Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16956467	16956467	+	Intron	SNP	A	T	T	rs1762950	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956467A>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						gcaattttttaaatttttagt	0.214													5	14	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16956468	16956468	+	Intron	SNP	A	T	T	rs1762951	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956468A>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						caattttttaaatttttagta	0.219													5	14	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16972068	16972068	+	5'Flank	SNP	A	G	G	rs1360575	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16972068A>G	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|uc001azj.1_5'Flank|MST1P2_uc009vow.2_5'Flank|MST1P2_uc010ocg.1_5'Flank|MST1P2_uc010och.1_5'Flank|MST1P2_uc010oci.1_5'Flank|MST1P2_uc001azk.2_5'Flank|MST1P2_uc001azl.3_5'Flank|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GACAGGTTTCACAACTTCCCG	0.627													5	11	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22178148	22178148	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22178148G>A	uc001bfj.2	-	55	7089	c.7049C>T	c.(7048-7050)TCG>TTG	p.S2350L	HSPG2_uc009vqd.2_Missense_Mutation_p.S2351L	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2350	Ig-like C2-type 9.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CGCCACTTGCGAGGAGGAGGG	0.652													4	111	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54605390	54605390	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54605390C>T	uc001cwv.1	-	4	2001	c.1153G>A	c.(1153-1155)GAA>AAA	p.E385K		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	385						extracellular region				ovary(1)	1						GCCTCCCCTTCGCCCTCAGTG	0.612													40	38	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103544235	103544235	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103544235G>A	uc001dul.2	-	3	785	c.467C>T	c.(466-468)ACT>ATT	p.T156I	COL11A1_uc001dum.2_Missense_Mutation_p.T156I|COL11A1_uc001dun.2_Missense_Mutation_p.T156I|COL11A1_uc009weh.2_Missense_Mutation_p.T156I	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	156	TSP N-terminal.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GATGTTAACAGTTCTGAAGAG	0.338													68	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803734	142803734	+	Intron	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803734C>A	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gttaaataaacaactatggat	0.000													5	21	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148346958	148346958	+	5'Flank	SNP	A	G	G	rs613569	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148346958A>G	uc001eqe.2	-						LOC200030_uc001eqf.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'UTR|uc010paw.1_5'UTR			Q86T75	NBPFB_HUMAN	SubName: Full=cDNA FLJ78770;							cytoplasm					0						AACAAGGTTCAAGGTGCCTCA	0.473													3	16	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156830913	156830913	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156830913C>T	uc001fqh.1	+	1	243	c.187C>T	c.(187-189)CCC>TCC	p.P63S	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc010pht.1_5'Flank|INSRR_uc009wsj.1_5'Flank|NTRK1_uc001fqi.1_Missense_Mutation_p.P63S|NTRK1_uc009wsk.1_Missense_Mutation_p.P63S	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	63	Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CCACCACCTGCCCGGCGCAGA	0.736			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			5	7	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200587742	200587742	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200587742T>G	uc010ppk.1	-	2	549	c.110A>C	c.(109-111)AAG>ACG	p.K37T	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	37	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						CAAATGCAGCTTAAGTCGGCT	0.368													48	161	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202245638	202245638	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202245638C>T	uc001gxu.2	+	5	633	c.633C>T	c.(631-633)AGC>AGT	p.S211S	LGR6_uc001gxv.2_Silent_p.S159S|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_RNA	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	211	LRR 6.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						ATCTCACCAGCCTTGTGGTGC	0.612													12	19	---	---	---	---	PASS
STAMBP	10617	broad.mit.edu	37	2	74072296	74072296	+	Silent	SNP	A	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74072296A>G	uc002sjs.2	+	4	332	c.282A>G	c.(280-282)AAA>AAG	p.K94K	STAMBP_uc002sjt.2_Silent_p.K94K|STAMBP_uc002sju.2_Silent_p.K94K|STAMBP_uc002sjv.2_Silent_p.K94K	NM_201647	NP_964010	O95630	STABP_HUMAN	STAM binding protein	94	Interaction with CHMP3.				JAK-STAT cascade|positive regulation of cell proliferation	early endosome|membrane|nucleus	metal ion binding|metallopeptidase activity|protein binding			ovary(1)|lung(1)|breast(1)|pancreas(1)	4						TGTCTCAGAAATTAAAGGAGA	0.343													41	53	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109382170	109382170	+	Silent	SNP	A	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109382170A>G	uc002tem.3	+	20	5301	c.5175A>G	c.(5173-5175)GAA>GAG	p.E1725E		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1725	RanBP2-type 7.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CTAAGAAGGAAGGACAGTGGG	0.418													6	214	---	---	---	---	PASS
HJURP	55355	broad.mit.edu	37	2	234756069	234756069	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234756069C>G	uc002vvg.2	-	5	442	c.376G>C	c.(376-378)GAA>CAA	p.E126Q	HJURP_uc010znd.1_Intron|HJURP_uc010zne.1_Intron	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	126					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		ACTGACTCTTCCTGGTCTGAC	0.488													7	128	---	---	---	---	PASS
PRR21	643905	broad.mit.edu	37	2	240981472	240981472	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240981472C>A	uc010zod.1	-	1	928	c.928G>T	c.(928-930)GGC>TGC	p.G310C		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	310	Pro-rich.									ovary(1)|skin(1)	2						GACGAAGGGCCGTGGGTGAAG	0.612													5	107	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132441268	132441268	+	5'UTR	SNP	T	C	C	rs13099099	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132441268T>C	uc003epe.1	-	1					NCRNA00119_uc003epg.1_Intron|NPHP3_uc003epf.1_5'UTR|NCRNA00119_uc010htu.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						cgggacggggtggggcagagg	0.428													6	4	---	---	---	---	PASS
MSL2	55167	broad.mit.edu	37	3	135870947	135870947	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135870947T>A	uc003eqx.1	-	2	1509	c.776A>T	c.(775-777)GAT>GTT	p.D259V	MSL2_uc011bmb.1_Missense_Mutation_p.D185V	NM_018133	NP_060603	Q9HCI7	MSL2_HUMAN	ring finger protein 184 isoform 1	259					histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1						AGGTTTTATATCTTCACTGAA	0.448													57	156	---	---	---	---	PASS
PPP2R2C	5522	broad.mit.edu	37	4	6377648	6377648	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6377648G>C	uc003gjc.2	-	4	715	c.345C>G	c.(343-345)ATC>ATG	p.I115M	PPP2R2C_uc003gjb.2_Missense_Mutation_p.I98M|PPP2R2C_uc011bwd.1_Missense_Mutation_p.I108M|PPP2R2C_uc011bwe.1_Missense_Mutation_p.I108M|PPP2R2C_uc003gja.2_Missense_Mutation_p.I115M|PPP2R2C_uc003gjd.1_Missense_Mutation_p.I203M	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein	115	WD 2.				signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						TCCATAATTTGATAGTTTTAT	0.413													10	234	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15569018	15569018	+	Silent	SNP	G	A	A	rs73125627	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15569018G>A	uc010idv.2	+	26	3446	c.3201G>A	c.(3199-3201)TCG>TCA	p.S1067S	CC2D2A_uc003gnx.2_Silent_p.S1018S|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	1067	C2.				cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						AGCAGCCGTCGAGGTCTTCAA	0.423													3	73	---	---	---	---	PASS
MFSD8	256471	broad.mit.edu	37	4	128843022	128843022	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128843022C>G	uc003ifp.2	-	11	1258	c.1095G>C	c.(1093-1095)CAG>CAC	p.Q365H	MFSD8_uc011cgu.1_Missense_Mutation_p.Q320H|MFSD8_uc011cgv.1_Intron|MFSD8_uc011cgw.1_RNA	NM_152778	NP_689991	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing	365	Extracellular (Potential).				cell death|transmembrane transport	integral to membrane|lysosomal membrane				ovary(1)|liver(1)	2						TACCTTCCCACTGTATTTTGG	0.373													30	60	---	---	---	---	PASS
CCL28	56477	broad.mit.edu	37	5	43381809	43381809	+	3'UTR	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43381809C>A	uc003jnu.2	-	3					CCL28_uc003jns.2_Intron|CCL28_uc003jnt.2_Intron|CCL28_uc010ivn.2_3'UTR	NM_148672	NP_683513	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28 precursor						chemotaxis|immune response	extracellular space	chemokine activity			ovary(1)|kidney(1)	2						TTATTGGCTACATTTGCATAC	0.204													4	21	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98192174	98192174	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98192174C>T	uc003knf.2	-	35	5191	c.5043G>A	c.(5041-5043)CAG>CAA	p.Q1681Q	CHD1_uc010jbn.2_Silent_p.Q407Q	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1681					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AAGGAGATCTCTGATCTAGTG	0.443													53	21	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98192340	98192340	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98192340C>G	uc003knf.2	-	35	5025	c.4877G>C	c.(4876-4878)AGA>ACA	p.R1626T	CHD1_uc010jbn.2_Missense_Mutation_p.R352T	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1626					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AGAATGAGATCTATCTTTTAA	0.383													71	18	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553130	140553130	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553130C>T	uc003lit.2	+	1	888	c.714C>T	c.(712-714)AAC>AAT	p.N238N		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	238	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAAATGACAACGCCCCTGATT	0.542													8	131	---	---	---	---	PASS
CCNG1	900	broad.mit.edu	37	5	162868107	162868107	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162868107T>A	uc003lzb.2	+	4	422	c.288T>A	c.(286-288)TGT>TGA	p.C96*	CCNG1_uc011dek.1_5'UTR|CCNG1_uc011del.1_5'UTR|CCNG1_uc003lzc.2_RNA	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1	96					cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		ACCTTGGGTGTGTTGGACTGA	0.368													60	82	---	---	---	---	PASS
CTGF	1490	broad.mit.edu	37	6	132271204	132271204	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132271204C>A	uc003qcz.2	-	4	844	c.638G>T	c.(637-639)TGT>TTT	p.C213F		NM_001901	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor precursor	213	TSP type-1.				cellular lipid metabolic process|DNA replication|epidermis development|regulation of cell growth|response to wounding	plasma membrane|proteinaceous extracellular matrix	heparin binding|insulin-like growth factor binding				0	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCCCATCCCACAGGTCTTGGA	0.587											OREG0017666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	77	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20778650	20778650	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20778650C>T	uc003suw.3	+	15	2123	c.1577C>T	c.(1576-1578)ACG>ATG	p.T526M	ABCB5_uc010kuh.2_Missense_Mutation_p.T971M	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	526	Helical; (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						ATCGGAGAAACGCTCGTTTTG	0.418													27	111	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40039015	40039015	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40039015C>G	uc003thh.3	+	4	2380	c.2098C>G	c.(2098-2100)CGC>GGC	p.R700G	CDK13_uc003thi.3_Missense_Mutation_p.R700G|CDK13_uc011kbf.1_Missense_Mutation_p.R86G	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	700					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						CTGGGGAAAACGCTGCGTGGA	0.358													68	174	---	---	---	---	PASS
ZNF713	349075	broad.mit.edu	37	7	56007656	56007656	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56007656G>T	uc003trc.1	+	4	1288	c.1250G>T	c.(1249-1251)TGT>TTT	p.C417F	ZNF713_uc003tra.1_Missense_Mutation_p.C430F|MRPS17_uc003trb.2_Intron	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	zinc finger protein 713	417					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GAATATAAATGTGAGCAAACT	0.388													105	86	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	82996880	82996880	+	3'UTR	SNP	G	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82996880G>C	uc003uhy.1	-	17						NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTCTTCAAAAGACAGTAGATA	0.393													34	393	---	---	---	---	PASS
SHFM1	7979	broad.mit.edu	37	7	96339204	96339204	+	Splice_Site	SNP	A	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96339204A>T	uc003uoi.2	-	1	1	c.-127_splice	c.e1-1		SHFM1_uc010lfn.1_Splice_Site	NM_006304	NP_006295	P60896	DSS1_HUMAN	split hand/foot malformation type 1						proteolysis	proteasome complex	peptidase activity|protein binding				0	all_cancers(62;4.24e-09)|all_epithelial(64;5.59e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0353)|Lung NSC(181;0.0987)					GGGAAAGAATACGGGAGCAGC	0.527								Direct_reversal_of_damage|Homologous_recombination					6	7	---	---	---	---	PASS
ENTPD4	9583	broad.mit.edu	37	8	23290499	23290499	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23290499C>T	uc003xdl.2	-	13	1955	c.1791G>A	c.(1789-1791)TCG>TCA	p.S597S	ENTPD4_uc011kzu.1_Intron|ENTPD4_uc003xdm.2_Silent_p.S589S	NM_004901	NP_004892	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	597	Cytoplasmic (Potential).				UDP catabolic process	autophagic vacuole membrane|cytoplasmic vesicle|integral to Golgi membrane	uridine-diphosphatase activity			ovary(1)|kidney(1)	2		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GGGCGGCGGCCGAGCTGCTCC	0.647													4	4	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72963064	72963064	+	Silent	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72963064G>A	uc003xza.2	-	15	2029	c.1854C>T	c.(1852-1854)GGC>GGT	p.G618G	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	618	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GACATTTATTGCCTGGAGAAT	0.338													56	108	---	---	---	---	PASS
POU5F1B	5462	broad.mit.edu	37	8	128428780	128428780	+	Silent	SNP	A	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128428780A>C	uc003ysf.2	+	1	924	c.669A>C	c.(667-669)GCA>GCC	p.A223A	uc003ysc.1_Intron|uc003ysd.1_Intron|LOC727677_uc003yse.1_Intron|uc011liu.1_5'Flank	NM_001159542	NP_001153014	Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	223						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TATGCAAAGCAGAAACCCTCA	0.507													17	18	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136573417	136573417	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136573417G>T	uc004cep.3	-	11	1596	c.1462C>A	c.(1462-1464)CTG>ATG	p.L488M	SARDH_uc004ceo.2_Missense_Mutation_p.L488M|SARDH_uc011mdn.1_Missense_Mutation_p.L488M|SARDH_uc011mdo.1_Missense_Mutation_p.L320M	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	488					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		ACCTCGTGCAGCGGGTCTCTC	0.632													12	76	---	---	---	---	PASS
LOC399815	399815	broad.mit.edu	37	10	124657552	124657552	+	3'UTR	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124657552C>A	uc010qua.1	+	6						NR_027282				SubName: Full=cDNA FLJ60030;												0						GAGCTCTCAACATAAACAGTG	0.363													3	43	---	---	---	---	PASS
HIPK3	10114	broad.mit.edu	37	11	33373268	33373268	+	Silent	SNP	T	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33373268T>C	uc001mul.1	+	15	3192	c.2922T>C	c.(2920-2922)CAT>CAC	p.H974H	HIPK3_uc001mum.1_Silent_p.H953H|HIPK3_uc009yjv.1_Silent_p.H953H	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform	974	Required for localization to nuclear speckles (By similarity).				anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						AGGACACTCATGAAAACACAG	0.483													40	139	---	---	---	---	PASS
DAK	26007	broad.mit.edu	37	11	61114098	61114098	+	3'UTR	SNP	A	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61114098A>G	uc001nre.2	+	18						NM_015533	NP_056348	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2						glycerol metabolic process	cytosol	ATP binding|FAD-AMP lyase (cyclizing) activity|glycerone kinase activity|metal ion binding				0						CCCACCCTCTAAGTTGAGCAG	0.592													18	17	---	---	---	---	PASS
ADCY6	112	broad.mit.edu	37	12	49176734	49176734	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49176734G>A	uc001rsh.3	-	1	1144	c.484C>T	c.(484-486)CTC>TTC	p.L162F	ADCY6_uc001rsj.3_Missense_Mutation_p.L162F|ADCY6_uc001rsi.3_Missense_Mutation_p.L162F	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	162	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						ACCGCTGTGAGCAGCACCAGC	0.652													18	24	---	---	---	---	PASS
KRT5	3852	broad.mit.edu	37	12	52908651	52908651	+	3'UTR	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52908651G>T	uc001san.2	-	9						NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5						epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		AACATGGCTTGAGCAACTGCC	0.527													8	34	---	---	---	---	PASS
SP1	6667	broad.mit.edu	37	12	53804756	53804756	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53804756G>A	uc001scw.2	+	6	2187	c.2090G>A	c.(2089-2091)AGG>AAG	p.R697K	SP1_uc010sog.1_Missense_Mutation_p.R690K	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	697	VZV IE62-binding.|C2H2-type 3.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)		CGCTTCATGAGGAGTGACCAC	0.493													143	195	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54903701	54903701	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54903701C>T	uc001sgc.3	+	7	746	c.667C>T	c.(667-669)CGC>TGC	p.R223C	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Missense_Mutation_p.R173C	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	223					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TGAGCAGTGGCGCAGTGCCCA	0.517													10	266	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80658832	80658832	+	IGR	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80658832G>T								PPP1R12A (329597 upstream) : PTPRQ (179294 downstream)																							TTTGCTCCTTGCCACATCTAT	0.493													172	270	---	---	---	---	PASS
TPPP2	122664	broad.mit.edu	37	14	21498804	21498804	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21498804G>A	uc001vzh.2	+	2	252	c.64G>A	c.(64-66)GGC>AGC	p.G22S	NDRG2_uc010tll.1_Intron	NM_173846	NP_776245	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family	22						cytoplasm					0	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ATCAAGCAGTGGCACTGAAAT	0.517													28	36	---	---	---	---	PASS
EGLN3	112399	broad.mit.edu	37	14	34419426	34419426	+	Intron	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34419426G>A	uc001wsa.3	-						EGLN3_uc001wry.2_Intron|EGLN3_uc001wrz.2_Intron|EGLN3_uc001wsb.1_3'UTR	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3						apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	GTTGACTTTCGCTCAGAGGAG	0.512													5	8	---	---	---	---	PASS
EGLN3	112399	broad.mit.edu	37	14	34419427	34419427	+	Intron	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34419427C>A	uc001wsa.3	-						EGLN3_uc001wry.2_Intron|EGLN3_uc001wrz.2_Intron|EGLN3_uc001wsb.1_3'UTR	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3						apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	TTGACTTTCGCTCAGAGGAGC	0.512													5	8	---	---	---	---	PASS
PNMA1	9240	broad.mit.edu	37	14	74180414	74180414	+	5'UTR	SNP	A	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74180414A>C	uc001xor.1	-	1						NM_006029	NP_006020	Q8ND90	PNMA1_HUMAN	paraneoplastic antigen MA1						apoptosis|central nervous system development|inflammatory response to antigenic stimulus|spermatogenesis	cytoplasm|focal adhesion|nucleolus	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		TTAGAACAATACCAGACACTC	0.403													9	45	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55964737	55964737	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55964737C>T	uc002adg.2	-	11	1995	c.1947G>A	c.(1945-1947)CAG>CAA	p.Q649Q	PRTG_uc002adh.2_Silent_p.Q151Q	NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	649	Fibronectin type-III 3.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GCTTGTAGCCCTGAATAGCAG	0.498													45	79	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65780073	65780073	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65780073T>C	uc002aov.2	-	7	2536	c.958A>G	c.(958-960)ATG>GTG	p.M320V	DPP8_uc002aow.2_Missense_Mutation_p.M320V|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.M304V|DPP8_uc002aoy.2_Missense_Mutation_p.M320V|DPP8_uc002aoz.2_Missense_Mutation_p.M304V|DPP8_uc010bhj.2_Missense_Mutation_p.M320V|DPP8_uc002apa.2_Missense_Mutation_p.M217V|DPP8_uc010bhk.1_Missense_Mutation_p.M62V	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	320					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						GTTTCCAACATAGGGGATGTA	0.338													20	247	---	---	---	---	PASS
LCTL	197021	broad.mit.edu	37	15	66853375	66853375	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66853375C>A	uc002aqc.2	-	6	806	c.674G>T	c.(673-675)GGC>GTC	p.G225V	LCTL_uc002aqd.3_Missense_Mutation_p.G52V|LCTL_uc010bhw.2_Intron	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	225	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						CTTGTACAGGCCGGTGCCGCG	0.602													10	103	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72193592	72193592	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72193592G>T	uc002atl.3	-	23	3563	c.3090C>A	c.(3088-3090)TTC>TTA	p.F1030L	MYO9A_uc010biq.2_Missense_Mutation_p.F650L|MYO9A_uc002atn.1_Missense_Mutation_p.F1011L|MYO9A_uc002atk.2_5'Flank|MYO9A_uc002atm.1_5'Flank	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1030	IQ 1.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						GCAAGACCCTGAACCATCGCT	0.453													42	75	---	---	---	---	PASS
FES	2242	broad.mit.edu	37	15	91428783	91428783	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91428783C>A	uc002bpv.2	+	3	451	c.355C>A	c.(355-357)CAG>AAG	p.Q119K	FES_uc010uqj.1_Intron|FES_uc010uqk.1_Missense_Mutation_p.Q101K|FES_uc002bpw.2_RNA|FES_uc010bny.2_Intron|FES_uc002bpx.2_Missense_Mutation_p.Q119K|FES_uc002bpy.2_Intron	NM_002005	NP_001996	P07332	FES_HUMAN	feline sarcoma oncogene isoform 1	119	Important for interaction with membranes containing phosphoinositides.				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CTACAGCGAGCAGTGGCAGCA	0.597													12	17	---	---	---	---	PASS
FAM174B	400451	broad.mit.edu	37	15	93162648	93162648	+	3'UTR	SNP	A	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93162648A>G	uc010boe.2	-	3					FAM174B_uc002bsl.3_RNA	NM_207446	NP_997329	Q3ZCQ3	F174B_HUMAN	hypothetical protein LOC400451							integral to membrane					0						GCAGCTGACCAACTTTCCACA	0.527													19	28	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516581	102516581	+	3'UTR	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516581C>T	uc002cdi.2	+	11					WASH3P_uc002cdl.2_3'UTR|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_3'UTR|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GTGACGGAACCAGCACTGTGT	0.632													3	9	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2503242	2503242	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2503242C>A	uc002cqd.1	+	14	1607	c.1519C>A	c.(1519-1521)CAA>AAA	p.Q507K	CCNF_uc002cqe.1_Missense_Mutation_p.Q199K	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	507					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				GGACTACAGGCAAGTCTCTCT	0.572													9	97	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3778253	3778253	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3778253C>T	uc002cvv.2	-	31	6999	c.6795G>A	c.(6793-6795)GCG>GCA	p.A2265A	CREBBP_uc002cvw.2_Silent_p.A2227A	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	2265					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCATCTGAGCCGCCATCTGGC	0.672			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				29	29	---	---	---	---	PASS
FAM18A	780776	broad.mit.edu	37	16	10868977	10868977	+	Intron	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10868977C>T	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_RNA|FAM18A_uc002dae.1_5'Flank	NM_001079512	NP_001072980	A6NH52	FA18A_HUMAN	hypothetical protein LOC780776							integral to membrane					0						CAGAAGGCGCCCTCACTCCAA	0.552													6	5	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15847364	15847364	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15847364A>C	uc002ddy.2	-	15	1858	c.1751T>G	c.(1750-1752)GTG>GGG	p.V584G	MYH11_uc002ddv.2_Missense_Mutation_p.V591G|MYH11_uc002ddw.2_Missense_Mutation_p.V584G|MYH11_uc002ddx.2_Missense_Mutation_p.V591G|MYH11_uc010bvg.2_Missense_Mutation_p.V416G|MYH11_uc002dea.1_Missense_Mutation_p.V290G	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	584	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						ATTATAGTCCACCTGCCAAGG	0.547			T	CBFB	AML								10	48	---	---	---	---	PASS
ELMO3	79767	broad.mit.edu	37	16	67234423	67234423	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67234423G>A	uc002esa.2	+	6	685	c.642G>A	c.(640-642)TGG>TGA	p.W214*	ELMO3_uc002esb.2_Nonsense_Mutation_p.W197*|ELMO3_uc002esc.2_Nonsense_Mutation_p.W48*	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	161					apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		TGGTGTCCTGGGAGACTCTGA	0.652													3	68	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67305047	67305047	+	Silent	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67305047C>T	uc002esm.2	+	16	2688	c.2625C>T	c.(2623-2625)ACC>ACT	p.T875T	SLC9A5_uc010cee.2_Silent_p.T580T|SLC9A5_uc010vji.1_Silent_p.T379T	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	875					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		AGGACCACACCCATCTCAGCC	0.662													4	31	---	---	---	---	PASS
DHRS13	147015	broad.mit.edu	37	17	27229944	27229944	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27229944C>T	uc002hde.3	-	1	146	c.19G>A	c.(19-21)GGC>AGC	p.G7S	DHRS13_uc002hdd.3_5'UTR|DHRS13_uc010wba.1_Missense_Mutation_p.G7S	NM_144683	NP_653284	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	7						extracellular region	binding|oxidoreductase activity				0	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			AACCCCGCGCCCAGCAGCAGC	0.756													5	12	---	---	---	---	PASS
SPOP	8405	broad.mit.edu	37	17	47696432	47696432	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47696432A>C	uc010dbk.2	-	6	1023	c.391T>G	c.(391-393)TGG>GGG	p.W131G	SPOP_uc002ipb.2_Missense_Mutation_p.W131G|SPOP_uc002ipc.2_Missense_Mutation_p.W131G|SPOP_uc002ipd.2_Missense_Mutation_p.W131G|SPOP_uc002ipe.2_Missense_Mutation_p.W131G|SPOP_uc002ipf.2_Missense_Mutation_p.W131G|SPOP_uc002ipg.2_Missense_Mutation_p.W131G	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein	131	MATH.|Required for nuclear localization.				mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						TTGAATCCCCAGTCTTTGCCT	0.458										Prostate(2;0.17)			139	222	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56083187	56083187	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56083187T>C	uc002ivi.2	-	3	736	c.527A>G	c.(526-528)GAT>GGT	p.D176G	SFRS1_uc002ivj.2_Missense_Mutation_p.D176G	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	176	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		CTTAGTGTTATCCAGTTTTCG	0.403													85	117	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47352677	47352677	+	3'UTR	SNP	A	C	C	rs3208550		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352677A>C	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AAAAATAATGACATAGTTGTG	0.323													3	4	---	---	---	---	PASS
CYP4F3	4051	broad.mit.edu	37	19	15756624	15756624	+	Silent	SNP	C	A	A	rs116936513	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15756624C>A	uc002nbj.2	+	3	344	c.294C>A	c.(292-294)ATC>ATA	p.I98I	CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,	98					leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GGCACGCAATCGTCCGCATCT	0.582													48	75	---	---	---	---	PASS
OR10H3	26532	broad.mit.edu	37	19	15852413	15852413	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15852413G>A	uc010xoq.1	+	1	211	c.211G>A	c.(211-213)GAG>AAG	p.E71K		NM_013938	NP_039226	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTCCATCTCTGAGATTCTGTT	0.498													21	764	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40420067	40420067	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40420067C>T	uc002omp.3	-	6	2935	c.2927G>A	c.(2926-2928)GGC>GAC	p.G976D		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	976	VWFD 2.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACAGTCAGGCCAAAGTCCGT	0.592													37	60	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45858059	45858059	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45858059G>A	uc002pbj.2	-	17	1641	c.1594C>T	c.(1594-1596)CCT>TCT	p.P532S	ERCC2_uc002pbh.2_Missense_Mutation_p.P95S|ERCC2_uc002pbi.2_Missense_Mutation_p.P225S|ERCC2_uc010ejz.2_Missense_Mutation_p.P454S|ERCC2_uc002pbk.2_Missense_Mutation_p.P508S	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	532	Mediates interaction with MMS19.				cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ATGCCATCAGGGACCACAGCG	0.627			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				67	145	---	---	---	---	PASS
ZNF525	170958	broad.mit.edu	37	19	53889471	53889471	+	3'UTR	SNP	A	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53889471A>C	uc010eqn.2	+	4					ZNF525_uc002qbl.2_RNA|ZNF765_uc010ydx.1_Intron	NR_003699				Homo sapiens cDNA FLJ39718 fis, clone SMINT2013695.												0						TGTGTGCTTGACTCTGCTTCT	0.338													6	48	---	---	---	---	PASS
ZFP28	140612	broad.mit.edu	37	19	57065114	57065114	+	Silent	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57065114G>A	uc002qnj.2	+	8	1031	c.960G>A	c.(958-960)GGG>GGA	p.G320G	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	320					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		ATGCTGAAGGGGTAACAGACA	0.403													6	152	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30977078	30977078	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30977078G>C	uc003aij.1	-	9	907	c.833C>G	c.(832-834)GCC>GGC	p.A278G	PES1_uc003aik.1_Missense_Mutation_p.A278G|PES1_uc003ail.1_Missense_Mutation_p.A261G|PES1_uc003aim.1_Missense_Mutation_p.A278G|PES1_uc003ain.1_Missense_Mutation_p.A139G|PES1_uc003aio.1_Missense_Mutation_p.A139G	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	278					cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						GGCACTGAGGGCTGCCAGTTT	0.657													8	27	---	---	---	---	PASS
CACNG2	10369	broad.mit.edu	37	22	36960764	36960764	+	Silent	SNP	G	A	A			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36960764G>A	uc003aps.1	-	4	888	c.606C>T	c.(604-606)ATC>ATT	p.I202I		NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2	202	Helical; (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						TGTGCCGGTCGATAAACATGT	0.622													142	194	---	---	---	---	PASS
KLHL13	90293	broad.mit.edu	37	X	117043609	117043609	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117043609G>T	uc004eql.2	-	5	1083	c.1021C>A	c.(1021-1023)CAC>AAC	p.H341N	KLHL13_uc004eqk.2_Missense_Mutation_p.H290N|KLHL13_uc011mtn.1_Missense_Mutation_p.H181N|KLHL13_uc011mto.1_Missense_Mutation_p.H335N|KLHL13_uc011mtp.1_Missense_Mutation_p.H343N|KLHL13_uc004eqm.2_Missense_Mutation_p.H290N|KLHL13_uc011mtq.1_Missense_Mutation_p.H325N	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	341	Kelch 1.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						GTAACCAAGTGAGTGGTGTCA	0.473													5	150	---	---	---	---	PASS
RAB39B	116442	broad.mit.edu	37	X	154490041	154490041	+	3'UTR	SNP	C	G	G			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154490041C>G	uc004fne.2	-	2						NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATTTCTCTTACTTTTCAGTTC	0.418													27	72	---	---	---	---	PASS
TNFRSF9	3604	broad.mit.edu	37	1	8002099	8002101	+	5'Flank	DEL	AAG	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8002099_8002101delAAG	uc001aot.2	-							NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,						induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		ataaagagaaaaggaggaggagg	0.025													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19314274	19314277	+	IGR	DEL	GAAA	-	-	rs72498264		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19314274_19314277delGAAA								IFFO2 (31448 upstream) : UBR4 (84327 downstream)																							aggaaggaaggaaagaaggaagga	0.191													4	2	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21299378	21299378	+	Intron	DEL	A	-	-	rs76449388		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21299378delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGGGAAGAATAAAAAAAAAAA	0.284													6	3	---	---	---	---	
RAB3B	5865	broad.mit.edu	37	1	52446102	52446102	+	Intron	DEL	A	-	-	rs80211476		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52446102delA	uc001cth.2	-							NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						tgtctctaccaaaaaaaaaaa	0.219													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148015979	148015980	+	Intron	INS	-	AC	AC			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148015979_148015980insAC	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						AAAGATGAAAGacacacacaca	0.337													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148856151	148856151	+	IGR	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148856151delA								NBPF16 (97840 upstream) : LOC645166 (72135 downstream)																							ACAAGAGACCAGGGGGATAGG	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153198550	153198550	+	IGR	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153198550delA								LELP1 (20956 upstream) : LOR (33629 downstream)																							tacttctttcaaaaaaaaatg	0.149													6	4	---	---	---	---	
GPATCH4	54865	broad.mit.edu	37	1	156565503	156565504	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156565503_156565504insT	uc001fpm.2	-	8	668_669	c.629_630insA	c.(628-630)AAGfs	p.K210fs	APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Frame_Shift_Ins_p.K205fs	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	205	Potential.					intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTTCTTTTTCTTTTTTTTGGG	0.535													320	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	176200269	176200270	+	IGR	INS	-	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176200269_176200270insT								RFWD2 (23899 upstream) : PAPPA2 (232037 downstream)																							tcagatatgtctttTTTTTTTT	0.173													4	2	---	---	---	---	
C1orf220	400798	broad.mit.edu	37	1	178514560	178514561	+	5'UTR	INS	-	T	T	rs139120215	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178514560_178514561insT	uc001glx.1	+	2					C1orf49_uc001glv.1_Intron	NM_207467	NP_997350			hypothetical protein LOC400798												0						TTGAAGGTTGATTTTGACTACT	0.381													5	9	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236707828	236707829	+	Intron	INS	-	G	G	rs144740089	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236707828_236707829insG	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTGATTTTAAAGGGTTTTTTTT	0.411													6	3	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236740444	236740445	+	Intron	INS	-	AAAT	AAAT	rs144706824	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236740444_236740445insAAAT	uc001hyd.1	-						HEATR1_uc009xgh.1_Intron	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGAAAAtacacaagagcatact	0.168													4	2	---	---	---	---	
IFT172	26160	broad.mit.edu	37	2	27669365	27669366	+	Intron	INS	-	T	T	rs11430923		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27669365_27669366insT	uc002rku.2	-						IFT172_uc010ezb.2_Intron	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog						cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					CTGGGTCTTAGttttttttttc	0.203													5	3	---	---	---	---	
AHSA2	130872	broad.mit.edu	37	2	61412459	61412459	+	Intron	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61412459delA	uc002sbc.1	+						AHSA2_uc002sbb.1_Intron	NM_152392	NP_689605	Q719I0	AHSA2_HUMAN	AHA1, activator of heat shock 90kDa protein						response to stress	cytoplasm	ATPase activator activity|chaperone binding			breast(1)	1			Epithelial(17;0.0994)			CTCTGGTTCCAAAGTAAAGAC	0.448													20	12	---	---	---	---	
FAM176A	84141	broad.mit.edu	37	2	75745347	75745348	+	Intron	DEL	AT	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75745347_75745348delAT	uc002sni.2	-						FAM176A_uc002snj.1_Intron|FAM176A_uc002snk.1_Intron	NM_001135032	NP_001128504	Q9H8M9	F176A_HUMAN	family with sequence similarity 176, member A						apoptosis|autophagy	endoplasmic reticulum membrane|integral to membrane|lysosomal membrane|plasma membrane					0						GTTTGGGAACATAAAGTGAGTG	0.510													27	14	---	---	---	---	
ACVR1C	130399	broad.mit.edu	37	2	158406515	158406515	+	Intron	DEL	A	-	-	rs151060608		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158406515delA	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Intron	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						attacgtctcaaaaaaaaaaa	0.080													4	2	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166894121	166894124	+	Intron	DEL	GTTT	-	-	rs139551129		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166894121_166894124delGTTT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AATAATCATAGTTTGTTTTTCTTT	0.206													5	5	---	---	---	---	
AZI2	64343	broad.mit.edu	37	3	28379714	28379714	+	Intron	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28379714delA	uc003ceb.2	-						AZI2_uc003cec.2_Intron|AZI2_uc003ced.2_Intron|AZI2_uc003cee.3_Intron|AZI2_uc003ceg.2_Intron|AZI2_uc011axd.1_Intron|AZI2_uc003cef.2_Intron	NM_022461	NP_071906	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2 isoform a							mitochondrion|plasma membrane				ovary(2)	2						TCACTGGCTTAAAAAAAAAAA	0.284													4	2	---	---	---	---	
SCN11A	11280	broad.mit.edu	37	3	38912760	38912761	+	Intron	INS	-	T	T	rs148305784	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38912760_38912761insT	uc011ays.1	-							NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	AGCAGTCAATGAAGTTGCAGAT	0.450													4	5	---	---	---	---	
MAPKAPK3	7867	broad.mit.edu	37	3	50655021	50655042	+	Frame_Shift_Del	DEL	CAGGGGGGCCCTGTGCCCCCGC	-	-	rs149349769	byFrequency	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50655021_50655042delCAGGGGGGCCCTGTGCCCCCGC	uc003day.1	+	4	621_642	c.25_46delCAGGGGGGCCCTGTGCCCCCGC	c.(25-48)CAGGGGGGCCCTGTGCCCCCGCCAfs	p.Q9fs	MAPKAPK3_uc003daz.1_Frame_Shift_Del_p.Q9fs|MAPKAPK3_uc003dba.1_Frame_Shift_Del_p.Q9fs|MAPKAPK3_uc010hlr.1_Frame_Shift_Del_p.Q9fs	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	9_16					activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AGCAGAGGAGCAGGGGGGCCCTGTGCCCCCGCCAGTTGCACC	0.698													68	9	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119128712	119128712	+	Intron	DEL	T	-	-	rs149651758		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119128712delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TGAAAAAAAATTTTTTTTTGA	0.378													1	7	---	---	---	---	
RABL3	285282	broad.mit.edu	37	3	120428430	120428431	+	Intron	INS	-	AGACAAAGCAC	AGACAAAGCAC	rs141684205	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120428430_120428431insAGACAAAGCAC	uc003edx.2	-							NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AGAAACACTTAATGTTTAATGT	0.272													5	5	---	---	---	---	
BCHE	590	broad.mit.edu	37	3	165515095	165515099	+	Intron	DEL	CCCTT	-	-	rs142594104		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165515095_165515099delCCCTT	uc003fem.3	-						BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor						choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	ctccctcccccccttccttccttcc	0.034													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191888074	191888074	+	Intron	DEL	A	-	-	rs11293703		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888074delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gcctcaaaagaaaaaaaaaaa	0.159													11	5	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21227977	21227978	+	Intron	INS	-	GAAG	GAAG	rs72485326		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21227977_21227978insGAAG	uc003gqf.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_147183	NP_671712	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 4							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				gagaaggaagagaaggaaggaa	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32779983	32779984	+	IGR	INS	-	CTTTCTTTCTT	CTTTCTTTCTT	rs138164136	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32779983_32779984insCTTTCTTTCTT								None (None upstream) : None (None downstream)																							ttccttccttccttTCTttctt	0.005													4	3	---	---	---	---	
TMEM165	55858	broad.mit.edu	37	4	56262481	56262481	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56262481delG	uc003hax.2	+	1	392	c.125delG	c.(124-126)CGGfs	p.R42fs	TMEM165_uc011bzy.1_5'UTR	NM_018475	NP_060945	Q9HC07	TM165_HUMAN	transmembrane protein 165	42						integral to membrane					0	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			CTTAGCCACCGGAACAAAGAA	0.532													5	3	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243419	120243420	+	5'Flank	INS	-	TT	TT	rs151066719	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243419_120243420insTT	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						AATTCTTATTAATTAATTCTTA	0.287													4	2	---	---	---	---	
RAD50	10111	broad.mit.edu	37	5	131973204	131973205	+	Intron	INS	-	T	T	rs140387335	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131973204_131973205insT	uc003kxi.2	+						RAD50_uc003kxh.2_Intron	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAGGAAACTCttttttttttc	0.183								Homologous_recombination					3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	Splice_Site	INS	-	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512916_57512917insT	uc003pdx.2	+	16	1839	c.1752_splice	c.e16+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.000													4	4	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	137019612	137019612	+	Intron	DEL	T	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137019612delT	uc003qhc.2	-						MAP3K5_uc011edk.1_Intron|MAP3K5_uc010kgw.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AATGGCATTATTAATTAAACT	0.378													52	25	---	---	---	---	
LRP11	84918	broad.mit.edu	37	6	150173960	150173961	+	Intron	DEL	CT	-	-	rs142047967		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150173960_150173961delCT	uc003qng.2	-						LRP11_uc003qnh.1_Intron	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein							integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		TTGCTGCTCACTCTCAGCAGAA	0.421													3	5	---	---	---	---	
DAGLB	221955	broad.mit.edu	37	7	6469934	6469935	+	Intron	DEL	GA	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6469934_6469935delGA	uc003sqa.2	-						DAGLB_uc011jwt.1_Intron|DAGLB_uc011jwu.1_Intron|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GGGAGGGAGGGAGAGAGagaga	0.134													7	4	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8196560	8196578	+	Intron	DEL	AAAAAAAAAAAAAAAAAAA	-	-	rs71014766		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8196560_8196578delAAAAAAAAAAAAAAAAAAA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		CTGATGCAGTaaaaaaaaaaaaaaaaaaaaaaaaagaaa	0.347													12	6	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11109307	11109308	+	Intron	INS	-	CCTT	CCTT			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11109307_11109308insCCTT	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ccctccctttcccttccttccT	0.114													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65888170	65888170	+	IGR	DEL	A	-	-	rs147935079		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65888170delA								NCRNA00174 (22775 upstream) : LOC493754 (105276 downstream)																							TATTCAGAGCAAAAAAAAAAA	0.343													4	2	---	---	---	---	
MYOM2	9172	broad.mit.edu	37	8	2026738	2026738	+	Intron	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2026738delA	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GTGTGTGCATATATGCATATA	0.318													12	36	---	---	---	---	
RAB11FIP1	80223	broad.mit.edu	37	8	37720396	37720397	+	3'UTR	INS	-	T	T			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37720396_37720397insT	uc003xkm.1	-	6					RAB11FIP1_uc010lvz.1_3'UTR|RAB11FIP1_uc003xkn.1_3'UTR|RAB11FIP1_uc003xkl.1_3'UTR	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3						protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ACGTCTCGGTGTTTTTTTTCTG	0.505													696	9	---	---	---	---	
ANKRD46	157567	broad.mit.edu	37	8	101535133	101535138	+	Intron	DEL	ATATAT	-	-	rs66638989		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101535133_101535138delATATAT	uc003yjm.2	-						ANKRD46_uc003yjn.1_Intron|ANKRD46_uc003yjo.1_Intron|ANKRD46_uc003yjp.1_Intron	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			acacacacacatatatatatatacac	0.214													4	2	---	---	---	---	
ANGPT1	284	broad.mit.edu	37	8	108359118	108359118	+	Intron	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108359118delA	uc003ymn.2	-						ANGPT1_uc003ymo.2_Intron	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AAAGCTAAAGAAAAAAAAAAT	0.418													278	7	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110535664	110535667	+	Intron	DEL	AATT	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110535664_110535667delAATT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAATAGAGACAATTATAATGTTCT	0.358										HNSCC(38;0.096)			123	8	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134129130	134129131	+	Intron	INS	-	A	A	rs35664939		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134129130_134129131insA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		cggggaaagttaaaaaaaaaaa	0.054													6	4	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				7	5	---	---	---	---	
C9orf150	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	GGCGGCGGC	GGCGGCGGC	rs139315731	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12775861_12775862insGGCGGCGGC	uc003zkw.2	+	1	850_851	c.147_148insGGCGGCGGC	c.(145-150)insGGCGGCGGC	p.55_56insGGG		NM_203403	NP_981948	Q8IV03	CI150_HUMAN	hypothetical protein LOC286343	58_59	Gly-rich.										0				GBM - Glioblastoma multiforme(1;1.64e-13)		gcggtggtggtggcggcggcgg	0.505													6	5	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386733	33386734	+	Intron	INS	-	A	A	rs144694820	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386733_33386734insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		gaggaacacagaggcgatggct	0.158													2	4	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78790207	78790208	+	Intron	INS	-	GAATA	GAATA	rs10124596		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790207_78790208insGAATA	uc004ajz.2	+						PCSK5_uc004ajy.2_Frame_Shift_Ins_p.R688fs|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						cgaatcgaatcgaatagaatag	0.099													5	6	---	---	---	---	
SURF4	6836	broad.mit.edu	37	9	136231567	136231567	+	Intron	DEL	A	-	-	rs79396370		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136231567delA	uc004cdj.2	-						SURF4_uc011mda.1_Intron|SURF4_uc010nal.2_Intron|SURF4_uc011mdb.1_Intron|SURF4_uc011mdc.1_Intron|SURF4_uc011mdd.1_Intron	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4							endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		actccgtctcaaaaaaaaaaa	0.259													4	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137709530	137709531	+	Intron	DEL	CA	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137709530_137709531delCA	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCTGCAGGCCACACACACACA	0.688													8	4	---	---	---	---	
KIF18A	81930	broad.mit.edu	37	11	28098483	28098484	+	Intron	DEL	AA	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28098483_28098484delAA	uc001msc.2	-							NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						actccttctgaaaaaaaaaaaa	0.099													4	3	---	---	---	---	
MS4A12	54860	broad.mit.edu	37	11	60269262	60269282	+	Intron	DEL	AAATTAAGGAAAAGAAAATAA	-	-	rs3831398		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60269262_60269282delAAATTAAGGAAAAGAAAATAA	uc001npr.2	+							NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						CATAGGCCAGAAATTAAGGAAAAGAAAATAAAAAAGAAGTC	0.326													8	7	---	---	---	---	
FADS1	3992	broad.mit.edu	37	11	61580507	61580508	+	Intron	INS	-	G	G	rs143226787	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61580507_61580508insG	uc010rlm.1	-						FADS1_uc001nsh.2_Intron|FADS1_uc010rln.1_Intron	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1						cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGGTAGTGGCAGCCTTGGGGGA	0.401													7	4	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	70028923	70028923	+	Intron	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70028923delA	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						AAGAAGAAGGAAAAAAAAAAA	0.249													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95110003	95110006	+	IGR	DEL	CCTC	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110003_95110006delCCTC								SESN3 (144298 upstream) : FAM76B (392100 downstream)																							tcccttccctcctccctccctccc	0.201													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113769072	113769073	+	IGR	INS	-	CTTC	CTTC	rs144460106	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113769072_113769073insCTTC								USP28 (22816 upstream) : HTR3B (6516 downstream)																							tttcttcctttcttccttcctt	0.000													5	4	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122680263	122680264	+	Intron	DEL	AT	-	-	rs146476661		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122680263_122680264delAT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGCAATGTAAATACTCTTCTAA	0.351													1	5	---	---	---	---	
PDE3A	5139	broad.mit.edu	37	12	20523344	20523344	+	Intron	DEL	T	-	-	rs11045194		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20523344delT	uc001reh.1	+							NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	gttttttttgttttttttttt	0.338													4	2	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54730796	54730797	+	Intron	INS	-	CT	CT	rs111512035		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54730796_54730797insCT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron|uc010sou.1_5'Flank|MIR148B_hsa-mir-148b|MI0000811_5'Flank	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						acagagagagactgtcgcaaaa	0.153													4	2	---	---	---	---	
IRAK3	11213	broad.mit.edu	37	12	66629084	66629085	+	Intron	INS	-	GCGGGC	GCGGGC	rs139344896	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66629084_66629085insGCGGGC	uc001sth.2	+						IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		gggccgcggcggcgggcgcggg	0.431													3	3	---	---	---	---	
IKBIP	121457	broad.mit.edu	37	12	99008211	99008211	+	Intron	DEL	T	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99008211delT	uc001tfv.2	-						IKBIP_uc001tfw.2_Intron	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2						induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ttaattttaattttttttttg	0.085													4	2	---	---	---	---	
SLC24A6	80024	broad.mit.edu	37	12	113747852	113747852	+	Intron	DEL	A	-	-	rs11297438		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113747852delA	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						agctattaccaaaaaAAAAAA	0.174													4	2	---	---	---	---	
IRF9	10379	broad.mit.edu	37	14	24635589	24635590	+	3'UTR	INS	-	T	T	rs111232493		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24635589_24635590insT	uc001wmq.2	+	9					RNF31_uc001wmp.2_RNA|IRF9_uc010alj.2_3'UTR	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,						interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)		ATTTTTTATCCTTTTTTTTTTT	0.426													5	3	---	---	---	---	
FAM177A1	283635	broad.mit.edu	37	14	35546674	35546674	+	Intron	DEL	C	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35546674delC	uc001wsp.2	+						FAM177A1_uc001wsq.2_Intron	NM_001079519	NP_001072987	Q8N128	F177A_HUMAN	hypothetical protein LOC283635 isoform 2												0						TTTTCAAGttctttttttttt	0.129													5	3	---	---	---	---	
MIA2	117153	broad.mit.edu	37	14	39706333	39706334	+	Intron	INS	-	T	T	rs11429335		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39706333_39706334insT	uc001wux.2	+						MIA2_uc010amy.1_Intron	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2							extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		Cttttcttttcttttttttgga	0.163													21	9	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64921265	64921265	+	Intron	DEL	T	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64921265delT	uc001xhb.2	+						MTHFD1_uc010aqf.2_Intron|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CCAACAGTTCTTTTTTTTTTT	0.303													4	2	---	---	---	---	
AHSA1	10598	broad.mit.edu	37	14	77935239	77935240	+	Intron	INS	-	G	G	rs141792523	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77935239_77935240insG	uc001xtw.2	+							NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase						protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ttagtagagatggagtttcacc	0.005													6	7	---	---	---	---	
MIR544	664613	broad.mit.edu	37	14	101514904	101514905	+	5'Flank	DEL	GT	-	-	rs112536165		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101514904_101514905delGT	hsa-mir-544|MI0003515	+						MIR655_hsa-mir-655|MI0003677_5'Flank																	0						CACCTCTGGGgtgtgtgtgtgt	0.312													5	3	---	---	---	---	
GALK2	2585	broad.mit.edu	37	15	49470576	49470577	+	Intron	DEL	AT	-	-	rs10574188		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49470576_49470577delAT	uc001zxj.1	+						GALK2_uc001zxi.1_Intron|GALK2_uc010ufb.1_Intron|GALK2_uc001zxk.2_Intron|GALK2_uc010ufc.1_Intron	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1						galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		atatatgtaCATATATATATAT	0.208													4	2	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs140336932	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAACAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													3	4	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	673935	673936	+	Intron	INS	-	T	T	rs79441857		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:673935_673936insT	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		acgcatctatgttttttttttt	0.000													4	4	---	---	---	---	
ROCK1	6093	broad.mit.edu	37	18	18586265	18586265	+	Intron	DEL	T	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18586265delT	uc002kte.2	-							NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein						actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					aatgttataataaatttcatg	0.124													38	12	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64559977	64559978	+	IGR	INS	-	AAGGAAGGAAGGAAGA	AAGGAAGGAAGGAAGA	rs151112863	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64559977_64559978insAAGGAAGGAAGGAAGA								CDH19 (288761 upstream) : DSEL (613841 downstream)																							aaggaaagaggaaggaaggaag	0.000													3	6	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1046580	1046580	+	Intron	DEL	G	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1046580delG	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGTCTGGTGGGGGGGGGGA	0.652													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715876	49715877	+	IGR	INS	-	CCTC	CCTC	rs143181876	by1000genomes	TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715876_49715877insCCTC								TRPM4 (785 upstream) : SLC6A16 (77017 downstream)																							cttccttccttcctccctccct	0.035													4	2	---	---	---	---	
ZNF320	162967	broad.mit.edu	37	19	53391576	53391577	+	Intron	INS	-	GA	GA			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53391576_53391577insGA	uc002qag.2	-						ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Intron|ZNF320_uc002qai.2_Intron	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		AATGAGAAGAGGAGAGGGGAAA	0.406													11	6	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21324475	21324475	+	Intron	DEL	T	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21324475delT	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						CTTCAGAAACTTTTTTTTTTG	0.249													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29819371	29819372	+	IGR	INS	-	T	T	rs67350067		TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29819371_29819372insT								AP1B1 (34802 upstream) : RFPL1S (13634 downstream)																							AATCTATCAACttttttttttt	0.173													5	3	---	---	---	---	
C22orf30	253143	broad.mit.edu	37	22	32084031	32084031	+	Intron	DEL	G	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32084031delG	uc003alp.3	-						C22orf30_uc003alo.1_Intron|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143												0						aaaaaaaaaaGACCCAATATT	0.179													13	6	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1536698	1536701	+	Intron	DEL	AGAG	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1536698_1536701delAGAG	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				acatgcacacagagagacacacac	0.137													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53043948	53043948	+	IGR	DEL	A	-	-			TCGA-CH-5788-01A-11D-1576-08	TCGA-CH-5788-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53043948delA								FAM156A (106365 upstream) : GPR173 (34558 downstream)																							agaccttgccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
