Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CLSTN1	22883	broad.mit.edu	37	1	9795231	9795231	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9795231A>C	uc001aqh.2	-	14	2644	c.1885T>G	c.(1885-1887)TGT>GGT	p.C629G	CLSTN1_uc001aqi.2_Missense_Mutation_p.C619G|CLSTN1_uc010oag.1_Missense_Mutation_p.C610G|CLSTN1_uc001aqf.2_5'Flank	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	629	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCGTTAAAACACCTGCCAGCA	0.587													23	76	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10292482	10292482	+	Silent	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10292482C>T	uc001aqx.3	+	2	298	c.96C>T	c.(94-96)GGC>GGT	p.G32G	KIF1B_uc001aqv.3_Silent_p.G32G|KIF1B_uc001aqw.3_Silent_p.G32G|KIF1B_uc001aqy.2_Silent_p.G32G|KIF1B_uc001aqz.2_Silent_p.G32G|KIF1B_uc001ara.2_Silent_p.G32G|KIF1B_uc001arb.2_Silent_p.G32G|KIF1B_uc009vmt.2_RNA	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	32	Kinesin-motor.				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGATGCAAGGCAACTCGACCA	0.458													6	28	---	---	---	---	PASS
MASP2	10747	broad.mit.edu	37	1	11090302	11090302	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11090302A>T	uc001aru.2	-	10	1249	c.1228T>A	c.(1228-1230)TAT>AAT	p.Y410N		NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform	410	Sushi 2.				complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TCACACACATATTTACCTGCA	0.393													23	139	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16956467	16956467	+	Intron	SNP	A	T	T	rs1762950	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956467A>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						gcaattttttaaatttttagt	0.214													7	10	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16956468	16956468	+	Intron	SNP	A	T	T	rs1762951	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956468A>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						caattttttaaatttttagta	0.219													7	11	---	---	---	---	PASS
SEPN1	57190	broad.mit.edu	37	1	26138262	26138262	+	Silent	SNP	T	C	C	rs760597	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26138262T>C	uc010oer.1	+	11	1228	c.1173T>C	c.(1171-1173)CCT>CCC	p.P391P	SEPN1_uc010oes.1_Silent_p.P357P	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor	391						endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GCCACCTGCCTTCAGGGGAGC	0.642													6	9	---	---	---	---	PASS
TESK2	10420	broad.mit.edu	37	1	45923458	45923458	+	5'UTR	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45923458A>C	uc001cns.1	-	2					TESK2_uc009vxr.1_5'UTR|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_5'UTR|TESK2_uc010olp.1_5'UTR	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					TCCGATCCATAGTCTAAATAA	0.388													12	99	---	---	---	---	PASS
GSTM2	2946	broad.mit.edu	37	1	110217403	110217403	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110217403G>T	uc001dyi.2	+	8	916	c.602G>T	c.(601-603)AGC>ATC	p.S201I	GSTM2_uc001dyj.2_Missense_Mutation_p.S201I|GSTM2_uc010ovt.1_Intron|GSTM2_uc009wfk.2_Intron	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1	201	GST C-terminal.				glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	ATGAAGTCCAGCCGCTTCCTC	0.577													20	137	---	---	---	---	PASS
GSTM2	2946	broad.mit.edu	37	1	110217413	110217413	+	Silent	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110217413C>G	uc001dyi.2	+	8	926	c.612C>G	c.(610-612)CTC>CTG	p.L204L	GSTM2_uc001dyj.2_Silent_p.L204L|GSTM2_uc010ovt.1_Intron|GSTM2_uc009wfk.2_Intron	NM_000848	NP_000839	P28161	GSTM2_HUMAN	glutathione S-transferase mu 2 isoform 1	204	GST C-terminal.				glutathione metabolic process|xenobiotic catabolic process	cytoplasm	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	GCCGCTTCCTCCCAAGACCTG	0.582													23	146	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145209366	145209366	+	Translation_Start_Site	SNP	A	G	G	rs856450	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209366A>G	uc001emn.3	+	1	256	c.-114A>G	c.(-116--112)ATACC>ATGCC		NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Translation_Start_Site|NOTCH2NL_uc001emm.3_Translation_Start_Site|NOTCH2NL_uc001emo.2_Translation_Start_Site|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein						cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						CCGAGAAGATACCCGCCCTGC	0.592													2	8	---	---	---	---	PASS
ATF6	22926	broad.mit.edu	37	1	161833188	161833188	+	Intron	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161833188A>C	uc001gbr.2	+						ATF6_uc001gbq.1_3'UTR	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			GGAAAATACAAAGATGTGAGA	0.224													14	34	---	---	---	---	PASS
ADAM17	6868	broad.mit.edu	37	2	9634938	9634938	+	Intron	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9634938A>C	uc002qzu.2	-						IAH1_uc010yiz.1_RNA|ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TTGTTCTGAGACCTGCCTCTC	0.468													12	28	---	---	---	---	PASS
RTKN	6242	broad.mit.edu	37	2	74666743	74666743	+	Intron	SNP	C	T	T	rs112456374		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74666743C>T	uc002sle.2	-						RTKN_uc002slc.2_Missense_Mutation_p.D3N|RTKN_uc002sld.2_Intron|RTKN_uc010ffe.1_Intron|RTKN_uc010fff.1_Missense_Mutation_p.D3N|RTKN_uc010ffg.1_Intron	NM_001015055	NP_001015055	Q9BST9	RTKN_HUMAN	rhotekin isoform a						apoptosis|regulation of anti-apoptosis|Rho protein signal transduction	intracellular	GTP binding|GTP-Rho binding|GTPase inhibitor activity			skin(1)	1						TGCAATCTGTCCTGCATCTCT	0.577													11	48	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88870483	88870483	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88870483T>A	uc002stc.3	-	14	3096	c.2894A>T	c.(2893-2895)GAT>GTT	p.D965V		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	965	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						CTCTTCCTCATCCTGGTCCAT	0.463													39	252	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101591316	101591316	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101591316G>A	uc002tap.1	+	13	1478	c.1192G>A	c.(1192-1194)GGT>AGT	p.G398S	NPAS2_uc010yvt.1_Missense_Mutation_p.G463S|NPAS2_uc010fit.1_5'UTR	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	398					central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						ACTCGACGTGGGTGCCTCGGG	0.532													18	82	---	---	---	---	PASS
ERCC3	2071	broad.mit.edu	37	2	128050049	128050049	+	Intron	SNP	T	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128050049T>G	uc002toh.1	-						ERCC3_uc002toe.1_5'Flank|ERCC3_uc002tof.1_Intron|ERCC3_uc002tog.1_Intron|ERCC3_uc010flx.1_Intron|ERCC3_uc010yzh.1_RNA|ERCC3_uc010fly.2_Intron	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		gcggctggggtaatcagtcgt	0.095			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				6	21	---	---	---	---	PASS
LIMS2	55679	broad.mit.edu	37	2	128399723	128399723	+	Silent	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128399723C>A	uc002tpa.2	-	6	727	c.561G>T	c.(559-561)CTG>CTT	p.L187L	LIMS2_uc002tou.2_5'UTR|LIMS2_uc002tov.2_Silent_p.L35L|LIMS2_uc002tow.2_Silent_p.L35L|LIMS2_uc002tox.2_Silent_p.L211L|LIMS2_uc010fmb.2_Silent_p.L97L|LIMS2_uc002toy.2_Silent_p.L182L|LIMS2_uc010yzm.1_Silent_p.L209L|LIMS2_uc002toz.2_Silent_p.L182L|LIMS2_uc002tpb.2_Silent_p.L182L	NM_001161403	NP_001154875	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	187	LIM zinc-binding 3.				cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		CATGGCAGGGCAGGCAGTAGA	0.692													7	17	---	---	---	---	PASS
ICA1L	130026	broad.mit.edu	37	2	203661648	203661648	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203661648T>A	uc002uzh.1	-	11	1114	c.950A>T	c.(949-951)GAA>GTA	p.E317V	ICA1L_uc002uzi.1_Missense_Mutation_p.E317V	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1	317											0						TGCTCCAAATTCTCTCATTTG	0.279													11	86	---	---	---	---	PASS
FZD5	7855	broad.mit.edu	37	2	208632596	208632596	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208632596C>G	uc002vcj.2	-	2	1278	c.868G>C	c.(868-870)GTC>CTC	p.V290L		NM_003468	NP_003459	Q13467	FZD5_HUMAN	frizzled 5 precursor	290	Helical; Name=2; (Potential).				angiogenesis|anterior/posterior axis specification, embryo|axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to molecule of bacterial origin|embryonic camera-type eye development|gonad development|labyrinthine layer blood vessel development|positive regulation of interferon-gamma production|positive regulation of transcription from RNA polymerase II promoter|post-embryonic camera-type eye development|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell projection|cell surface|Golgi membrane|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|protein kinase binding|Wnt-protein binding			ovary(2)|lung(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TGGCCCACGACCAGACGCACC	0.622													4	19	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241556456	241556456	+	3'UTR	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241556456A>G	uc002vzq.1	+	4					GPR35_uc010fzh.1_Intron|GPR35_uc010fzi.1_Intron	NM_023089	NP_075577	Q9HC96	CAN10_HUMAN	calpain 10 isoform g						actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		ctgcagccccagctgacacct	0.000													3	11	---	---	---	---	PASS
COLQ	8292	broad.mit.edu	37	3	15563253	15563253	+	5'UTR	SNP	C	T	T	rs113510832		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15563253C>T	uc003bzx.2	-	1					HACL1_uc011avr.1_Intron|COLQ_uc003bzz.2_5'UTR|COLQ_uc010heo.2_5'UTR|COLQ_uc003cae.1_5'UTR|COLQ_uc003cad.1_RNA	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN	acetylcholinesterase collagen-like tail subunit						acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft					0						tgtgtgtgtgcgtgtgtgtgt	0.194													4	7	---	---	---	---	PASS
DNAH12	201625	broad.mit.edu	37	3	57488129	57488129	+	Silent	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57488129C>T	uc003dit.2	-	10	1345	c.1164G>A	c.(1162-1164)GTG>GTA	p.V388V	DNAH12_uc003diu.2_Silent_p.V388V	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1	388	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						CCCAGTGTAACACGTGTTCAG	0.388													48	224	---	---	---	---	PASS
MBD4	8930	broad.mit.edu	37	3	129150264	129150264	+	3'UTR	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129150264A>G	uc003emh.1	-	8					uc003emg.2_5'Flank|MBD4_uc003emi.1_3'UTR|MBD4_uc003emj.1_3'UTR|MBD4_uc003emk.1_3'UTR	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4						depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						CTATGGCTGGAAAGGTGGTTG	0.373								BER_DNA_glycosylases					26	46	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195447871	195447871	+	5'UTR	SNP	C	T	T	rs11185524	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195447871C>T	uc010hzo.2	+	1						NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CAGCGGTGGCCGGCTAGGATG	0.617													3	7	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195692347	195692347	+	Missense_Mutation	SNP	G	A	A	rs62282794	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195692347G>A	uc003fvy.2	-	3	310	c.196C>T	c.(196-198)CAC>TAC	p.H66Y	SDHAP1_uc003fvx.3_RNA					Homo sapiens full length insert cDNA clone ZC24D06.												0						TTCCTCCAGTGCTCCTCAAAG	0.572													6	30	---	---	---	---	PASS
TM4SF19	116211	broad.mit.edu	37	3	196051403	196051403	+	Intron	SNP	A	G	G	rs2280526	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196051403A>G	uc003fwj.2	-						uc003fwk.1_3'UTR|TM4SF19_uc010iad.1_Intron|TM4SF19_uc003fwl.1_Intron|TM4SF19_uc011btv.1_Intron	NM_138461		Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		ACGGGGTCGCAGCTGGGGAGT	0.607													9	9	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170165	90170165	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170165C>T	uc003hsm.1	-	2	1616	c.1097G>A	c.(1096-1098)GGG>GAG	p.G366E		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	366										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TGTGTGGCTCCCACTGCTGTG	0.582													34	158	---	---	---	---	PASS
SCRG1	11341	broad.mit.edu	37	4	174309467	174309467	+	3'UTR	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174309467T>A	uc003ite.2	-	3					SCRG1_uc003itf.2_RNA	NM_007281	NP_009212	O75711	SCRG1_HUMAN	stimulator of chondrogenesis 1 precursor						nervous system development	extracellular space					0		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		TCAGGAATGGTGTTCTCCAGA	0.353													17	111	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187629931	187629931	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187629931T>C	uc003izf.2	-	2	1239	c.1051A>G	c.(1051-1053)AAA>GAA	p.K351E	FAT1_uc010iso.1_Missense_Mutation_p.K351E	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	351	Extracellular (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGAATGACTTTAACAGAAGAG	0.458										HNSCC(5;0.00058)			44	242	---	---	---	---	PASS
NDUFS4	4724	broad.mit.edu	37	5	52979037	52979037	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52979037G>T	uc003jpe.2	+	5	542	c.514G>T	c.(514-516)GTA>TTA	p.V172L		NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4	172					brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	AAGAACAAGAGTATCCACAAA	0.378													12	52	---	---	---	---	PASS
TCF7	6932	broad.mit.edu	37	5	133481718	133481718	+	Intron	SNP	T	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133481718T>G	uc003kyt.2	+						TCF7_uc003kyu.1_3'UTR|TCF7_uc003kyv.2_Intron|TCF7_uc003kyw.2_Intron|TCF7_uc003kyx.2_Intron|TCF7_uc003kyy.2_Intron|TCF7_uc003kyz.2_Intron|TCF7_uc003kza.2_Intron|TCF7_uc003kzb.2_Intron|TCF7_uc010jdu.2_Intron	NM_003202	NP_003193	P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific,						cellular response to interleukin-4|immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription regulatory region DNA binding				0		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTTGTGGCTGTTCTGGGAACT	0.547											OREG0016787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	6	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57499035	57499035	+	Silent	SNP	T	C	C	rs61753605		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57499035T>C	uc003pdx.2	+	14	1386	c.1299T>C	c.(1297-1299)AAT>AAC	p.N433N		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	433					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGATACACAATGTAAGTATTT	0.214													6	13	---	---	---	---	PASS
CYB5R4	51167	broad.mit.edu	37	6	84649905	84649905	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84649905G>C	uc003pkf.2	+	13	1371	c.1239G>C	c.(1237-1239)TTG>TTC	p.L413F		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	413	FAD (By similarity).				cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		ATTATGCTTTGACTGATATAC	0.333													31	166	---	---	---	---	PASS
PLEKHA8	84725	broad.mit.edu	37	7	30102304	30102304	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30102304A>C	uc003tam.1	+	12	1337	c.1246A>C	c.(1246-1248)AAG>CAG	p.K416Q	PLEKHA8_uc003tao.2_Missense_Mutation_p.K300Q|PLEKHA8_uc003tap.1_Missense_Mutation_p.K416Q|PLEKHA8_uc003tan.2_Missense_Mutation_p.K416Q	NM_032639	NP_116028	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A	416					protein transport	cytoplasm	glycolipid binding|glycolipid transporter activity			breast(3)|ovary(1)	4						CAAATTTTTGAAGGGATTTTT	0.343													17	139	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31862740	31862740	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31862740C>G	uc003tcm.1	-	14	1998	c.1529G>C	c.(1528-1530)TGG>TCG	p.W510S	PDE1C_uc003tcn.1_Missense_Mutation_p.W510S|PDE1C_uc003tco.1_Missense_Mutation_p.W570S|PDE1C_uc003tcr.2_Missense_Mutation_p.W510S|PDE1C_uc003tcs.2_Missense_Mutation_p.W510S	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	510	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			CACTTCCGTCCAAGTAGCTTT	0.488													31	286	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38389495	38389495	+	Intron	SNP	C	A	A	rs2012300	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38389495C>A	uc003tgp.1	+						uc003tgq.1_5'UTR					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		CTTAAAACTCCGGCCCCACTC	0.542													5	21	---	---	---	---	PASS
STK17A	9263	broad.mit.edu	37	7	43659292	43659292	+	Nonsense_Mutation	SNP	C	T	T	rs149915695		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43659292C>T	uc003tih.2	+	4	812	c.661C>T	c.(661-663)CGA>TGA	p.R221*	C7orf44_uc003til.2_Intron|C7orf44_uc003tii.2_Intron|C7orf44_uc003tij.2_Intron|C7orf44_uc010kxu.1_Intron|C7orf44_uc003tik.2_Intron	NM_004760	NP_004751	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	221	Protein kinase.				apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			skin(2)	2						TGAAGAGCTCCGAGAAATTAT	0.403													48	388	---	---	---	---	PASS
LOC442308	442308	broad.mit.edu	37	7	55714354	55714354	+	RNA	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55714354C>T	uc010kzj.2	+	1		c.1043C>T				NR_003598				Homo sapiens similar to tubulin, beta 5 (LOC442308), non-coding RNA.												0						TCCCCAACAACATCAAGACAG	0.502													7	57	---	---	---	---	PASS
KIAA1324L	222223	broad.mit.edu	37	7	86539226	86539226	+	Missense_Mutation	SNP	C	T	T	rs139786503	byFrequency	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86539226C>T	uc011kha.1	-	16	2446	c.2261G>A	c.(2260-2262)GGG>GAG	p.G754E	KIAA1324L_uc003uif.1_Missense_Mutation_p.G514E|KIAA1324L_uc011kgz.1_Missense_Mutation_p.G640E|KIAA1324L_uc003uie.2_Missense_Mutation_p.G587E	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	754	Extracellular (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					TACAAATGCCCCTACCAAATT	0.398													21	121	---	---	---	---	PASS
FSCN3	29999	broad.mit.edu	37	7	127235734	127235734	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127235734C>G	uc003vmd.1	+	2	737	c.518C>G	c.(517-519)CCC>CGC	p.P173R	FSCN3_uc003vmc.1_Missense_Mutation_p.P128R|FSCN3_uc011kog.1_RNA|FSCN3_uc011koh.1_Missense_Mutation_p.P39R|FSCN3_uc010llc.1_Missense_Mutation_p.P173R	NM_020369	NP_065102	Q9NQT6	FSCN3_HUMAN	fascin 3	173						actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging			ovary(1)	1						GCAGCAGTTCCCTGCCTGGAG	0.602													24	128	---	---	---	---	PASS
CDK5	1020	broad.mit.edu	37	7	150754948	150754948	+	5'UTR	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150754948G>A	uc003wir.1	-	1					CDK5_uc003wis.1_5'UTR|SLC4A2_uc003wit.3_5'Flank	NM_004935	NP_004926	Q00535	CDK5_HUMAN	cyclin-dependent kinase 5 isoform 1						activation of pro-apoptotic gene products|blood coagulation|cell division|cell proliferation|embryo development|negative regulation of transcription, DNA-dependent|positive regulation of neuron apoptosis	axon|cytosol|dendrite|growth cone|lamellipodium|membrane|neuromuscular junction|neuronal cell body	acetylcholine receptor activator activity|ATP binding|cyclin-dependent protein kinase activity|ErbB-2 class receptor binding|ErbB-3 class receptor binding|tau-protein kinase activity			lung(1)|central_nervous_system(1)	2		Breast(660;0.159)|Ovarian(593;0.182)	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.008)|Lung(243;0.00942)|BRCA - Breast invasive adenocarcinoma(188;0.242)		CGGCGGCCGCGGGGACCCCTG	0.642													5	26	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76456145	76456145	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76456145C>A	uc003yaq.2	+	3	347	c.77C>A	c.(76-78)GCA>GAA	p.A26E	HNF4G_uc003yap.1_Missense_Mutation_p.A26E|HNF4G_uc003yar.2_Missense_Mutation_p.A63E	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	26	Nuclear receptor.|NR C4-type.				endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CACTATGGGGCATCCAGCTGT	0.468													39	179	---	---	---	---	PASS
CPNE3	8895	broad.mit.edu	37	8	87563330	87563330	+	Splice_Site	SNP	T	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87563330T>G	uc003ydv.2	+	13	1230	c.1068_splice	c.e13+2	p.Q356_splice	CPNE3_uc003ydw.1_Splice_Site_p.Q72_splice	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						CAGTGGCAGGTAAGAGGAAAT	0.368													16	23	---	---	---	---	PASS
SNX31	169166	broad.mit.edu	37	8	101589258	101589258	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101589258G>A	uc003yjr.2	-	13	1367	c.1216C>T	c.(1216-1218)CAA>TAA	p.Q406*	SNX31_uc011lha.1_Nonsense_Mutation_p.Q201*|SNX31_uc011lhb.1_Nonsense_Mutation_p.Q307*	NM_152628	NP_689841	Q8N9S9	SNX31_HUMAN	sorting nexin 31	406					cell communication|protein transport		phosphatidylinositol binding				0	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TGGCTTTGTTGAATGTGGTAT	0.343													52	334	---	---	---	---	PASS
DGAT1	8694	broad.mit.edu	37	8	145541933	145541933	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145541933C>T	uc003zbv.3	-	7	935	c.667G>A	c.(667-669)GCC>ACC	p.A223T	DGAT1_uc010mfv.2_Missense_Mutation_p.A223T	NM_012079	NP_036211	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	223	Helical; (Potential).				triglyceride biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CCAGCCTTGGCCCTGGCCCTG	0.692													8	51	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14823308	14823308	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14823308C>A	uc003zlm.2	-	13	2777	c.2187G>T	c.(2185-2187)ATG>ATT	p.M729I	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	729	CSPG 4.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AGGCCACTTTCATATAGTTCA	0.453													74	350	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	43861081	43861081	+	RNA	SNP	T	G	G	rs62536501		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43861081T>G	uc004acz.1	+	11		c.1905T>G								Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																		GGGCACCCGCTCTCGGCTGTG	0.746													2	9	---	---	---	---	PASS
TMC1	117531	broad.mit.edu	37	9	75357381	75357381	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75357381G>A	uc004aiz.1	+	10	1015	c.475G>A	c.(475-477)GAT>AAT	p.D159N	TMC1_uc010moz.1_Missense_Mutation_p.D117N|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.D13N|TMC1_uc010mpa.1_Missense_Mutation_p.D13N	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	159	Cytoplasmic (Potential).|Arg/Asp/Glu/Lys-rich (highly charged).				sensory perception of sound	integral to membrane				ovary(1)	1						ATTCCTCCGTGATTTTGAGAA	0.378													16	87	---	---	---	---	PASS
FGD3	89846	broad.mit.edu	37	9	95784668	95784668	+	Silent	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95784668A>C	uc004asw.2	+	14	2182	c.1554A>C	c.(1552-1554)GCA>GCC	p.A518A	FGD3_uc004asx.2_Silent_p.A518A|FGD3_uc004asz.2_Silent_p.A518A|FGD3_uc011luc.1_Silent_p.A121A	NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	518					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						CGGGTGCAGCAGGGGTAAGTG	0.612													13	103	---	---	---	---	PASS
ST6GALNAC4	27090	broad.mit.edu	37	9	130678772	130678772	+	5'UTR	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130678772A>C	uc004bss.2	-	2					ST6GALNAC4_uc004bst.2_Intron	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a						glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						GGAGCCGGGCACCTGCCAAGA	0.617													7	18	---	---	---	---	PASS
DDIT4	54541	broad.mit.edu	37	10	74034535	74034535	+	Silent	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74034535G>A	uc001jsx.1	+	3	490	c.288G>A	c.(286-288)CTG>CTA	p.L96L		NM_019058	NP_061931	Q9NX09	DDIT4_HUMAN	RTP801	96					apoptosis					pancreas(1)	1						GTGCCAACCTGATGCAGCTGC	0.627											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	371	---	---	---	---	PASS
C10orf99	387695	broad.mit.edu	37	10	85933664	85933664	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85933664C>G	uc001kcu.2	+	1	111	c.57C>G	c.(55-57)ATC>ATG	p.I19M	uc001kct.2_5'Flank	NM_207373	NP_997256	Q6UWK7	CJ099_HUMAN	hypothetical protein LOC387695 precursor	19						extracellular region		p.I19I(1)		pancreas(1)	1						GCTTCTCCATCTTCTCCACAG	0.547													25	251	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66192368	66192368	+	Silent	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66192368C>T	uc001ohx.1	+	7	2183	c.2007C>T	c.(2005-2007)GAC>GAT	p.D669D	NPAS4_uc010rpc.1_Silent_p.D459D	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	669					transcription, DNA-dependent		DNA binding|signal transducer activity				0						AGCCCCTGGACTCCAACCTGT	0.607													46	269	---	---	---	---	PASS
LRFN4	78999	broad.mit.edu	37	11	66627358	66627358	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66627358A>C	uc001ojr.2	+	2	1940	c.1600A>C	c.(1600-1602)ACT>CCT	p.T534P	PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron|PC_uc001ojn.1_Intron|LRFN4_uc001ojs.2_Intron	NM_024036	NP_076941	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III	534	Helical; (Potential).					integral to membrane					0						ACTGGTCTTCACTGTGGCCTT	0.721													7	27	---	---	---	---	PASS
USP35	57558	broad.mit.edu	37	11	77911274	77911274	+	Silent	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77911274C>T	uc009yva.1	+	5	1278	c.1032C>T	c.(1030-1032)TTC>TTT	p.F344F	USP35_uc001oze.2_Silent_p.F100F|USP35_uc001ozc.2_Intron|USP35_uc010rsp.1_Intron|USP35_uc001ozd.2_5'UTR|USP35_uc001ozf.2_Silent_p.F75F	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	344					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			ACGAAGCCTTCCACCTGGTAA	0.627													12	82	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88781056	88781056	+	5'UTR	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88781056C>A	uc001pcq.2	-	1					GRM5_uc009yvm.2_5'UTR|GRM5_uc009yvn.1_5'UTR	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GAAAGGAGTTCAAGCCAATAA	0.463													7	16	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108170450	108170450	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108170450G>C	uc001pkb.1	+	34	5400	c.5015G>C	c.(5014-5016)GGA>GCA	p.G1672A	ATM_uc009yxr.1_Missense_Mutation_p.G1672A|ATM_uc001pke.1_Missense_Mutation_p.G324A|ATM_uc001pkg.1_Missense_Mutation_p.G29A	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1672					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GAGGCTGTTGGAAGCTGCTTG	0.333			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			30	209	---	---	---	---	PASS
FAM90A1	55138	broad.mit.edu	37	12	8380196	8380196	+	5'UTR	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8380196A>G	uc001qui.2	-	1					FAM90A1_uc001quh.2_5'UTR	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138								nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		AAGGGCCCGGATGGGGCCTGA	0.667													5	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	9548853	9548853	+	RNA	SNP	A	T	T	rs61914444	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9548853A>T	uc009zgp.2	+	4		c.3028A>T								Homo sapiens cDNA clone IMAGE:4838157.																		CTGTCTTCTGAGAGATGTCTC	0.308													3	6	---	---	---	---	PASS
TAS2R46	259292	broad.mit.edu	37	12	11214315	11214315	+	Silent	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11214315T>A	uc001qzp.1	-	1	579	c.579A>T	c.(577-579)ATA>ATT	p.I193I	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176887	NP_795368	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	193	Helical; Name=5; (Potential).				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GCAGAAAAGATATCAGGGTCA	0.413													39	231	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30818715	30818715	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30818715T>A	uc001rjd.2	-	12	1456	c.1286A>T	c.(1285-1287)AAG>ATG	p.K429M	IPO8_uc001rje.1_5'Flank|IPO8_uc010sjt.1_Missense_Mutation_p.K224M	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	429					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCCATCTTTCTTCCTAGGGTC	0.358													22	134	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30818751	30818751	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30818751T>A	uc001rjd.2	-	12	1420	c.1250A>T	c.(1249-1251)TAT>TTT	p.Y417F	IPO8_uc001rje.1_5'Flank|IPO8_uc010sjt.1_Missense_Mutation_p.Y212F	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	417					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CAGGATTTGATAACAGAATGC	0.378													28	120	---	---	---	---	PASS
KRT4	3851	broad.mit.edu	37	12	53201573	53201573	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53201573G>A	uc001saz.2	-	7	1694	c.1423C>T	c.(1423-1425)CGC>TGC	p.R475C		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	401						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						AGCTCTACGCGCTTGCTGTGG	0.557													18	88	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116457671	116457671	+	Silent	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116457671C>T	uc001tvw.2	-	6	787	c.732G>A	c.(730-732)CCG>CCA	p.P244P		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	244					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTAGCACCATCGGGTAGAAAT	0.418													63	158	---	---	---	---	PASS
CHFR	55743	broad.mit.edu	37	12	133428223	133428223	+	Silent	SNP	C	T	T	rs142511371		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133428223C>T	uc001ulf.2	-	12	1593	c.1509G>A	c.(1507-1509)CCG>CCA	p.P503P	CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Silent_p.P491P|CHFR_uc010tbs.1_Silent_p.P502P|CHFR_uc001uld.2_Silent_p.P462P|CHFR_uc010tbt.1_Silent_p.P411P	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains	503					cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GGGCGACACGCGGGTCCTGCT	0.657													58	292	---	---	---	---	PASS
ITGBL1	9358	broad.mit.edu	37	13	102250584	102250584	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102250584C>T	uc001vpb.2	+	7	1169	c.950C>T	c.(949-951)ACG>ATG	p.T317M	ITGBL1_uc010agb.2_Missense_Mutation_p.T268M|ITGBL1_uc001vpc.3_Missense_Mutation_p.T176M	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat	317	VI.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGTCCTGCACGCTGTCAGCT	0.567													18	79	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53513502	53513502	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53513502T>C	uc001xai.2	-	13	2917	c.2687A>G	c.(2686-2688)AAT>AGT	p.N896S	DDHD1_uc001xaj.2_Missense_Mutation_p.N875S|DDHD1_uc001xah.2_Missense_Mutation_p.N868S|DDHD1_uc001xag.2_Missense_Mutation_p.N450S	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	896					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					TGGATCTAAATTGGGTTTTGC	0.388													25	133	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58471373	58471373	+	3'UTR	SNP	T	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58471373T>G	uc001xdc.2	-	8					C14orf37_uc010tro.1_3'UTR	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						ATGTGGCAGGTTGTTCTTTTT	0.383													19	43	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112942	59112942	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112942A>G	uc001xdw.2	+	4	1765	c.1601A>G	c.(1600-1602)GAG>GGG	p.E534G	DACT1_uc010trv.1_Missense_Mutation_p.E253G|DACT1_uc001xdx.2_Missense_Mutation_p.E497G|DACT1_uc010trw.1_Missense_Mutation_p.E253G	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	534					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						CCCGTGGAAGAGAGGCCTGCC	0.592													26	161	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106234188	106234188	+	Intron	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106234188A>G	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						CACACGCTTAACAGGAAGAGT	0.592													4	15	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65502037	65502037	+	Silent	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65502037C>A	uc002aon.2	-	2	238	c.57G>T	c.(55-57)GTG>GTT	p.V19V		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	19					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CTATACCCAACACAGATGTGA	0.542													10	83	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74326687	74326687	+	Intron	SNP	T	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74326687T>G	uc002awv.2	+						PML_uc002awm.2_Intron|PML_uc002awl.2_Intron|PML_uc002awj.1_3'UTR|PML_uc002awk.2_Intron|PML_uc002awn.2_Intron|PML_uc002awo.2_Intron|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002awx.2_Intron|PML_uc002awy.2_Intron	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						ACAGTGGCTGTTCCCGTCCCC	0.517			T	RARA|PAX5	APL|ALL								6	8	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85055872	85055872	+	RNA	SNP	C	T	T	rs62029638	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85055872C>T	uc002bkm.2	-	6		c.688G>A				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CTCCTGTTCACGTAGCCTCTC	0.547													4	12	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515299G>A	uc002cdi.2	+	9	1943	c.523G>A	c.(523-525)GGC>AGC	p.G175S	WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						TGGGGGCATCGGCAAGGCCAA	0.652													7	17	---	---	---	---	PASS
ZP2	7783	broad.mit.edu	37	16	21215330	21215330	+	Intron	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21215330G>C	uc002dii.2	-						ZP2_uc010bwn.1_Intron|ZP2_uc010bwo.2_Missense_Mutation_p.H370Q	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein						binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)		GTGGAGTTCAGTGGTTGACAA	0.423													25	138	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30731617	30731617	+	Silent	SNP	A	C	C	rs145842115	byFrequency	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30731617A>C	uc002dze.1	+	19	3337	c.2952A>C	c.(2950-2952)CCA>CCC	p.P984P	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.P841P|SRCAP_uc010bzz.1_Silent_p.P554P	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	984	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CTGACCCCCCACCCCGGCCCA	0.572													34	109	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30731626	30731626	+	Silent	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30731626C>A	uc002dze.1	+	19	3346	c.2961C>A	c.(2959-2961)CCC>CCA	p.P987P	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.P844P|SRCAP_uc010bzz.1_Silent_p.P557P	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	987	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CACCCCGGCCCAAGCCAGTCA	0.582													34	138	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													3	13	---	---	---	---	PASS
ZCCHC14	23174	broad.mit.edu	37	16	87448079	87448079	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87448079C>G	uc002fjz.1	-	10	1160	c.1133G>C	c.(1132-1134)CGA>CCA	p.R378P	ZCCHC14_uc002fka.1_RNA|ZCCHC14_uc002fkb.2_Missense_Mutation_p.R154P	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	378					cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GGGGGGCACTCGAGCCACACC	0.627													4	2	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48741530	48741530	+	Intron	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48741530G>C	uc002isl.2	+						ABCC3_uc002isk.3_Intron|ABCC3_uc002ism.2_3'UTR	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	GAAGTGGCAAGAGAGGATTAT	0.348													17	70	---	---	---	---	PASS
METTL2A	339175	broad.mit.edu	37	17	60526184	60526184	+	3'UTR	SNP	T	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60526184T>C	uc002izv.2	+	9					METTL2A_uc002izw.2_3'UTR	NM_181725	NP_859076	Q96IZ6	MTL2A_HUMAN	methyltransferase like 2A								methyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			atgcctgtaatcccagccact	0.174													15	26	---	---	---	---	PASS
CSH2	1443	broad.mit.edu	37	17	61950978	61950978	+	5'UTR	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61950978C>A	uc002jch.2	-	1					CSH2_uc002jcg.2_5'UTR|CSH2_uc002jci.2_5'UTR|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						CAGCCATTGCCGCTAGGTGAG	0.602													11	103	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64239269	64239269	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64239269G>A	uc002lkc.1	-	2	311	c.173C>T	c.(172-174)ACG>ATG	p.T58M	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.T58M|CDH19_uc002lkd.2_Missense_Mutation_p.T58M	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	58	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				ATGACTAGTCGTATTCATTTC	0.373													21	109	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12543983	12543983	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12543983A>C	uc002mtu.2	-	2	230	c.32T>G	c.(31-33)GTG>GGG	p.V11G		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	11	KRAB.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						GGTGAAGTTCACAGCCACATC	0.468													15	70	---	---	---	---	PASS
C19orf57	79173	broad.mit.edu	37	19	14015677	14015677	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14015677G>A	uc002mxl.1	-	2	88	c.29C>T	c.(28-30)TCA>TTA	p.S10L	CC2D1A_uc002mxn.2_5'Flank|CC2D1A_uc002mxo.2_5'Flank|CC2D1A_uc002mxp.2_5'Flank|C19orf57_uc002mxm.1_Missense_Mutation_p.S10L	NM_024323	NP_077299	Q0VDD7	CS057_HUMAN	hypothetical protein LOC79173	10					multicellular organismal development		protein binding			ovary(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			GAACGTACCTGAGGTCCGCAG	0.413													27	155	---	---	---	---	PASS
HAPLN4	404037	broad.mit.edu	37	19	19371864	19371864	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19371864C>T	uc002nmb.2	-	3	297	c.242G>A	c.(241-243)GGC>GAC	p.G81D	HAPLN4_uc002nmc.2_Missense_Mutation_p.G81D	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	81	Ig-like C2-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			GAGCCGGACGCCGTCGTGACC	0.667													9	49	---	---	---	---	PASS
FAM98C	147965	broad.mit.edu	37	19	38895746	38895746	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38895746A>T	uc002oin.1	+	4	567	c.548A>T	c.(547-549)CAT>CTT	p.H183L	FAM98C_uc002oio.1_Missense_Mutation_p.H183L|FAM98C_uc010xtz.1_Intron	NM_174905	NP_777565	Q17RN3	FA98C_HUMAN	hypothetical protein LOC147965	183										skin(1)	1	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGGAGTTGCATGCTAAGGTA	0.627													16	66	---	---	---	---	PASS
KLK13	26085	broad.mit.edu	37	19	51567954	51567954	+	Intron	SNP	A	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51567954A>G	uc002pvn.2	-						KLK13_uc002pvl.2_RNA|KLK13_uc002pvm.2_RNA|KLK13_uc002pvo.2_Intron|KLK13_uc002pvp.2_Intron|KLK13_uc010eon.2_Intron|KLK13_uc002pvq.2_Intron|KLK13_uc010eoo.2_Intron|KLK13_uc002pvr.2_Intron	NM_015596	NP_056411	Q9UKR3	KLK13_HUMAN	kallikrein 13 precursor						proteolysis		protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		ctgctaggctactggctcaaa	0.139													2	8	---	---	---	---	PASS
BFSP1	631	broad.mit.edu	37	20	17475376	17475376	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17475376C>A	uc002wpo.2	-	8	1380	c.1341G>T	c.(1339-1341)AAG>AAT	p.K447N	BFSP1_uc002wpp.2_Missense_Mutation_p.K322N|BFSP1_uc010zrn.1_Missense_Mutation_p.K308N|BFSP1_uc010zro.1_Missense_Mutation_p.K308N	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	447	Tail.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						TCTCCTTGACCTTCCTGTATA	0.527													35	217	---	---	---	---	PASS
RAE1	8480	broad.mit.edu	37	20	55948566	55948566	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55948566C>G	uc002xyg.2	+	9	1019	c.678C>G	c.(676-678)AAC>AAG	p.N226K	RAE1_uc010gis.1_Missense_Mutation_p.N179K|RAE1_uc010git.1_Missense_Mutation_p.N226K|RAE1_uc002xyh.2_Missense_Mutation_p.N226K|RAE1_uc002xyi.2_Missense_Mutation_p.N226K	NM_003610	NP_003601	P78406	RAE1L_HUMAN	RAE1 (RNA export 1, S.pombe) homolog	226					carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			ACAAACAGAACAAGCCTACTG	0.408													24	176	---	---	---	---	PASS
SRRD	402055	broad.mit.edu	37	22	26884148	26884148	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26884148G>C	uc010gve.2	+	3	411	c.404G>C	c.(403-405)GGA>GCA	p.G135A	SRRD_uc003acp.3_Missense_Mutation_p.G128A	NM_001013694	NP_001013716	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	135					rhythmic process						0						TTGGTCACAGGAACCTGCCAT	0.468													52	210	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31667167	31667167	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31667167C>A	uc003akh.2	+	12	1508	c.1363C>A	c.(1363-1365)CAC>AAC	p.H455N	LIMK2_uc003akg.2_Missense_Mutation_p.H372N|LIMK2_uc003aki.2_Missense_Mutation_p.H209N|LIMK2_uc003akj.2_Missense_Mutation_p.H434N|LIMK2_uc003akk.2_Missense_Mutation_p.H434N|LIMK2_uc011aln.1_Missense_Mutation_p.H372N	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	455	Protein kinase.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						TCTGAACTCGCACAACTGCCT	0.542													29	158	---	---	---	---	PASS
NLGN4X	57502	broad.mit.edu	37	X	5821237	5821237	+	Silent	SNP	G	C	C	rs146227486		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5821237G>C	uc010ndh.2	-	5	1983	c.1482C>G	c.(1480-1482)CCC>CCG	p.P494P	NLGN4X_uc004crp.2_Silent_p.P514P|NLGN4X_uc004crq.2_Silent_p.P494P|NLGN4X_uc010ndi.2_Silent_p.P531P|NLGN4X_uc004crr.2_Silent_p.P494P|NLGN4X_uc010ndj.2_Silent_p.P494P	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	494	Extracellular (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4						CGAAGACATAGGGGACCTCAT	0.552													11	72	---	---	---	---	PASS
GAB3	139716	broad.mit.edu	37	X	153940643	153940643	+	Silent	SNP	G	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153940643G>C	uc004fmj.1	-	4	975	c.927C>G	c.(925-927)CCC>CCG	p.P309P	GAB3_uc004fmk.1_Silent_p.P310P|GAB3_uc010nve.1_Silent_p.P310P|GAB3_uc004fml.1_Intron	NM_080612	NP_542179	Q8WWW8	GAB3_HUMAN	Gab3 protein isoform 2	309										ovary(1)	1	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TAGGGGGGCGGGGAGGTGGAG	0.488													17	164	---	---	---	---	PASS
KDM1A	23028	broad.mit.edu	37	1	23408924	23408924	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23408924delT	uc001bgi.2	+						KDM1A_uc001bgj.2_Intron	NM_015013	NP_055828	O60341	KDM1A_HUMAN	lysine-specific histone demethylase 1 isoform b						blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2						ATGTCCCTGATTTTTTTTTTT	0.443													35	9	---	---	---	---	
SFRS4	6429	broad.mit.edu	37	1	29475219	29475221	+	In_Frame_Del	DEL	CTT	-	-	rs138237342	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29475219_29475221delCTT	uc001bro.2	-	6	1559_1561	c.1186_1188delAAG	c.(1186-1188)AAGdel	p.K396del	SFRS4_uc010ofy.1_3'UTR	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4	396	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		CAGTGTCTTCCTTCTTCTTCTTC	0.325													329	10	---	---	---	---	
MYSM1	114803	broad.mit.edu	37	1	59148352	59148365	+	Intron	DEL	CTTTTCTTTTTTTT	-	-	rs72078164		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59148352_59148365delCTTTTCTTTTTTTT	uc009wab.1	-						MYSM1_uc001czc.2_Intron	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					CTCTAATGCGCTTTTCttttttttcttttctttt	0.131													9	4	---	---	---	---	
SFRS11	9295	broad.mit.edu	37	1	70687370	70687371	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70687370_70687371insG	uc001des.2	+	2	175_176	c.51_52insG	c.(49-54)GGCGGGfs	p.G17fs	SFRS11_uc009wbi.2_Frame_Shift_Ins_p.G17fs|SFRS11_uc009wbj.1_Frame_Shift_Ins_p.G17fs|SFRS11_uc010oqo.1_Frame_Shift_Ins_p.G17fs|SFRS11_uc001det.2_Frame_Shift_Ins_p.G17fs|SFRS11_uc001deu.2_Frame_Shift_Ins_p.G17fs	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	17_18	Poly-Gly.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						GCCCCAGCGGCGGGCCcggtgg	0.495													351	8	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													9	4	---	---	---	---	
SCNM1	79005	broad.mit.edu	37	1	151139074	151139074	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151139074delT	uc001ewz.2	+						LYSMD1_uc001ewy.2_5'Flank|LYSMD1_uc010pcr.1_5'Flank|SCNM1_uc010pcs.1_Intron|SCNM1_uc009wmn.2_Intron	NM_024041	NP_076946	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTCAATAGACTTttttttttt	0.269													24	7	---	---	---	---	
PLA2G4A	5321	broad.mit.edu	37	1	186934533	186934533	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186934533delT	uc001gsc.2	+						PLA2G4A_uc010pos.1_Intron	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA						phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	TTCTTTTATGTTTTTAAGATC	0.318													65	21	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	216742453	216742454	+	Intron	INS	-	GAAG	GAAG	rs56064287		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216742453_216742454insGAAG	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	gaaggaaggaagaaggaaggaa	0.000													3	3	---	---	---	---	
CEP170	9859	broad.mit.edu	37	1	243332885	243332886	+	Intron	DEL	AG	-	-	rs140816120		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243332885_243332886delAG	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			aaatggagaaagagaagaaaaa	0.218													2	6	---	---	---	---	
ZNF124	7678	broad.mit.edu	37	1	247323280	247323281	+	Intron	DEL	TC	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247323280_247323281delTC	uc001ick.2	-						ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_Intron	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			ACATAGCAGttctttttttttt	0.183													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89399858	89399859	+	Intron	INS	-	AA	AA			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89399858_89399859insAA	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GATTCCTGCACAGTCTGACCAG	0.569													7	4	---	---	---	---	
SLC20A1	6574	broad.mit.edu	37	2	113420507	113420507	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113420507delA	uc002tib.2	+	11	2391	c.1945delA	c.(1945-1947)AACfs	p.N649fs		NM_005415	NP_005406	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate	649	Extracellular (Potential).				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2						TCTCTTTCGTAACATTTTTAT	0.478													238	37	---	---	---	---	
ZRANB3	84083	broad.mit.edu	37	2	136148395	136148395	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136148395delA	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		ATACACCTGGaaaaaaaaaaa	0.204													9	4	---	---	---	---	
GPR155	151556	broad.mit.edu	37	2	175300751	175300754	+	3'UTR	DEL	TTGC	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175300751_175300754delTTGC	uc002uit.2	-	17					GPR155_uc002uiu.2_3'UTR|GPR155_uc002uiv.2_3'UTR|GPR155_uc010fqs.2_3'UTR	NM_001033045	NP_001028217	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1						ctcagagaggttgcctctgttaac	0.132													45	7	---	---	---	---	
DFNB59	494513	broad.mit.edu	37	2	179322311	179322312	+	Intron	INS	-	GGTCCCTCCCACC	GGTCCCTCCCACC	rs143243913	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179322311_179322312insGGTCCCTCCCACC	uc002umi.3	+						DFNB59_uc002umj.3_Intron	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59						sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TGAAAAGCCGTGCTTTTGTGCT	0.436													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGTGATCTTCTGC	0.577													11	5	---	---	---	---	
GRM7	2917	broad.mit.edu	37	3	7621013	7621013	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7621013delT	uc003bqm.2	+	8	2694	c.2420delT	c.(2419-2421)ATTfs	p.I807fs	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Frame_Shift_Del_p.I807fs|GRM7_uc003bql.2_Frame_Shift_Del_p.I807fs|GRM7_uc003bqn.1_Frame_Shift_Del_p.I390fs|GRM7_uc010hch.1_Frame_Shift_Del_p.I318fs	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	807	Helical; Name=6; (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	TTCATTCCAATTTTTTTTGGC	0.383													61	11	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41288555	41288556	+	Intron	INS	-	C	C	rs143939899	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41288555_41288556insC	uc003ckv.3	-						ULK4_uc003cku.3_Intron	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TTTCAAAGGGGCCAGCCTCTTT	0.525													2	8	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106824710	106824710	+	Intron	DEL	T	-	-	rs139188639		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106824710delT	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						tttttatatcttttttttttt	0.199													4	2	---	---	---	---	
ALDH1L1	10840	broad.mit.edu	37	3	125878066	125878067	+	Intron	DEL	CA	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125878066_125878067delCA	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Intron|ALDH1L1_uc003eip.1_5'Flank|ALDH1L1_uc011bkj.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	cacatgcgtgcacacacacaca	0.000													4	2	---	---	---	---	
ATR	545	broad.mit.edu	37	3	142231081	142231081	+	Intron	DEL	G	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142231081delG	uc003eux.3	-							NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						AAAAAAAAAAGAAACAGAAGT	0.333								Other_conserved_DNA_damage_response_genes					147	7	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		ccttcgttccttcgttccttcctt	0.039			T	HMGA2|MLL|C12orf9	lipoma|leukemia								6	4	---	---	---	---	
TM4SF19	116211	broad.mit.edu	37	3	196051088	196051089	+	Intron	DEL	TC	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196051088_196051089delTC	uc003fwj.2	-						uc003fwk.1_3'UTR|TM4SF19_uc010iad.1_Intron|TM4SF19_uc003fwl.1_Intron|TM4SF19_uc011btv.1_Intron	NM_138461		Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TGTCTTTTTGTCTCTCTCTCTC	0.455													87	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	69242368	69242369	+	IGR	DEL	AA	-	-	rs34520796		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69242368_69242369delAA								YTHDC1 (26544 upstream) : UGT2B15 (269947 downstream)																							CTTTGACTTGAAAAAAAAAAAA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120314212	120314212	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120314212delA	uc003icx.1	+											Homo sapiens cDNA FLJ40382 fis, clone TESTI2035775.																		TGTGGATGTTAAAAAAAAAAA	0.338													4	2	---	---	---	---	
RNF175	285533	broad.mit.edu	37	4	154633581	154633581	+	Intron	DEL	A	-	-	rs33952548		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154633581delA	uc003int.2	-							NM_173662	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				ATATCCCCAGAAACATTCAAG	0.318													6	12	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	49962737	49962738	+	Intron	INS	-	CCT	CCT	rs151280834	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49962737_49962738insCCT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_5'Flank|PARP8_uc003jop.2_5'Flank	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GCCGAcctccccctcctcctcc	0.450													5	6	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137897634	137897634	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137897634delT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron|SNORD63_uc003ldg.2_5'Flank	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAAGAATACttttttttttt	0.174													5	4	---	---	---	---	
HIST1H2BG	8339	broad.mit.edu	37	6	26216797	26216799	+	In_Frame_Del	DEL	CTT	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26216797_26216799delCTT	uc003ngz.2	-	1	74_76	c.73_75delAAG	c.(73-75)AAGdel	p.K25del	HIST1H2AE_uc003nha.1_5'Flank	NM_003518	NP_003509	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	25					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1		all_hematologic(11;0.196)				TCTTGCCATCCTTCTTCTGCGCC	0.517													352	9	---	---	---	---	
STK19	8859	broad.mit.edu	37	6	31939825	31939826	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31939825_31939826insG	uc003nyv.2	+	1	180_181	c.52_53insG	c.(52-54)CGGfs	p.R18fs	DOM3Z_uc003nyo.1_5'UTR|DOM3Z_uc003nyp.1_5'UTR|DOM3Z_uc003nyq.1_5'UTR|DOM3Z_uc003nyr.1_5'UTR|DOM3Z_uc003nys.1_5'Flank|DOM3Z_uc010jtl.1_5'UTR|STK19_uc003nyt.2_5'UTR|DOM3Z_uc003nyu.1_5'UTR|STK19_uc011dow.1_Frame_Shift_Ins_p.R18fs|STK19_uc011dox.1_5'UTR|STK19_uc003nyw.2_Frame_Shift_Ins_p.R18fs|STK19_uc010jtn.1_5'Flank	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	18						nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4						GCGACAGTGGCGGGCAAACCCC	0.634													308	8	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57499078	57499078	+	Intron	DEL	G	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57499078delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTGTCTTTTGTTACTGTGTC	0.169													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747283	134747286	+	IGR	DEL	TCTT	-	-	rs67886112		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747283_134747286delTCTT								SGK1 (108087 upstream) : ALDH8A1 (491243 downstream)																							tccctctccctctttctttctttc	0.034													5	4	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1040074	1040075	+	Intron	INS	-	G	G	rs146570421	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1040074_1040075insG	uc003sju.2	-						C7orf50_uc003sjs.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		CCTCAGCCCCCAGGAGACGTGC	0.673													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	29729590	29729591	+	Intron	INS	-	AC	AC			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29729590_29729591insAC	uc003tah.1	+											Homo sapiens DPY-19-like 2 pseudogene 3 (DPY19L2P3) pseudogene mRNA, complete sequence.																		tGTGTTTGCATACACACACACA	0.267													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													5	5	---	---	---	---	
ARF5	381	broad.mit.edu	37	7	127230390	127230390	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127230390delT	uc003vmb.1	+						FSCN3_uc003vmc.1_5'Flank	NM_001662	NP_001653	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1						ttgtcttgtcttttttttttt	0.174													4	2	---	---	---	---	
WHSC1L1	54904	broad.mit.edu	37	8	38195824	38195824	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38195824delA	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			tctcaaaaagaaaaaaaaaaa	0.139			T	NUP98	AML								3	3	---	---	---	---	
TRPA1	8989	broad.mit.edu	37	8	72936093	72936099	+	Frame_Shift_Del	DEL	ATTTGGT	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72936093_72936099delATTTGGT	uc003xza.2	-	26	3274_3280	c.3099_3105delACCAAAT	c.(3097-3105)ATACCAAATfs	p.I1033fs	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	1033_1035	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	ATTTATCAGCATTTGGTATTTCTTGTC	0.266													109	11	---	---	---	---	
ANGPT1	284	broad.mit.edu	37	8	108348408	108348408	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108348408delT	uc003ymn.2	-	3	1013	c.545delA	c.(544-546)AATfs	p.N182fs	ANGPT1_uc011lhv.1_Translation_Start_Site|ANGPT1_uc003ymo.2_Frame_Shift_Del_p.N182fs	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	182	Potential.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			CAAGATTTCATTTGTCTGTTG	0.363													115	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33617692	33617703	+	5'Flank	DEL	GGATGTAACACG	-	-	rs113178723		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33617692_33617703delGGATGTAACACG	uc003ztf.1	+											Homo sapiens patient CS-1 clone 1 T cell receptor beta chain CDR3 (TCRB) mRNA, partial cds.																		GCAGAGAGATGGATGTAACACGGGTCATGAGC	0.349											OREG0019139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	65577178	65577178	+	IGR	DEL	G	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:65577178delG								FAM74A4 (82792 upstream) : LOC442421 (919292 downstream)																							GGAAAACTTTGtttttttttt	0.383													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68344276	68344279	+	IGR	DEL	AAGG	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68344276_68344279delAAGG								FAM27B (550087 upstream) : MIR1299 (657960 downstream)																							agttacaataaaggaaggaaggaa	0.093													4	2	---	---	---	---	
MAPKAP1	79109	broad.mit.edu	37	9	128305260	128305261	+	Intron	DEL	CA	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128305260_128305261delCA	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						AGCCAGCCATCACACACACACA	0.436													182	8	---	---	---	---	
ZER1	10444	broad.mit.edu	37	9	131515228	131515229	+	Intron	INS	-	C	C			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131515228_131515229insC	uc004bwa.1	-							NM_006336	NP_006327	Q7Z7L7	ZER1_HUMAN	zyg-11 homolog B (C. elegans)-like						ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1						GAGGGCCCATTCCTGCCACAAC	0.564													34	7	---	---	---	---	
NOXA1	10811	broad.mit.edu	37	9	140320927	140320928	+	Intron	INS	-	GGGTC	GGGTC	rs145312088	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140320927_140320928insGGGTC	uc004cmv.2	+						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Intron|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1						regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CAGGGAAACCTGAGACTGTGGC	0.426													4	2	---	---	---	---	
DCLRE1C	64421	broad.mit.edu	37	10	14968657	14968657	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14968657delA	uc001inn.2	-						DCLRE1C_uc010qbx.1_Intron|DCLRE1C_uc001ink.2_5'Flank|DCLRE1C_uc001inl.2_Intron|DCLRE1C_uc009xji.2_Intron|DCLRE1C_uc001inm.2_Intron|DCLRE1C_uc001ino.2_Intron|DCLRE1C_uc009xjh.2_Intron|DCLRE1C_uc001inp.2_Intron|DCLRE1C_uc001inq.2_Intron|DCLRE1C_uc001inr.2_Intron|DCLRE1C_uc009xjj.1_Intron	NM_001033855	NP_001029027	Q96SD1	DCR1C_HUMAN	artemis protein isoform a						DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)	1						tgtctcaaccaaaaaaaaaaa	0.075								Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ					3	3	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61819088	61819089	+	Intron	INS	-	C	C	rs144642230	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61819088_61819089insC	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTTTTTTGAAACAGCCATACCT	0.401													225	14	---	---	---	---	
RTKN2	219790	broad.mit.edu	37	10	64005582	64005583	+	Intron	INS	-	A	A	rs145698745	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64005582_64005583insA	uc001jlw.2	-						RTKN2_uc001jlx.2_Intron	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2						signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					tcttaaactctaaagttctata	0.129													9	10	---	---	---	---	
SEC23IP	11196	broad.mit.edu	37	10	121691448	121691448	+	Intron	DEL	A	-	-	rs77894008		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121691448delA	uc001leu.1	+						SEC23IP_uc010qtc.1_Intron|SEC23IP_uc009xzk.1_Intron	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125						Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TTTAGTCATTAAAAAAAAAAG	0.303													5	4	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2441291	2441311	+	Intron	DEL	GGCCCCCACGGCCCAGGTCTC	-	-	rs147399841		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2441291_2441311delGGCCCCCACGGCCCAGGTCTC	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CCACGGCCCAGGCCCCCACGGCCCAGGTCTCGGTGCTCAGG	0.683													3	11	---	---	---	---	
SWAP70	23075	broad.mit.edu	37	11	9735198	9735199	+	Intron	INS	-	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9735198_9735199insT	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TAAGGTGTGGCTTGGGGAGTTT	0.347													438	7	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132306683	132306684	+	Intron	DEL	AC	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132306683_132306684delAC	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TCTGTGGGAAacacacacacac	0.381													101	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16879340	16879350	+	IGR	DEL	TCCTTCCTTCC	-	-	rs71953318		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16879340_16879350delTCCTTCCTTCC								LMO3 (116582 upstream) : None (None downstream)																							cttccttccttccttccttccttccttcctt	0.175													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24737258	24737263	+	5'Flank	DEL	CCCCCA	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737258_24737263delCCCCCA	uc001rgb.1	-											Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																		CTTCGATTAGcccccacccccacccc	0.432													4	2	---	---	---	---	
C12orf52	84934	broad.mit.edu	37	12	113629261	113629262	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113629261_113629262insT	uc001tur.1	+	4	917_918	c.449_450insT	c.(448-450)GGTfs	p.G150fs	C12orf52_uc009zwg.1_Frame_Shift_Ins_p.G147fs|C12orf52_uc001tus.1_Frame_Shift_Ins_p.G150fs|C12orf52_uc001tut.1_Frame_Shift_Ins_p.G174fs	NM_032848	NP_116237	Q96K30	RITA_HUMAN	hypothetical protein LOC84934	150	Interaction with RBPJ/RBPSUH.				negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|neurogenesis|Notch signaling pathway|nuclear export	centrosome|nucleus	tubulin binding				0						ACCCCCAGGGGTAGCCACTCGC	0.678													63	8	---	---	---	---	
ING1	3621	broad.mit.edu	37	13	111367630	111367630	+	5'UTR	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111367630delA	uc001vri.2	+	1					CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D						cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGTGGGGGCAAAAAAAAAAA	0.517													4	3	---	---	---	---	
PRPF39	55015	broad.mit.edu	37	14	45584161	45584163	+	3'UTR	DEL	ATT	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45584161_45584163delATT	uc001wvz.3	+	14					PRPF39_uc001wvy.3_3'UTR|PRPF39_uc010and.2_3'UTR|PRPF39_uc001wwa.1_3'UTR	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog						mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						AAAGTATGAAATTATTATTTTTT	0.320													71	10	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106725714	106725715	+	Intron	INS	-	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106725714_106725715insG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ATCCCAGGGCTGGGCTCCTCTC	0.500													142	9	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106774086	106774087	+	Splice_Site	INS	-	AGTAATACACGGCA	AGTAATACACGGCA			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106774086_106774087insAGTAATACACGGCA	uc010tyt.1	-	430		c.15674_splice	c.e430+1							Parts of antibodies, mostly variable regions.												0						GCCTCTTGCACGTGTCCTCAGC	0.550													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23098652	23098655	+	Intron	DEL	TTCT	-	-	rs3057778		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23098652_23098655delTTCT	uc001yvf.2	-											Homo sapiens cDNA clone IMAGE:5275816.																		tgagtcctacttctctctccatct	0.211													9	9	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23331163	23331163	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23331163delA	uc001yvr.2	-						HERC2P2_uc010ayf.1_Intron					RecName: Full=Putative HERC2-like protein 3;												0						AATAAATACTAAAAAAAAAAA	0.368													9	5	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99459491	99459491	+	Intron	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99459491delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron|IGF1R_uc010urr.1_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TATCTTCTGGttttttttttt	0.224													5	3	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11064866	11064866	+	Intron	DEL	T	-	-	rs71404430		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11064866delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						ATTGGCAACATTTTTTTTTTT	0.428													4	3	---	---	---	---	
CCDC102A	92922	broad.mit.edu	37	16	57546593	57546594	+	3'UTR	INS	-	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57546593_57546594insG	uc002elw.2	-	9						NM_033212	NP_149989	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A											ovary(1)	1						TTTGAGTGGCTGGTTAGCCTGG	0.619													253	7	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70564867	70564867	+	Intron	DEL	T	-	-	rs74711427		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70564867delT	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				CACCTCAGTGTTTTTTTTTAA	0.234													405	11	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2888572	2888573	+	Intron	DEL	TG	-	-	rs146159488		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2888572_2888573delTG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						TAAACAGTGATGTTTTTTTTTT	0.391													7	4	---	---	---	---	
MYBBP1A	10514	broad.mit.edu	37	17	4442658	4442658	+	3'UTR	DEL	T	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4442658delT	uc002fyb.3	-	26					MYBBP1A_uc002fxz.3_Intron|SPNS2_uc002fxx.2_3'UTR|SPNS2_uc002fxy.2_3'UTR|MYBBP1A_uc002fya.3_3'UTR|MYBBP1A_uc010vsa.1_3'UTR	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2						nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						aaaaaaaaaataGGCGTCTCA	0.557													269	8	---	---	---	---	
CHD3	1107	broad.mit.edu	37	17	7801306	7801307	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7801306_7801307insT	uc002gje.2	+	12	2087_2088	c.1937_1938insT	c.(1936-1938)AATfs	p.N646fs	CHD3_uc002gjd.2_Frame_Shift_Ins_p.N705fs|CHD3_uc002gjf.2_Frame_Shift_Ins_p.N646fs|CHD3_uc002gjg.1_Frame_Shift_Ins_p.N474fs	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	646	Chromo 2.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				AAAAAGGGGAATTACCACTATC	0.450													203	29	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20254234	20254235	+	Intron	INS	-	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20254234_20254235insT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AAGAGGAATTGTTTTTTTTTTT	0.248													4	2	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61493196	61493197	+	Intron	INS	-	T	T	rs147536574	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61493196_61493197insT	uc002jal.3	+						TANC2_uc010wpe.1_Intron|TANC2_uc002jao.3_Intron	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						GAAATCAAGTCTAAGTACAATC	0.391													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75921984	75921987	+	IGR	DEL	AAGA	-	-	rs67051242		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921984_75921987delAAGA								FLJ45079 (41815 upstream) : TNRC6C (78331 downstream)																							ggaaggaaggaagaaagaaagaaa	0.235													4	2	---	---	---	---	
IER3IP1	51124	broad.mit.edu	37	18	44682614	44682614	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44682614delA	uc002lcu.2	-							NM_016097	NP_057181	Q9Y5U9	IR3IP_HUMAN	immediate early response 3 interacting protein							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane					0						CTGTAAAGAGAAAAAAAAAAG	0.284													125	8	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48335515	48335527	+	Intron	DEL	AAAAAAAAAAAAA	-	-	rs72245727		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48335515_48335527delAAAAAAAAAAAAA	uc002lew.3	-						MRO_uc010xdn.1_Intron|MRO_uc010dpa.2_Intron|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		actccgtctcaaaaaaaaaaaaaaaaaaaaaaa	0.160													4	3	---	---	---	---	
ST8SIA3	51046	broad.mit.edu	37	18	55021574	55021575	+	Intron	INS	-	A	A			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55021574_55021575insA	uc002lgn.2	+							NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide						glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		CTTTAATGGCTACCTCGGCTTC	0.629													251	7	---	---	---	---	
CYB5A	1528	broad.mit.edu	37	18	71930382	71930382	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71930382delA	uc002lli.2	-						CYB5A_uc002llh.2_Intron	NM_148923	NP_683725	P00167	CYB5_HUMAN	cytochrome b-5 isoform 1						electron transport chain|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	aldo-keto reductase (NADP) activity|cytochrome-c oxidase activity|enzyme binding|heme binding				0		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)			Methoxyflurane(DB01028)	gacctgtctcaaaaaaaaaaa	0.124													5	5	---	---	---	---	
C19orf6	91304	broad.mit.edu	37	19	1014538	1014547	+	Intron	DEL	CGTGATGGGG	-	-	rs143052245		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1014538_1014547delCGTGATGGGG	uc002lqr.1	-						C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Intron	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1							cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGGCCTACGTGATGGGGCGTGATGGGG	0.681													8	8	---	---	---	---	
C19orf35	374872	broad.mit.edu	37	19	2280757	2280776	+	Intron	DEL	CCTGCCGCTCCCTGCACCCA	-	-	rs66905368	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2280757_2280776delCCTGCCGCTCCCTGCACCCA	uc002lvn.2	-						SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872											pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGCAACCTcctgccgctccctgcacccacctgccgctc	0.459													3	4	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4207083	4207084	+	Intron	DEL	TT	-	-	rs67275884		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4207083_4207084delTT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		taatgtttgctttttttttttt	0.000													4	2	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11527832	11527833	+	Intron	INS	-	T	T	rs160523		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11527832_11527833insT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron|RGL3_uc002mrq.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						ttttttttttgttttttttttt	0.252													8	5	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50749368	50749369	+	Intron	INS	-	CTTC	CTTC	rs142068028	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50749368_50749369insCTTC	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tcccttcctttcttccttcctt	0.084													4	2	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50764079	50764080	+	Intron	INS	-	GT	GT	rs140241247	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50764079_50764080insGT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tgtgtgtgcaagtgtgtgtgca	0.094													5	4	---	---	---	---	
ZNF534	147658	broad.mit.edu	37	19	52955323	52955324	+	3'UTR	INS	-	T	T	rs149737151	by1000genomes	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52955323_52955324insT	uc002pzj.1	+	5					ZNF534_uc010epo.1_3'UTR|ZNF578_uc002pzm.2_5'Flank|ZNF578_uc002pzn.2_5'Flank|ZNF578_uc002pzp.3_5'Flank|ZNF578_uc002pzo.1_5'Flank|ZNF578_uc010epp.1_5'Flank			Q76KX8	ZN534_HUMAN	SubName: Full=Putative uncharacterized protein;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAGTACTGCATTTTTTTTTTA	0.277													4	2	---	---	---	---	
ZNF264	9422	broad.mit.edu	37	19	57723318	57723326	+	In_Frame_Del	DEL	AAGCCTTAC	-	-	rs149508999	byFrequency	TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57723318_57723326delAAGCCTTAC	uc002qob.2	+	4	1266_1274	c.853_861delAAGCCTTAC	c.(853-861)AAGCCTTACdel	p.KPY285del		NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264	285_287	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		CAGTGGAGAGAAGCCTTACAAGTGCAATG	0.507													144	14	---	---	---	---	
CDK5RAP1	51654	broad.mit.edu	37	20	31960720	31960720	+	Intron	DEL	T	-	-	rs67566730		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31960720delT	uc010gek.2	-						CDK5RAP1_uc002wyy.2_Intron|CDK5RAP1_uc002wyz.2_Intron|CDK5RAP1_uc002wza.2_Intron|CDK5RAP1_uc010gel.2_Intron|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Intron|CDK5RAP1_uc002wzb.1_5'UTR	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1						brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						GGACATAAACttttttttttt	0.159													4	2	---	---	---	---	
STK4	6789	broad.mit.edu	37	20	43625566	43625569	+	Intron	DEL	TTGA	-	-	rs67595276		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43625566_43625569delTTGA	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron|STK4_uc010ggw.1_Intron	NM_006282	NP_006273	Q13043	STK4_HUMAN	serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)				ATAAAAAAGCTTGATTGATGTTGT	0.373													3	4	---	---	---	---	
PCIF1	63935	broad.mit.edu	37	20	44575249	44575252	+	Intron	DEL	AGTG	-	-	rs72434642		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44575249_44575252delAGTG	uc002xqs.2	+						PCIF1_uc002xqt.2_Intron|PCIF1_uc002xqu.2_5'Flank	NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1							nucleus				skin(1)	1						TGGGTTTCTCAGTGAGTCAGTTCA	0.441													7	5	---	---	---	---	
SLC2A11	66035	broad.mit.edu	37	22	24199261	24199261	+	Intron	DEL	G	-	-	rs71184919		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24199261delG	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_5'UTR|SLC2A11_uc011ajd.1_5'Flank|SLC2A11_uc002zyp.3_5'Flank	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						GTGTGTGTGTGGGGGGGGGGG	0.612													4	2	---	---	---	---	
RFPL3	10738	broad.mit.edu	37	22	32752978	32752979	+	5'Flank	INS	-	G	G			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32752978_32752979insG	uc003amj.2	+						RFPL3_uc010gwn.2_Intron	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1								zinc ion binding			ovary(1)	1						GGCTGGCCTGTGGGTGGGCGAG	0.624													17	8	---	---	---	---	
RPS6KA3	6197	broad.mit.edu	37	X	20204678	20204679	+	Intron	INS	-	T	T			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20204678_20204679insT	uc004czu.2	-						RPS6KA3_uc011mjk.1_Intron|RPS6KA3_uc004czv.2_Intron|RPS6KA3_uc011mjl.1_Intron|RPS6KA3_uc011mjm.1_Intron	NM_004586	NP_004577	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						GAGCTATACAGTTTTTTTTTTT	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48156079	48156079	+	Intron	DEL	A	-	-	rs72033452		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48156079delA	uc010nib.1	-							NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		agaatccgtcaaaaaaaaaaa	0.184													5	3	---	---	---	---	
TEX11	56159	broad.mit.edu	37	X	70080912	70080912	+	Intron	DEL	T	-	-	rs11363600		TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70080912delT	uc004dyl.2	-						TEX11_uc004dym.2_Intron	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1								protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					TGTAAAGGCCttttttttttt	0.139													5	3	---	---	---	---	
UTY	7404	broad.mit.edu	37	Y	15470914	15470914	+	Intron	DEL	A	-	-			TCGA-CH-5762-01A-11D-1576-08	TCGA-CH-5762-11A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15470914delA	uc004fsx.1	-						UTY_uc004fsw.1_Intron|UTY_uc004fsy.2_Intron|UTY_uc004fsz.2_Intron	NM_007125	NP_009056	O14607	UTY_HUMAN	tetratricopeptide repeat protein isoform 3						chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CTGAAGAGTGAAAAAAAAAAA	0.333													8	5	---	---	---	---	
