INS	-	TG	TG	rs112687053		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8390842_8390843insTG								LMO1 (100660 upstream) : STK33 (22575 downstream)																							GGTTTTTACTCtgtgtgtgtgt	0.337													5	4	---	---	---	---	
TEAD1	7003	broad.mit.edu	37	11	12804645	12804646	+	Intron	INS	-	TG	TG	rs148884122		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12804645_12804646insTG	uc001mkj.3	+							NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		AGGTAAGGGTTtgtgtgtgtgt	0.307													3	3	---	---	---	---	
CDC42BPG	55561	broad.mit.edu	37	11	64608924	64608924	+	Intron	DEL	A	-	-	rs78799447		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64608924delA	uc001obs.3	-							NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						attccgtctcaaaaaaaaaaa	0.169													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68412258	68412259	+	IGR	INS	-	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412258_68412259insA								SAPS3 (29459 upstream) : GAL (39724 downstream)																							aggaaggaaagaaggaaggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68995243	68995244	+	IGR	DEL	TG	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68995243_68995244delTG								TPCN2 (65336 upstream) : MYEOV (66378 downstream)																							tatatatgtatgtgtgtgtgtg	0.079													2	4	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152589	75152590	+	Intron	DEL	GT	-	-	rs34643232		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152589_75152590delGT	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CTGCCCGACCgtgtgtgtgtgt	0.569													2	4	---	---	---	---	
ETS1	2113	broad.mit.edu	37	11	128455227	128455228	+	Intron	INS	-	AAGG	AAGG	rs80273140	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128455227_128455228insAAGG	uc001qej.2	-							NM_001143820	NP_001137292	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		aggaaggaagcaaggaaggaag	0.158													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47144923	47144926	+	IGR	DEL	GAAG	-	-	rs35061598		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47144923_47144926delGAAG								SLC38A2 (378278 upstream) : SLC38A4 (13618 downstream)																							aggaaggaaagaaggaaggaagga	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59830850	59830853	+	IGR	DEL	AAGG	-	-	rs55789525		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59830850_59830853delAAGG								LRIG3 (516588 upstream) : SLC16A7 (158995 downstream)																							aaagaaaagaaaggaaggaaggaa	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60564483	60564484	+	IGR	INS	-	AC	AC	rs145084660	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60564483_60564484insAC								SLC16A7 (389076 upstream) : None (None downstream)																							cacacacacatacacacacaca	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594093	69594102	+	IGR	DEL	AGAAAGAGAT	-	-	rs80081772		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594093_69594102delAGAAAGAGAT								CPM (237073 upstream) : CPSF6 (39215 downstream)																							ataagagataagaaagagataagagataag	0.024													6	5	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49830214	49830215	+	Intron	INS	-	A	A	rs35925057		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49830214_49830215insA	uc001vcu.2	+						CDADC1_uc001vcs.1_Intron|CDADC1_uc001vct.1_Intron|CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		TCCTTTTTTTTAAAAAAAAAAG	0.262													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31128275	31128275	+	IGR	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31128275delT								ARHGAP11B (150466 upstream) : MTMR15 (67780 downstream)																							TTTGATAAGCTTTTTTTTTTT	0.313													4	3	---	---	---	---	
TTBK2	146057	broad.mit.edu	37	15	43130552	43130553	+	Intron	DEL	GT	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43130552_43130553delGT	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		ATAATTCAGGgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
SLC28A2	9153	broad.mit.edu	37	15	45561371	45561372	+	Intron	INS	-	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45561371_45561372insA	uc001zva.2	+							NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		ataataataataaaaaaaAAAC	0.233													5	4	---	---	---	---	
TIPIN	54962	broad.mit.edu	37	15	66629667	66629667	+	Intron	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66629667delT	uc002apr.2	-						TIPIN_uc010ujn.1_Intron|TIPIN_uc010ujo.1_Intron	NM_017858	NP_060328	Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell division|DNA replication checkpoint|intra-S DNA damage checkpoint|mitosis|positive regulation of cell proliferation|regulation of DNA replication involved in S phase|replication fork protection	cytoplasm|nuclear chromatin	protein binding			ovary(1)	1						TAAATATATCttttttttttt	0.149													4	2	---	---	---	---	
IQCH	64799	broad.mit.edu	37	15	67553431	67553432	+	Intron	INS	-	A	A	rs11380255		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67553431_67553432insA	uc002aqo.1	+						IQCH_uc010ujv.1_Intron|IQCH_uc002aqn.1_Intron|IQCH_uc002aqq.1_Intron|IQCH_uc002aqp.1_Intron|IQCH_uc002aqm.2_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1											skin(3)|ovary(1)	4				Colorectal(3;0.0856)		aattccatctcaaaaaaaaaaa	0.149													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70476101	70476102	+	IGR	DEL	CC	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70476101_70476102delCC								TLE3 (85845 upstream) : UACA (470793 downstream)																							ttccttccttcctctttctttc	0.015													3	4	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600778	600779	+	Intron	INS	-	C	C	rs146137561	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600778_600779insC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CCGGTGAGGGTCCCGGTCGGTG	0.757													3	5	---	---	---	---	
ABCA17P	650655	broad.mit.edu	37	16	2475097	2475098	+	Intron	DEL	TC	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2475097_2475098delTC	uc002cqc.1	+							NR_003574				Homo sapiens cDNA FLJ37881 fis, clone BRSTN2000367.												0						GGTAActctgtctctctctctc	0.465													4	2	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4938713	4938714	+	Intron	INS	-	TTT	TTT	rs34143557		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4938713_4938714insTTT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						tttatcctgcattttttttttt	0.000													7	5	---	---	---	---	
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				cctgtctcagaaaaaaaaaaa	0.219													5	4	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57105571	57105572	+	Intron	INS	-	AGTA	AGTA	rs144570575	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57105571_57105572insAGTA	uc002ekk.1	+						NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_Intron|NLRC5_uc002ekq.1_Intron|NLRC5_uc002ekr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				aatgggaagggagtgagtggtg	0.000													4	2	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74576668	74576669	+	Intron	INS	-	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74576668_74576669insA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						aggaaggaaggaaggaaggaag	0.094													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	76003236	76003237	+	IGR	INS	-	TCT	TCT	rs147792701	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76003236_76003237insTCT								TERF2IP (311908 upstream) : CNTNAP4 (307939 downstream)																							cctcttcctcctcctcttcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5620718	5620724	+	IGR	DEL	TCTTTCC	-	-	rs60705446	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5620718_5620724delTCTTTCC								NLRP1 (132886 upstream) : WSCD1 (351713 downstream)																							cttccttccttctttcctccttccttc	0.000													9	4	---	---	---	---	
ALDH3A2	224	broad.mit.edu	37	17	19576700	19576700	+	Intron	DEL	T	-	-	rs66737570		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19576700delT	uc002gwb.1	+						ALDH3A2_uc002gwa.1_Intron|ALDH3A2_uc010cqr.1_Intron|ALDH3A2_uc002gwc.1_Intron|ALDH3A2_uc002gwd.1_Intron	NM_000382	NP_000373	P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3A2 isoform 2						cellular aldehyde metabolic process|central nervous system development|epidermis development|lipid metabolic process|peripheral nervous system development	endoplasmic reticulum membrane|integral to membrane	3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(2)	2	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)				NADH(DB00157)	tttatttttgttttttttttg	0.184													11	7	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34930247	34930247	+	Intron	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34930247delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron|GGNBP2_uc002hnc.1_5'Flank	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		gactgtagtcttttttttttt	0.159													4	4	---	---	---	---	
MRM1	79922	broad.mit.edu	37	17	34964977	34964977	+	3'UTR	DEL	A	-	-	rs4796229	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34964977delA	uc002hne.2	+	5					MRM1_uc002hnf.2_3'UTR	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog						RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CCACAGTCTGAGGGGGGGGGA	0.592											OREG0024339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43616636	43616636	+	Intron	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43616636delA	uc002ijh.2	-						uc010wjv.1_Intron					Homo sapiens cDNA FLJ45049 fis, clone BRAWH3022347.																		CAAGCCAAAGAAAAAAAAAAT	0.323													7	4	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087407	76087408	+	Intron	INS	-	A	A			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087407_76087408insA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			gactccgtctcaaaaaaaaaaa	0.178													7	6	---	---	---	---	
SKA1	220134	broad.mit.edu	37	18	47918722	47918723	+	3'UTR	INS	-	T	T			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47918722_47918723insT	uc002let.2	+	7					SKA1_uc002leu.2_3'UTR|SKA1_uc010xdl.1_3'UTR	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						tttttgtttccttttttttttt	0.099													4	2	---	---	---	---	
TCF4	6925	broad.mit.edu	37	18	53029621	53029624	+	Intron	DEL	GAAA	-	-	rs71167291	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53029621_53029624delGAAA	uc002lfz.2	-						TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		aggaaggaaggaaagaaggaagga	0.103													4	2	---	---	---	---	
GALR1	2587	broad.mit.edu	37	18	74964876	74964876	+	Intron	DEL	C	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74964876delC	uc002lms.3	+							NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1						digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		accaccaccaccatcaccacc	0.000													7	4	---	---	---	---	
ZNF555	148254	broad.mit.edu	37	19	2851297	2851297	+	Intron	DEL	A	-	-	rs10713166		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2851297delA	uc002lwo.2	+						ZNF555_uc002lwn.3_Intron	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cctggccGTGaattttttttt	0.144													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													5	3	---	---	---	---	
ZNF14	7561	broad.mit.edu	37	19	19825509	19825510	+	Intron	DEL	CC	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19825509_19825510delCC	uc002nnk.1	-							NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				ttttctttttcctttttctttt	0.173													4	2	---	---	---	---	
NFKBIB	4793	broad.mit.edu	37	19	39399197	39399199	+	Intron	DEL	AAG	-	-	rs56371900		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39399197_39399199delAAG	uc002ojw.2	+						NFKBIB_uc002ojx.2_3'UTR|NFKBIB_uc002ojy.2_3'UTR	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			aaaaaaaaaaaagaaagaaaaGA	0.236													8	4	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14517272	14517273	+	Intron	INS	-	GTGT	GTGT	rs143826646	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14517272_14517273insGTGT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AGGTAACATTGgtgtgtgtgtg	0.228													3	3	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15343634	15343653	+	Intron	DEL	GAAGGAAGAAAGGAAAGAAG	-	-	rs75464011	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15343634_15343653delGAAGGAAGAAAGGAAAGAAG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				aggaaagaaagaaggaagaaaggaaagaaggaagggagaa	0.145													3	3	---	---	---	---	
SALL4	57167	broad.mit.edu	37	20	50418694	50418694	+	Intron	DEL	C	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50418694delC	uc002xwh.3	-						SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GGGCACTGAGCCCCCAAATCT	0.632													4	2	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43257865	43257882	+	Intron	DEL	TCCTGAGCTCCAGAACAT	-	-	rs71969131		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43257865_43257882delTCCTGAGCTCCAGAACAT	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCATTAAACTCCTGAGCTCCAGAACATTCCTGAGCTC	0.381													6	5	---	---	---	---	
C22orf13	83606	broad.mit.edu	37	22	24940236	24940237	+	Intron	DEL	GG	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24940236_24940237delGG	uc003aah.2	-						C22orf13_uc003aal.2_Intron|C22orf13_uc003aai.3_Intron|C22orf13_uc003aaj.3_Intron|C22orf13_uc003aak.3_Intron	NM_031444	NP_113632	Q96NT3	CV013_HUMAN	chromosome 22 open reading frame 13												0						GGAGACCGGTGGGGGGGGTGTG	0.589													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25855682	25855683	+	Intron	INS	-	GTGT	GTGT	rs138963277	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25855682_25855683insGTGT	uc003abt.2	+						uc003abu.2_Intron|uc003abv.2_Intron					Homo sapiens cDNA clone IMAGE:3542716, partial cds.																		CCTGGCAGCTGgtgtgtgtgtg	0.406													9	4	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	39966294	39966295	+	5'Flank	INS	-	TCCC	TCCC	rs141735480	by1000genomes	TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39966294_39966295insTCCC	uc003ayc.2	+						CACNA1I_uc003ayd.2_5'Flank	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	ccttcctttcttccctccctcc	0.134													3	3	---	---	---	---	
ARFGAP3	26286	broad.mit.edu	37	22	43219494	43219508	+	Intron	DEL	ACATTAATCTCTTTG	-	-	rs11272578		TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43219494_43219508delACATTAATCTCTTTG	uc003bdd.2	-						ARFGAP3_uc010gzf.2_Intron|ARFGAP3_uc011apu.1_Intron	NM_014570	NP_055385	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating						intracellular protein transport|protein secretion|regulation of ARF GTPase activity|vesicle-mediated transport	cytosol|Golgi membrane	ARF GTPase activator activity|protein transporter activity|zinc ion binding			breast(1)	1						AATAAGTATAACATTAATCTCTTTGACATTAATCT	0.274													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42384501	42384501	+	IGR	DEL	A	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384501delA								CASK (602214 upstream) : PPP1R2P9 (252118 downstream)																							ttgtctcaggaaaaaaaaaaa	0.149													4	3	---	---	---	---	
SSX7	280658	broad.mit.edu	37	X	52681174	52681174	+	Intron	DEL	T	-	-			TCGA-BP-5190-01A-01D-1429-08	TCGA-BP-5190-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681174delT	uc004dqx.1	-							NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					ctgcatgcaattttttttttt	0.169													8	4	---	---	---	---	
