Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TNFRSF14	8764	broad.mit.edu	37	1	2494690	2494690	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2494690C>T	uc001ajr.2	+	8	1129	c.830C>T	c.(829-831)ACG>ATG	p.T277M	TNFRSF14_uc001ajt.1_3'UTR|TNFRSF14_uc001ajs.2_3'UTR	NM_003820	NP_003811	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily,	277	Cytoplasmic (Potential).				immune response|interspecies interaction between organisms|T cell costimulation		tumor necrosis factor receptor activity			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		CCCTCATTCACGGGGAGGAGC	0.622			Mis|N|F		follicular lymphoma								4	49	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10394639	10394639	+	Missense_Mutation	SNP	G	A	A	rs145596547		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10394639G>A	uc001aqx.3	+	28	3188	c.2986G>A	c.(2986-2988)GTC>ATC	p.V996I	KIF1B_uc001aqw.3_Missense_Mutation_p.V950I|KIF1B_uc001aqy.2_Missense_Mutation_p.V970I|KIF1B_uc001aqz.2_Missense_Mutation_p.V996I|KIF1B_uc001ara.2_Missense_Mutation_p.V956I|KIF1B_uc001arb.2_Missense_Mutation_p.V982I	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	996					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGTGGCCATCGTCAGTGAGAA	0.512													119	226	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12476777	12476777	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12476777T>C	uc001atv.2	+	65	12371	c.12230T>C	c.(12229-12231)CTT>CCT	p.L4077P	VPS13D_uc001atw.2_Missense_Mutation_p.L4052P|VPS13D_uc001atx.2_Missense_Mutation_p.L3264P|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_Missense_Mutation_p.L75P	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	4076					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCTATGGGGCTTTTGAATGAT	0.468													10	635	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14113128	14113128	+	Intron	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14113128A>G	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_3'UTR|PRDM2_uc001avj.2_RNA|PRDM2_uc001avk.2_3'UTR|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AGCTTGCAAGACCAGTTGAAG	0.473													6	164	---	---	---	---	PASS
UBXN10	127733	broad.mit.edu	37	1	20517641	20517641	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20517641A>G	uc001bdb.2	+	2	671	c.587A>G	c.(586-588)GAA>GGA	p.E196G		NM_152376	NP_689589	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	196	UBX.									ovary(1)	1						TCGGACCAAGAACCAAGGTTG	0.517													5	108	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32259422	32259422	+	Silent	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32259422G>T	uc001bts.1	-	12	2518	c.2460C>A	c.(2458-2460)GCC>GCA	p.A820A	SPOCD1_uc001btr.1_5'Flank|SPOCD1_uc001btt.2_Silent_p.A125A|SPOCD1_uc001btu.2_Silent_p.A820A|SPOCD1_uc001btv.2_Silent_p.A313A	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	820					transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TTTGGCTTAGGGCTTTCTGGA	0.582													78	171	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36931800	36931800	+	3'UTR	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36931800G>A	uc001caw.1	-	17					MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_3'UTR|CSF3R_uc009vvc.1_3'UTR|CSF3R_uc001cau.1_3'UTR|CSF3R_uc001cav.1_Missense_Mutation_p.A750V|CSF3R_uc001cax.1_3'UTR|CSF3R_uc001cay.1_3'UTR	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a						cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGGAGGCCCAGCCTATGGAGA	0.532													54	80	---	---	---	---	PASS
SF3A3	10946	broad.mit.edu	37	1	38455225	38455225	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38455225G>A	uc001cci.2	-	2	263	c.139C>T	c.(139-141)CAA>TAA	p.Q47*	SF3A3_uc010oik.1_Nonsense_Mutation_p.Q47*	NM_006802	NP_006793	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3	47					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCACATCTTGCATGGCCCGA	0.547													12	39	---	---	---	---	PASS
SF3A3	10946	broad.mit.edu	37	1	38455226	38455226	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38455226C>T	uc001cci.2	-	2	262	c.138G>A	c.(136-138)ATG>ATA	p.M46I	SF3A3_uc010oik.1_Missense_Mutation_p.M46I	NM_006802	NP_006793	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3	46					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCACATCTTGCATGGCCCGAG	0.552													12	39	---	---	---	---	PASS
CDKN2C	1031	broad.mit.edu	37	1	51436156	51436156	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51436156G>C	uc001csf.2	+	2	1332	c.116G>C	c.(115-117)AGG>ACG	p.R39T	CDKN2C_uc001csg.2_Missense_Mutation_p.R39T	NM_001262	NP_001253	P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C	39	ANK 2.				cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	p.0?(4)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(2)|thyroid(1)|lung(1)|kidney(1)	17				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		GGATTTGGAAGGACTGCGCTG	0.463			D		glioma|MM				Multiple_Endocrine_Neoplasia_type_1				55	126	---	---	---	---	PASS
FAM151A	338094	broad.mit.edu	37	1	55077410	55077410	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55077410A>C	uc001cxn.2	-	6	941	c.809T>G	c.(808-810)CTG>CGG	p.L270R	ACOT11_uc001cxm.1_Intron	NM_176782	NP_788954	Q8WW52	F151A_HUMAN	hypothetical protein LOC338094	270						integral to membrane					0						CCACAGCGTCAGGCTGTACCT	0.602													10	19	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55619805	55619805	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55619805T>G	uc001cyg.3	-	13	1367	c.1367A>C	c.(1366-1368)GAA>GCA	p.E456A		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	600					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						CTTAATATCTTCTATGCACTT	0.403													102	243	---	---	---	---	PASS
PDE4B	5142	broad.mit.edu	37	1	66827366	66827366	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66827366C>A	uc001dcn.2	+	10	1101	c.910C>A	c.(910-912)CTC>ATC	p.L304I	PDE4B_uc009war.2_Missense_Mutation_p.L212I|PDE4B_uc001dco.2_Missense_Mutation_p.L304I|PDE4B_uc001dcp.2_Missense_Mutation_p.L289I|PDE4B_uc001dcq.2_Missense_Mutation_p.L132I|PDE4B_uc009was.2_Missense_Mutation_p.L71I	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1	304					signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	AAAGCAGCAGCTCATGACCCA	0.408													115	216	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104114732	104114732	+	Missense_Mutation	SNP	G	T	T	rs143079100		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104114732G>T	uc001duq.2	+	4	785	c.169G>T	c.(169-171)GTC>TTC	p.V57F	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.V57F	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	57					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAATTTGTAGGTCTCTCCACC	0.318													9	654	---	---	---	---	PASS
CASQ2	845	broad.mit.edu	37	1	116243859	116243859	+	3'UTR	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116243859G>A	uc001efx.3	-	11					CASQ2_uc010owu.1_3'UTR	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor						heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GTTTGGAGTTGGGCTATtcat	0.284													6	647	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154574687	154574687	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154574687A>T	uc001ffh.2	-	2	631	c.431T>A	c.(430-432)TTA>TAA	p.L144*	ADAR_uc001ffj.2_Nonsense_Mutation_p.L144*|ADAR_uc001ffi.2_Nonsense_Mutation_p.L144*|ADAR_uc001ffk.2_5'UTR|ADAR_uc001ffl.1_5'UTR|ADAR_uc001ffm.1_RNA|ADAR_uc001ffn.1_3'UTR	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	144	DRADA 1.				adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CAGGAACTTTAAGATCCTTTG	0.478													42	85	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158390080	158390080	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158390080G>A	uc010pii.1	-	1	577	c.577C>T	c.(577-579)CAC>TAC	p.H193Y		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TGACTAAAGTGGTTATGGTGA	0.438													8	210	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165377504	165377504	+	Silent	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165377504C>T	uc001gda.2	-	8	1398	c.1098G>A	c.(1096-1098)TCG>TCA	p.S366S		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	366	Ligand-binding (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	ATCCCAGTTCCGACTTGTCCA	0.502													4	208	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198687258	198687258	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198687258A>T	uc001gur.1	+	14	1660	c.1480A>T	c.(1480-1482)ACA>TCA	p.T494S	PTPRC_uc001gus.1_Missense_Mutation_p.T446S|PTPRC_uc001gut.1_Missense_Mutation_p.T333S|PTPRC_uc009wzf.1_Missense_Mutation_p.T382S|PTPRC_uc010ppg.1_Missense_Mutation_p.T430S	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	494	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TGTCTCCATGACATCAGATAA	0.393													13	156	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220324917	220324917	+	Intron	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220324917C>A	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron|RAB3GAP2_uc001hmh.2_Missense_Mutation_p.G297C	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ATCCAATGACCTTTTGCCTGA	0.383													46	111	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220346067	220346067	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220346067A>G	uc010puk.1	-	22	2492	c.2328T>C	c.(2326-2328)GTT>GTC	p.V776V	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Silent_p.V356V	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	776					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		TTGAAAGCCAAACACTCAGGA	0.358													105	219	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237619946	237619946	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237619946A>G	uc001hyl.1	+	16	1643	c.1523A>G	c.(1522-1524)TAC>TGC	p.Y508C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	508	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGCACGTCTACAGCAGTGCA	0.433													5	243	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20518361	20518361	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20518361C>T	uc002rds.1	-	2	120	c.97G>A	c.(97-99)GAT>AAT	p.D33N	PUM2_uc002rdt.1_Missense_Mutation_p.D33N|PUM2_uc002rdr.2_5'UTR|PUM2_uc010yjy.1_Missense_Mutation_p.D33N|PUM2_uc002rdu.1_Missense_Mutation_p.D33N|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	33	Interaction with SNAPIN.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTGTCCATCTTTTGTTGAA	0.333													22	505	---	---	---	---	PASS
GCKR	2646	broad.mit.edu	37	2	27719812	27719812	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27719812C>T	uc002rky.2	+	1	107	c.41C>T	c.(40-42)CCG>CTG	p.P14L	FNDC4_uc002rkx.2_5'Flank|GCKR_uc010ezd.2_Missense_Mutation_p.P14L|GCKR_uc010ylu.1_5'UTR	NM_001486	NP_001477	Q14397	GCKR_HUMAN	glucokinase regulatory protein	14					carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)					ATTGAGACCCCGGAGCCTGGC	0.527													54	121	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32693677	32693677	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32693677A>T	uc010ezu.2	+	29	6087	c.5953A>T	c.(5953-5955)AAT>TAT	p.N1985Y		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1985					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCTTCAACTAAATTTGGCTCA	0.408													80	169	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49189849	49189849	+	3'UTR	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49189849C>G	uc002rww.2	-	10					FSHR_uc002rwx.2_3'UTR|FSHR_uc010fbn.2_3'UTR	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	attCAATACTCAGATACATTT	0.224									Gonadal_Dysgenesis_46_XX				7	258	---	---	---	---	PASS
VPS54	51542	broad.mit.edu	37	2	64147103	64147103	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64147103T>C	uc002scq.2	-	15	2241	c.2078A>G	c.(2077-2079)AAG>AGG	p.K693R	VPS54_uc002scp.2_Missense_Mutation_p.K681R|VPS54_uc002scn.2_5'UTR|VPS54_uc002sco.2_Missense_Mutation_p.K178R|VPS54_uc010fct.2_Missense_Mutation_p.K540R	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1	693					protein transport|retrograde transport, endosome to Golgi						0						ATCTGCTTGCTTCCAGCGCTC	0.388													6	267	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72362015	72362015	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72362015C>T	uc002sih.1	-	4	736	c.736G>A	c.(736-738)GGG>AGG	p.G246R	CYP26B1_uc010yra.1_Missense_Mutation_p.G229R|CYP26B1_uc010yrb.1_Missense_Mutation_p.G171R	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	246					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						TTCTCCAGCCCCTTCTGCAGG	0.617													16	35	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72968545	72968545	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72968545C>A	uc010fep.2	-	2	305	c.167G>T	c.(166-168)CGT>CTT	p.R56L	EXOC6B_uc002sij.2_Missense_Mutation_p.R56L	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	56	Potential.				protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						ATTACGGATACGAGTTTCAAG	0.398													8	282	---	---	---	---	PASS
FUNDC2P2	388965	broad.mit.edu	37	2	84518404	84518404	+	3'UTR	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84518404A>G	uc010ffz.1	+	1						NR_003663				RecName: Full=FUN14 domain-containing protein 2; AltName: Full=Hepatitis C virus core-binding protein 6; AltName: Full=Cervical cancer proto-oncogene 3 protein;          Short=HCC-3;												0						CCTAAAGAAGATACCTCATTT	0.483													6	140	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89103729	89103729	+	Intron	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89103729A>G	uc010fhg.2	+						FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						aaaattaattacaaaaaacag	0.065													3	18	---	---	---	---	PASS
MGAT4A	11320	broad.mit.edu	37	2	99256416	99256416	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99256416G>A	uc002sze.2	-	12	1491	c.1177C>T	c.(1177-1179)CCT>TCT	p.P393S	C2orf64_uc002sza.2_Intron|MGAT4A_uc010yvm.1_Missense_Mutation_p.P265S|MGAT4A_uc010fil.2_Missense_Mutation_p.P147S	NM_012214	NP_036346	Q9UM21	MGT4A_HUMAN	alpha-1,3-mannosyl-glycoprotein	393	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1						ACCTCCGCAGGTGGGTTTACA	0.398													119	252	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109371681	109371681	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109371681T>G	uc002tem.3	+	17	2558	c.2432T>G	c.(2431-2433)CTG>CGG	p.L811R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	811					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AATTCTTTACTGAAAATGATT	0.353													12	767	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133430867	133430867	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133430867T>C	uc002ttp.2	-	20	6099	c.5725A>G	c.(5725-5727)ACT>GCT	p.T1909A	NCKAP5_uc002ttq.2_Missense_Mutation_p.T590A|LYPD1_uc002ttn.2_5'Flank|LYPD1_uc002tto.2_5'Flank	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1909							protein binding				0						TTTCTTCAAGTTGTCTCAATT	0.264													9	684	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149851037	149851037	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149851037A>G	uc010zbu.1	+	17	2376	c.2008A>G	c.(2008-2010)AAG>GAG	p.K670E	KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Missense_Mutation_p.K222E	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	670					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGAGCTGGCAAAGCTCCGAGC	0.507													24	56	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160661456	160661456	+	3'UTR	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160661456A>G	uc002ubc.3	-	35					LY75_uc002ubb.3_Intron|LY75_uc010fos.2_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		AGTATTTAAGAGTTCTACTTT	0.328													12	26	---	---	---	---	PASS
DCAF17	80067	broad.mit.edu	37	2	172291646	172291646	+	Silent	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172291646C>G	uc002ugx.2	+	2	409	c.180C>G	c.(178-180)GCC>GCG	p.A60A	METTL8_uc002ugu.3_5'Flank|METTL8_uc002ugv.3_5'Flank|METTL8_uc002ugt.3_5'Flank|METTL8_uc002ugs.3_5'Flank|METTL8_uc010zdo.1_5'Flank|METTL8_uc010zdp.1_5'Flank|DCAF17_uc010zdq.1_RNA|DCAF17_uc010fqf.1_Silent_p.A60A|DCAF17_uc010zdr.1_RNA	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1	60						CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						CACCTATAGCCTATGAGAGAG	0.353													123	341	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183616891	183616891	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183616891A>G	uc002uow.1	+	16	1942	c.1527A>G	c.(1525-1527)ACA>ACG	p.T509T	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Silent_p.T463T|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	509	Thioredoxin 2.				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TAGATTGTACAGTTCATGAGG	0.333													94	263	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198540067	198540067	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540067A>G	uc002uuo.3	-	1	518	c.116T>C	c.(115-117)GTA>GCA	p.V39A		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	39						plasma membrane					0						ATCCAGCAATACATATTCGTA	0.348													7	694	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9068661	9068661	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9068661G>A	uc003brf.1	-	13	2234	c.1558C>T	c.(1558-1560)CCG>TCG	p.P520S	SRGAP3_uc003brg.1_Missense_Mutation_p.P496S|SRGAP3_uc003bri.1_RNA	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	520	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ACTACAAGCGGTATAGCTTGT	0.433			T	RAF1	pilocytic astrocytoma								8	90	---	---	---	---	PASS
LRRFIP2	9209	broad.mit.edu	37	3	37095929	37095929	+	Silent	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37095929T>C	uc003cgp.2	-	28	2451	c.2028A>G	c.(2026-2028)AAA>AAG	p.K676K	MLH1_uc011aye.1_Intron|LRRFIP2_uc011ayf.1_Silent_p.K458K|LRRFIP2_uc003cgr.2_Silent_p.K379K|LRRFIP2_uc003cgs.3_Silent_p.K379K|LRRFIP2_uc003cgt.3_Silent_p.K355K	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting	676	Potential.				Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1						GTTTTTCTGCTTTCAATTCAT	0.368													8	680	---	---	---	---	PASS
DHX30	22907	broad.mit.edu	37	3	47887677	47887677	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47887677T>G	uc003cru.2	+	11	1541	c.1115T>G	c.(1114-1116)ATC>AGC	p.I372S	DHX30_uc003crt.2_Missense_Mutation_p.I333S	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	372						mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGTTCATGGATCGCCCCAGAA	0.547													7	13	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62388785	62388785	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62388785G>A	uc003dll.2	-	29	4213	c.3853C>T	c.(3853-3855)CAG>TAG	p.Q1285*	CADPS_uc003dlj.1_Nonsense_Mutation_p.Q240*|CADPS_uc003dlk.1_Nonsense_Mutation_p.Q733*|CADPS_uc003dlm.2_Nonsense_Mutation_p.Q1246*|CADPS_uc003dln.2_Nonsense_Mutation_p.Q1206*	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1285	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTTTTCAACTGATAAATATGA	0.373													19	237	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62388786	62388786	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62388786A>G	uc003dll.2	-	29	4212	c.3852T>C	c.(3850-3852)TAT>TAC	p.Y1284Y	CADPS_uc003dlj.1_Silent_p.Y239Y|CADPS_uc003dlk.1_Silent_p.Y732Y|CADPS_uc003dlm.2_Silent_p.Y1245Y|CADPS_uc003dln.2_Silent_p.Y1205Y	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1284	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TTTTCAACTGATAAATATGAA	0.368													18	234	---	---	---	---	PASS
STX19	415117	broad.mit.edu	37	3	93733880	93733880	+	Silent	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93733880C>A	uc003drh.1	-	2	491	c.234G>T	c.(232-234)CTG>CTT	p.L78L	ARL13B_uc003drc.2_Intron|ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_001001850	NP_001001850	Q8N4C7	STX19_HUMAN	syntaxin 19	78					intracellular protein transport|vesicle-mediated transport	membrane	SNAP receptor activity				0						TTGAAGCCACCAGACTTTTCT	0.358													5	216	---	---	---	---	PASS
AGTR1	185	broad.mit.edu	37	3	148459496	148459496	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148459496C>G	uc003ewg.2	+	4	1120	c.674C>G	c.(673-675)GCT>GGT	p.A225G	AGTR1_uc003ewh.2_Missense_Mutation_p.A225G|AGTR1_uc003ewi.2_Missense_Mutation_p.A225G|AGTR1_uc003ewj.2_Missense_Mutation_p.A225G|AGTR1_uc003ewk.2_Missense_Mutation_p.A225G	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	225	Cytoplasmic (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CTAAAGAAGGCTTATGAAATT	0.358													61	83	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189455538	189455538	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189455538A>G	uc003fry.2	+	2	161	c.72A>G	c.(70-72)GAA>GAG	p.E24E	TP63_uc003frx.2_Silent_p.E24E|TP63_uc003frz.2_Silent_p.E24E|TP63_uc010hzc.1_Silent_p.E24E	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	24	Transcription activation.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GTTTCGTAGAAACCCCAGCTC	0.348									Hay-Wells_syndrome	HNSCC(45;0.13)			5	185	---	---	---	---	PASS
ZNF141	7700	broad.mit.edu	37	4	367565	367565	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:367565G>A	uc003gaa.2	+	5	1517	c.1339G>A	c.(1339-1341)GTA>ATA	p.V447I	ZNF141_uc003gab.2_Intron	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141	447					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						AATTCATACTGTAGATAAACC	0.318													4	97	---	---	---	---	PASS
CHRNA9	55584	broad.mit.edu	37	4	40337469	40337469	+	5'UTR	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40337469G>C	uc003gva.1	+	1						NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9						elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	CTTTATTATAGAGGCTCAGGA	0.517													62	134	---	---	---	---	PASS
SCARB2	950	broad.mit.edu	37	4	77100845	77100845	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77100845C>A	uc003hju.1	-	4	776	c.437G>T	c.(436-438)TGG>TTG	p.W146L	SCARB2_uc011cbu.1_Intron	NM_005506	NP_005497	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	146	Lumenal (Potential).				cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)			CACCTGGGACCACTCTATGAC	0.527											OREG0016231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	66	---	---	---	---	PASS
DSPP	1834	broad.mit.edu	37	4	88537258	88537258	+	Silent	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88537258T>C	uc003hqu.2	+	5	3564	c.3444T>C	c.(3442-3444)AGT>AGC	p.S1148S		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	1148	Asp/Ser-rich.				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagtgaaagcagcg	0.000													2	0	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114232524	114232524	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114232524C>T	uc003ibe.3	+	24	2762	c.2662C>T	c.(2662-2664)CGA>TGA	p.R888*	ANK2_uc003ibd.3_Nonsense_Mutation_p.R867*|ANK2_uc003ibf.3_Nonsense_Mutation_p.R888*|ANK2_uc011cgc.1_Nonsense_Mutation_p.R97*|ANK2_uc003ibc.2_Nonsense_Mutation_p.R864*|ANK2_uc011cgb.1_Nonsense_Mutation_p.R903*	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	888					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAATTACCTGCGATACAGCTT	0.433													11	238	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164534641	164534641	+	Intron	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164534641C>T	uc003iqs.1	-						MARCH1_uc003iqr.1_Missense_Mutation_p.V6I	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTACAACAAACGTGGCTGCTG	0.353													12	272	---	---	---	---	PASS
C9	735	broad.mit.edu	37	5	39285281	39285281	+	3'UTR	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39285281G>A	uc003jlv.3	-	11						NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TTCCACTGGAGCTCAGAGAAG	0.388													56	209	---	---	---	---	PASS
C9	735	broad.mit.edu	37	5	39285282	39285282	+	3'UTR	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39285282C>T	uc003jlv.3	-	11						NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TCCACTGGAGCTCAGAGAAGC	0.388													56	208	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128932305	128932305	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128932305G>A	uc003kvb.1	+	8	1408	c.1408G>A	c.(1408-1410)GAA>AAA	p.E470K	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	470	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TATTATTGCTGAAGACAATGG	0.289													10	635	---	---	---	---	PASS
RASGEF1C	255426	broad.mit.edu	37	5	179546418	179546418	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179546418T>G	uc003mlq.2	-	7	1132	c.835A>C	c.(835-837)ATT>CTT	p.I279L	RASGEF1C_uc003mlr.2_Missense_Mutation_p.I279L|RASGEF1C_uc003mlp.3_Missense_Mutation_p.I128L	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	279	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGAACTCAATCACCTGGGCC	0.637													9	44	---	---	---	---	PASS
ZNF187	7741	broad.mit.edu	37	6	28244851	28244851	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28244851A>C	uc011dld.1	+	5	1685	c.1415A>C	c.(1414-1416)CAC>CCC	p.H472P	ZNF187_uc011dlc.1_Missense_Mutation_p.H473P|ZNF187_uc003nku.3_Missense_Mutation_p.H338P|ZNF187_uc003nkw.3_Missense_Mutation_p.H319P|ZNF187_uc011dle.1_Missense_Mutation_p.H319P|ZNF187_uc011dlf.1_Missense_Mutation_p.H264P|ZNF187_uc011dlg.1_Missense_Mutation_p.H319P	NM_001111039	NP_001104509	Q16670	ZN187_HUMAN	zinc finger protein 187 isoform b	472	C2H2-type 8.				viral reproduction	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CAGAGATATCACCACAAAGAC	0.428													9	19	---	---	---	---	PASS
ZSCAN12	9753	broad.mit.edu	37	6	28348341	28348341	+	3'UTR	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28348341A>C	uc010jre.2	-	6						NM_001145043	NP_001138515			RecName: Full=Zinc finger and SCAN domain-containing protein 12; AltName: Full=Zinc finger protein 96; AltName: Full=Zinc finger protein 305;												0						TGTGGCTGAAAACTTTCCCAC	0.403													15	48	---	---	---	---	PASS
PRR3	80742	broad.mit.edu	37	6	30531904	30531904	+	3'UTR	SNP	T	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30531904T>A	uc003nqi.1	+	4					PRR3_uc003nqj.1_3'UTR	NM_025263	NP_079539	P79522	PRR3_HUMAN	proline-rich protein 3 isoform a								nucleic acid binding|zinc ion binding				0						GAAGACAGGTTTCTCATAATC	0.413													3	3	---	---	---	---	PASS
SNRPC	6631	broad.mit.edu	37	6	34730477	34730477	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34730477A>G	uc003ojt.1	+	3	172	c.157A>G	c.(157-159)ACA>GCA	p.T53A		NM_003093	NP_003084	P09234	RU1C_HUMAN	small nuclear ribonucleoprotein polypeptide C	53					spliceosomal snRNP assembly	Cajal body|U1 snRNP	protein homodimerization activity|single-stranded RNA binding|zinc ion binding			pancreas(1)	1						GATTGACAAAACAAGTATGTT	0.403													6	197	---	---	---	---	PASS
OOEP	441161	broad.mit.edu	37	6	74078432	74078432	+	3'UTR	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74078432G>A	uc003pgu.3	-	3					OOEP_uc003pgv.3_3'UTR	NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ATTTAAGAATGCTATACTTGC	0.358													37	92	---	---	---	---	PASS
PDSS2	57107	broad.mit.edu	37	6	107655484	107655484	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107655484G>A	uc003prt.2	-	2	639	c.349C>T	c.(349-351)CTC>TTC	p.L117F	PDSS2_uc011eak.1_5'UTR|PDSS2_uc011eal.1_Missense_Mutation_p.L117F|PDSS2_uc003pru.2_Missense_Mutation_p.L117F|PDSS2_uc003prv.2_Missense_Mutation_p.L117F	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2	117					isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		GAGATAAGGAGCACCACCAAG	0.483													21	44	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110528751	110528751	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110528751C>A	uc003pua.2	+	4	473	c.449C>A	c.(448-450)GCT>GAT	p.A150D		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	150					mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		CAAGTGTCTGCTAAATATATT	0.269													10	518	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112441542	112441542	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112441542G>T	uc003pvu.2	-	33	4918	c.4609C>A	c.(4609-4611)CAC>AAC	p.H1537N	LAMA4_uc003pvv.2_Missense_Mutation_p.H1530N|LAMA4_uc003pvt.2_Missense_Mutation_p.H1530N	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1537	Laminin G-like 4.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGTTTTTTGTGACCAACATTA	0.418													93	260	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112441543	112441543	+	Silent	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112441543A>T	uc003pvu.2	-	33	4917	c.4608T>A	c.(4606-4608)GGT>GGA	p.G1536G	LAMA4_uc003pvv.2_Silent_p.G1529G|LAMA4_uc003pvt.2_Silent_p.G1529G	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1536	Laminin G-like 4.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GTTTTTTGTGACCAACATTAA	0.423													93	256	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117663690	117663690	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117663690T>C	uc003pxp.1	-	28	4741	c.4542A>G	c.(4540-4542)ATA>ATG	p.I1514M	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1514	Extracellular (Potential).|Fibronectin type-III 6.				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAATAAGAGCTATACTGTCCT	0.264			T	GOPC|ROS1	glioblastoma|NSCLC								6	561	---	---	---	---	PASS
CENPW	387103	broad.mit.edu	37	6	126669610	126669610	+	Splice_Site	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126669610A>G	uc003qao.2	+	3	408	c.241_splice	c.e3-2	p.V81_splice	CENPW_uc003qap.3_Intron	NM_001012507	NP_001012525	Q5EE01	CENPW_HUMAN	hypothetical protein LOC387103							chromosome, centromeric region|nucleus	DNA binding				0						TCCCTCTTACAGGTAATTCTA	0.294													180	373	---	---	---	---	PASS
PCMT1	5110	broad.mit.edu	37	6	150123574	150123574	+	Intron	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150123574G>C	uc003qne.2	+						PCMT1_uc003qna.2_3'UTR|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		TGGATTTTAAGACATTAGACT	0.368													6	186	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11446611	11446611	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11446611C>G	uc003ssf.3	-	20	4240	c.3988G>C	c.(3988-3990)GAC>CAC	p.D1330H		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1330	Extracellular (Potential).|TSP type-1 13.					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTGGACTGGTCCATCAGGGAA	0.493										HNSCC(18;0.044)			59	116	---	---	---	---	PASS
CDCA7L	55536	broad.mit.edu	37	7	21951266	21951266	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21951266T>C	uc010kuk.2	-	3	392	c.272A>G	c.(271-273)GAT>GGT	p.D91G	CDCA7L_uc003sve.3_Missense_Mutation_p.D57G|CDCA7L_uc010kul.2_Intron|CDCA7L_uc003svf.3_Missense_Mutation_p.D90G|CDCA7L_uc011jyk.1_Missense_Mutation_p.D91G	NM_018719	NP_061189	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like isoform 1	91	PSIP1-binding.				positive regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus					0						TCCATTCAGATCACTCTGCGT	0.383													8	529	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37953856	37953856	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37953856T>C	uc003tfo.3	-	3	937	c.551A>G	c.(550-552)AAG>AGG	p.K184R		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	184	NTR.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						CAAAGTTGGCTTCACCTTTTT	0.413													7	409	---	---	---	---	PASS
IKZF1	10320	broad.mit.edu	37	7	50444291	50444291	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50444291A>G	uc003tow.3	+	5	389	c.221A>G	c.(220-222)AAT>AGT	p.N74S	IKZF1_uc003tox.3_Missense_Mutation_p.N74S|IKZF1_uc003toy.3_Missense_Mutation_p.N74S|IKZF1_uc011kck.1_Intron|IKZF1_uc003toz.3_Missense_Mutation_p.N44S|IKZF1_uc010kyx.2_Intron	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	74					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(74)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				TGTGAAATGAATGGGGAAGAA	0.488			D		ALL								6	379	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91708417	91708417	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91708417A>T	uc003ulg.2	+	31	7195	c.6970A>T	c.(6970-6972)ATA>TTA	p.I2324L	AKAP9_uc003ulf.2_Missense_Mutation_p.I2316L|AKAP9_uc003uli.2_Missense_Mutation_p.I1947L|AKAP9_uc003ulj.2_Missense_Mutation_p.I94L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2336	Potential.|Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAATGAACTGATAAGGGATCT	0.274			T	BRAF	papillary thyroid								5	137	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94043554	94043554	+	Silent	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94043554T>C	uc003ung.1	+	29	2157	c.1686T>C	c.(1684-1686)GGT>GGC	p.G562G	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	562			G -> V (in OI2A).|G -> C (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GCCCCTCAGGTCCCGCTGGTG	0.433										HNSCC(75;0.22)			6	176	---	---	---	---	PASS
SH2B2	10603	broad.mit.edu	37	7	101952119	101952119	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101952119T>G	uc011kko.1	+	4	1028	c.983T>G	c.(982-984)ATC>AGC	p.I328S		NM_020979	NP_066189	O14492	SH2B2_HUMAN	SH2B adaptor protein 2	285	PH.				blood coagulation|insulin receptor signaling pathway|intracellular signal transduction	cytosol|plasma membrane	JAK pathway signal transduction adaptor activity|SH3/SH2 adaptor activity|signal transducer activity				0						GCCGAATACATCTTGGAGACC	0.602													8	48	---	---	---	---	PASS
NAPEPLD	222236	broad.mit.edu	37	7	102743799	102743799	+	Intron	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102743799T>C	uc003vbc.2	-						NAPEPLD_uc003vbd.2_3'UTR|NAPEPLD_uc011klj.1_3'UTR|NAPEPLD_uc003vbe.2_Intron	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						ACAATATTCATGAATTTCTAA	0.274													41	91	---	---	---	---	PASS
PSMC2	5701	broad.mit.edu	37	7	103003194	103003194	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103003194A>G	uc003vbs.2	+	6	554	c.484A>G	c.(484-486)ACC>GCC	p.T162A	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011klo.1_Missense_Mutation_p.T25A	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2	162					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						CCCAACAGTTACCATGATGCA	0.264													5	275	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111379463	111379463	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111379463G>T	uc003vfx.2	-	47	5353	c.5084C>A	c.(5083-5085)TCG>TAG	p.S1695*	DOCK4_uc011kml.1_Nonsense_Mutation_p.S576*|DOCK4_uc011kmm.1_Nonsense_Mutation_p.S602*|DOCK4_uc003vfw.2_Nonsense_Mutation_p.S1145*|DOCK4_uc003vfy.2_Nonsense_Mutation_p.S1740*|DOCK4_uc003vfv.2_5'UTR	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1695	Ser-rich.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TCTGGCACTCGATGGAGCAGA	0.532													41	66	---	---	---	---	PASS
LMOD2	442721	broad.mit.edu	37	7	123303919	123303919	+	3'UTR	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123303919C>A	uc003vky.2	+	3						NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)							cytoskeleton	actin binding|tropomyosin binding				0						AAAATAATCTCACCCATTAAT	0.303													61	126	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127224747	127224747	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127224747G>A	uc003vma.2	-	1	908	c.490C>T	c.(490-492)CAG>TAG	p.Q164*		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	164	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						GTAGCCAACTGAGTCTTCAGC	0.522													46	81	---	---	---	---	PASS
MRPS33	51650	broad.mit.edu	37	7	140710230	140710230	+	Silent	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140710230A>C	uc003vwd.3	-	2	360	c.204T>G	c.(202-204)CTT>CTG	p.L68L	MRPS33_uc003vwe.3_Silent_p.L68L	NM_016071	NP_057155	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	68					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	Melanoma(164;0.00956)					TGTAGAGTCCAAGAAATCGGA	0.408													124	251	---	---	---	---	PASS
SLC7A2	6542	broad.mit.edu	37	8	17409461	17409461	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17409461G>A	uc011kyc.1	+	6	1190	c.1021G>A	c.(1021-1023)GTC>ATC	p.V341I	SLC7A2_uc011kyd.1_Missense_Mutation_p.V381I|SLC7A2_uc011kye.1_Missense_Mutation_p.V381I|SLC7A2_uc011kyf.1_Missense_Mutation_p.V341I	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	341	Helical; (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CAAATATGTCGTCGCAGCTGG	0.488													11	172	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69009342	69009342	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69009342G>C	uc003xxv.1	+	22	2486	c.2459G>C	c.(2458-2460)GGT>GCT	p.G820A	PREX2_uc003xxu.1_Missense_Mutation_p.G820A|PREX2_uc011lez.1_Missense_Mutation_p.G755A	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	820					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CTGGAATATGGTGTCGTGTAT	0.453													49	151	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95522881	95522881	+	Splice_Site	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95522881C>A	uc003ygo.1	-	14	3404	c.3391_splice	c.e14-1	p.V1131_splice	KIAA1429_uc010maz.1_Splice_Site	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1						mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GCTCAATAACCTGTTAAAAAA	0.333													5	216	---	---	---	---	PASS
STK3	6788	broad.mit.edu	37	8	99591893	99591893	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99591893G>T	uc003yip.2	-	8	1088	c.947C>A	c.(946-948)TCG>TAG	p.S316*	STK3_uc003yio.2_Nonsense_Mutation_p.S344*|STK3_uc010mbm.1_Nonsense_Mutation_p.S205*	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3	316	Potential.				apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		ATTACAAACCGAATTTTCTTC	0.308													8	804	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105459636	105459636	+	Silent	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105459636C>T	uc003yly.3	-	3	648	c.519G>A	c.(517-519)CTG>CTA	p.L173L		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	173					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CGTACAGCTCCAGGTCTGTCA	0.418													5	288	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121239463	121239463	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121239463T>C	uc003yox.2	+	17	2274	c.2009T>C	c.(2008-2010)GTC>GCC	p.V670A	COL14A1_uc003yoy.2_Missense_Mutation_p.V348A	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	670	Fibronectin type-III 5.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTTCAGGTTGTCCTGAAAGAA	0.383													5	150	---	---	---	---	PASS
RNF139	11236	broad.mit.edu	37	8	125498660	125498660	+	Nonsense_Mutation	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125498660T>G	uc003yrc.2	+	2	1113	c.770T>G	c.(769-771)TTA>TGA	p.L257*		NM_007218	NP_009149	Q8WU17	RN139_HUMAN	ring finger protein 139	257					negative regulation of cell proliferation|regulation of protein ubiquitination	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			kidney(1)	1	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ATGTACATCTTAAGGATGGCA	0.393									Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				92	202	---	---	---	---	PASS
NOL6	65083	broad.mit.edu	37	9	33473894	33473894	+	5'UTR	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33473894C>T	uc003zsz.2	-	1					SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zta.2_5'UTR|NOL6_uc010mjv.2_5'UTR|NOL6_uc011lob.1_5'UTR|NOL6_uc003ztb.1_5'UTR	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform						rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		GTCTATACCTCATAGCTTCCC	0.597													5	15	---	---	---	---	PASS
LOC440896	440896	broad.mit.edu	37	9	69192740	69192740	+	RNA	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69192740A>G	uc004afh.2	-	1		c.140T>C								Homo sapiens cDNA FLJ30529 fis, clone BRAWH2001052.												0						tcctaataccatgggctgatc	0.000													4	2	---	---	---	---	PASS
LRRC8A	56262	broad.mit.edu	37	9	131669449	131669449	+	Silent	SNP	T	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131669449T>A	uc004bwl.3	+	3	260	c.6T>A	c.(4-6)ATT>ATA	p.I2I	LRRC8A_uc010myp.2_Silent_p.I2I|LRRC8A_uc010myq.2_Silent_p.I2I	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	2					pre-B cell differentiation	integral to membrane					0						GAACCATGATTCCGGTGACAG	0.542													16	49	---	---	---	---	PASS
AKR1E2	83592	broad.mit.edu	37	10	4889437	4889437	+	Intron	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4889437T>C	uc001ihi.2	+						AKR1E2_uc001ihl.1_Intron|AKR1E2_uc001ihh.1_3'UTR|AKR1E2_uc009xhw.2_Intron|AKR1E2_uc001ihj.2_RNA|AKR1E2_uc001ihk.2_Intron	NM_001040177	NP_001035267	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2							cytoplasm	1,5-anhydro-D-fructose reductase activity				0						ATATGGCTCCTTCTTTTTAAA	0.343													10	171	---	---	---	---	PASS
MCM10	55388	broad.mit.edu	37	10	13225029	13225029	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13225029A>G	uc001ima.2	+	8	1131	c.1030A>G	c.(1030-1032)AAG>GAG	p.K344E	MCM10_uc001imb.2_Missense_Mutation_p.K343E|MCM10_uc001imc.2_Missense_Mutation_p.K343E	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	344					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						AGCGCTCTGGAAGACGGAGCA	0.483													5	160	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78709126	78709126	+	Splice_Site	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78709126T>C	uc001jxn.2	-	22	2662	c.2485_splice	c.e22-1	p.T829_splice	KCNMA1_uc001jxj.2_Splice_Site_p.T775_splice|KCNMA1_uc001jxk.1_Splice_Site_p.T447_splice|KCNMA1_uc009xrt.1_Splice_Site_p.T620_splice|KCNMA1_uc001jxl.1_Splice_Site_p.T454_splice|KCNMA1_uc001jxo.2_Splice_Site_p.T812_splice|KCNMA1_uc001jxm.2_Splice_Site_p.T771_splice|KCNMA1_uc001jxq.2_Splice_Site_p.T774_splice	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	ACTTCGAGTCTACAACAGGGA	0.478													3	27	---	---	---	---	PASS
FAM35A	54537	broad.mit.edu	37	10	88930275	88930275	+	Silent	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88930275G>C	uc001kei.3	+	5	1788	c.1674G>C	c.(1672-1674)CTG>CTC	p.L558L	FAM35A_uc001kej.3_5'UTR	NM_019054	NP_061927	Q86V20	FA35A_HUMAN	hypothetical protein LOC54537	558										ovary(2)|skin(2)	4						AAGACTTACTGGCATATGTGT	0.398													64	167	---	---	---	---	PASS
C10orf131	100127889	broad.mit.edu	37	10	97684091	97684091	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97684091C>A	uc010qoo.1	+	5	290	c.94C>A	c.(94-96)CAA>AAA	p.Q32K	uc001klg.1_Intron|uc001klj.1_Intron	NM_001130446	NP_001123918	B4DG41	B4DG41_HUMAN	hypothetical protein LOC100127889	32											0						AGAAGAAAATCAAAATGTAGC	0.254													33	390	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068347	5068347	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068347G>A	uc010qyv.1	+	1	592	c.592G>A	c.(592-594)GGT>AGT	p.G198S		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	198	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCGTATCAATGGTATCTATGG	0.448													160	402	---	---	---	---	PASS
TMEM86A	144110	broad.mit.edu	37	11	18726190	18726190	+	3'UTR	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18726190A>G	uc001moz.1	+	3					IGSF22_uc009yht.2_Intron|IGSF22_uc001mpa.2_Intron	NM_153347	NP_699178	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A							integral to membrane				ovary(1)	1						GGACCCTGGGACCCTTAATCT	0.333													12	38	---	---	---	---	PASS
LUZP2	338645	broad.mit.edu	37	11	25100364	25100364	+	3'UTR	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25100364A>T	uc001mqs.2	+	12					LUZP2_uc009yif.2_3'UTR|LUZP2_uc009yig.2_3'UTR	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						TTCCAGACCAATTATGATCCT	0.313													4	19	---	---	---	---	PASS
F2	2147	broad.mit.edu	37	11	46747604	46747604	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46747604A>G	uc001ndf.3	+	7	798	c.755A>G	c.(754-756)AAC>AGC	p.N252S	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	252	Kringle 2.				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)	CAGGACTTCAACTCAGCTGTG	0.657													11	22	---	---	---	---	PASS
CPSF7	79869	broad.mit.edu	37	11	61183665	61183665	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61183665G>T	uc001nrq.2	-	6	1011	c.877C>A	c.(877-879)CCA>ACA	p.P293T	CPSF7_uc001nro.2_Missense_Mutation_p.P284T|CPSF7_uc001nrp.2_Missense_Mutation_p.P336T|CPSF7_uc001nrr.2_Missense_Mutation_p.P284T|CPSF7_uc001nrs.1_Missense_Mutation_p.P194T	NM_001136040	NP_001129512	Q8N684	CPSF7_HUMAN	pre-mRNA cleavage factor I, 59 kDa subunit	293	Pro-rich.				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						AAGAAGGCTGGATTGAGGTGA	0.567													17	59	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64514199	64514199	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64514199A>G	uc001oax.3	-	20	3278	c.2461T>C	c.(2461-2463)TAT>CAT	p.Y821H	RASGRP2_uc009ypu.2_5'Flank|RASGRP2_uc009ypv.2_5'Flank|RASGRP2_uc009ypw.2_5'Flank|RASGRP2_uc001oaw.1_5'Flank|PYGM_uc001oay.3_Missense_Mutation_p.Y733H	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	821					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	TCCCGGGCATACTGGGCAATG	0.622													15	39	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96104210	96104210	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96104210C>A	uc009ywp.2	-	4	1419	c.1176G>T	c.(1174-1176)TTG>TTT	p.L392F	CCDC82_uc009ywq.2_Missense_Mutation_p.L392F|CCDC82_uc001pfx.3_Missense_Mutation_p.L392F|CCDC82_uc009ywr.2_Missense_Mutation_p.L392F	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	392							protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TTCTAGATACCAAGCTCTCTA	0.408													5	312	---	---	---	---	PASS
MMP1	4312	broad.mit.edu	37	11	102661075	102661075	+	3'UTR	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102661075A>G	uc001phi.2	-	10					uc001phh.1_Intron|MMP1_uc010ruv.1_3'UTR	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1						blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		CTGAGAAAATAGACAGTTCTT	0.328													5	276	---	---	---	---	PASS
PDGFD	80310	broad.mit.edu	37	11	103797665	103797665	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103797665C>A	uc001phq.2	-	6	1334	c.962G>T	c.(961-963)GGG>GTG	p.G321V	PDGFD_uc001php.2_Missense_Mutation_p.G315V	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1	321					positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CACGGTTTTCCCTGAATTGCA	0.408													49	107	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107197726	107197726	+	Silent	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107197726G>A	uc010rvp.1	-	18	2625	c.2595C>T	c.(2593-2595)ATC>ATT	p.I865I	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	865							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		AGCTTTCTCGGATGCCTTTCC	0.388													7	395	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108201113	108201113	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108201113A>T	uc001pkb.1	+	50	7865	c.7480A>T	c.(7480-7482)AAT>TAT	p.N2494Y	ATM_uc009yxr.1_Missense_Mutation_p.N2494Y|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.N1146Y|ATM_uc001pkg.1_Missense_Mutation_p.N851Y	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2494	FAT.				cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		CTGGCTTGAAAATTCTGGAGT	0.348			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			121	266	---	---	---	---	PASS
MIR125B1	406911	broad.mit.edu	37	11	121970479	121970479	+	RNA	SNP	C	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121970479C>A	hsa-mir-125b-1|MI0000446	-			c.74C>A			LOC399959_uc009zba.2_Intron|uc001pxz.1_Intron|LOC399959_uc001pya.3_Intron|LOC399959_uc001pyc.1_Intron|LOC399959_uc001pyd.1_Intron|uc001pye.1_5'Flank|uc010rzr.1_RNA																	0						CGACTCGCAGCTCCCAAGAGC	0.413													10	118	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1995485	1995485	+	Silent	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1995485G>A	uc001qjp.2	-	8	1128	c.897C>T	c.(895-897)AGC>AGT	p.S299S	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	299	VWFA.|MIDAS-like motif.|Extracellular (Potential).	Divalent metal cation (By similarity).				integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TCATACTGCCGCTCACGTCCA	0.493													12	233	---	---	---	---	PASS
TNFRSF1A	7132	broad.mit.edu	37	12	6439822	6439822	+	Silent	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6439822G>T	uc001qnu.2	-	7	962	c.681C>A	c.(679-681)CTC>CTA	p.L227L	TNFRSF1A_uc001qnt.2_Silent_p.L119L|TNFRSF1A_uc010sey.1_5'UTR|TNFRSF1A_uc010sez.1_Silent_p.L119L|TNFRSF1A_uc009zek.2_Silent_p.L184L	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor	227	Helical; (Potential).				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						CAATGAAGAGGAGGGATAAAA	0.557													36	94	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15669743	15669743	+	Silent	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15669743G>A	uc001rcv.1	+	9	1806	c.1632G>A	c.(1630-1632)ACG>ACA	p.T544T	PTPRO_uc001rcw.1_Silent_p.T544T|PTPRO_uc001rcu.1_Silent_p.T544T	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	544	Fibronectin type-III 6.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				TGGGTCCTACGGCCGTGGTTC	0.428													5	274	---	---	---	---	PASS
KIAA0748	9840	broad.mit.edu	37	12	55357653	55357653	+	Silent	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55357653T>C	uc001sgn.3	-	8	638	c.528A>G	c.(526-528)AAA>AAG	p.K176K	KIAA0748_uc001sgl.3_Silent_p.K38K|KIAA0748_uc001sgm.3_5'UTR|KIAA0748_uc010spb.1_5'UTR|KIAA0748_uc010spc.1_Silent_p.K38K|KIAA0748_uc010spd.1_Silent_p.K176K|KIAA0748_uc001sgo.3_Intron	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	176										ovary(1)|central_nervous_system(1)	2						GAGAAGTGTCTTTGTGATCCT	0.502													6	265	---	---	---	---	PASS
OR6C68	403284	broad.mit.edu	37	12	55886972	55886972	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55886972G>C	uc010spo.1	+	1	826	c.826G>C	c.(826-828)GGT>CGT	p.G276R		NM_001005519	NP_001005519	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CATTAATAAAGGTGTGTCAGT	0.358													57	126	---	---	---	---	PASS
OR6C4	341418	broad.mit.edu	37	12	55945508	55945508	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55945508C>G	uc010spp.1	+	1	498	c.498C>G	c.(496-498)TTC>TTG	p.F166L		NM_001005494	NP_001005494	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGGTAGATTTCTGTGTCTCCA	0.478													50	116	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101413836	101413836	+	Silent	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101413836G>A	uc010svm.1	+	9	1331	c.759G>A	c.(757-759)ACG>ACA	p.T253T	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Silent_p.T218T|ANO4_uc001thx.2_Silent_p.T253T	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	253	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						ACAAAGAAACGTTCTTCAACA	0.299										HNSCC(74;0.22)			8	261	---	---	---	---	PASS
PWP1	11137	broad.mit.edu	37	12	108082496	108082496	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108082496G>A	uc001tmo.1	+	3	323	c.236G>A	c.(235-237)GGT>GAT	p.G79D	PWP1_uc001tmn.1_RNA|PWP1_uc009zuu.1_Missense_Mutation_p.G79D	NM_007062	NP_008993	Q13610	PWP1_HUMAN	periodic tryptophan protein 1	79					transcription, DNA-dependent	nucleus					0						CTGGAGGATGGTGACCCAGAG	0.532													85	167	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109947471	109947471	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109947471T>C	uc001top.2	+	16	2296	c.1693T>C	c.(1693-1695)TCT>CCT	p.S565P	UBE3B_uc001toq.2_Missense_Mutation_p.S565P|UBE3B_uc001tos.2_5'UTR|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Missense_Mutation_p.S565P	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	565					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						CACTATCTCCTCTTTCCTGAA	0.398													9	792	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133327385	133327385	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133327385T>A	uc001ukx.2	-	3	758	c.691A>T	c.(691-693)ATG>TTG	p.M231L	ANKLE2_uc001uky.3_Missense_Mutation_p.M169L	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	231						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CCTTTGATCATCTTGACAGCT	0.378													150	355	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20000577	20000577	+	Silent	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20000577C>T	uc001umd.2	-	19	1594	c.1383G>A	c.(1381-1383)CAG>CAA	p.Q461Q	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Silent_p.Q350Q|TPTE2_uc001ume.2_Silent_p.Q384Q|TPTE2_uc009zzm.2_Silent_p.Q132Q|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Silent_p.Q132Q	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	461	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AAGAGAAAAACTGCACTTTCA	0.343													5	338	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22471461	22471461	+	Intron	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22471461T>C	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wct.3_Silent_p.A4A					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGCTGTCTGCTTCCTGCTCAG	0.398													6	321	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	23018621	23018621	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23018621A>C	uc001wbw.2	+	5	728	c.719A>C	c.(718-720)GAA>GCA	p.E240A	uc001wcx.3_RNA|uc001wdv.3_Missense_Mutation_p.E166A|uc001wec.2_Missense_Mutation_p.E125A|uc001wee.3_Missense_Mutation_p.E54A|uc001weg.2_Missense_Mutation_p.E54A|uc001wei.2_Missense_Mutation_p.E54A|uc001wej.2_Missense_Mutation_p.E54A|uc001wek.2_Missense_Mutation_p.E111A|uc001wel.2_Missense_Mutation_p.E54A|uc001wem.3_Missense_Mutation_p.E54A|uc001weo.2_Missense_Mutation_p.E54A|uc001wep.2_Missense_Mutation_p.E54A|uc001weq.2_Missense_Mutation_p.E118A|uc001wer.2_RNA|uc001wet.2_Missense_Mutation_p.E54A|uc001weu.2_Missense_Mutation_p.E54A|uc001wev.2_Missense_Mutation_p.E119A|uc001wew.2_Missense_Mutation_p.E54A|uc010ajx.1_Missense_Mutation_p.E54A|uc001wfd.1_Missense_Mutation_p.E54A|uc001wfe.2_Missense_Mutation_p.E126A|uc001wfh.1_Missense_Mutation_p.E117A|uc001wfk.2_Missense_Mutation_p.E54A|uc010ajy.1_Missense_Mutation_p.E54A|uc001wfn.2_Missense_Mutation_p.E54A|uc001wfp.2_Missense_Mutation_p.E54A|uc001wfw.1_Missense_Mutation_p.E54A|uc001wfx.2_Missense_Mutation_p.E54A|uc001wgd.2_Missense_Mutation_p.E111A|uc001wge.3_Missense_Mutation_p.E54A|uc010tmw.1_Missense_Mutation_p.E54A|uc010tmx.1_Missense_Mutation_p.E54A|uc001wgh.2_Missense_Mutation_p.E54A|uc001wgj.1_Missense_Mutation_p.E54A|uc001wgk.2_Missense_Mutation_p.E54A					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AAAAGCTTTGAAACAGGTAAG	0.488													37	110	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	38277972	38277972	+	Intron	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38277972C>T	uc001wug.2	+						uc001wuh.2_Missense_Mutation_p.A130V|uc001wui.2_RNA|uc001wuj.2_Missense_Mutation_p.A227V					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		TTAACTACAGCTATCAGCATG	0.279													8	444	---	---	---	---	PASS
PNN	5411	broad.mit.edu	37	14	39645318	39645318	+	Silent	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39645318T>C	uc001wuw.3	+	2	247	c.150T>C	c.(148-150)CCT>CCC	p.P50P		NM_002687	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	50	Necessary for interaction with RNPS1.|Necessary for mediating alternative 5' splicing.|Necessary for interactions with KRT8, KRT18 and KRT19.				cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity			ovary(1)	1	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		TTTCTGGTCCTGGTGGAGGTA	0.418													160	376	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55455841	55455841	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55455841A>G	uc001xbm.1	-	13	1509	c.1431T>C	c.(1429-1431)CAT>CAC	p.H477H	WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Silent_p.H354H	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	477						cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AGTGTGTTGCATGGTGTATGG	0.393													9	558	---	---	---	---	PASS
FBXO34	55030	broad.mit.edu	37	14	55817639	55817639	+	Silent	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55817639T>G	uc001xbu.2	+	2	776	c.531T>G	c.(529-531)CCT>CCG	p.P177P	FBXO34_uc001xbv.2_RNA|FBXO34_uc010aoo.2_Silent_p.P177P	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN	F-box only protein 34	177										ovary(2)|lung(2)|skin(1)	5						GCTACCAACCTGAGCCTTTTG	0.483													35	65	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58923511	58923511	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58923511A>G	uc001xdv.3	+	10	1618	c.1345A>G	c.(1345-1347)ACA>GCA	p.T449A	KIAA0586_uc010trr.1_Missense_Mutation_p.T490A|KIAA0586_uc001xdt.3_Missense_Mutation_p.T405A|KIAA0586_uc001xdu.3_Missense_Mutation_p.T434A|KIAA0586_uc010trs.1_Missense_Mutation_p.T364A|KIAA0586_uc010trt.1_Missense_Mutation_p.T309A|KIAA0586_uc010tru.1_Missense_Mutation_p.T309A	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	449										ovary(1)	1						AGAGAAAGAAACAAATAGCAT	0.318													6	238	---	---	---	---	PASS
VIPAR	63894	broad.mit.edu	37	14	77901690	77901690	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77901690C>T	uc001xtt.1	-	15	1297	c.959G>A	c.(958-960)CGA>CAA	p.R320Q	VIPAR_uc001xtu.1_Missense_Mutation_p.R320Q|VIPAR_uc010tvj.1_Missense_Mutation_p.R271Q|VIPAR_uc001xtv.1_Missense_Mutation_p.R320Q	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	320					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						GGGGTGCTTTCGGAAGATCTC	0.463													5	252	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92470875	92470875	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92470875T>C	uc001xzy.2	-	11	4233	c.3445A>G	c.(3445-3447)AGT>GGT	p.S1149G	TRIP11_uc010auf.1_Missense_Mutation_p.S885G	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1149	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TGGCCACTACTTTCAAATCTA	0.333			T	PDGFRB	AML								6	238	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102446833	102446833	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102446833A>G	uc001yks.2	+	5	1071	c.907A>G	c.(907-909)ATC>GTC	p.I303V		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	303	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GACTCTGGATATCTTGAAACA	0.448													44	93	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50168715	50168715	+	Silent	SNP	C	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50168715C>T	uc001zxu.2	-	25	2929	c.2787G>A	c.(2785-2787)GTG>GTA	p.V929V	ATP8B4_uc010ber.2_Silent_p.V802V|ATP8B4_uc010ufd.1_Silent_p.V739V|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_5'UTR	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	929	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TCTGGTCACTCACATCCTGTA	0.413													56	124	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52892386	52892386	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52892386T>C	uc002acg.3	-	9	2740	c.2587A>G	c.(2587-2589)AAA>GAA	p.K863E	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Missense_Mutation_p.K775E|KIAA1370_uc010ugf.1_Missense_Mutation_p.K870E	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	863											0				all cancers(107;0.0803)		AAAAATGGTTTTTCATGAATA	0.308													8	525	---	---	---	---	PASS
LASS3	204219	broad.mit.edu	37	15	101009686	101009686	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101009686C>G	uc002bvz.2	-	11	1244	c.742G>C	c.(742-744)GCT>CCT	p.A248P	LASS3_uc002bwa.2_Missense_Mutation_p.A259P|LASS3_uc002bwb.2_Missense_Mutation_p.A248P	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	248	TLC.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			AACATCTTAGCAGACTGCAAA	0.299													52	116	---	---	---	---	PASS
C16orf89	146556	broad.mit.edu	37	16	5115948	5115948	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5115948C>G	uc010bud.2	-	1	164	c.76G>C	c.(76-78)GGT>CGT	p.G26R	ALG1_uc002cyj.2_Intron|C16orf89_uc002cyk.3_Missense_Mutation_p.G26R	NM_152459	NP_689672	Q6UX73	CP089_HUMAN	hypothetical protein LOC146556 isoform 1	Error:Variant_position_missing_in_Q6UX73_after_alignment						extracellular region				ovary(1)|skin(1)	2						CGCTCAGCACCCTGAGCTCTG	0.667													4	2	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48149472	48149472	+	Missense_Mutation	SNP	G	A	A	rs146005796		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48149472G>A	uc002efc.1	-	13	2189	c.1843C>T	c.(1843-1845)CGC>TGC	p.R615C	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	615	ABC transporter 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				TAGACAGCGCGGGCCAGGCTA	0.627													14	24	---	---	---	---	PASS
TUBB3	10381	broad.mit.edu	37	16	89986049	89986049	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89986049T>C	uc002fpf.2	+	1	791	c.383T>C	c.(382-384)ATG>ACG	p.M128T	MC1R_uc002fpe.3_Missense_Mutation_p.M128T|TUBB3_uc010ciz.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	Error:Variant_position_missing_in_Q13509_after_alignment					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TGCAGCTCCATGCTGTCCAGC	0.652													6	9	---	---	---	---	PASS
TUBB3	10381	broad.mit.edu	37	16	89986131	89986131	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89986131C>G	uc002fpf.2	+	1	873	c.465C>G	c.(463-465)ATC>ATG	p.I155M	MC1R_uc002fpe.3_Missense_Mutation_p.I155M|TUBB3_uc010ciz.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	Error:Variant_position_missing_in_Q13509_after_alignment					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		ACCACAGCATCGTGACCCTGC	0.647													3	16	---	---	---	---	PASS
TUSC5	286753	broad.mit.edu	37	17	1198861	1198861	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1198861C>G	uc002fsi.1	+	2	803	c.464C>G	c.(463-465)ACC>AGC	p.T155S		NM_172367	NP_758955	Q8IXB3	TUSC5_HUMAN	LOST1	155	Helical; (Potential).				response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTCAGCATTACCCTCATCATC	0.612													9	17	---	---	---	---	PASS
LOC220594	220594	broad.mit.edu	37	17	18445401	18445401	+	5'Flank	SNP	C	T	T	rs113604847	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18445401C>T	uc002gty.2	-						CCDC144B_uc002gua.3_RNA					Homo sapiens mRNA for TL132.												0						TCTGTGCATACTCTTTTGTTA	0.318													8	96	---	---	---	---	PASS
SLC5A10	125206	broad.mit.edu	37	17	18874338	18874338	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18874338T>C	uc002guu.1	+	8	694	c.653T>C	c.(652-654)ATC>ACC	p.I218T	SLC5A10_uc002gur.1_Missense_Mutation_p.I135T|SLC5A10_uc002gut.1_Missense_Mutation_p.I218T|SLC5A10_uc002guv.1_Missense_Mutation_p.I191T|SLC5A10_uc010vyl.1_Missense_Mutation_p.I218T	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose	218	Helical; (Potential).				sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						TTTGACCAGATCGGTGGTTAC	0.622													5	26	---	---	---	---	PASS
SLC47A2	146802	broad.mit.edu	37	17	19619790	19619790	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19619790A>G	uc002gwe.3	-	1	254	c.79T>C	c.(79-81)TTT>CTT	p.F27L	SLC47A2_uc002gwg.3_Missense_Mutation_p.F27L|SLC47A2_uc002gwf.3_Missense_Mutation_p.F27L|SLC47A2_uc002gwh.3_RNA|SLC47A2_uc002gwi.2_Intron|SLC47A2_uc010cqs.1_RNA|SLC47A2_uc010cqt.1_5'Flank	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN	solute carrier family 47, member 2 isoform 1	27	Cytoplasmic (Potential).					integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)					TCAGTCCCAAAGCCTCTGGGA	0.642													4	24	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38508320	38508320	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38508320A>G	uc002huk.1	+	5	1083	c.628A>G	c.(628-630)ACG>GCG	p.T210A	RARA_uc002hul.3_Missense_Mutation_p.T210A|RARA_uc010wfe.1_Missense_Mutation_p.T113A|RARA_uc002hun.1_Missense_Mutation_p.T205A	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	210	Ligand-binding.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CAAATACACTACGGTATGGCT	0.632			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								6	20	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48916926	48916926	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48916926T>A	uc002isv.3	+	2	971	c.277T>A	c.(277-279)TAC>AAC	p.Y93N	WFIKKN2_uc010dbu.2_5'UTR	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	93						extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GGCGGCCCGCTACATGGACGT	0.582													13	18	---	---	---	---	PASS
RPS6KB1	6198	broad.mit.edu	37	17	58008993	58008993	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58008993G>A	uc002ixy.2	+	7	701	c.598G>A	c.(598-600)GCA>ACA	p.A200T	RPS6KB1_uc010ddj.1_Missense_Mutation_p.A200T|RPS6KB1_uc010wom.1_Missense_Mutation_p.A147T|RPS6KB1_uc010won.1_Missense_Mutation_p.A177T|RPS6KB1_uc010woo.1_Missense_Mutation_p.A135T	NM_003161	NP_003152	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide	200	Protein kinase.				apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity			large_intestine(1)	1	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			CTTTTACTTGGCAGAAATCTC	0.378													11	343	---	---	---	---	PASS
HELZ	9931	broad.mit.edu	37	17	65141857	65141857	+	Splice_Site	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65141857A>G	uc010wqk.1	-	21	2959	c.2772_splice	c.e21+1	p.E924_splice	HELZ_uc002jfv.3_Splice_Site|HELZ_uc002jfx.3_Splice_Site_p.E923_splice	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GAATTAAGGTACCTCTGCATT	0.323													93	241	---	---	---	---	PASS
NAT9	26151	broad.mit.edu	37	17	72768188	72768188	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72768188T>C	uc002jlq.2	-	6	474	c.400A>G	c.(400-402)ACC>GCC	p.T134A	NAT9_uc002jlr.2_Missense_Mutation_p.T133A	NM_015654	NP_056469	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9	134	N-acetyltransferase.					protein complex	N-acetyltransferase activity				0						CCTAGCGTGGTCACTCCTCGC	0.552													5	155	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7042148	7042148	+	Silent	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7042148G>A	uc002knm.2	-	9	1351	c.1257C>T	c.(1255-1257)CAC>CAT	p.H419H	LAMA1_uc010wzj.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	419	Laminin EGF-like 3.			H -> E (in Ref. 3; CAA41418).	axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACTTACCATTGTGTAAGTCAG	0.433													35	65	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18546995	18546995	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18546995G>A	uc002kte.2	-	27	4176	c.3235C>T	c.(3235-3237)CAG>TAG	p.Q1079*		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1079	Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CTGGCCAACTGCATCTGAAGC	0.368													134	300	---	---	---	---	PASS
ESCO1	114799	broad.mit.edu	37	18	19119910	19119910	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19119910G>A	uc002kth.1	-	9	2948	c.2014C>T	c.(2014-2016)CCT>TCT	p.P672S	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	672					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						GGGTCTTCAGGAAGAACCATT	0.289													94	276	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29121256	29121256	+	Silent	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29121256A>G	uc002kwu.3	+	13	2168	c.1980A>G	c.(1978-1980)GAA>GAG	p.E660E		NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	660	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			GGAATAATGAAGGAGCACCAC	0.468													6	198	---	---	---	---	PASS
ONECUT2	9480	broad.mit.edu	37	18	55143848	55143848	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55143848G>A	uc002lgo.2	+	2	1440	c.1408G>A	c.(1408-1410)GTC>ATC	p.V470I		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	470	Homeobox.				organ morphogenesis	nucleus	sequence-specific DNA binding	p.V470I(1)		ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GCTCACAACCGTCAGCAACTT	0.587													18	35	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6190637	6190637	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6190637A>T	uc002mef.1	+	14	2197	c.1970A>T	c.(1969-1971)TAC>TTC	p.Y657F	ACSBG2_uc002mee.1_Missense_Mutation_p.Y470F|ACSBG2_uc002meg.1_Missense_Mutation_p.Y657F|ACSBG2_uc002meh.1_Missense_Mutation_p.Y657F|ACSBG2_uc002mei.1_Missense_Mutation_p.Y607F|ACSBG2_uc010xiz.1_Missense_Mutation_p.Y629F|uc002mej.1_RNA	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2	657					cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						GCCCAGAAATACAAAAAACAA	0.403													8	359	---	---	---	---	PASS
ZNF844	284391	broad.mit.edu	37	19	12188257	12188257	+	3'UTR	SNP	A	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12188257A>T	uc002mtb.2	+	4					ZNF844_uc010dym.1_3'UTR	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCATGAAAAGACCCACACCAG	0.433													11	23	---	---	---	---	PASS
IL27RA	9466	broad.mit.edu	37	19	14157347	14157347	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14157347T>C	uc002mxx.2	+	8	1481	c.1058T>C	c.(1057-1059)GTG>GCG	p.V353A		NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN	class I cytokine receptor precursor	353	Extracellular (Potential).|Fibronectin type-III 2.				cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0						GAGCATGTAGTGGACTGGGCT	0.652													12	21	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17115085	17115085	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17115085T>C	uc002nfb.2	-	8	844	c.812A>G	c.(811-813)TAT>TGT	p.Y271C		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	224						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CAACTTACCATACTTCTGAAC	0.279													46	83	---	---	---	---	PASS
ZNF675	171392	broad.mit.edu	37	19	23836804	23836804	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23836804G>A	uc002nri.2	-	4	1113	c.931C>T	c.(931-933)CCC>TCC	p.P311S		NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675	311					bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CATATGTAGGGTTGCTCTCCA	0.378													6	94	---	---	---	---	PASS
AKT2	208	broad.mit.edu	37	19	40740421	40740421	+	Intron	SNP	A	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40740421A>G	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_3'UTR|AKT2_uc002one.2_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ggcatcccacacgtcattcct	0.000			A		ovarian|pancreatic 								3	3	---	---	---	---	PASS
VASP	7408	broad.mit.edu	37	19	46024608	46024608	+	Silent	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46024608T>G	uc002pcg.2	+	4	714	c.372T>G	c.(370-372)CTT>CTG	p.L124L	VASP_uc010eki.2_Intron|VASP_uc002pci.2_Silent_p.L111L	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	124	Pro-rich.				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		CCCCAGCACTTCCCACCTGGT	0.652													14	24	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17417410	17417410	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17417410G>T	uc002wpm.2	+	8	1087	c.767G>T	c.(766-768)AGT>ATT	p.S256I	PCSK2_uc002wpl.2_Missense_Mutation_p.S237I|PCSK2_uc010zrm.1_Missense_Mutation_p.S221I	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	256	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCCTCCATCAGTCATATGCCA	0.592													8	10	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20569934	20569934	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20569934T>C	uc002wrz.2	-	18	2560	c.2417A>G	c.(2416-2418)AAG>AGG	p.K806R	RALGAPA2_uc010gcx.2_Missense_Mutation_p.K510R|RALGAPA2_uc010zsg.1_Missense_Mutation_p.K254R	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	806					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						ATGTTCTCTCTTCACATGTCC	0.368													8	713	---	---	---	---	PASS
ITCH	83737	broad.mit.edu	37	20	33012330	33012330	+	Silent	SNP	A	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33012330A>C	uc010geu.1	+	8	835	c.643A>C	c.(643-645)AGA>CGA	p.R215R	ITCH_uc002xak.2_Silent_p.R174R|ITCH_uc010zuj.1_Silent_p.R64R	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase	215					apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						GGATGAAACAAGGTAAGCATT	0.338													149	340	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30426525	30426525	+	3'UTR	SNP	T	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30426525T>G	uc002ymy.2	+	18					USP16_uc002ymx.2_3'UTR|USP16_uc002ymw.2_3'UTR|USP16_uc011acm.1_3'UTR|USP16_uc011acn.1_3'UTR|USP16_uc011aco.1_3'UTR	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a						cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						CAAAAGCACTTTTTCTGGAAA	0.323													32	57	---	---	---	---	PASS
DFFB	1677	broad.mit.edu	37	1	3800477	3800477	+	3'UTR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3800477delG	uc001alc.2	+	7					DFFB_uc001ale.2_RNA|DFFB_uc009vlp.2_RNA|DFFB_uc001alb.2_RNA|DFFB_uc010nzn.1_3'UTR|DFFB_uc009vlq.2_RNA|DFFB_uc009vlr.2_3'UTR|DFFB_uc001ald.2_3'UTR	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta						apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CTGAATTGTTGGGGttttttt	0.169													4	3	---	---	---	---	
AJAP1	55966	broad.mit.edu	37	1	4717538	4717538	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4717538delG	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		ATGGGCACCTGGGGACTCTGA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11399326	11399327	+	IGR	INS	-	G	G	rs149997617		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11399326_11399327insG								UBIAD1 (50836 upstream) : PTCHD2 (139968 downstream)																							aaaaaaaaaaaaaagaaaCTAA	0.272													5	3	---	---	---	---	
PLEKHM2	23207	broad.mit.edu	37	1	16056227	16056228	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16056227_16056228insT	uc010obo.1	+							NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M						Golgi organization	cytoplasm	kinesin binding			ovary(1)	1		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCGCTCAAGACTAAGCCCTGTC	0.569													20	9	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17226274	17226275	+	Intron	INS	-	A	A	rs138568945	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17226274_17226275insA	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TTTCTAACATGAAAAAATAATA	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18733318	18733318	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18733318delG								IGSF21 (28342 upstream) : KLHDC7A (74106 downstream)																							acggtagggtgggaacatagg	0.000													4	2	---	---	---	---	
CAPZB	832	broad.mit.edu	37	1	19706501	19706502	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19706501_19706502insA	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		GCATGTTAAGGAAAAAAAAAGT	0.460													4	2	---	---	---	---	
KIF17	57576	broad.mit.edu	37	1	21014538	21014538	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21014538delT	uc001bdr.3	-						KIF17_uc001bdp.3_5'Flank|KIF17_uc001bdq.3_5'Flank|KIF17_uc009vpx.2_Intron|KIF17_uc001bds.3_Intron	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		tttttgtttgttttttttttg	0.204													3	3	---	---	---	---	
COL16A1	1307	broad.mit.edu	37	1	32171835	32171836	+	5'Flank	DEL	TC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32171835_32171836delTC	uc001btk.1	-						COL16A1_uc001btl.3_5'Flank	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor						cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGTACATAATTCTCAGAATGCC	0.421													4	2	---	---	---	---	
YARS	8565	broad.mit.edu	37	1	33276898	33276898	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33276898delG	uc001bvy.1	-							NM_003680	NP_003671	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase						apoptosis|tyrosyl-tRNA aminoacylation	cytosol|extracellular space|nucleus|soluble fraction	ATP binding|interleukin-8 receptor binding|signal transducer activity|tRNA binding|tyrosine-tRNA ligase activity			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	gtagccccttgcagcctctta	0.015													6	5	---	---	---	---	
CLSPN	63967	broad.mit.edu	37	1	36231152	36231152	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36231152delA	uc001bzi.2	-						CLSPN_uc009vux.2_Intron	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				tagtaacggtaaaaaaaaaaa	0.065													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36867494	36867495	+	IGR	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36867494_36867495insG								LSM10 (4001 upstream) : OSCP1 (16013 downstream)																							acccaaagtctgggggggtgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46990301	46990301	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46990301delC								DMBX1 (10417 upstream) : KNCN (21015 downstream)																							CTCAATTGTTCCATTCAGAGC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56652093	56652094	+	IGR	DEL	CG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56652093_56652094delCG								USP24 (971331 upstream) : PPAP2B (308339 downstream)																							caagcgttgccgatgagaacaa	0.000													4	2	---	---	---	---	
FGGY	55277	broad.mit.edu	37	1	59827872	59827873	+	Intron	INS	-	CTCTT	CTCTT	rs143898997	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59827872_59827873insCTCTT	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					tcttctttctcctatttaattt	0.059													5	3	---	---	---	---	
ATG4C	84938	broad.mit.edu	37	1	63300856	63300858	+	Intron	DEL	AAA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63300856_63300858delAAA	uc001dat.2	+						ATG4C_uc001dau.2_Intron	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8						autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						AGGCCTGTTTAAAAAAAAAAAAA	0.310													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64865905	64865905	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64865905delT								UBE2U (155878 upstream) : CACHD1 (70571 downstream)																							tatatttctctttctctcttc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	66154934	66154934	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66154934delT								LEPR (52114 upstream) : PDE4B (103259 downstream)																							TTGTTGTTGCTTTTTTTTTTC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	66200443	66200444	+	IGR	INS	-	T	T	rs148034728	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66200443_66200444insT								LEPR (97623 upstream) : PDE4B (57749 downstream)																							acattgtgctatttttttttat	0.000													3	4	---	---	---	---	
IL23R	149233	broad.mit.edu	37	1	67612742	67612742	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67612742delT	uc009waz.2	+									Q5VWK5	IL23R_HUMAN	RecName: Full=Interleukin-23 receptor;          Short=IL-23R; Flags: Precursor;						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						ttctctgagatttttTTTTTC	0.224													4	2	---	---	---	---	
TNNI3K	51086	broad.mit.edu	37	1	74892892	74892892	+	Intron	DEL	G	-	-	rs35246247		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74892892delG	uc001dgf.1	+						TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GGATTGCATAGAGACTTTATA	0.348													4	3	---	---	---	---	
TNNI3K	51086	broad.mit.edu	37	1	74993025	74993028	+	Intron	DEL	TCAT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74993025_74993028delTCAT	uc001dgf.1	+						TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GGAGGAAACATCATTCATTCATTC	0.319													4	2	---	---	---	---	
AK5	26289	broad.mit.edu	37	1	77837192	77837192	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77837192delT	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						ATCTGGTTAATTTTTTTTTCT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79132403	79132403	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79132403delA								IFI44 (2642 upstream) : ELTD1 (223048 downstream)																							TATTTGTGTTAAAAAAAAAAA	0.378													10	5	---	---	---	---	
ELTD1	64123	broad.mit.edu	37	1	79404212	79404213	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404212_79404213insT	uc001diq.3	-							NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGAATTAATAATTTTTTTAAAT	0.257													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81656190	81656190	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81656190delA								None (None upstream) : LPHN2 (115655 downstream)																							ACCCTCCAATAAAAAAAAAAT	0.338													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88444851	88444851	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88444851delT								LMO4 (630248 upstream) : PKN2 (705071 downstream)																							CATCATTCCCTTTATTAGCTT	0.378													4	2	---	---	---	---	
RWDD3	25950	broad.mit.edu	37	1	95673234	95673234	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95673234delG	uc001drd.3	+						uc001dre.1_Intron	NM_152487	NP_689700	Q9Y3V2	RWDD3_HUMAN	transmembrane protein 56							cytoplasm|nucleus	protein binding			ovary(1)	1		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		aagggaaagagggaggcagga	0.000													4	2	---	---	---	---	
VCAM1	7412	broad.mit.edu	37	1	101189831	101189831	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101189831delA	uc001dti.2	+						VCAM1_uc001dtj.2_Intron|VCAM1_uc010ouj.1_Intron	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a						heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	actcttttggaaagcagtggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	103755005	103755005	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103755005delT								COL11A1 (180953 upstream) : RNPC3 (313573 downstream)																							tcgcagcttctttgttgagaa	0.000													4	2	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109914718	109914718	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109914718delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron|SORT1_uc009wfb.2_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		TCAATGGGAGAAAAAAATACG	0.433													4	2	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114267762	114267762	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114267762delA	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAATCTACTAAAAAAAAAAA	0.348													6	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144527406	144527406	+	Intron	DEL	G	-	-	rs2940061	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144527406delG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						ttgattttttgttttgtagag	0.000													4	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148001285	148001286	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001285_148001286insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CATCATTTTTGAAAAGAGTATT	0.277													2	6	---	---	---	---	
FLAD1	80308	broad.mit.edu	37	1	154964919	154964919	+	Intron	DEL	A	-	-	rs79704914		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154964919delA	uc001fgf.1	+						FLAD1_uc001fge.1_Intron|FLAD1_uc001fgg.1_Intron|FLAD1_uc001fgh.1_Intron|LENEP_uc001fgi.2_5'Flank	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform						FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			actccgtctcaaaaaaaaaaT	0.229													4	4	---	---	---	---	
FCRL3	115352	broad.mit.edu	37	1	157653322	157653322	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157653322delG	uc001frb.2	-						FCRL3_uc001fqx.3_Intron|FCRL3_uc001fqy.3_Intron|FCRL3_uc001fqz.3_Intron|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_Intron|FCRL3_uc001fra.2_Intron|FCRL3_uc001frc.1_Intron	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					GTCACAACCTGGGTCAGGTGC	0.418													4	2	---	---	---	---	
SPTA1	6708	broad.mit.edu	37	1	158653579	158653579	+	Intron	DEL	T	-	-	rs35379131		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158653579delT	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAATAACTGATTTTTTTTTGG	0.328													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	170095908	170095908	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170095908delT								KIFAP3 (52029 upstream) : METTL11B (19280 downstream)																							gctcattcactttcctctgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	170479299	170479303	+	Intron	DEL	AGCAG	-	-	rs67806161		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170479299_170479303delAGCAG	uc001ggy.1	-											Homo sapiens cDNA FLJ39010 fis, clone NT2RI2026758.																		GGTActgaaaagcagagactatctt	0.224													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	172613341	172613342	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172613341_172613342insA								C1orf9 (32370 upstream) : FASLG (14843 downstream)																							CAGGCCCTGTTAGGGGAAGGGC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177399990	177399990	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177399990delT								FAM5B (148433 upstream) : SEC16B (497499 downstream)																							atggaattgattttttttttc	0.020													4	2	---	---	---	---	
C1orf125	126859	broad.mit.edu	37	1	179462338	179462339	+	Intron	INS	-	CTAT	CTAT	rs142692537		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179462338_179462339insCTAT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						tgtctgatctactaacaccaaa	0.000													6	6	---	---	---	---	
CEP350	9857	broad.mit.edu	37	1	180060144	180060144	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180060144delT	uc001gnt.2	+						CEP350_uc009wxl.2_Intron|CEP350_uc001gnv.2_Intron|CEP350_uc001gnw.1_Intron|CEP350_uc001gnx.1_5'Flank	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4						gttttttgggttttttttttg	0.075													6	3	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181633593	181633594	+	Intron	DEL	CC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181633593_181633594delCC	uc001gow.2	+						CACNA1E_uc009wxs.2_Intron	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TGTAATATTACCCCCATTTTAG	0.248													2	4	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183853716	183853717	+	Intron	DEL	AT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183853716_183853717delAT	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						GTCTGTTGAAATGGACACCATG	0.351													35	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187008355	187008355	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187008355delA								PLA2G4A (50250 upstream) : None (None downstream)																							TGAGGCAGGGAAAAAAAAAGG	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200423913	200423914	+	Intron	INS	-	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200423913_200423914insC	uc010ppi.1	+											Homo sapiens clone HA_003012 unknown mRNA.																		atcttcaccatccccccagctc	0.000													4	2	---	---	---	---	
PPFIA4	8497	broad.mit.edu	37	1	203025004	203025006	+	Intron	DEL	GAT	-	-	rs112453902	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203025004_203025006delGAT	uc001gyz.2	+						PPFIA4_uc009xaj.2_Intron|PPFIA4_uc010pqf.1_Intron|PPFIA4_uc001gza.2_Intron|PPFIA4_uc001gzb.1_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CTCTCCCTTGGATGAGCCCAGAC	0.512													4	2	---	---	---	---	
PPFIA4	8497	broad.mit.edu	37	1	203025015	203025016	+	Intron	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203025015_203025016delAC	uc001gyz.2	+						PPFIA4_uc009xaj.2_Intron|PPFIA4_uc010pqf.1_Intron|PPFIA4_uc001gza.2_Intron|PPFIA4_uc001gzb.1_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						ATGAGCCCAGACTGCTTAAGAA	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207470142	207470146	+	IGR	DEL	AAAGT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207470142_207470146delAAAGT								C4BPA (151834 upstream) : CD55 (24671 downstream)																							GAAGTTTGGGAAAGTCCAGATGTAG	0.415													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209264939	209264940	+	IGR	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209264939_209264940delAC								PLXNA2 (847274 upstream) : LOC642587 (337228 downstream)																							ctatctagttacacacacacac	0.000													4	2	---	---	---	---	
AGT	183	broad.mit.edu	37	1	230846729	230846729	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230846729delA	uc001hty.3	-						AGT_uc009xfe.2_5'Flank|AGT_uc009xff.2_Intron	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	TCATGTCTACAAAAAAAAGAA	0.303													4	2	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233192656	233192657	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233192656_233192657insT	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				TTTCCAAAGAATTTTTTTTTCC	0.347													4	2	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242403896	242403896	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242403896delA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AATTGAAGGTAAATATGTAAG	0.368													4	2	---	---	---	---	
SDCCAG8	10806	broad.mit.edu	37	1	243431782	243431782	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243431782delA	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AATCAGCGCCAAATTCATTTC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	248604274	248604275	+	IGR	INS	-	A	A	rs143324771	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248604274_248604275insA								OR2T1 (33870 upstream) : OR2T2 (11824 downstream)																							GAACTCTAAATAGTAATCACCA	0.347													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5613570	5613571	+	IGR	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5613570_5613571delGT								None (None upstream) : SOX11 (219228 downstream)																							AAATGAAGGAGTGTGTGTGTGT	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6570091	6570091	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6570091delA								LOC400940 (441727 upstream) : CMPK2 (410412 downstream)																							AAGCCAAAGGAAAAAAAAAAA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14887188	14887189	+	IGR	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14887188_14887189delAC								FAM84A (96255 upstream) : NBAS (419843 downstream)																							acatactcatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16089762	16089762	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16089762delG								MYCN (2634 upstream) : FAM49A (644139 downstream)																							TCCATGTGCTGGACTCTGGCT	0.517													4	2	---	---	---	---	
CAD	790	broad.mit.edu	37	2	27457744	27457744	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27457744delA	uc002rji.2	+						CAD_uc010eyw.2_Intron	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate						'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TTGGATCCCCAAAAAAGCTTT	0.343													4	2	---	---	---	---	
LCLAT1	253558	broad.mit.edu	37	2	30719464	30719464	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30719464delG	uc002rnj.2	+						LCLAT1_uc010ymp.1_Intron|LCLAT1_uc002rnk.1_Intron|LCLAT1_uc002rnl.2_Intron|LCLAT1_uc010ymq.1_Intron	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1						multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						ttgccagaaaggtcaaatgag	0.090													4	2	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32735235	32735235	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32735235delT	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					tggagtgcagtggcgcaatct	0.095													4	2	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32828388	32828388	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32828388delA	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					aactcccatcaaaaaAAATTC	0.264													4	3	---	---	---	---	
FEZ2	9637	broad.mit.edu	37	2	36814940	36814940	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36814940delA	uc002rph.2	-						FEZ2_uc002rpf.2_Intron|FEZ2_uc002rpg.2_Intron|FEZ2_uc002rpi.2_Intron|FEZ2_uc002rpj.2_Intron	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1						axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				TTGCCAGATTAAAAAAAAAAT	0.353													4	3	---	---	---	---	
SLC8A1	6546	broad.mit.edu	37	2	40606785	40606785	+	Intron	DEL	T	-	-	rs74961725		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40606785delT	uc002rrx.2	-						SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGATTTTGCCTTTTTTTTTTT	0.458													5	3	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43513865	43513865	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43513865delA	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				actccgtctcaaaaaaaaaGA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45249173	45249173	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45249173delG								SIX2 (12630 upstream) : SRBD1 (366647 downstream)																							GGCTGTCAGAGGGGGAAGGCT	0.483													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50351333	50351333	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50351333delA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			tcaacgatataaaatgctgct	0.020													4	2	---	---	---	---	
ZNF638	27332	broad.mit.edu	37	2	71580203	71580204	+	Intron	DEL	GC	-	-	rs35587549		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71580203_71580204delGC	uc002shx.2	+						ZNF638_uc010fec.2_Intron|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Intron|ZNF638_uc002shy.2_Intron|ZNF638_uc002shz.2_Intron|ZNF638_uc002sia.2_Intron|ZNF638_uc002sib.1_Intron	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ATATTTTGCAGCCTCGTAAGTG	0.337													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	76356071	76356071	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76356071delA								C2orf3 (417960 upstream) : LRRTM4 (618787 downstream)																							atatttttctaaaaaaaaatt	0.303													4	2	---	---	---	---	
DNAH6	1768	broad.mit.edu	37	2	84860821	84860821	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84860821delT	uc010fgb.2	+							NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						ATATTCCAGCTTTTTTTTTTT	0.423													4	3	---	---	---	---	
POLR1A	25885	broad.mit.edu	37	2	86259773	86259773	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86259773delA	uc002sqs.2	-						POLR1A_uc010ytb.1_Intron	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						CCCAAAAATTAAAAAAAAAAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91778108	91778109	+	IGR	INS	-	CT	CT	rs145938704		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91778108_91778109insCT								None (None upstream) : LOC654342 (27083 downstream)																							TTCCTTCTTTCCTCTCTCTCTC	0.559													4	2	---	---	---	---	
FER1L5	90342	broad.mit.edu	37	2	97356847	97356847	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97356847delG	uc010fia.2	+						FER1L5_uc002sws.3_Intron|FER1L5_uc010fib.1_5'Flank	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2							integral to membrane				ovary(1)	1						TGCCCCTCTAGGGCCTGTCTC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107123111	107123112	+	IGR	INS	-	A	A	rs146930021	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107123111_107123112insA								RGPD3 (38310 upstream) : ST6GAL2 (294946 downstream)																							ataaatttgtgattctcttaga	0.025													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107189477	107189477	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107189477delG								RGPD3 (104676 upstream) : ST6GAL2 (228581 downstream)																							CAATTCCTATGGTGTTTGAAG	0.323													4	2	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111850096	111850096	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111850096delG	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						TTtgctgtatggactttgctc	0.149													4	2	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112596165	112596165	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112596165delA	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						AAGGATTCAGAAATCAGTTCT	0.249													29	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	117397201	117397202	+	IGR	INS	-	A	A	rs151181189	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117397201_117397202insA								DPP10 (795265 upstream) : None (None downstream)																							gcaacatggatgaatttggagc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126623604	126623605	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126623604_126623605insT								CNTNAP5 (950743 upstream) : GYPC (790079 downstream)																							TTCTGCAAAACTTTTTTTTTAG	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129173137	129173138	+	IGR	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129173137_129173138delGT								HS6ST1 (96966 upstream) : None (None downstream)																							TCATGTTGGAGTGTGTGTGTTA	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130419789	130419790	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130419789_130419790insT								None (None upstream) : LOC389033 (260645 downstream)																							gtaggggctagttttttcactg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	145311967	145311967	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145311967delA								ZEB2 (34036 upstream) : None (None downstream)																							TAGCTATAATAAAAAAAAAAC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	147067749	147067749	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147067749delT								None (None upstream) : PABPC1P2 (276876 downstream)																							GTTGTAAGTATTTTTTTGTAA	0.308													4	2	---	---	---	---	
NMI	9111	broad.mit.edu	37	2	152133670	152133671	+	Intron	INS	-	A	A	rs150332060	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152133670_152133671insA	uc002txi.2	-						NMI_uc010zbx.1_Intron	NM_004688	NP_004679	Q13287	NMI_HUMAN	N-myc and STAT interactor						inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity				0				BRCA - Breast invasive adenocarcinoma(221;0.0571)		TGGAGGAAGAGAAAAAAGGGCC	0.411													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156532796	156532797	+	IGR	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156532796_156532797delTG								KCNJ3 (819782 upstream) : NR4A2 (648149 downstream)																							TGTGGGCTTATGTGTGTGTGTC	0.173													3	3	---	---	---	---	
IFIH1	64135	broad.mit.edu	37	2	163143072	163143072	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163143072delG	uc002uce.2	-							NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1						detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						TCCTAGGTGTGGGGGCTGCAT	0.463													4	2	---	---	---	---	
CSRNP3	80034	broad.mit.edu	37	2	166521343	166521343	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166521343delG	uc002udf.2	+						CSRNP3_uc002udg.2_Intron	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3						apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5						gtaagctggtggtaagcaaaa	0.000													4	2	---	---	---	---	
XIRP2	129446	broad.mit.edu	37	2	167746236	167746236	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167746236delT	uc010fpn.2	+						XIRP2_uc010fpo.2_Intron	NM_001079810	NP_001073278	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 2						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGGTTGTCTATCCTACCTGCT	0.443													4	2	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170863158	170863159	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170863158_170863159insA	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron|UBR3_uc010zdj.1_Intron	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TGGGGTAAGAGGAGGGCAACCC	0.356													4	2	---	---	---	---	
FAM171B	165215	broad.mit.edu	37	2	187578848	187578849	+	Intron	INS	-	T	T	rs11458662		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187578848_187578849insT	uc002ups.2	+						FAM171B_uc002upr.1_Intron	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946							integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						AGCAGATGAAATTTTTTTTTTT	0.342													3	3	---	---	---	---	
CALCRL	10203	broad.mit.edu	37	2	188275147	188275147	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188275147delA	uc002upv.3	-						CALCRL_uc010frt.2_Intron	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor							integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			agaaagaaagaaaaaaaaaag	0.000													4	2	---	---	---	---	
HIBCH	26275	broad.mit.edu	37	2	191159172	191159172	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191159172delA	uc002uru.2	-						HIBCH_uc002urv.2_Intron	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform						branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			AAAAAGTTCTAAAAAGTAAAG	0.274													39	28	---	---	---	---	
ORC2L	4999	broad.mit.edu	37	2	201822439	201822439	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201822439delA	uc002uwr.2	-						ORC2L_uc010zhj.1_Intron	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						TTATATAGTTAAAAAAAAAAA	0.279													5	4	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	212522235	212522235	+	Intron	DEL	A	-	-	rs76080792		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212522235delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		ctcggtctccaaaaaaaaaaa	0.159										TSP Lung(8;0.080)			3	3	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218821382	218821382	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218821382delC	uc010fvk.1	-						TNS1_uc002vgv.1_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CACACACacacagctcacaca	0.249													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218821384	218821384	+	Intron	DEL	G	-	-	rs2059737	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218821384delG	uc010fvk.1	-						TNS1_uc002vgv.1_Intron	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CACACacacagctcacacaca	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221324106	221324106	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221324106delA								SLC4A3 (817405 upstream) : EPHA4 (958643 downstream)																							ACAAGCACACAGGGCACTTTC	0.398													3	3	---	---	---	---	
WDFY1	57590	broad.mit.edu	37	2	224752492	224752492	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224752492delA	uc002vnq.2	-							NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1							cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		AAATTTGGTTAAAAAAAATAA	0.313													3	3	---	---	---	---	
IRS1	3667	broad.mit.edu	37	2	227623463	227623463	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227623463delA	uc002voh.3	-							NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1						fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CAGGGAGTTTAAAAAAAAAAG	0.383													2	4	---	---	---	---	
MIR1471	100302126	broad.mit.edu	37	2	232758346	232758347	+	5'Flank	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232758346_232758347insT	hsa-mir-1471|MI0007076	-																							0						CATACCCCAGGTAGCCACTGGC	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235774611	235774612	+	IGR	INS	-	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235774611_235774612insC								ARL4C (368918 upstream) : SH3BP4 (86016 downstream)																							ATATGCCCAAACCCACCCTGCC	0.421													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236664939	236664940	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236664939_236664940insT	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						CAGGATCAGGGTTTTTTTGTTG	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238850320	238850321	+	IGR	INS	-	A	A	rs145843282	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238850320_238850321insA								RAMP1 (29567 upstream) : UBE2F (25379 downstream)																							agttctgggtcaaaaaaaaata	0.020													5	4	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1273485	1273485	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1273485delC	uc003boz.2	+						CNTN6_uc010hbo.2_Intron|CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TCTCTTTCTTCCCCAACCCAA	0.303													4	2	---	---	---	---	
SUMF1	285362	broad.mit.edu	37	3	4182886	4182888	+	Intron	DEL	GCA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4182886_4182888delGCA	uc003bps.1	-							NM_182760		Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		TCAAATAAATGCAGCAGTGAGAG	0.394													4	2	---	---	---	---	
TADA3	10474	broad.mit.edu	37	3	9833520	9833521	+	Intron	INS	-	TGC	TGC	rs138499246	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9833520_9833521insTGC	uc003bsx.1	-						TADA3_uc010hcn.1_Intron|TADA3_uc003bsy.2_Intron|ARPC4_uc003bsz.1_5'Flank|ARPC4_uc003bta.1_5'Flank|ARPC4_uc003btb.1_5'Flank|ARPC4_uc003btc.1_5'Flank	NM_006354	NP_006345	O75528	TADA3_HUMAN	transcriptional adaptor 3 isoform a						estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0						cctgatcaccatgctatactgC	0.213													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	21440494	21440494	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21440494delC								None (None upstream) : VENTXP7 (6724 downstream)																							tgttctatcacccaccagcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	33804191	33804191	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33804191delT								CLASP2 (44343 upstream) : PDCD6IP (35875 downstream)																							gtttgaattgtttttttttcc	0.000													4	2	---	---	---	---	
SCAP	22937	broad.mit.edu	37	3	47461081	47461099	+	Frame_Shift_Del	DEL	AGCCAGGGCTCCCTCACCC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47461081_47461099delAGCCAGGGCTCCCTCACCC	uc003crh.1	-	13	1914_1932	c.1659_1677delGGGTGAGGGAGCCCTGGCT	c.(1657-1677)TTGGGTGAGGGAGCCCTGGCTfs	p.L553fs	SCAP_uc011baz.1_Frame_Shift_Del_p.L298fs|SCAP_uc003crg.2_Frame_Shift_Del_p.L161fs	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	553_559	Lumenal (By similarity).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CGGGCATGGGAGCCAGGGCTCCCTCACCCAATGGGCTCT	0.630													16	9	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52643908	52643908	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643908delT	uc003des.2	-	16	2000	c.1988delA	c.(1987-1989)AATfs	p.N663fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.N663fs|PBRM1_uc003der.2_Frame_Shift_Del_p.N631fs|PBRM1_uc003det.2_Frame_Shift_Del_p.N678fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.N678fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.N663fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.N663fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.N663fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.N663fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.N576fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.N9fs|PBRM1_uc003dfc.2_Frame_Shift_Del_p.N30fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	663					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATAGACCTCATTTAGTTTCTG	0.383			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								74	64	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	55815526	55815526	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55815526delT	uc003dhr.1	-						ERC2_uc003dhq.1_Intron|ERC2_uc003dht.1_Intron	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTAAAAATGGTTTTTTTTTTG	0.338													2	4	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	60148871	60148872	+	Intron	INS	-	T	T	rs57113846		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60148871_60148872insT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		CCCTATGGCCCGTAAGATGTTC	0.267			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
CADPS	8618	broad.mit.edu	37	3	62437283	62437283	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62437283delA	uc003dll.2	-						CADPS_uc003dlj.1_Intron|CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GATCTCTCACAAAAAAAAAGG	0.428													5	3	---	---	---	---	
ADAMTS9	56999	broad.mit.edu	37	3	64566985	64566987	+	Intron	DEL	TGG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64566985_64566987delTGG	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc011bfp.1_Intron|uc003dmi.1_Intron	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GTGAGCTTTTTGGTGGTGGTGGT	0.296													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65553048	65553048	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65553048delA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		ACTGACCATGAAAAAAAAAAT	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75605142	75605143	+	IGR	INS	-	A	A	rs145455361	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75605142_75605143insA								FAM86D (120876 upstream) : MIR1324 (74771 downstream)																							aacaaactgtgaaaaaagaaag	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87364401	87364401	+	IGR	DEL	C	-	-	rs10709986		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87364401delC								POU1F1 (38664 upstream) : HTR1F (667325 downstream)																							ctttgagtcacccccactgat	0.000													3	4	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89176045	89176046	+	Intron	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89176045_89176046insG	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TAATGTTGTTTTCTATTATGCA	0.238										TSP Lung(6;0.00050)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98441282	98441282	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98441282delA								CPOX (128841 upstream) : ST3GAL6 (9870 downstream)																							AATACTGAATAAAAAAGTCTT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	104317280	104317281	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104317280_104317281insT								None (None upstream) : ALCAM (768432 downstream)																							CTTGGCACAGATTTTTCCCTGT	0.391													4	2	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106939626	106939626	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106939626delC	uc003dwf.3	-						LOC100302640_uc011bhk.1_Intron					Homo sapiens cDNA clone IMAGE:5284861.												0						TGGAGGTCTGCCAGAGTGGAT	0.493													4	2	---	---	---	---	
STXBP5L	9515	broad.mit.edu	37	3	121037148	121037148	+	Intron	DEL	A	-	-	rs79113147		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121037148delA	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		ctataaaaataaaaaaaaaat	0.095													4	3	---	---	---	---	
PARP14	54625	broad.mit.edu	37	3	122438903	122438903	+	Intron	DEL	T	-	-	rs151330692		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122438903delT	uc003efq.3	+						PARP14_uc010hrk.2_Intron|PARP14_uc003efr.2_Intron|PARP14_uc003efs.1_Intron	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		gtggctttccttttttttgtt	0.080													6	3	---	---	---	---	
SEMA5B	54437	broad.mit.edu	37	3	122680312	122680312	+	Intron	DEL	T	-	-	rs111407084		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122680312delT	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc003egb.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		tgaaacaaacttttttttttt	0.124													3	3	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132404893	132404893	+	Intron	DEL	A	-	-	rs78161722		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132404893delA	uc003epe.1	-						NPHP3_uc003eoz.1_5'Flank|NPHP3_uc003epd.1_Intron	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						actccgtctcaaaaaaaaaaa	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144069303	144069303	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144069303delA								C3orf58 (358094 upstream) : None (None downstream)																							AACTCCTGGTAAGTGGTCAAT	0.348													4	2	---	---	---	---	
P2RY13	53829	broad.mit.edu	37	3	151045534	151045535	+	3'UTR	INS	-	G	G	rs71728321		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151045534_151045535insG	uc003eyv.2	-	2					MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_176894	NP_795713	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13							integral to membrane|plasma membrane				ovary(3)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			aaaaaaaaaaaaaagaaagaaa	0.317													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	160351778	160351779	+	IGR	DEL	GC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160351778_160351779delGC								KPNA4 (68402 upstream) : ARL14 (43169 downstream)																							TGTTTTTCCTGCCTCAATAACT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194554743	194554744	+	IGR	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194554743_194554744insG								FAM43A (144979 upstream) : C3orf21 (234271 downstream)																							AGTCAGCAAGAGGGGCAGGTGG	0.455													1	5	---	---	---	---	
PIGG	54872	broad.mit.edu	37	4	494593	494593	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:494593delA	uc003gak.3	+						PIGG_uc003gaj.3_Intron|PIGG_uc011bux.1_Intron|PIGG_uc010ibf.2_Intron|PIGG_uc003gal.3_Intron|ZNF721_uc003gag.2_5'Flank|ZNF721_uc010ibe.2_5'Flank|ZNF721_uc003gah.1_5'Flank|PIGG_uc003gai.2_Intron|PIGG_uc011buw.1_Intron|PIGG_uc003gam.2_Intron|PIGG_uc003gan.2_Intron	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						TCAAGTAGCCAAAGCTCATGC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3621168	3621168	+	IGR	DEL	G	-	-	rs11339032		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3621168delG								LRPAP1 (86944 upstream) : ADRA2C (146907 downstream)																							catttacactgaagattttac	0.159													4	2	---	---	---	---	
SH3TC1	54436	broad.mit.edu	37	4	8216875	8216875	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8216875delC	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						TCACACTCTGCCCTCTGTAAT	0.532													4	2	---	---	---	---	
HS3ST1	9957	broad.mit.edu	37	4	11432857	11432857	+	5'Flank	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11432857delA	uc003gmq.2	-							NM_005114	NP_005105	O14792	HS3S1_HUMAN	heparan sulfate D-glucosaminyl							Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			skin(1)	1						CTATGCTCTTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12080033	12080034	+	IGR	INS	-	CTT	CTT	rs145358380	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12080033_12080034insCTT								HS3ST1 (649496 upstream) : None (None downstream)																							CAAAACGAGCACTTCATCCTTC	0.431													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13185800	13185800	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13185800delT								None (None upstream) : HSP90AB2P (149237 downstream)																							ggaaggctccttttttttaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	17257064	17257066	+	IGR	DEL	CAC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17257064_17257066delCAC								LDB2 (356640 upstream) : QDPR (230954 downstream)																							ttgtctttttcacACATTCAGAC	0.310													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40641319	40641319	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40641319delA								RBM47 (8679 upstream) : NSUN7 (110595 downstream)																							aagggaatagaaaaaaaaaca	0.000													4	2	---	---	---	---	
GABRB1	2560	broad.mit.edu	37	4	47424805	47424805	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47424805delT	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	taacaaactctttttttccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56036560	56036560	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56036560delG								KDR (44798 upstream) : SRD5A3 (175849 downstream)																							ggagtacaatggcacgatctt	0.000													4	2	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62403984	62403985	+	Intron	INS	-	TAGC	TAGC	rs140703687	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62403984_62403985insTAGC	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						tttgttgtgaatagctattgtc	0.000													4	3	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79434300	79434301	+	Intron	INS	-	A	A	rs138090444	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79434300_79434301insA	uc003hlb.2	+							NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TTCCTGTATAGAAAAAAAATCT	0.356													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	83951320	83951320	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83951320delA								LIN54 (17280 upstream) : COPS4 (4919 downstream)																							aatatttagtaaaattgctgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	93083992	93083992	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93083992delC								FAM190A (560623 upstream) : GRID2 (141558 downstream)																							aatggcaggtccccagggagt	0.000													4	2	---	---	---	---	
ADH4	127	broad.mit.edu	37	4	100056609	100056609	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100056609delG	uc003hun.2	-						uc003hum.1_Intron|ADH4_uc011ced.1_Intron	NM_000670	NP_000661	P08319	ADH4_HUMAN	class II alcohol dehydrogenase, pi subunit						alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding			skin(2)	2				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	NADH(DB00157)	ggtgaaaactgggagggatac	0.000													4	2	---	---	---	---	
DKK2	27123	broad.mit.edu	37	4	108132119	108132119	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108132119delC	uc010ilw.1	-									Q9UBU2	DKK2_HUMAN	Homo sapiens dickkopf-2 mRNA, complete cds.						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		AAATTCACCGCCATTTATGGG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	110461652	110461652	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110461652delT								SEC24B (38 upstream) : CCDC109B (19703 downstream)																							GTTTGATTGGTTTTTTGTGGG	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112790805	112790805	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112790805delA								None (None upstream) : C4orf32 (275748 downstream)																							CAAGGTGATTAAAAAAAAAAT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	113430867	113430867	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113430867delA								ALPK1 (67106 upstream) : NEUROG2 (3807 downstream)																							CGAGAGGGGGAAAAAAGTCGT	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	125812660	125812662	+	IGR	DEL	TAG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125812660_125812662delTAG								ANKRD50 (178773 upstream) : FAT4 (424905 downstream)																							ACAATGATCTTAGTTTGTTGTAT	0.384													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	132400259	132400259	+	IGR	DEL	T	-	-	rs77973233		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132400259delT								None (None upstream) : None (None downstream)																							CCTTTTATCATTTTTTTTCTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	134937699	134937699	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134937699delC								PCDH10 (824968 upstream) : PABPC4L (179792 downstream)																							ttcagtttttctccttcacat	0.000													4	2	---	---	---	---	
TBC1D9	23158	broad.mit.edu	37	4	141623109	141623109	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141623109delG	uc010ioj.2	-							NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				caaaccctgtgggcacaaaac	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	142352575	142352575	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142352575delT								ZNF330 (196727 upstream) : IL15 (205179 downstream)																							TAGATTAGTATTTTTTTAATA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	144540929	144540929	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144540929delC								LOC441046 (51616 upstream) : GYPE (251091 downstream)																							GACCTCAAGGCCCTACTATTA	0.393													3	4	---	---	---	---	
ZNF827	152485	broad.mit.edu	37	4	146809696	146809696	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146809696delG	uc003ikn.2	-						ZNF827_uc003ikm.2_Intron|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					CTTGGGTTGTGGTatttcaga	0.239													4	2	---	---	---	---	
PRMT10	90826	broad.mit.edu	37	4	148600207	148600207	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148600207delT	uc003ilc.2	-						PRMT10_uc003ild.2_Intron	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						aaattcacccttttttgcctg	0.005													4	2	---	---	---	---	
GUCY1A3	2982	broad.mit.edu	37	4	156638014	156638014	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156638014delA	uc003iov.2	+						GUCY1A3_uc010iqc.2_Intron|GUCY1A3_uc003iow.2_Intron|GUCY1A3_uc010iqd.2_Intron|GUCY1A3_uc003iox.2_Intron|GUCY1A3_uc003ioz.2_Intron|GUCY1A3_uc003ioy.2_Intron|GUCY1A3_uc010iqe.2_Intron|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Intron	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TTATATGGTGAAAAAAAAGAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165708696	165708696	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165708696delT	uc003iqu.1	+											Homo sapiens cDNA FLJ37936 fis, clone CTONG2005468.																		ACATTTGGGCTTTTTTTTTTT	0.249													3	3	---	---	---	---	
ANXA10	11199	broad.mit.edu	37	4	169105255	169105255	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169105255delT	uc003irm.2	+						ANXA10_uc003irn.2_Intron	NM_007193	NP_009124	Q9UJ72	ANX10_HUMAN	annexin A10								calcium ion binding|calcium-dependent phospholipid binding				0		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		TACTGCTGTCTTAGACAAATC	0.323													4	2	---	---	---	---	
WDR17	116966	broad.mit.edu	37	4	177010838	177010838	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177010838delT	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GTGAGAGAGCTTTTTTtgcat	0.214													4	2	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186815418	186815419	+	Intron	INS	-	AGG	AGG	rs139312176	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186815418_186815419insAGG	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AAAATGTTGGCAGGTGTTGGGG	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190631197	190631197	+	IGR	DEL	T	-	-	rs78311979		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190631197delT								None (None upstream) : FRG1 (230777 downstream)																							aagacaaggcttttaggtcac	0.080													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190818144	190818144	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818144delG	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		actaacaaaagggaaatgatt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1918926	1918926	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1918926delA								IRX4 (36046 upstream) : IRX2 (827355 downstream)																							AAGCATCCCTAAACGTGCATG	0.488													4	2	---	---	---	---	
SEMA5A	9037	broad.mit.edu	37	5	9314810	9314811	+	Intron	INS	-	A	A	rs72261635		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9314810_9314811insA	uc003jek.2	-							NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						ACACGTGATATAAAAAAAAAAA	0.366													4	2	---	---	---	---	
FAM173B	134145	broad.mit.edu	37	5	10233833	10233833	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10233833delC	uc003jeo.2	-						FAM173B_uc003jep.2_Intron|FAM173B_uc010itr.2_Intron	NM_199133	NP_954584	Q6P4H8	F173B_HUMAN	hypothetical protein LOC134145							integral to membrane				kidney(1)|central_nervous_system(1)	2						CATCATCCTGCCTCTCCACAA	0.453											OREG0016509	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11006176	11006176	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11006176delA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						AAACAACAACAAAAAAACCAT	0.388													4	2	---	---	---	---	
LOC285696	285696	broad.mit.edu	37	5	17203614	17203614	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17203614delT	uc003jfw.2	-							NR_027253				Homo sapiens cDNA FLJ34047 fis, clone FCBBF3000001.												0						AGCGATACTGTTTTTTTTTGA	0.299											OREG0016535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17789675	17789676	+	IGR	INS	-	GGG	GGG	rs147948497		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17789675_17789676insGGG								BASP1 (512740 upstream) : None (None downstream)																							CCTCCCGAGTAGGACACCTTGA	0.416													4	2	---	---	---	---	
CDH9	1007	broad.mit.edu	37	5	26953906	26953906	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26953906delA	uc003jgs.1	-						CDH9_uc010iug.2_Intron	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						atggcttcctaaaaaccaggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30754270	30754270	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30754270delG								None (None upstream) : CDH6 (439526 downstream)																							tgctgcttttgggggtaccac	0.000													4	2	---	---	---	---	
MTMR12	54545	broad.mit.edu	37	5	32248553	32248553	+	Intron	DEL	G	-	-	rs149036469	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32248553delG	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						GCTTTGTTTTGTTTAATTTGA	0.224													4	2	---	---	---	---	
DAB2	1601	broad.mit.edu	37	5	39393144	39393144	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39393144delT	uc003jlx.2	-						DAB2_uc003jlw.2_Intron	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2						cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			GCATCTAGAGTCCTATTATAC	0.388													22	20	---	---	---	---	
DAB2	1601	broad.mit.edu	37	5	39393791	39393791	+	Intron	DEL	T	-	-	rs34489272		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39393791delT	uc003jlx.2	-						DAB2_uc003jlw.2_Intron	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2						cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			TTCATCATAGTTTTTTTTAAG	0.313													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55649137	55649138	+	IGR	DEL	AA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55649137_55649138delAA								ANKRD55 (119951 upstream) : MAP3K1 (461762 downstream)																							AAGGCTTGTTAACTTTTCTTTC	0.356													4	2	---	---	---	---	
RAB3C	115827	broad.mit.edu	37	5	57887076	57887077	+	Intron	DEL	TA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57887076_57887077delTA	uc003jrp.2	+							NM_138453	NP_612462	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		tcattagggttatggcattgtg	0.000													4	2	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58767220	58767220	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58767220delA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	AGATTAAATCAAAAAAGCTAA	0.343													4	2	---	---	---	---	
ELOVL7	79993	broad.mit.edu	37	5	60109276	60109276	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60109276delC	uc003jsi.3	-						ELOVL7_uc010iwk.2_Intron|ELOVL7_uc003jsj.3_Intron	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				ATCACCTTTTCCCCTTTCCCT	0.378													4	2	---	---	---	---	
NDUFAF2	91942	broad.mit.edu	37	5	60317179	60317186	+	Intron	DEL	TCTGTCGC	-	-	rs71606656		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60317179_60317186delTCTGTCGC	uc003jsp.3	+						NDUFAF2_uc003jso.3_Intron	NM_174889	NP_777549	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha							membrane|mitochondrion	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				ttcaaacagatctgtcgctgactctcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	60508296	60508296	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60508296delA								C5orf43 (49994 upstream) : ZSWIM6 (119804 downstream)																							AAACTGAGTTAAAAAAAATTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	63216950	63216950	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63216950delT								None (None upstream) : HTR1A (39329 downstream)																							TATTCTAGTCTTTAATTTTCA	0.373													4	2	---	---	---	---	
CD180	4064	broad.mit.edu	37	5	66482125	66482125	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66482125delA	uc003juy.2	-							NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor						inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		tgaaaaaaataaaaaaaaccc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	66817512	66817513	+	IGR	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66817512_66817513delGT								CD180 (324895 upstream) : PIK3R1 (694091 downstream)																							TAGCGTTTGAGTGTGTGTGTGT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	68339737	68339738	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68339737_68339738insT								PIK3R1 (742090 upstream) : SLC30A5 (50080 downstream)																							CAACTTAATGATTTTTTTTTTC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	71211121	71211121	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71211121delT								CARTPT (194249 upstream) : MAP1B (191997 downstream)																							ttagaaactctagatgaagat	0.000													4	2	---	---	---	---	
FCHO2	115548	broad.mit.edu	37	5	72328532	72328532	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72328532delT	uc003kcl.2	+						FCHO2_uc011csl.1_Intron|FCHO2_uc011csk.1_Intron|FCHO2_uc011csm.1_Intron	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a											ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TGGTACTTACTTTTTTCTACT	0.323													4	2	---	---	---	---	
ANKRD31	256006	broad.mit.edu	37	5	74494236	74494236	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74494236delA	uc003kdo.1	-									Q8N7Z5	ANR31_HUMAN	Homo sapiens cDNA FLJ40191 fis, clone TESTI2019280, weakly similar to Homo sapiens nasopharyngeal carcinoma susceptibility protein LZ16 mRNA.												0						TCTGGGGAAGAAAAAAATGGA	0.159													4	2	---	---	---	---	
HOMER1	9456	broad.mit.edu	37	5	78721074	78721074	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78721074delA	uc003kfy.2	-						HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		CCGGAGTAGGAAAAAAAAAAA	0.378													6	4	---	---	---	---	
VCAN	1462	broad.mit.edu	37	5	82850442	82850442	+	Intron	DEL	C	-	-	rs2290671	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82850442delC	uc003kii.3	+						VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor						cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACAACAACAACAAAAAAATAG	0.318													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84695099	84695099	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84695099delA								None (None upstream) : NBPF22P (883163 downstream)																							ttctctaactaaaaacaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84941676	84941677	+	IGR	INS	-	CT	CT	rs149417502	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84941676_84941677insCT								None (None upstream) : NBPF22P (636585 downstream)																							CCGGATTTCAGCTCTCTCACCT	0.351													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92374609	92374609	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92374609delA								None (None upstream) : FLJ42709 (370456 downstream)																							AGAAAGAAAGAAAAAAAAAGG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96199715	96199716	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96199715_96199716insT	uc003kmo.1	-											Homo sapiens cDNA FLJ37666 fis, clone BRHIP2011576.																		TAAATTCTTGATTTTTTTTTAC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102630102	102630103	+	IGR	DEL	TC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102630102_102630103delTC								C5orf30 (15741 upstream) : NUDT12 (254454 downstream)																							CTTGCCAATTTCTAGAGGCTGT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103446723	103446723	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103446723delT								NUDT12 (548233 upstream) : RAB9BP1 (988452 downstream)																							gaacacattattttttttgct	0.000													8	4	---	---	---	---	
FBXL17	64839	broad.mit.edu	37	5	107458866	107458866	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107458866delT	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		TGTCTTTTGCTTTTTTTAATT	0.333													4	2	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108375861	108375861	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108375861delG	uc003kop.1	+						FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		acttccaagtggggatgatgg	0.000													4	2	---	---	---	---	
KCNN2	3781	broad.mit.edu	37	5	113762706	113762706	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113762706delG	uc003kqo.2	+							NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		ATTGTGGAATGGGGAACTTTT	0.443													4	2	---	---	---	---	
COMMD10	51397	broad.mit.edu	37	5	115454213	115454214	+	Intron	INS	-	A	A	rs142953074	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115454213_115454214insA	uc003krt.1	+							NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10								protein binding			ovary(1)	1		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		GGGATATTTTTTTTATTGACAG	0.287													0	7	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126675191	126675191	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126675191delG	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GCGCATAACTGGGGGAGACAC	0.328													4	2	---	---	---	---	
ADAMTS19	171019	broad.mit.edu	37	5	128994021	128994022	+	Intron	DEL	AG	-	-	rs34134562		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128994021_128994022delAG	uc003kvb.1	+						ADAMTS19_uc010jdh.1_Intron	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		aaagaaagaaagaaagaaagaa	0.069													4	2	---	---	---	---	
SPOCK1	6695	broad.mit.edu	37	5	136440837	136440839	+	Intron	DEL	TGC	-	-	rs116731824	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136440837_136440839delTGC	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTGCCTAATTGCTGCTGCTGCT	0.483													4	2	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139362049	139362049	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139362049delA	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTTTTCTAAACTCCTACA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	142949679	142949680	+	IGR	DEL	AA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142949679_142949680delAA								NR3C1 (134602 upstream) : HMHB1 (242046 downstream)																							TGAAAATCATAAAGAGCCATGT	0.193													4	2	---	---	---	---	
MYOZ3	91977	broad.mit.edu	37	5	150055509	150055509	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150055509delC	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			tgaaacttttcccccgccatc	0.000													4	2	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150504098	150504109	+	Intron	DEL	GAGAGAGAGAGA	-	-	rs72392693		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150504098_150504109delGAGAGAGAGAGA	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACGAGAGCTgagagagagagagagagagaga	0.429													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152007586	152007586	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152007586delT	uc003luw.1	-						uc003lux.1_Intron					Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		TGGGCTCTTGTTTTAGACAGC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154870909	154870909	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154870909delT								KIF4B (473224 upstream) : SGCD (264154 downstream)																							GGAATAAAGATTCAATGTCCT	0.378													170	91	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157154456	157154456	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157154456delT								C5orf52 (47296 upstream) : THG1L (3867 downstream)																							tacccatcccttttttttttc	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	158908001	158908002	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158908001_158908002insA								LOC285627 (14717 upstream) : ADRA1B (435738 downstream)																							taagtcacccctgcagccagtc	0.069													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168513997	168513997	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168513997delA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGTGCTATGCAAAGTGCCGTC	0.413													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168602142	168602142	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168602142delG	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTTAGTCATGGGAAGAAGGA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175580832	175580832	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175580832delC	uc003mdn.2	-											Homo sapiens cDNA clone IMAGE:5171181.																		AGCTTCCACTCCTCAGGCAGA	0.567													4	2	---	---	---	---	
C5orf25	375484	broad.mit.edu	37	5	175760955	175760955	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175760955delT	uc003mds.3	+						C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc003mdv.2_Intron			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		ctattattggttttttttttt	0.000													2	4	---	---	---	---	
ZNF454	285676	broad.mit.edu	37	5	178369405	178369406	+	Intron	INS	-	CAAA	CAAA			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178369405_178369406insCAAA	uc003mjo.1	+						ZNF454_uc010jkz.1_Intron|ZNF454_uc003mjp.2_Intron	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		agactctgtctcaaacaaacaa	0.213													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179502277	179502277	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179502277delT								RNF130 (3168 upstream) : RASGEF1C (25519 downstream)																							GTACGAGTGGTTTTATCGGAC	0.373													4	2	---	---	---	---	
DUSP22	56940	broad.mit.edu	37	6	332874	332874	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:332874delG	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		GGAGCGTGGAGGGAGAGTGTG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	353069	353072	+	IGR	DEL	CATT	-	-	rs148332139		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:353069_353072delCATT								DUSP22 (1716 upstream) : IRF4 (38680 downstream)																							GCTGCCTCTCcattcattcattca	0.230													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	360165	360166	+	IGR	INS	-	T	T	rs139730316	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:360165_360166insT								DUSP22 (8812 upstream) : IRF4 (31586 downstream)																							tattttcttggttttttttaac	0.153													5	4	---	---	---	---	
GMDS	2762	broad.mit.edu	37	6	1766444	1766444	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1766444delT	uc003mtq.2	-							NM_001500	NP_001491	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TTTTTGTGTGTGGCACAGAAG	0.428													3	3	---	---	---	---	
SLC22A23	63027	broad.mit.edu	37	6	3293546	3293546	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3293546delA	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron	NM_015482	NP_056297	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				ATGAGTCATTAAAAAAGCACA	0.383													4	2	---	---	---	---	
CDYL	9425	broad.mit.edu	37	6	4952834	4952834	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4952834delC	uc003mwi.2	+						CDYL_uc003mwj.2_Intron|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_Intron|CDYL_uc011dhy.1_Intron	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		TTTGCAAATACCCAGGAACCA	0.473													4	2	---	---	---	---	
ELOVL2	54898	broad.mit.edu	37	6	10994987	10994988	+	Intron	DEL	GA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10994987_10994988delGA	uc003mzp.3	-							NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			ATGTGCCTCTGACCATGGGACA	0.485													4	2	---	---	---	---	
JARID2	3720	broad.mit.edu	37	6	15301661	15301661	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15301661delT	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CATACCTTTATTTTTTTTCTA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	17039052	17039052	+	IGR	DEL	C	-	-	rs35318484		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17039052delC								ATXN1 (277331 upstream) : RBM24 (242757 downstream)																							aaagtttcctccacgttccgc	0.020													1	5	---	---	---	---	
SLC17A3	10786	broad.mit.edu	37	6	25849902	25849915	+	Intron	DEL	AAACGGCCACAGGT	-	-	rs7741430	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25849902_25849915delAAACGGCCACAGGT	uc003nfi.3	-						SLC17A3_uc003nfk.3_Intron	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						TACCTGAAAAAAACGGCCACAGGTCTATCTGTGG	0.355													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	39747502	39747502	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39747502delT								KIF6 (54321 upstream) : DAAM2 (12640 downstream)																							tcatttgatcttttttttttt	0.065													4	2	---	---	---	---	
UBR2	23304	broad.mit.edu	37	6	42651136	42651136	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42651136delT	uc011dur.1	+						UBR2_uc011dus.1_Intron|UBR2_uc003osh.2_Intron|UBR2_uc011dut.1_Intron	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CTTAGCTCTATTTTTTTCTAT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44512922	44512924	+	IGR	DEL	AGC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44512922_44512924delAGC								CDC5L (98143 upstream) : SUPT3H (264130 downstream)																							GAATTTGTTTAGCAGcagcagtg	0.251													4	2	---	---	---	---	
TRAM2	9697	broad.mit.edu	37	6	52365325	52365326	+	3'UTR	DEL	TG	-	-	rs67786570		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52365325_52365326delTG	uc003paq.2	-	11					EFHC1_uc011dwv.1_Intron	NM_012288	NP_036420	Q15035	TRAM2_HUMAN	translocation-associated membrane protein 2						collagen biosynthetic process|protein transport|transmembrane transport	integral to membrane	protein binding				0	Lung NSC(77;0.109)					GGtttttttttgtttttttttt	0.500													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57346713	57346714	+	Intron	INS	-	T	T	rs143071210	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57346713_57346714insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATTCGGGATGATTTTTTCCTGG	0.292													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57434316	57434317	+	Intron	INS	-	TGTT	TGTT	rs138331811		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57434316_57434317insTGTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGATTTTAGACTGTTTGTTCAT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	83381057	83381057	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83381057delT								TPBG (304443 upstream) : UBE2CBP (221129 downstream)																							TAGTGTTTTGTTTTTTTTTAA	0.179													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87354313	87354313	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87354313delG								SNHG5 (965862 upstream) : HTR1E (292711 downstream)																							CTGCAGATATGGACCATTCAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	99148481	99148482	+	IGR	INS	-	CT	CT	rs146835544	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99148481_99148482insCT								MIR2113 (675984 upstream) : POU3F2 (134098 downstream)																							ACTGATCCTCACTCTCTCTCTC	0.371													0	6	---	---	---	---	
ASCC3	10973	broad.mit.edu	37	6	101057863	101057863	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101057863delA	uc003pqk.2	-							NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AGGATAACATAAGGCACAGCA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106253453	106253455	+	IGR	DEL	GAT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106253453_106253455delGAT								PREP (402484 upstream) : PRDM1 (280740 downstream)																							ttgtaggggagatgatgagctca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116760344	116760344	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116760344delA								DSE (904 upstream) : FAM26F (22212 downstream)																							ATTTTGAAAGAAAAAAAAAAG	0.338													4	3	---	---	---	---	
FAM162B	221303	broad.mit.edu	37	6	117082917	117082918	+	Intron	DEL	AT	-	-	rs73765851		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117082917_117082918delAT	uc003pxi.2	-							NM_001085480	NP_001078949	Q5T6X4	F162B_HUMAN	hypothetical protein LOC221303							integral to membrane					0						acacacacacatatatatatat	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	125592233	125592234	+	IGR	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125592233_125592234delAC								TPD52L1 (7589 upstream) : HDDC2 (4262 downstream)																							tgaaagtgtgacaggatgggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127327854	127327855	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127327854_127327855insT	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		TTGTTGAGCACTTTTTTCCTAA	0.347													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	135575688	135575688	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135575688delG								MIR548A2 (15294 upstream) : AHI1 (29424 downstream)																							atgaaGATGTGGAATGATAAT	0.264													4	2	---	---	---	---	
IL22RA2	116379	broad.mit.edu	37	6	137493351	137493351	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137493351delT	uc003qhl.2	-						IL22RA2_uc003qhm.2_Intron|IL22RA2_uc003qhn.2_Intron	NM_052962	NP_443194	Q969J5	I22R2_HUMAN	interleukin 22-binding protein isoform 1						regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	interleukin-22 receptor activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		AAATTCGAGGTTTTATGATGA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	137507791	137507791	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137507791delT								IL22RA2 (13006 upstream) : IFNGR1 (10830 downstream)																							tggcttttgattttttttttt	0.100													4	4	---	---	---	---	
UST	10090	broad.mit.edu	37	6	149138297	149138297	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149138297delT	uc003qmg.2	+							NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TGTTTGTTTATTTTTGGTTTT	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150629346	150629346	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150629346delT								PPP1R14C (57820 upstream) : IYD (60682 downstream)																							GGAAATGAGCTTTCGCCCTCA	0.438													4	2	---	---	---	---	
MYCT1	80177	broad.mit.edu	37	6	153018814	153018815	+	5'Flank	INS	-	AC	AC			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153018814_153018815insAC	uc003qpd.3	+						MYCT1_uc010kjc.1_5'Flank|MYCT1_uc003qpc.3_5'Flank	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1							nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		GGGATGAGGAAacacacacaca	0.337													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	154298455	154298456	+	IGR	DEL	CT	-	-	rs148305858		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154298455_154298456delCT								RGS17 (846066 upstream) : OPRM1 (33180 downstream)																							GATTCTCTGACTCTTTTCACAA	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	502855	502855	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:502855delT								FAM20C (202144 upstream) : PDGFA (34044 downstream)																							TTGAACCCCCTTGCCCTCATC	0.632													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	3856491	3856491	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3856491delT	uc003smx.2	+							NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTTGAAGTGGTTTTTTTTTTT	0.323													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25277972	25277973	+	IGR	INS	-	A	A	rs144789862	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25277972_25277973insA								NPVF (9867 upstream) : MIR148A (711566 downstream)																							GTTTTGATGGTAAAAAAAAAAT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25705138	25705138	+	5'Flank	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25705138delA	uc003sxp.1	-											Homo sapiens cDNA FLJ32817 fis, clone TESTI2002877.																		agcgggagggaggtgtccagg	0.000													4	2	---	---	---	---	
NEUROD6	63974	broad.mit.edu	37	7	31383439	31383439	+	5'Flank	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31383439delG	uc003tch.2	-							NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						AATGTGGACTGGGACAGGATC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	32452521	32452521	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32452521delA								PDE1C (113580 upstream) : LSM5 (72424 downstream)																							catagcacggaaaaaaaaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	36825573	36825573	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36825573delT								AOAH (61420 upstream) : ELMO1 (68388 downstream)																							TTTTCTAGGCTTTTTTTTGGC	0.388													4	2	---	---	---	---	
RALA	5898	broad.mit.edu	37	7	39737735	39737736	+	Intron	INS	-	AG	AG	rs148570662	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39737735_39737736insAG	uc003thd.2	+							NM_005402	NP_005393	P11233	RALA_HUMAN	ras related v-ral simian leukemia viral oncogene						actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity			lung(1)|skin(1)	2						cctcacatgacagagagagaga	0.000													4	2	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43591571	43591571	+	Intron	DEL	C	-	-	rs72187433		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43591571delC	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						tatctaagcacccccccaaag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47085703	47085704	+	IGR	DEL	AG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47085703_47085704delAG								None (None upstream) : TNS3 (229049 downstream)																							AGTCATGGACAGAGAGAGAGAA	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47134808	47134809	+	IGR	INS	-	T	T	rs150658392	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47134808_47134809insT								None (None upstream) : TNS3 (179944 downstream)																							AGTAGGCTTCATTTTTTCAGAG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	50473351	50473351	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50473351delC								IKZF1 (555 upstream) : FIGNL1 (38483 downstream)																							CCAATGATCTCCCAGGACTTT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64399667	64399667	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64399667delT								ZNF273 (7714 upstream) : ZNF117 (35163 downstream)																							TATGTTTTGATTTTTTTTTTA	0.373													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69782234	69782235	+	Intron	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69782234_69782235delTG	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TTGTATATTTTGTGTGTGTGTT	0.332													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71176081	71176081	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71176081delG	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGGGGCAGCTGTGGAGTTTCT	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	90930018	90930018	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90930018delT								FZD1 (31887 upstream) : MTERF (501442 downstream)																							ctttacttccttttttaggcg	0.000													4	2	---	---	---	---	
CALCR	799	broad.mit.edu	37	7	93065669	93065671	+	Intron	DEL	TGT	-	-	rs144127533		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93065669_93065671delTGT	uc003umv.1	-						CALCR_uc011kia.1_Intron|CALCR_uc003ums.1_Intron|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	tttaattttatgttccctccagc	0.113													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93808324	93808325	+	IGR	INS	-	TC	TC			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93808324_93808325insTC								BET1 (174634 upstream) : COL1A2 (215548 downstream)																							CTTTCTCTAAGTCTCTCTCTCT	0.371													4	2	---	---	---	---	
PPP1R9A	55607	broad.mit.edu	37	7	94915800	94915802	+	Intron	DEL	CAA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94915800_94915802delCAA	uc003unp.2	+						PPP1R9A_uc010lfj.2_Intron|PPP1R9A_uc011kif.1_Intron|PPP1R9A_uc003unq.2_Intron|PPP1R9A_uc011kig.1_Intron|PPP1R9A_uc003unr.2_Intron	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)							cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			CTCCCTTTCTCAACAGAAAAGCA	0.404										HNSCC(28;0.073)			4	2	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197796	102197800	+	Intron	DEL	TTTTG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197796_102197800delTTTTG	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						ttttttttttttttgtgtgtgtgtg	0.263													7	4	---	---	---	---	
SLC26A5	375611	broad.mit.edu	37	7	103081650	103081650	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103081650delT	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TGCCTTTCCATTTTTGCTCAA	0.383													4	2	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116792932	116792933	+	Intron	DEL	AG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116792932_116792933delAG	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7_uc011knn.1_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		tgtctgtctcagagagagagag	0.000													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127292577	127292578	+	Intron	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127292577_127292578insG	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CTCCACCTTCCGCCAGCCTGCT	0.619													4	3	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128312236	128312236	+	5'Flank	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128312236delT	uc003vnk.3	+						FAM71F2_uc010llm.1_5'Flank|FAM71F2_uc003vnl.2_5'Flank|FAM71F2_uc010lln.1_5'Flank	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						CTTCCTCTTCTTTTTTTTTTC	0.483													4	3	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133409617	133409617	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133409617delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				actggtaggattagaacacaa	0.000													4	2	---	---	---	---	
CALD1	800	broad.mit.edu	37	7	134509518	134509518	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134509518delT	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						AGTTTTCTGCTTTTTTTCATT	0.234													5	3	---	---	---	---	
WDR91	29062	broad.mit.edu	37	7	134873773	134873773	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134873773delC	uc003vsp.2	-						WDR91_uc010lmq.2_Intron|WDR91_uc010lmr.2_Intron	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91											breast(2)|ovary(1)|skin(1)	4						GAATCAACTACCCACAGCAAG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	136491712	136491713	+	IGR	DEL	CT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136491712_136491713delCT								LUZP6 (829508 upstream) : CHRM2 (61686 downstream)																							TCCCATCATCCTCTCTCTCTCT	0.376													4	2	---	---	---	---	
CREB3L2	64764	broad.mit.edu	37	7	137653703	137653703	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137653703delG	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Intron	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						aaacgaaggagaagaataggg	0.209			T	FUS	fibromyxoid sarcoma								4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152085705	152085705	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152085705delC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCAAGCACACCCTTTTTTGT	0.224			N		medulloblastoma								2	5	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152104995	152104996	+	Intron	DEL	TT	-	-	rs145762454		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152104995_152104996delTT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAAATTTATCTTGTTAGAATAC	0.262			N		medulloblastoma								4	2	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153985865	153985865	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153985865delA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			atatgctggtaaaaaaaaaca	0.159													4	2	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156936136	156936136	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156936136delG	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CACCACCACAGGAGTTGCTTG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1404818	1404819	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1404818_1404819insA								ERICH1 (723592 upstream) : DLGAP2 (44750 downstream)																							TGCATCATTAGAAAAATAAAAT	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2221438	2221439	+	IGR	INS	-	CA	CA	rs139067614		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2221438_2221439insCA								MYOM2 (128059 upstream) : CSMD1 (571437 downstream)																							CAGATGTGAGTCACACACACAC	0.416													4	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3605309	3605309	+	Intron	DEL	A	-	-	rs80150376		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3605309delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ccaatagtgCAAAAAAAAAGT	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8906117	8906117	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8906117delG								ERI1 (15268 upstream) : PPP1R3B (87657 downstream)																							GGAAGGACATGGGGAAAAGGT	0.388													4	2	---	---	---	---	
C8orf74	203076	broad.mit.edu	37	8	10532598	10532602	+	Intron	DEL	GCCAG	-	-	rs150257613		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10532598_10532602delGCCAG	uc003wtd.1	+						C8orf74_uc003wte.1_Intron	NM_001040032	NP_001035121	Q6P047	CH074_HUMAN	hypothetical protein LOC203076												0				COAD - Colon adenocarcinoma(149;0.0811)		TTGCACAACAGCCAGGGTGTTTGCT	0.434													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	13708312	13708312	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13708312delC								C8orf48 (282516 upstream) : SGCZ (239062 downstream)																							TGTACTGACACCCAACTGACA	0.413													4	2	---	---	---	---	
ZDHHC2	51201	broad.mit.edu	37	8	17055624	17055625	+	Intron	DEL	AA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17055624_17055625delAA	uc003wxe.2	+							NM_016353	NP_057437	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2							integral to membrane	acyltransferase activity|zinc ion binding				0				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		GTTGTATATTAATACATTATAT	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20274633	20274633	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20274633delT								LZTS1 (161830 upstream) : None (None downstream)																							ATCATGGTTATTTTTTTTTGG	0.383													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20821095	20821096	+	IGR	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20821095_20821096delAC								LZTS1 (708292 upstream) : GFRA2 (728434 downstream)																							CACACATACAACACACACACAG	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20837621	20837621	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20837621delT								LZTS1 (724818 upstream) : GFRA2 (711909 downstream)																							attttatgacttttttttctt	0.219													4	2	---	---	---	---	
SORBS3	10174	broad.mit.edu	37	8	22426860	22426861	+	Intron	DEL	TT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22426860_22426861delTT	uc003xbv.2	+						SORBS3_uc003xbw.3_Intron	NM_005775	NP_005766	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3 isoform 1						muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CTAAAAACAGtttttttttttt	0.292													6	3	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25215434	25215434	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25215434delT	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ATAATTCACATTTTTTTGGTC	0.348													4	2	---	---	---	---	
DPYSL2	1808	broad.mit.edu	37	8	26384456	26384456	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26384456delG	uc003xfa.2	+							NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		tcctatgactgggcatctcag	0.000													4	2	---	---	---	---	
DPYSL2	1808	broad.mit.edu	37	8	26515051	26515053	+	3'UTR	DEL	TTG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26515051_26515053delTTG	uc003xfb.1	+	14					DPYSL2_uc003xfa.2_3'UTR|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_3'UTR	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		TTTGGGTTTTTTGTTGTTGTTGT	0.335													4	2	---	---	---	---	
CCDC25	55246	broad.mit.edu	37	8	27607186	27607186	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27607186delA	uc003xgc.2	-						CCDC25_uc003xgd.2_Intron|CCDC25_uc011lan.1_Intron|CCDC25_uc011lao.1_Intron|CCDC25_uc003xge.2_Intron|CCDC25_uc003xgf.1_Intron	NM_018246	NP_060716	Q86WR0	CCD25_HUMAN	coiled-coil domain containing 25												0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0223)|KIRC - Kidney renal clear cell carcinoma(542;0.11)|Kidney(114;0.131)|Colorectal(74;0.154)		ccctggatccaaaaaaaaaag	0.000													4	2	---	---	---	---	
KIF13B	23303	broad.mit.edu	37	8	28997105	28997111	+	Intron	DEL	ACACGTA	-	-	rs138551278	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28997105_28997111delACACGTA	uc003xhh.3	-						uc003xhi.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CTTGTGGCTGACACGTAACTTACTCCC	0.459													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29894723	29894723	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29894723delA								LOC286135 (83602 upstream) : TMEM66 (25909 downstream)																							atagaaaaagaaaaaaaaaga	0.000													4	2	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40394423	40394424	+	Intron	INS	-	A	A	rs33947310		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40394423_40394424insA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			GGGGTTTGgagaaaaaaaaaaa	0.332													4	4	---	---	---	---	
AGPAT6	137964	broad.mit.edu	37	8	41465549	41465549	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41465549delT	uc003xnz.2	+							NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta						acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TATATTAACATTTTTAAAGGA	0.393													4	2	---	---	---	---	
MYST3	7994	broad.mit.edu	37	8	41894131	41894131	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41894131delA	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			actccaactcaaaaaaaaaaG	0.219													5	3	---	---	---	---	
C8orf40	114926	broad.mit.edu	37	8	42399065	42399067	+	Intron	DEL	GGT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42399065_42399067delGGT	uc011lcv.1	+						SLC20A2_uc010lxm.2_5'Flank|SLC20A2_uc003xpe.2_5'Flank|uc003xpf.1_5'Flank|C8orf40_uc003xph.2_Intron|C8orf40_uc003xpg.2_Intron|C8orf40_uc010lxo.2_Intron	NM_001135676	NP_001129148	Q96E16	CH040_HUMAN	hypothetical protein LOC114926							cytoplasm|integral to membrane|nucleolus					0	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGCCAAACACGGTGGTGGTGGTT	0.419													4	2	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53055298	53055299	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53055298_53055299insT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TAATCAACAGGCTTTTAATTCT	0.361													23	12	---	---	---	---	
PLAG1	5324	broad.mit.edu	37	8	57105508	57105508	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57105508delA	uc003xsr.3	-						PLAG1_uc010lyi.2_Intron|PLAG1_uc010lyj.2_Intron	NM_002655	NP_002646	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			tttaaggaagaaaaaaaaatg	0.000			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57746801	57746801	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57746801delA								PENK (387519 upstream) : IMPAD1 (123690 downstream)																							TGTTCAGGGGAAAAAAAATCA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66900354	66900354	+	IGR	DEL	C	-	-	rs150000256		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66900354delC								PDE7A (146599 upstream) : DNAJC5B (33437 downstream)																							TCTTTGACTTCCCTGCTAAGC	0.403													2	4	---	---	---	---	
SGK3	23678	broad.mit.edu	37	8	67706715	67706715	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67706715delA	uc003xwr.2	+						SGK3_uc003xwp.2_Intron|SGK3_uc003xwt.2_Intron|SGK3_uc003xwu.2_Intron	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCTCCCCCTGAAaaaaaaaaa	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77254158	77254158	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77254158delT								HNF4G (775099 upstream) : LOC100192378 (268957 downstream)																							TTCTATGGTCTTTTTCACTGA	0.378													4	2	---	---	---	---	
TMEM64	169200	broad.mit.edu	37	8	91705413	91705413	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91705413delA	uc003yeo.2	-							NM_001008495	NP_001008495	Q6YI46	TMM64_HUMAN	transmembrane protein 64 isoform 1							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(11;0.0598)			CTGTTAATGGAATCAGAGCCT	0.403													4	2	---	---	---	---	
TMEM64	169200	broad.mit.edu	37	8	91736136	91736136	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91736136delC	uc003yeo.2	-							NM_001008495	NP_001008495	Q6YI46	TMM64_HUMAN	transmembrane protein 64 isoform 1							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(11;0.0598)			ACAGACTCTGCCCCCATGTGT	0.413													4	2	---	---	---	---	
SDC2	6383	broad.mit.edu	37	8	97598436	97598436	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97598436delA	uc003yhv.1	+						SDC2_uc011lgu.1_Intron	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor							integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)	CCAGCTTTTTAAAAAAGAGAC	0.423													4	2	---	---	---	---	
SYBU	55638	broad.mit.edu	37	8	110595422	110595422	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110595422delG	uc003ynj.3	-						SYBU_uc003yni.3_Intron|SYBU_uc003ynk.3_Intron|SYBU_uc010mco.2_Intron|SYBU_uc003ynl.3_Intron|SYBU_uc010mcp.2_Intron|SYBU_uc010mcq.2_Intron|SYBU_uc003yno.3_Intron|SYBU_uc010mcr.2_Intron|SYBU_uc003ynm.3_Intron|SYBU_uc003ynn.3_Intron|SYBU_uc010mcs.2_Intron|SYBU_uc010mct.2_Intron|SYBU_uc010mcu.2_Intron|SYBU_uc003ynp.3_Intron|SYBU_uc010mcv.2_Intron|SYBU_uc003ynh.3_5'Flank|SYBU_uc011lhw.1_Intron	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						actaagttctgggcatcatgt	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123557657	123557657	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123557657delA								HAS2AS (900724 upstream) : ZHX2 (236244 downstream)																							AAAAAAGCACAAAAAAAATGA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130703258	130703258	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130703258delG								None (None upstream) : GSDMC (57185 downstream)																							ATAAAGGGCTGCAGCCTCCTC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131625131	131625134	+	IGR	DEL	AGAG	-	-	rs143668252		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131625131_131625134delAGAG								ASAP1 (210915 upstream) : ADCY8 (167414 downstream)																							agagagagacagagagagagagag	0.142													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131704608	131704608	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131704608delT								ASAP1 (290392 upstream) : ADCY8 (87940 downstream)																							aaggaatttgtttttgtttgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138552053	138552053	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138552053delT								None (None upstream) : FAM135B (590215 downstream)																							TTTTTAAGGCTTTTTTTTTCC	0.269													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	140879008	140879009	+	Intron	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140879008_140879009delTG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						atgttgaggctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1021013	1021013	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1021013delT								DMRT3 (29281 upstream) : DMRT2 (28845 downstream)																							ATTTCTGTGGTTAGGTGATTT	0.488													4	2	---	---	---	---	
KIAA0020	9933	broad.mit.edu	37	9	2834833	2834834	+	Intron	INS	-	TCTT	TCTT	rs149750531	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2834833_2834834insTCTT	uc003zhp.1	-						KIAA0020_uc010mhc.1_Intron|KIAA0020_uc003zhq.1_Intron	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein							endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		AAAGTCGAATATCTATCACCAC	0.312													1	6	---	---	---	---	
C9orf46	55848	broad.mit.edu	37	9	5365512	5365512	+	Intron	DEL	T	-	-	rs113281384		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5365512delT	uc003zjc.2	-						C9orf46_uc003zjd.2_Intron	NM_018465	NP_060935	Q9HBL7	CI046_HUMAN	hypothetical protein LOC55848							integral to membrane				ovary(1)	1	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.00106)|Lung(218;0.125)		gatcttgggctttgcttagtt	0.045													5	3	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20990252	20990253	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20990252_20990253insG	uc003zog.1	+	44	5498_5499	c.5135_5136insG	c.(5134-5136)GTAfs	p.V1712fs	KIAA1797_uc003zoh.1_Frame_Shift_Ins_p.V1148fs	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	1712						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GCTGGGCCAGTACCAAGCTTCC	0.594													51	24	---	---	---	---	
UBAP1	51271	broad.mit.edu	37	9	34198059	34198059	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34198059delA	uc003ztx.2	+						UBAP1_uc010mka.1_Intron|UBAP1_uc003zty.2_Intron|UBAP1_uc011loi.1_Intron|UBAP1_uc011loj.1_Intron	NM_016525	NP_057609	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1							cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)			agctgcccatactctgaggtt	0.000													4	2	---	---	---	---	
IGFBPL1	347252	broad.mit.edu	37	9	38409922	38409922	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38409922delT	uc004aba.2	-						uc004aaz.1_5'Flank	NM_001007563	NP_001007564	Q8WX77	IBPL1_HUMAN	insulin-like growth factor binding protein-like						regulation of cell growth	extracellular region	insulin-like growth factor binding				0				GBM - Glioblastoma multiforme(29;0.0437)|Lung(182;0.116)		TCTCCTCCCATTCCCTTACAT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44110180	44110181	+	IGR	INS	-	A	A	rs145444400		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44110180_44110181insA								FAM75A6 (479450 upstream) : FAM27C (880055 downstream)																							gactctatctcaaaaaaaaaaa	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45372355	45372355	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45372355delT								FAM27C (380864 upstream) : FAM27A (354674 downstream)																							agtttaactattttagatatc	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68415021	68415021	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68415021delA								FAM27B (620832 upstream) : MIR1299 (587218 downstream)																							aaagaaaaggaaaaaagaaaa	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70836724	70836724	+	IGR	DEL	T	-	-	rs143594975		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70836724delT								CBWD3 (336661 upstream) : FOXD4L3 (81059 downstream)																							AAATCAGGTGTCGGGGAGTGT	0.219													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	80795432	80795432	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80795432delT								GNAQ (149240 upstream) : CEP78 (55559 downstream)																							ACTCTTCCAGTTTAGCCATGG	0.428													4	2	---	---	---	---	
FRMD3	257019	broad.mit.edu	37	9	86063591	86063592	+	Intron	INS	-	A	A	rs113871777	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86063591_86063592insA	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						CACAGAGCGGGAAAAAAAAATG	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87082382	87082383	+	IGR	DEL	TA	-	-	rs111685301		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87082382_87082383delTA								SLC28A3 (98969 upstream) : NTRK2 (201083 downstream)																							gtgtggtgtgtatgtggtgtgt	0.109													6	9	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90163570	90163570	+	Intron	DEL	C	-	-	rs12378686	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90163570delC	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TGTATCTTTTCTTTGGGATAA	0.418									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				4	2	---	---	---	---	
SYK	6850	broad.mit.edu	37	9	93590411	93590411	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93590411delA	uc004aqz.2	+						SYK_uc004aqy.2_Intron|SYK_uc004ara.2_Intron|SYK_uc004arb.2_Intron|SYK_uc004arc.2_Intron	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1						cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						ATGGAAAAGTAAAATAGAGCC	0.453			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								4	2	---	---	---	---	
TEX10	54881	broad.mit.edu	37	9	103102057	103102057	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103102057delT	uc004bas.2	-						TEX10_uc011lvf.1_Intron|TEX10_uc011lvg.1_Intron|TEX10_uc011lvh.1_Intron	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1							integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		CTAGGCTTACTTTTTTTTTTT	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104717376	104717377	+	IGR	DEL	GT	-	-	rs149421595		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104717376_104717377delGT								GRIN3A (216514 upstream) : None (None downstream)																							acctaatccagtgtggtgggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104719138	104719138	+	IGR	DEL	C	-	-	rs149435649	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104719138delC								GRIN3A (218276 upstream) : None (None downstream)																							ccactcattgccatgacaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	113590718	113590718	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113590718delT								MUSK (27440 upstream) : LPAR1 (45338 downstream)																							AAAGTCCCCCTTTTTTTTTGC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	123013384	123013384	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123013384delT								MIR147 (6056 upstream) : CDK5RAP2 (137764 downstream)																							CAAGTTAAAATTTTTTTTACT	0.403													4	2	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123870318	123870319	+	Intron	DEL	AG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123870318_123870319delAG	uc004bkx.1	+						CEP110_uc004bkw.2_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						CTCATAAGACAGATAATTCTTt	0.178													77	35	---	---	---	---	
DAB2IP	153090	broad.mit.edu	37	9	124366945	124366946	+	Intron	INS	-	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124366945_124366946insC	uc004bln.2	+							NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						TGTTCTCATTGCCCCCCTAAGG	0.550													4	2	---	---	---	---	
TTLL11	158135	broad.mit.edu	37	9	124703038	124703039	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124703038_124703039insA	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						TCACTGCATGGTAGAGAGCAGG	0.396													4	2	---	---	---	---	
FNBP1	23048	broad.mit.edu	37	9	132769158	132769158	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132769158delA	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TGTGTGGGTTAAAAAAATAAA	0.279			T	MLL	AML								4	2	---	---	---	---	
ABCA2	20	broad.mit.edu	37	9	139917547	139917548	+	Intron	DEL	GA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139917547_139917548delGA	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004cko.1_5'Flank|ABCA2_uc010nca.2_5'UTR	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ggtgaaaggggagagagagaga	0.248													5	4	---	---	---	---	
PFKFB3	5209	broad.mit.edu	37	10	6263003	6263006	+	Intron	DEL	TGTA	-	-	rs3083330		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6263003_6263006delTGTA	uc001ije.2	+						PFKFB3_uc001ijd.2_Intron|PFKFB3_uc009xii.2_Intron|PFKFB3_uc010qaw.1_Intron|PFKFB3_uc001ijf.2_Intron	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						tgtgcatctctgtatggctctgtg	0.069													2	4	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13933400	13933401	+	Intron	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13933400_13933401delGT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						AGGAAAGTAGGTGTGTGTGTGC	0.485													4	2	---	---	---	---	
NMT2	9397	broad.mit.edu	37	10	15181250	15181253	+	Intron	DEL	TCTA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15181250_15181253delTCTA	uc001inz.1	-						NMT2_uc001ioa.1_Intron|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Intron	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2						N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						taaactcccctctatctatctatc	0.020													4	2	---	---	---	---	
RSU1	6251	broad.mit.edu	37	10	16689847	16689847	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16689847delA	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		aaagctatttaaaaaAAACTC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	18376473	18376476	+	IGR	DEL	CAAA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18376473_18376476delCAAA								SLC39A12 (44252 upstream) : CACNB2 (53130 downstream)																							TGGAATGCTTCAAACAAACAAAGC	0.466													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	25252056	25252057	+	IGR	DEL	CA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25252056_25252057delCA								PRTFDC1 (10523 upstream) : ENKUR (18860 downstream)																							ACACCTAGGTCACCTTTTCCAG	0.416													4	2	---	---	---	---	
MAP3K8	1326	broad.mit.edu	37	10	30725249	30725249	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30725249delG	uc001ivi.1	+						MAP3K8_uc009xlf.1_Intron|MAP3K8_uc001ivj.1_5'Flank	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase						cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)				GAGGCTTTTTGCAGGCGCAGT	0.473													4	2	---	---	---	---	
ZNF239	8187	broad.mit.edu	37	10	44053904	44053904	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44053904delT	uc001jaw.3	-						ZNF239_uc001jax.3_Intron|ZNF239_uc009xmj.2_Intron|ZNF239_uc009xmk.2_Intron	NM_005674	NP_005665	Q16600	ZN239_HUMAN	zinc finger protein 239						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding				0						TCTCACTTCAttttttttttt	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50484495	50484496	+	IGR	INS	-	G	G			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50484495_50484496insG								C10orf128 (88088 upstream) : C10orf71 (22691 downstream)																							cctatgtttgaggggggaaagc	0.248													4	2	---	---	---	---	
PHYHIPL	84457	broad.mit.edu	37	10	60998081	60998081	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60998081delT	uc001jkk.3	+						PHYHIPL_uc001jkl.3_Intron|PHYHIPL_uc001jkm.3_Intron	NM_032439	NP_115815	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting												0						TTTAACTTAATTTTTGTTTCA	0.264													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80870074	80870074	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80870074delT	uc001kaf.2	+							NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			gttattCTTGTTTTTGGCCTT	0.249													4	2	---	---	---	---	
C10orf58	84293	broad.mit.edu	37	10	82175288	82175288	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82175288delT	uc001kcc.3	+						C10orf58_uc001kcd.3_Intron|C10orf58_uc001kce.3_Intron	NM_032333	NP_115709	Q9BRX8	CJ058_HUMAN	hypothetical protein LOC84293 precursor							extracellular region					0			Colorectal(32;0.229)			TCCTTCTGGGTGCTTCTGTGG	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86610121	86610122	+	IGR	DEL	TC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86610121_86610122delTC								FAM190B (331845 upstream) : GRID1 (749190 downstream)																							CTGTGGGATATCTCTCTCTCAA	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86617848	86617848	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86617848delT								FAM190B (339572 upstream) : GRID1 (741464 downstream)																							gcttttagtctttttttttct	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	90858428	90858429	+	IGR	INS	-	AG	AG	rs149449109	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90858428_90858429insAG								FAS (82887 upstream) : CH25H (107267 downstream)																							CAGGTGCCAAAAGAGAGAGAGA	0.500													5	3	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94215812	94215812	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94215812delA	uc001kia.2	-						IDE_uc010qnp.1_Intron|IDE_uc001khz.2_Intron	NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	aaggactgggaagttaacttg	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	100142166	100142174	+	IGR	DEL	GACAAAAAC	-	-	rs112767651	byFrequency	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100142166_100142174delGACAAAAAC								LOXL4 (114159 upstream) : PYROXD2 (1149 downstream)																							ATACAAAAATGACAAAAACGACAAAAACG	0.287													2	5	---	---	---	---	
SCD	6319	broad.mit.edu	37	10	102108345	102108346	+	Intron	INS	-	A	A	rs146321079		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102108345_102108346insA	uc001kqy.2	+							NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		CTTTGAAGTGTGCTGTGCTGGA	0.540													5	3	---	---	---	---	
SCD	6319	broad.mit.edu	37	10	102108346	102108347	+	Intron	INS	-	AC	AC	rs10635975		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102108346_102108347insAC	uc001kqy.2	+							NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		TTTGAAGTGTGCTGTGCTGGAG	0.535													5	3	---	---	---	---	
TIAL1	7073	broad.mit.edu	37	10	121333766	121333766	+	3'UTR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121333766delC	uc001lei.1	-	12					TIAL1_uc001leh.1_3'UTR|TIAL1_uc001lej.1_3'UTR|TIAL1_uc001lek.1_3'UTR|TIAL1_uc009xzi.1_3'UTR	NM_003252	NP_003243	Q01085	TIAR_HUMAN	TIA-1 related protein isoform 1						apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		CCAATTGATTCCTTTACAAAC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	123481383	123481383	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123481383delA								FGFR2 (123411 upstream) : ATE1 (21243 downstream)																							GCTCCAATACAAAAAATGCAT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130467884	130467885	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130467884_130467885insA								MKI67 (543416 upstream) : MGMT (797569 downstream)																							atgggcacaggaaaaaagagac	0.045													4	2	---	---	---	---	
PAOX	196743	broad.mit.edu	37	10	135190401	135190402	+	5'Flank	INS	-	G	G	rs145079253	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135190401_135190402insG	uc001lmv.2	+						PAOX_uc001lmw.2_5'Flank|PAOX_uc001lmx.2_5'Flank|PAOX_uc001lmy.2_5'Flank|PAOX_uc001lmz.2_5'Flank|PAOX_uc001lna.2_5'Flank|PAOX_uc001lnb.2_5'Flank|PAOX_uc001lnc.2_5'Flank	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CTGCAGCTCTTGGGTCCATGTC	0.609													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1048858	1048859	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1048858_1048859insA								MUC6 (12152 upstream) : MUC2 (26016 downstream)																							ATAAAACCTGGAAAAATGTAGA	0.421													4	2	---	---	---	---	
BRSK2	9024	broad.mit.edu	37	11	1472476	1472476	+	Intron	DEL	G	-	-	rs36031025		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1472476delG	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_Intron|BRSK2_uc001ltn.2_Intron|BRSK2_uc010qwx.1_Intron|BRSK2_uc009ycw.2_Intron	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CAGTGCCCCTGGGGGGGCTGT	0.687													7	5	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3723544	3723563	+	Intron	DEL	CTCTCTCTCTCTCTCTCTCT	-	-	rs10767514		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3723544_3723563delCTCTCTCTCTCTCTCTCTCT	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		cacacacacactctctctctctctctctctctctctctct	0.209			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13543597	13543597	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13543597delT								PTH (26030 upstream) : FAR1 (146609 downstream)																							GAGAAACTCCTTCTATTGTCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15928694	15928695	+	IGR	INS	-	CA	CA	rs147531669	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15928694_15928695insCA								INSC (659942 upstream) : SOX6 (59301 downstream)																							acctggccctccacacacacac	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18281746	18281746	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18281746delC								SAA2 (11564 upstream) : SAA1 (6026 downstream)																							TTATTTTAGTCCACTTGACCT	0.463													4	2	---	---	---	---	
PRMT3	10196	broad.mit.edu	37	11	20409873	20409873	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20409873delG	uc001mqb.2	+						PRMT3_uc001mqc.2_Intron|PRMT3_uc010rdn.1_Intron	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1								zinc ion binding				0						GTAGTAGAGAGGGGGAACCGT	0.458													4	2	---	---	---	---	
CD44	960	broad.mit.edu	37	11	35207247	35207248	+	Intron	DEL	CA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35207247_35207248delCA	uc001mvu.2	+						CD44_uc001mvv.2_Intron|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor						cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	TTTAAGTATGCACACACACACA	0.312													4	2	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35432412	35432412	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35432412delT	uc001mwd.2	-						SLC1A2_uc001mwe.2_Intron|SLC1A2_uc010rev.1_Intron	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	ccctcattccttcataaggat	0.025													4	2	---	---	---	---	
C11orf74	119710	broad.mit.edu	37	11	36661065	36661066	+	Intron	INS	-	AA	AA			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36661065_36661066insAA	uc001mwy.1	+						C11orf74_uc010rfd.1_Intron|C11orf74_uc001mww.1_Intron|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Intron|C11orf74_uc010rfe.1_Intron	NM_138787	NP_620142	Q86VG3	CK074_HUMAN	hypothetical protein LOC119710												0	all_lung(20;0.226)	all_hematologic(20;0.0118)				tctgcaggctgtgcaagaagca	0.030													4	2	---	---	---	---	
C11orf74	119710	broad.mit.edu	37	11	36661068	36661068	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36661068delC	uc001mwy.1	+						C11orf74_uc010rfd.1_Intron|C11orf74_uc001mww.1_Intron|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Intron|C11orf74_uc010rfe.1_Intron	NM_138787	NP_620142	Q86VG3	CK074_HUMAN	hypothetical protein LOC119710												0	all_lung(20;0.226)	all_hematologic(20;0.0118)				gcaggctgtgcaagaagcatg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38781160	38781160	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38781160delA								None (None upstream) : None (None downstream)																							TAGAGATATTATGAATGAAAG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43209156	43209157	+	IGR	DEL	AA	-	-	rs67433457		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43209156_43209157delAA								None (None upstream) : API5 (124348 downstream)																							CCCAACCAGGAAAAAAAAAAAA	0.485													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45447111	45447111	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45447111delT								SYT13 (139227 upstream) : CHST1 (223316 downstream)																							ACAATGATGGTTTTTTGAGGA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48359727	48359728	+	IGR	INS	-	A	A	rs148222456	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48359727_48359728insA								OR4C3 (12247 upstream) : OR4C45 (7174 downstream)																							taaaggtatgtaaataaagcat	0.000													4	2	---	---	---	---	
RPLP0P2	113157	broad.mit.edu	37	11	61397049	61397050	+	Intron	INS	-	AC	AC	rs147379520	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61397049_61397050insAC	uc001nrz.1	+							NR_002775				SubName: Full=cDNA FLJ51469, highly similar to 60S acidic ribosomal protein P0;												0						CTCACACAACAACACACACACA	0.530													4	2	---	---	---	---	
ASRGL1	80150	broad.mit.edu	37	11	62108311	62108312	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62108311_62108312insA	uc001nte.3	+						ASRGL1_uc001ntf.3_Intron|ASRGL1_uc001ntg.3_Intron	NM_025080	NP_079356	Q7L266	ASGL1_HUMAN	asparaginase-like 1						asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	AACTGTTTGGGAACTTCATACA	0.416													4	2	---	---	---	---	
TMEM223	79064	broad.mit.edu	37	11	62558503	62558503	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62558503delT	uc001nve.2	-							NM_001080501	NP_001073970	A0PJW6	TM223_HUMAN	transmembrane protein 223							integral to membrane					0						TACTGAGCGCttttttttttg	0.264													4	2	---	---	---	---	
KDM2A	22992	broad.mit.edu	37	11	66975342	66975342	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66975342delA	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Intron	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						caaaaagtacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68834849	68834850	+	Intron	DEL	CC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68834849_68834850delCC	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGCTGGGAGGCCACAGGGAGAT	0.688													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74929403	74929405	+	IGR	DEL	AGG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74929403_74929405delAGG								SLCO2B1 (11959 upstream) : ARRB1 (47077 downstream)																							TAAATCAATTAGGAGGAGGAGGA	0.488													4	2	---	---	---	---	
MRE11A	4361	broad.mit.edu	37	11	94182288	94182289	+	Intron	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94182288_94182289delTG	uc001peu.2	-						MRE11A_uc001pev.2_Intron|MRE11A_uc009ywj.2_Intron	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				TTCTAAGCTCTGTGATACCATA	0.426								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95500185	95500185	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95500185delT								SESN3 (534480 upstream) : FAM76B (1921 downstream)																							GTGCTGTGCATTTTTTTTTTC	0.328													4	2	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108203617	108203617	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108203617delG	uc001pkb.1	+	53	8302	c.7917delG	c.(7915-7917)AAGfs	p.K2639fs	ATM_uc009yxr.1_Frame_Shift_Del_p.K2639fs|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Frame_Shift_Del_p.K1291fs|ATM_uc001pkg.1_Frame_Shift_Del_p.K996fs	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2639					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		CTCAGTGGAAGACTCAGAGAA	0.348			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			223	114	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112217223	112217223	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112217223delG								PTS (76546 upstream) : NCAM1 (614772 downstream)																							AGTCAGAGGTGGACTTCTTAT	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113879377	113879377	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113879377delA								HTR3A (18345 upstream) : ZBTB16 (51054 downstream)																							ctcacaggctaaaatgccgga	0.000													4	2	---	---	---	---	
TRAPPC4	51399	broad.mit.edu	37	11	118893972	118893973	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118893972_118893973insA	uc010ryo.1	+						TRAPPC4_uc010ryp.1_Intron|TRAPPC4_uc001pup.2_Intron|TRAPPC4_uc010ryq.1_Intron	NM_016146	NP_057230	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development|ER to Golgi vesicle-mediated transport	cis-Golgi network|dendrite|endoplasmic reticulum|Golgi stack|synaptic vesicle	protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TCCCCTGGCTTAAGTGGGGAGA	0.351													72	33	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132938355	132938355	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132938355delT	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GACGCTGCCCTTCTTCCAGTA	0.478													4	2	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7466338	7466338	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7466338delA	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						ataaggaaggaaaaaaaatac	0.124													7	4	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11289821	11289822	+	Intron	INS	-	CT	CT	rs145971306	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11289821_11289822insCT	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron|TAS2R30_uc009zhs.1_5'Flank	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						TTTAAATTTTACTGTTTTTATA	0.287										HNSCC(22;0.051)			5	3	---	---	---	---	
EMP1	2012	broad.mit.edu	37	12	13360860	13360861	+	Intron	DEL	CT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13360860_13360861delCT	uc001rbr.2	+						EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Intron	NM_001423	NP_001414	P54849	EMP1_HUMAN	epithelial membrane protein 1						cell growth|cell proliferation|epidermis development	integral to membrane|membrane fraction					0		Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TTTGGAACTGCTCAGTGCACCA	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14745685	14745685	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14745685delC								PLBD1 (24894 upstream) : GUCY2C (19885 downstream)																							GTTATCAGTTCCTCCAATGGT	0.294													4	2	---	---	---	---	
SSPN	8082	broad.mit.edu	37	12	26367387	26367388	+	Intron	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26367387_26367388delTG	uc001rhe.2	+						SSPN_uc001rhd.2_Intron|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077	Q14714	SSPN_HUMAN	sarcospan isoform 1						cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)					ATATTTGCTATGTGACCATgac	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31284899	31284900	+	Intron	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31284899_31284900delGT	uc010sjy.1	-											RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		TCTCCAAGAGGTGAATTTCATA	0.351													4	2	---	---	---	---	
DIP2B	57609	broad.mit.edu	37	12	51054343	51054343	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51054343delT	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron|DIP2B_uc009zls.1_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						ATTTCCAGTCTTTTTTTTTTT	0.333													6	4	---	---	---	---	
BIN2	51411	broad.mit.edu	37	12	51718862	51718862	+	5'Flank	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51718862delG	uc001ryg.2	-						BIN2_uc009zlz.2_5'Flank|BIN2_uc001ryh.2_5'Flank|BIN2_uc010sng.1_5'Flank	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						AGGATAGTATGGACGCCCGTG	0.458													4	2	---	---	---	---	
KIAA0748	9840	broad.mit.edu	37	12	55371803	55371804	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55371803_55371804insT	uc001sgn.3	-						KIAA0748_uc010spd.1_Intron|KIAA0748_uc001sgo.3_Intron	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840											ovary(1)|central_nervous_system(1)	2						TTTTTTTTTTGTTTTTTTTTCT	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55455784	55455784	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55455784delT								NEUROD4 (31984 upstream) : OR9K2 (67769 downstream)																							ATTTCAATGATTTTTTTTTTT	0.299													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78333905	78333905	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78333905delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AATCATCCCCTTTGAAATGAG	0.373										HNSCC(70;0.22)			4	2	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	82061280	82061280	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82061280delC	uc001szo.1	-						PPFIA2_uc010suj.1_Intron|PPFIA2_uc009zsi.1_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						tgttactcctccCCATCATTA	0.134													4	2	---	---	---	---	
C12orf50	160419	broad.mit.edu	37	12	88419254	88419254	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88419254delG	uc001tam.1	-						C12orf50_uc001tan.2_Intron	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419											skin(2)|ovary(1)	3						ggaatgaactgggggagtacc	0.005													4	2	---	---	---	---	
EPYC	1833	broad.mit.edu	37	12	91366991	91366992	+	Intron	INS	-	TATT	TATT	rs145098905	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91366991_91366992insTATT	uc001tbk.2	-							NM_004950	NP_004941	Q99645	EPYC_HUMAN	dermatan sulfate proteoglycan 3 precursor						female pregnancy	proteinaceous extracellular matrix	glycosaminoglycan binding			skin(1)	1						taGTACTTTTCTATTAGAAATT	0.183													4	4	---	---	---	---	
RFX4	5992	broad.mit.edu	37	12	106983412	106983412	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106983412delC	uc001tlr.2	+							NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						CATGCCCTCTCCCCACCCAGG	0.338													4	2	---	---	---	---	
IFT81	28981	broad.mit.edu	37	12	110643760	110643760	+	Intron	DEL	T	-	-	rs145505610	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110643760delT	uc001tqi.2	+						IFT81_uc001tqh.2_Intron|IFT81_uc001tqj.2_Intron	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						ttggcattgattacattcaca	0.040													4	2	---	---	---	---	
ACAD10	80724	broad.mit.edu	37	12	112129205	112129205	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112129205delC	uc001tsq.2	+						ACAD10_uc009zvw.2_Intron|ACAD10_uc001tso.3_Intron|ACAD10_uc001tsp.2_Intron|ACAD10_uc009zvx.2_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						tttctggtatccccaagaggc	0.060													4	2	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114308364	114308364	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114308364delG	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AGAACAAGGAGGGCAGGTGAT	0.438													4	2	---	---	---	---	
COQ5	84274	broad.mit.edu	37	12	120960838	120960838	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120960838delA	uc001tyn.2	-						COQ5_uc001tyo.2_Intron|COQ5_uc010szj.1_Intron	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase						ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGATTCTTATAAAAAAAAAAG	0.249													5	3	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124367604	124367604	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124367604delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		cggtacttcattttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124717070	124717070	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124717070delA								ZNF664 (217103 upstream) : FAM101A (56640 downstream)																							CCTTCCAGCGAGGGCTCACAT	0.577													4	2	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131499720	131499720	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131499720delG	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ATACCTGGGTGGGTGCTTCTG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20370779	20370780	+	IGR	DEL	CT	-	-	rs149055817		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20370779_20370780delCT								PSPC1 (13696 upstream) : ZMYM5 (26844 downstream)																							ggactaatagctCttttttttt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21816984	21816984	+	IGR	DEL	T	-	-	rs112717607		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21816984delT								MRP63 (63766 upstream) : ZDHHC20 (133526 downstream)																							CTACAGGCTATTTTTTTTTCA	0.413													5	5	---	---	---	---	
LNX2	222484	broad.mit.edu	37	13	28124846	28124847	+	Intron	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28124846_28124847delAC	uc001url.3	-							NM_153371	NP_699202	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2								zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CCAAGTGAAGacacacacacac	0.307													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31341550	31341551	+	IGR	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31341550_31341551delGT								ALOX5AP (2994 upstream) : C13orf33 (138761 downstream)																							GGCAGCAGCAGTGTGTGTGTGT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31635113	31635113	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31635113delA								C13orf26 (85962 upstream) : HSPH1 (75652 downstream)																							TTGCTTCCTTAGGGATTCATG	0.493													4	2	---	---	---	---	
WBP4	11193	broad.mit.edu	37	13	41655054	41655055	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41655054_41655055insA	uc001uxt.2	+						WBP4_uc010tfd.1_Intron	NM_007187	NP_009118	O75554	WBP4_HUMAN	WW domain-containing binding protein 4						nuclear mRNA cis splicing, via spliceosome	nuclear speck|spliceosomal complex	nucleic acid binding|proline-rich region binding|zinc ion binding			breast(2)|kidney(1)	3		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		ATTAAAAGTATAGCTTGAGGCC	0.218													34	26	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50963725	50963725	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50963725delG	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron|uc001veq.1_5'Flank|uc001ver.2_5'Flank|uc001veo.1_Intron|uc001vep.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						TAGGGGTAGTGGGGAGATAAG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74213359	74213359	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74213359delT								KLF5 (561684 upstream) : KLF12 (46791 downstream)																							ACCTACCTGGTCAGGGTGTCA	0.473													4	2	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74356401	74356401	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74356401delC	uc001vjf.2	-						KLF12_uc010aeq.2_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		ACAGTGTGTTCTATCCAAGTC	0.279													4	2	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96540376	96540390	+	Intron	DEL	AGTTTAGGTACAGAG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96540376_96540390delAGTTTAGGTACAGAG	uc001vmt.2	-						UGGT2_uc001vmu.1_Intron	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						gtacttttgcagtttaggtacagagagattaaggt	0.074													4	2	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	108515844	108515844	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108515844delA	uc001vql.2	-							NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						AAACCACAACAAAAAAACACC	0.338													4	2	---	---	---	---	
MCF2L	23263	broad.mit.edu	37	13	113732974	113732974	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113732974delC	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron|MCF2L_uc001vss.3_Intron|MCF2L_uc010tjs.1_Intron|MCF2L_uc001vst.1_Intron	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CTGTTTTTCTCCCCAGAGTGA	0.637													21	17	---	---	---	---	
RPGRIP1	57096	broad.mit.edu	37	14	21802084	21802086	+	Intron	DEL	TTT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21802084_21802086delTTT	uc001wag.2	+						RPGRIP1_uc001wah.2_Intron|RPGRIP1_uc001wai.2_Intron|RPGRIP1_uc001wak.2_Intron|RPGRIP1_uc010aim.2_Intron|RPGRIP1_uc001wal.2_Intron|RPGRIP1_uc001wam.2_Intron	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator						response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		tgaggccaccttttttttttttt	0.000													4	2	---	---	---	---	
SALL2	6297	broad.mit.edu	37	14	22002731	22002731	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22002731delG	uc001wbe.2	-						SALL2_uc010tma.1_Intron|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2								DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		TATGGGGAATGGGTGAGCAGA	0.458													4	2	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31176889	31176889	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31176889delA	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TATAACTCGCAAAAAAAAAAT	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	46232301	46232301	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46232301delA								C14orf106 (509696 upstream) : RPL10L (887921 downstream)																							TTTATATGGGAAAAATAGGTA	0.303													4	2	---	---	---	---	
PLEKHH1	57475	broad.mit.edu	37	14	68054176	68054176	+	3'UTR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68054176delT	uc001xjl.1	+	29					PLEKHH1_uc010tsw.1_3'UTR|PLEKHH1_uc001xjn.1_3'UTR|PLEKHH1_uc010tsx.1_3'UTR|PLEKHH1_uc001xjo.1_3'UTR|PLEKHH1_uc001xjp.1_3'UTR	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H							cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CATTTATTCCTTTTTTCATAA	0.378													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	68964203	68964203	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68964203delT	uc001xkf.1	+						RAD51L1_uc001xke.2_3'UTR|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		AACACATAGGTTTTTTTTTTT	0.279			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69650754	69650755	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69650754_69650755insT								DCAF5 (30840 upstream) : EXD2 (7491 downstream)																							aagccttccccttttttcacta	0.000													4	2	---	---	---	---	
SIPA1L1	26037	broad.mit.edu	37	14	72164662	72164662	+	Intron	DEL	C	-	-	rs67441385	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72164662delC	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		AAAAAAAAAACCACAGAAAAC	0.378													3	3	---	---	---	---	
PGF	5228	broad.mit.edu	37	14	75422793	75422794	+	5'Flank	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75422793_75422794delGT	uc010ase.1	-						PGF_uc001xqz.2_5'Flank|PGF_uc001xra.2_5'Flank|PGF_uc001xrb.2_5'Flank|PGF_uc010asf.1_5'Flank	NM_002632	NP_002623	P49763	PLGF_HUMAN	placental growth factor, vascular endothelial						angiogenesis|cell differentiation|cell-cell signaling|positive regulation of cell division|positive regulation of cell proliferation|vascular endothelial growth factor receptor signaling pathway	extracellular region|membrane	growth factor activity|heparin binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00668)		TTCTTGGAAAgtgtgtgtgtgt	0.287													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76308888	76308888	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76308888delT	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xrz.2_Intron|TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		TTTTGATTGATTTTACCCAGG	0.393													4	2	---	---	---	---	
C14orf118	55668	broad.mit.edu	37	14	76643327	76643327	+	Intron	DEL	C	-	-	rs67771969		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76643327delC	uc001xsh.2	+						C14orf118_uc001xsi.2_Intron|C14orf118_uc001xsl.2_Intron	NM_017926	NP_060396	Q9NWQ4	CN118_HUMAN	hypothetical protein LOC55668 isoform 1											ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.0172)		TTTTTTTTTTCCAAAATGGAT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	78552201	78552202	+	IGR	INS	-	T	T	rs150928559	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78552201_78552202insT								ADCK1 (151905 upstream) : NRXN3 (84726 downstream)																							CAGTGATTTGGTTCATTTCTAT	0.193													4	5	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78734628	78734629	+	Intron	INS	-	T	T	rs142891898	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78734628_78734629insT	uc001xum.1	+									Q9Y4C0	NRX3A_HUMAN	Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		gttttgttttgttttgttttCA	0.297													4	2	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81099844	81099845	+	Intron	INS	-	TC	TC	rs139177145	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81099844_81099845insTC	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGCCACCTCTGTCTCTCTCTAT	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86134667	86134667	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86134667delA								FLRT2 (40398 upstream) : None (None downstream)																							TGTATTGAACAAAAAAGACCT	0.443													4	2	---	---	---	---	
RPS6KA5	9252	broad.mit.edu	37	14	91380221	91380221	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91380221delA	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		AAGGAATTCCAAAGAGAAAGC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103220509	103220509	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103220509delT								RCOR1 (23597 upstream) : TRAF3 (23307 downstream)																							GTCTGTGTGATTTTTTTTTGA	0.433													11	5	---	---	---	---	
TRAF3	7187	broad.mit.edu	37	14	103342281	103342282	+	Intron	INS	-	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103342281_103342282insC	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		TTTTAAACACTCCCCCCCCTAC	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104003463	104003463	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104003463delA								TRMT61A (55 upstream) : BAG5 (19426 downstream)																							TCTAATGCCCAGGCGGGAGAG	0.552													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106787846	106787847	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106787846_106787847insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TCCTGATTACCAAATGGAAACC	0.495													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20210083	20210084	+	IGR	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20210083_20210084insT								None (None upstream) : GOLGA6L6 (527010 downstream)																							GCAGGAGGGCCTTCACAAAAAG	0.574													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20472742	20472742	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20472742delA								None (None upstream) : GOLGA6L6 (264352 downstream)																							actccatctcaaaaaaaaaaa	0.174													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20573306	20573306	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20573306delA								None (None upstream) : GOLGA6L6 (163788 downstream)																							attcaatcccaaaaaagttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22786042	22786043	+	IGR	DEL	CA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22786042_22786043delCA								GOLGA6L1 (40040 upstream) : TUBGCP5 (47352 downstream)																							GCTGGCCCTTCACAGCACAATG	0.530													4	2	---	---	---	---	
PWRN1	791114	broad.mit.edu	37	15	24796223	24796223	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24796223delT	uc001ywm.2	+											Homo sapiens cDNA FLJ25418 fis, clone TST03512.												0						gcgtgacgcattacatgggag	0.000													4	2	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30015670	30015671	+	Intron	DEL	CT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30015670_30015671delCT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ttcctgaggcctccccagaagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31110465	31110465	+	IGR	DEL	A	-	-	rs3841495		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31110465delA								ARHGAP11B (132656 upstream) : MTMR15 (85590 downstream)																							CGATTTATACATGCTGGAATG	0.373													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	33590490	33590491	+	IGR	INS	-	TTG	TTG	rs144814147	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33590490_33590491insTTG								FMN1 (230405 upstream) : RYR3 (12686 downstream)																							gcatagggctattggactaaat	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38964077	38964077	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38964077delT								RASGRP1 (107070 upstream) : C15orf53 (24722 downstream)																							TGAAATCAGGTTACGAAGAGC	0.507													4	2	---	---	---	---	
BMF	90427	broad.mit.edu	37	15	40390967	40390967	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40390967delA	uc001zkv.2	-						BMF_uc001zkt.2_Intron|BMF_uc001zku.2_Intron|BMF_uc001zkw.2_Intron	NM_033503	NP_277038	Q96LC9	BMF_HUMAN	Bcl2 modifying factor isoform bmf-1						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	cytosol|mitochondrial outer membrane|myosin complex|plasma membrane	protein binding			ovary(1)	1		all_cancers(109;4.18e-18)|all_epithelial(112;6.15e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0516)		CCCACTTTCCAAAAAAAAAAG	0.493													4	2	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41630002	41630002	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41630002delG	uc001zns.3	+						NUSAP1_uc001znq.3_Intron|NUSAP1_uc001znr.3_Intron|NUSAP1_uc010bce.2_Intron|NUSAP1_uc001znt.3_Intron|NUSAP1_uc001znv.3_Intron|NUSAP1_uc001znu.3_Intron|NUSAP1_uc010ucw.1_Intron	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		ctccttggttggttcttcatc	0.000													4	2	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43398407	43398407	+	5'Flank	DEL	T	-	-	rs78412725		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43398407delT	uc001zqq.2	-						UBR1_uc010udk.1_5'Flank	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GGACTGGAGATTTTTTTTTTC	0.512													6	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	47651186	47651187	+	Intron	DEL	TT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47651186_47651187delTT	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGAGAATAGCTTTAGTTCTTCC	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62534753	62534753	+	RNA	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62534753delT	uc002ain.1	-	11		c.2894delA			uc002aio.2_5'Flank|uc002aip.2_5'Flank|uc002air.1_5'Flank|uc002ais.2_5'Flank|uc002ait.2_5'Flank|uc002aiu.2_5'Flank|uc002aiv.2_5'Flank|uc002aix.1_5'Flank|uc002aiy.2_5'Flank|uc002aiz.1_5'Flank|uc002aja.2_5'Flank|uc002ajb.2_5'Flank|uc002ajc.2_5'Flank|uc002ajd.2_5'Flank|uc002aje.2_5'Flank|uc002ajf.2_5'Flank|uc010uhn.1_5'Flank|uc002ajg.1_5'Flank					Homo sapiens cDNA FLJ38723 fis, clone KIDNE2010137, weakly similar to GOLGIN-95.																		TTCCCATAACTTTTTTTTTTT	0.323													6	3	---	---	---	---	
APH1B	83464	broad.mit.edu	37	15	63595545	63595546	+	Intron	DEL	CA	-	-	rs138939092		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63595545_63595546delCA	uc002ama.2	+						APH1B_uc002amb.2_Intron|APH1B_uc010bgq.2_Intron|APH1B_uc010bgr.2_Intron	NM_031301	NP_112591	Q8WW43	APH1B_HUMAN	presenilin stabilization factor-like isoform 1						apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	integral to membrane|plasma membrane|transport vesicle	peptidase activity|protein binding				0						tcaacagagtcacacaacgttt	0.000													3	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63908449	63908450	+	Intron	INS	-	TCTA	TCTA	rs144336374	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63908449_63908450insTCTA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CAGGAGCCTGCTCTATTAGAAG	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	72702175	72702178	+	IGR	DEL	AGGC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72702175_72702178delAGGC								TMEM202 (1468 upstream) : ARIH1 (64489 downstream)																							tgggaggccaaggcaggcggattg	0.093													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78069685	78069686	+	IGR	DEL	AC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78069685_78069686delAC								LINGO1 (81210 upstream) : LOC645752 (136873 downstream)																							CCCCTCCcatacacacacacac	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78105576	78105576	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78105576delT								LINGO1 (117101 upstream) : LOC645752 (100983 downstream)																							caatagaaggtttttttttta	0.000													4	2	---	---	---	---	
UBE2Q2P1	388165	broad.mit.edu	37	15	85085805	85085805	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85085805delT	uc002bkn.1	-							NR_003661				Homo sapiens cDNA FLJ43276 fis, clone KIDNE2011532, moderately similar to Homo sapiens melanoma-associated chondroitin sulfate proteoglycan 4.												0						Atttattttattttttttttg	0.129													4	2	---	---	---	---	
LOC283761	283761	broad.mit.edu	37	15	90048926	90048927	+	RNA	INS	-	C	C			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90048926_90048927insC	uc002bob.2	-	4		c.704_705insG			LOC283761_uc002bod.2_RNA|LOC283761_uc010upt.1_Intron|LOC283761_uc010upu.1_RNA|LOC283761_uc002boc.2_RNA	NR_027075				Homo sapiens cDNA FLJ25381 fis, clone TST02166.												0						caggaagggatttttttttttt	0.040													4	2	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763301	90763302	+	Intron	DEL	GA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763301_90763302delGA	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GCGCAGCCCTGACAGCCATGTC	0.624											OREG0023468	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92165910	92165911	+	IGR	INS	-	A	A	rs139431469	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92165910_92165911insA								SV2B (327262 upstream) : SLCO3A1 (231027 downstream)																							ATTCTGCCCTCAAAAAAGTATT	0.376													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94381497	94381497	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94381497delG	uc002bte.1	-											Homo sapiens cDNA clone IMAGE:5266107.																		TCTAGTGAGTGGAAAAGGTTA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101249284	101249284	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101249284delC								ASB7 (57382 upstream) : ALDH1A3 (170725 downstream)																							cagaaatgtgccagggggagt	0.000													4	2	---	---	---	---	
C16orf91	283951	broad.mit.edu	37	16	1479062	1479064	+	Intron	DEL	GCA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1479062_1479064delGCA	uc010uvd.1	-							NM_001010878	NP_001010878	Q4G0I0	CSMT1_HUMAN	hypothetical protein LOC283951							integral to membrane					0						CTCACCTGGGGCATGGGCTCCCT	0.665													6	3	---	---	---	---	
C16orf5	29965	broad.mit.edu	37	16	4565010	4565010	+	5'Flank	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4565010delG	uc002cwu.2	-						C16orf5_uc002cwv.2_Intron|C16orf5_uc002cww.2_Intron|C16orf5_uc010uxl.1_Intron|C16orf5_uc010uxm.1_Intron|C16orf5_uc010btu.2_Intron	NM_013399	NP_037531	Q9H305	LITFL_HUMAN	cell death inducing protein						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|tumor necrosis factor-mediated signaling pathway	nucleus				ovary(1)	1		Ovarian(90;0.17)				GTGGGGGTCAGGGGGAAGAAG	0.532													4	2	---	---	---	---	
C16orf72	29035	broad.mit.edu	37	16	9196595	9196596	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9196595_9196596insT	uc002czm.2	+							NM_014117	NP_054836	Q14CZ0	CP072_HUMAN	hypothetical protein LOC29035											large_intestine(1)	1						TTTCTGTTAAATTTTTTTTTTT	0.302													4	2	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	10035487	10035487	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10035487delG	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CTCTGgggttggactacccag	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12668492	12668493	+	IGR	INS	-	AA	AA	rs144530004	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12668492_12668493insAA								SNX29 (347 upstream) : CPPED1 (85164 downstream)																							GTAAATATTGCAAGAGTGACAG	0.158													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12910928	12910928	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12910928delT								CPPED1 (13184 upstream) : SHISA9 (84549 downstream)																							CACTAGCTTGtttttttttag	0.184													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13328815	13328816	+	Intron	DEL	CT	-	-	rs72029595		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13328815_13328816delCT	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						CAGTCTCTAActctctctctct	0.386													6	3	---	---	---	---	
BFAR	51283	broad.mit.edu	37	16	14738020	14738020	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14738020delA	uc002dco.2	+						BFAR_uc002dcm.2_Intron|BFAR_uc002dcn.2_Intron|BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_5'Flank	NM_016561	NP_057645	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2						actgtgtctcaaaaaaaaaaa	0.119													5	4	---	---	---	---	
BFAR	51283	broad.mit.edu	37	16	14758635	14758636	+	Intron	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14758635_14758636delGT	uc002dco.2	+						BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_Intron	NM_016561	NP_057645	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2						gggattacaggtgtgagccacc	0.129													43	25	---	---	---	---	
ACSM2A	123876	broad.mit.edu	37	16	20490249	20490250	+	Intron	DEL	CT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20490249_20490250delCT	uc010bwe.2	+						ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						TCCTCAAGAACTCTCTGTTTCA	0.465													4	2	---	---	---	---	
VWA3A	146177	broad.mit.edu	37	16	22145979	22145980	+	Intron	INS	-	TGTT	TGTT	rs145330076	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22145979_22145980insTGTT	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc010bxc.2_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		gtggCAATTGGtgtttgtttgt	0.015													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23041708	23041709	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23041708_23041709insA								HS3ST2 (114051 upstream) : USP31 (31020 downstream)																							CTCATTTGAATAAAAAAAAAAT	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26228064	26228064	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26228064delG								HS3ST4 (79056 upstream) : C16orf82 (850155 downstream)																							ATTAATTTTTGTCAGAGTCAT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26385831	26385831	+	IGR	DEL	G	-	-	rs72532698		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26385831delG								HS3ST4 (236823 upstream) : C16orf82 (692388 downstream)																							tggatggaatgggtaagtaag	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33976289	33976289	+	IGR	DEL	T	-	-	rs147837943		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33976289delT								MIR1826 (10697 upstream) : UBE2MP1 (427513 downstream)																							gagaaacttctttgttatgtg	0.000													3	4	---	---	---	---	
ABCC11	85320	broad.mit.edu	37	16	48254286	48254286	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48254286delT	uc002eff.1	-						ABCC11_uc002efg.1_Intron|ABCC11_uc002efh.1_Intron|ABCC11_uc010vgl.1_Intron	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				aagagggatgttagagaactg	0.085									Cerumen_Type				4	2	---	---	---	---	
CCL22	6367	broad.mit.edu	37	16	57394892	57394893	+	Intron	INS	-	CAGGA	CAGGA	rs144288480	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57394892_57394893insCAGGA	uc002elh.2	+							NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0						GGATGGTGAAccaggcgtggtg	0.233													4	2	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58517272	58517272	+	Intron	DEL	A	-	-	rs35447648		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58517272delA	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						GTTTGCCTTTAAAAAAAAAAG	0.458													6	3	---	---	---	---	
ZFHX3	463	broad.mit.edu	37	16	72972757	72972757	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72972757delA	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CAGTCTGGGCAAAAAAAAATT	0.478													4	2	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78143939	78143939	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78143939delA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron|WWOX_uc002ffj.1_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		ACGCATCCTTAAAAAAAAAAA	0.209													5	3	---	---	---	---	
CENPN	55839	broad.mit.edu	37	16	81047510	81047510	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81047510delA	uc002ffx.2	+						CENPN_uc002ffw.3_Intron|CENPN_uc010vnl.1_Intron|CENPN_uc010vnm.1_Intron|CENPN_uc002ffy.3_Intron	NM_001100624	NP_001094094	Q96H22	CENPN_HUMAN	centromere protein N isoform 2						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0						ttaaaaaaTCAAAAAGTTAAA	0.169													27	13	---	---	---	---	
ZCCHC14	23174	broad.mit.edu	37	16	87504973	87504973	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87504973delA	uc002fjz.1	-						ZCCHC14_uc002fka.1_Intron	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		AACGCTAACCAAAAAAACATT	0.323													4	2	---	---	---	---	
PELP1	27043	broad.mit.edu	37	17	4586458	4586458	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4586458delG	uc002fyi.3	-						PELP1_uc010vsf.1_Intron	NM_014389	NP_055204	Q8IZL8	PELP1_HUMAN	proline, glutamic acid and leucine rich protein						transcription, DNA-dependent	cytoplasm|MLL1 complex	protein binding			ovary(1)|central_nervous_system(1)	2						GAATTTGTGTGGGGGAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4704553	4704553	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4704553delT								PSMB6 (2765 upstream) : PLD2 (5868 downstream)																							TTGCTAAGCCTTCCTGGAGGT	0.517													4	2	---	---	---	---	
ALOXE3	59344	broad.mit.edu	37	17	8018801	8018801	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8018801delA	uc010cnr.2	-						ALOXE3_uc002gka.2_Intron|ALOXE3_uc010vuo.1_Intron|ALOXE3_uc010vup.1_Intron	NM_021628	NP_067641	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3 isoform 2						leukotriene biosynthetic process		iron ion binding|lipoxygenase activity			skin(3)|lung(1)|central_nervous_system(1)	5						GGTTAGGTCCAAATAAGAGTC	0.438													30	16	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11836116	11836116	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11836116delA	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACCAGACCATACCTATGTCTT	0.458													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21227599	21227600	+	IGR	INS	-	A	A	rs143708005	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21227599_21227600insA								MAP2K3 (9050 upstream) : KCNJ12 (52099 downstream)																							TGTTGATTTATTCCTTCTAGCC	0.233													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21305652	21305653	+	Intron	INS	-	C	C	rs146958586		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21305652_21305653insC	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCTTTTTTTTTCCTCAGCCTGT	0.520										Prostate(3;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21341474	21341475	+	IGR	INS	-	AC	AC	rs58281653		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21341474_21341475insAC								KCNJ12 (18295 upstream) : C17orf51 (90097 downstream)																							TATCTATATCTacacacacaca	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25283918	25283918	+	IGR	DEL	A	-	-	rs111654238		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25283918delA								None (None upstream) : WSB1 (337188 downstream)																							agataaaatcagatgagcctg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27029737	27029737	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27029737delG								SUPT6H (489 upstream) : PROCA1 (797 downstream)																							TTTCCCAGCTGGGCCTTGGTC	0.572													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31695881	31695881	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31695881delG	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	ACTTTCCACAGGGAGGCCCTG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34980934	34980936	+	IGR	DEL	CTT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34980934_34980936delCTT								MRM1 (15528 upstream) : LHX1 (313563 downstream)																							GTTAGATGAACTTCTTCTTTGTG	0.493													3	4	---	---	---	---	
MED1	5469	broad.mit.edu	37	17	37562165	37562165	+	3'UTR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37562165delT	uc002hrv.3	-	17					MED1_uc010wee.1_3'UTR|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1						androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		ATCACCTGGCTTTTTTTTTTT	0.438										HNSCC(31;0.082)			3	3	---	---	---	---	
MPP2	4355	broad.mit.edu	37	17	41957523	41957523	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41957523delT	uc010wip.1	-						MPP2_uc002ien.1_Intron|MPP2_uc010wim.1_Intron|MPP2_uc002ieo.1_Intron|MPP2_uc010win.1_Intron|MPP2_uc010wio.1_Intron	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2						signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		ACTCTCCCCATTGGCACACAC	0.602											OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44309250	44309251	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44309250_44309251insA								KIAA1267 (6533 upstream) : ARL17B (54612 downstream)																							agacctgaaataaaacaatgcc	0.000													4	2	---	---	---	---	
HLF	3131	broad.mit.edu	37	17	53346099	53346099	+	Intron	DEL	T	-	-	rs75601852		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53346099delT	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_Intron|HLF_uc010wni.1_Intron	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TGTTCTTATCTTTTTTTTTTT	0.398			T	TCF3	ALL								2	4	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55367101	55367102	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55367101_55367102insA	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		GAAACACTCAGTGATGCTACTT	0.535			T	HOXA9	CML								4	2	---	---	---	---	
YPEL2	388403	broad.mit.edu	37	17	57451805	57451805	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57451805delC	uc002ixm.1	+							NM_001005404	NP_001005404	Q96QA6	YPEL2_HUMAN	yippee-like 2							nucleolus					0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					TGAATCCAGTCCCAGAGGGTT	0.468													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64113534	64113534	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64113534delA	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			GCACAAGACCAAAAAAAAAAT	0.294													5	7	---	---	---	---	
ABCA9	10350	broad.mit.edu	37	17	66988955	66988955	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66988955delA	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					actctgtctcaaaaaaaaaaa	0.114													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	67354112	67354112	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67354112delC								ABCA5 (30789 upstream) : MAP2K6 (56726 downstream)																							TTGGAAGAGACCAGCCACCTG	0.473													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77387305	77387305	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77387305delT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			ACTTCCCCACTGCTTGCAGGA	0.512													5	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78697010	78697011	+	Intron	INS	-	TTC	TTC	rs140995574	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78697010_78697011insTTC	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						aagttgttattttctttataat	0.000													4	3	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79423404	79423404	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79423404delA	uc002kaf.2	+	14	4651	c.4651delA	c.(4651-4653)AAGfs	p.K1551fs	BAHCC1_uc002kae.2_Frame_Shift_Del_p.K781fs	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	1551							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GCTGAAACCCAAGGTCAAGAG	0.657													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8442738	8442738	+	IGR	DEL	G	-	-	rs35000901		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8442738delG								PTPRM (35880 upstream) : RAB12 (166697 downstream)																							gagtctttttgatcccctacc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11250768	11250768	+	IGR	DEL	T	-	-	rs111438866		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11250768delT								FAM38B (548789 upstream) : GNAL (438368 downstream)																							GACTTTATGATTTTTTTTTTG	0.333													10	5	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11862174	11862174	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11862174delA	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_Intron	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						AGGCAACATTAAAAAAAAGAA	0.463													4	2	---	---	---	---	
ANKRD29	147463	broad.mit.edu	37	18	21214243	21214255	+	Intron	DEL	TTTTTTTTTTTTT	-	-	rs2914965		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21214243_21214255delTTTTTTTTTTTTT	uc002kun.2	-						ANKRD29_uc002kuo.2_Intron	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACTTTCCCTGttttttttttttttttttttttt	0.197													4	2	---	---	---	---	
ANKRD29	147463	broad.mit.edu	37	18	21225896	21225896	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21225896delA	uc002kun.2	-						ANKRD29_uc002kuo.2_Intron	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TAAGCTTGATAAAAAAAAAAG	0.358													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22314071	22314071	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22314071delG								HRH4 (254151 upstream) : ZNF521 (327817 downstream)																							TTGAGACAATGGGTCAGGCTA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22474853	22474853	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22474853delT								HRH4 (414933 upstream) : ZNF521 (167035 downstream)																							ATGAGCTCTATTTTGTTTGTG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	25763685	25763687	+	IGR	DEL	GGT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25763685_25763687delGGT								CDH2 (6240 upstream) : None (None downstream)																							AGGGAAAGGAGGTGAGAGACAGG	0.502													4	2	---	---	---	---	
DTNA	1837	broad.mit.edu	37	18	32462341	32462341	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32462341delT	uc010dmn.1	+						DTNA_uc002kxw.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						TAAATACttctttttttttta	0.184													6	3	---	---	---	---	
SLC14A2	8170	broad.mit.edu	37	18	42928076	42928076	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42928076delG	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CCAGAACACAGGGACAATTTC	0.512													4	2	---	---	---	---	
SMAD2	4087	broad.mit.edu	37	18	45458515	45458515	+	5'Flank	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45458515delT	uc002lcy.2	-						SMAD2_uc002lcz.2_5'Flank|SMAD2_uc010xdc.1_5'Flank|SMAD2_uc010xdd.1_5'Flank	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1						anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						TAGAACACAGTTTTTTTTTGG	0.413													4	2	---	---	---	---	
SKA1	220134	broad.mit.edu	37	18	47918723	47918723	+	3'UTR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47918723delT	uc002let.2	+	7					SKA1_uc002leu.2_3'UTR|SKA1_uc010xdl.1_3'UTR	NM_145060	NP_659497	Q96BD8	SKA1_HUMAN	spindle and KT associated 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0						ttttgtttccttttttttttt	0.095													4	3	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48349405	48349405	+	5'Flank	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48349405delG	uc002lew.3	-						MRO_uc010dpa.2_5'Flank|MRO_uc010dpb.2_5'Flank|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		TGTAGAGGATGGAGCATCTAC	0.522													4	2	---	---	---	---	
BCL2	596	broad.mit.edu	37	18	60830589	60830593	+	Intron	DEL	TAATA	-	-	rs59180476		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60830589_60830593delTAATA	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	TTTTGCTACCTAATATATCACTTCT	0.390			T	IGH@	NHL|CLL								4	2	---	---	---	---	
SERPINB7	8710	broad.mit.edu	37	18	61462992	61462992	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61462992delT	uc002ljl.2	+						SERPINB7_uc002ljm.2_Intron|SERPINB7_uc010xet.1_Intron|SERPINB7_uc010dqg.2_Intron	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade						regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				aaacatggcatttttgagcaa	0.000													4	2	---	---	---	---	
SERPINB8	5271	broad.mit.edu	37	18	61650927	61650927	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61650927delC	uc002ljv.2	+	5	708	c.539delC	c.(538-540)ACAfs	p.T180fs	SERPINB8_uc002ljt.2_Frame_Shift_Del_p.T180fs|SERPINB8_uc002lju.2_Frame_Shift_Del_p.T180fs|SERPINB8_uc010xex.1_5'UTR	NM_198833	NP_942130	P50452	SPB8_HUMAN	serine (or cysteine) proteinase inhibitor, clade	180					regulation of proteolysis	cytosol	protein binding|serine-type endopeptidase inhibitor activity			skin(1)	1		Esophageal squamous(42;0.129)				AGAAAGTACACAAGGGGAATG	0.388													196	101	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	69034016	69034017	+	IGR	DEL	TG	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69034016_69034017delTG								None (None upstream) : None (None downstream)																							aatacatgactgtgatgttggt	0.000													4	2	---	---	---	---	
DNM2	1785	broad.mit.edu	37	19	10831837	10831838	+	Intron	DEL	TA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10831837_10831838delTA	uc002mps.1	+						DNM2_uc010dxk.2_Intron|DNM2_uc002mpt.1_Intron|DNM2_uc002mpv.1_Intron|DNM2_uc002mpu.1_Intron|DNM2_uc010dxl.1_Intron	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2						G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			AGTTGCTCATTATATATATAtt	0.277													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13335318	13335320	+	Intron	DEL	AAC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13335318_13335320delAAC	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	aaaaaaaaaaaacaccaaaaCCC	0.232													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17003703	17003704	+	IGR	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17003703_17003704insA								F2RL3 (875 upstream) : CPAMD8 (59 downstream)																							AGGTGCCCGGGacacacacatg	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24103159	24103159	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24103159delT	uc002nrp.1	-						uc010eda.1_RNA					Homo sapiens cDNA FLJ43698 fis, clone TCERX2000998.																		ACAATCTGACTTTTTTTTTCT	0.274													4	2	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	31014593	31014594	+	Intron	INS	-	T	T			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31014593_31014594insT	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCATACTCTGATTTTTTTTTTT	0.525													4	3	---	---	---	---	
TSHZ3	57616	broad.mit.edu	37	19	31780892	31780892	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31780892delT	uc002nsy.3	-							NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					CTGTGCCCCCTGGGTTATGCT	0.473													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32085981	32085981	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32085981delA								TSHZ3 (245791 upstream) : ZNF507 (750533 downstream)																							actcagtgataaaaaataagc	0.050													4	2	---	---	---	---	
PLD3	23646	broad.mit.edu	37	19	40873490	40873490	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40873490delA	uc002onm.3	+						PLD3_uc002onj.3_Intron|PLD3_uc002onk.3_Intron|PLD3_uc002onl.3_Intron|PLD3_uc002onn.2_Intron|PLD3_uc002ono.2_3'UTR	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3						lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			ctctgtctctaaaaaaaaaaa	0.254													3	3	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41071833	41071833	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41071833delA	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCACCCTTGAAAAAAAAGTC	0.532													4	2	---	---	---	---	
ARHGEF1	9138	broad.mit.edu	37	19	42407087	42407087	+	Intron	DEL	T	-	-	rs76291947		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42407087delT	uc002orx.2	+						ARHGEF1_uc002ory.2_Intron|ARHGEF1_uc002orz.2_Intron|ARHGEF1_uc002osa.2_Intron|ARHGEF1_uc002osb.2_Intron|ARHGEF1_uc002osc.2_Intron|ARHGEF1_uc002osd.2_Intron|ARHGEF1_uc002ose.2_Intron	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform						cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GGCTCTCCTCTTTTTTTTTTA	0.358													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42440982	42440985	+	IGR	DEL	TGTC	-	-	rs68112136		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42440982_42440985delTGTC								ARHGEF1 (6688 upstream) : RABAC1 (19849 downstream)																							CTGTGTGCCGtgtctgtctgtctg	0.373													2	5	---	---	---	---	
GIPR	2696	broad.mit.edu	37	19	46177122	46177122	+	Intron	DEL	A	-	-	rs35790297		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46177122delA	uc002pcu.1	+						GIPR_uc002pct.1_Intron|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_Intron|MIR642_hsa-mir-642|MI0003657_5'Flank	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		accatgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DHDH	27294	broad.mit.edu	37	19	49439432	49439433	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49439432_49439433insA	uc002ple.1	+	3	386_387	c.346_347insA	c.(346-348)CGAfs	p.R116fs		NM_014475	NP_055290	Q9UQ10	DHDH_HUMAN	dimeric dihydrodiol dehydrogenase	116					carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGCCCGATCCCGAGCCCTCTTC	0.619													10	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51780512	51780512	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51780512delT								C19orf75 (7930 upstream) : IGLON5 (34590 downstream)																							ATAAATGATATTCTTATAAAC	0.343													4	2	---	---	---	---	
SIGLEC6	946	broad.mit.edu	37	19	52024615	52024616	+	Intron	INS	-	GT	GT			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52024615_52024616insGT	uc002pwy.2	-						SIGLEC6_uc002pwz.2_Intron|SIGLEC6_uc002pxa.2_Intron|SIGLEC6_uc010ydb.1_Intron|SIGLEC6_uc010ydc.1_Intron|SIGLEC6_uc010eoz.1_Intron	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1						cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TTTATACTGGAgtgtgtgtgtg	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3446197	3446197	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3446197delT								C20orf194 (57610 upstream) : ATRN (5468 downstream)																							ttcctGCTTATTCCCCTTTGA	0.264													4	2	---	---	---	---	
ESF1	51575	broad.mit.edu	37	20	13752841	13752841	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13752841delA	uc002woj.2	-						ESF1_uc002wok.1_Intron	NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						ATGATGTCTCAAAAAAAAAAG	0.264													4	5	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	16021670	16021670	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16021670delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AAGGCCACACAAAAGTATTCA	0.343													17	11	---	---	---	---	
RRBP1	6238	broad.mit.edu	37	20	17601725	17601725	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17601725delC	uc002wpv.1	-						RRBP1_uc010zrp.1_5'Flank|RRBP1_uc002wpt.1_Intron|RRBP1_uc002wpu.2_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron|RRBP1_uc010gcm.1_Intron	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						GGGTTTGCCACCAGCACCAAG	0.597													4	2	---	---	---	---	
SLC24A3	57419	broad.mit.edu	37	20	19398647	19398648	+	Intron	DEL	GA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19398647_19398648delGA	uc002wrl.2	+							NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						gaggtcccctgagagattgcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24023518	24023518	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24023518delG								GGTLC1 (54102 upstream) : TMEM90B (426317 downstream)																							TGTGGCTGCTGGCTTCATTTC	0.498													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24560219	24560219	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24560219delC	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						tctgtgctgtcccacgtgaca	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26209149	26209150	+	IGR	DEL	AA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26209149_26209150delAA								MIR663 (20235 upstream) : None (None downstream)																							TTTGTATTTTAAAAGATACTTA	0.198													5	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29645742	29645743	+	Intron	DEL	AG	-	-	rs148671604	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29645742_29645743delAG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						gactggataaagaaaatgtggt	0.000													6	3	---	---	---	---	
HCK	3055	broad.mit.edu	37	20	30650168	30650169	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30650168_30650169insA	uc002wxh.2	+						HCK_uc010gdy.2_Intron|HCK_uc002wxi.2_Intron	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK						interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GCCTTAGAGATAAAATCATTCC	0.228													4	2	---	---	---	---	
EDEM2	55741	broad.mit.edu	37	20	33733033	33733033	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33733033delT	uc002xbo.2	-						EDEM2_uc010zuv.1_Intron|EDEM2_uc010zus.1_5'Flank|EDEM2_uc002xbq.2_Intron|EDEM2_uc010zut.1_Intron|EDEM2_uc002xbp.2_Intron|EDEM2_uc002xbn.2_Intron|EDEM2_uc002xbr.2_Intron|EDEM2_uc010zuu.1_Intron	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGTAGCTCAATTGTAATTAAA	0.448													17	11	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40204705	40204706	+	Intron	INS	-	T	T	rs6102475	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40204705_40204706insT	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				AAAATTAATTCTTTTTTTTTCT	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45329083	45329083	+	IGR	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45329083delG								TP53RK (10807 upstream) : SLC2A10 (9196 downstream)																							ccacaggggtgaaggaaggAG	0.189											OREG0025998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46257004	46257004	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46257004delA	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron|NCOA3_uc010zyc.1_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						CAGataaattaaaaaaaaaat	0.308													6	3	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46260674	46260674	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46260674delT	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron|NCOA3_uc010zyc.1_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						cccagatgtatttttttctac	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51208784	51208784	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51208784delA								ZFP64 (400260 upstream) : TSHZ2 (380093 downstream)																							CTGCATGACTAAAAAAAATCA	0.333													4	2	---	---	---	---	
CASS4	57091	broad.mit.edu	37	20	55010152	55010152	+	Intron	DEL	G	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55010152delG	uc002xxp.2	+						CASS4_uc002xxq.3_Intron|CASS4_uc002xxr.2_Intron|CASS4_uc010zze.1_Intron|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a						cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						ATGTCTTTCTGGGTGCGTGAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9769171	9769172	+	RNA	INS	-	TT	TT			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9769171_9769172insTT	uc011abu.1	+	10		c.1146_1147insTT								Homo sapiens, clone IMAGE:4720764, mRNA.																		GAAATTGAATCATCAGTCTAGA	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9856378	9856380	+	IGR	DEL	CTC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9856378_9856380delCTC								None (None upstream) : None (None downstream)																							CCTCTGCCTTCTCCTCCAGGGCA	0.581													6	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAGGAAAAGTTATGTATAT	0.124													3	7	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11089518	11089519	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11089518_11089519insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gactctgtctcaaaaaaacaga	0.144													4	2	---	---	---	---	
NCAM2	4685	broad.mit.edu	37	21	22752883	22752884	+	Intron	INS	-	T	T	rs143341047	by1000genomes	TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22752883_22752884insT	uc002yld.1	+						NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Intron	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ctgttttcttgttttttttttc	0.000													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37660828	37660828	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37660828delA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						ccttgtctacaaaaaaataca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40542902	40542908	+	IGR	DEL	TAAAAAA	-	-	rs57027593		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40542902_40542908delTAAAAAA								ETS2 (346026 upstream) : PSMG1 (4482 downstream)																							ctcatttttttaaaaaataaaaaataa	0.150													2	5	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41603254	41603255	+	Intron	DEL	AT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41603254_41603255delAT	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				caaaattgccatttgcttgttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	45408187	45408188	+	IGR	DEL	CA	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45408187_45408188delCA								AGPAT3 (713 upstream) : TRAPPC10 (24018 downstream)																							CACGTCCCAGCACACACACGGG	0.450													4	2	---	---	---	---	
PWP2	5822	broad.mit.edu	37	21	45539215	45539215	+	Intron	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45539215delT	uc002zeb.2	+							NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog							cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GCCGGGCCAGTCTGACCTGGG	0.672													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45824662	45824663	+	Intron	INS	-	TGA	TGA			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45824662_45824663insTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GACAGTGACTGTGATGATAGTG	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23353071	23353071	+	IGR	DEL	T	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23353071delT								LOC96610 (87989 upstream) : RTDR1 (48523 downstream)																							CTGGCATTCATACCATCTCAG	0.408													11	6	---	---	---	---	
RFPL1S	10740	broad.mit.edu	37	22	29840242	29840243	+	5'Flank	DEL	CT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29840242_29840243delCT	uc003afm.1	-							NR_002727				Homo sapiens RET finger protein-like 1 antisense transcript, partial.												0						ccttccctccctctctctctcG	0.297													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29984705	29984706	+	IGR	DEL	TC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29984705_29984706delTC								NIPSNAP1 (7561 upstream) : NF2 (14839 downstream)														p.?(1)									TGTCCTAGGATCTCTCTCTCTC	0.505													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32380357	32380357	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32380357delA								YWHAH (26768 upstream) : SLC5A1 (58680 downstream)																							TAACAGTGATAAAAACCCGCA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34367552	34367553	+	IGR	DEL	GT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34367552_34367553delGT								LARGE (48968 upstream) : None (None downstream)																							GTGAAGAtgcgtgtgtgtgtgt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34798855	34798855	+	IGR	DEL	G	-	-	rs34048100		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34798855delG								LARGE (480271 upstream) : ISX (663274 downstream)																							cttcaacgctggggatcaaaa	0.109													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34920523	34920524	+	IGR	INS	-	CACT	CACT			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34920523_34920524insCACT								LARGE (601939 upstream) : ISX (541605 downstream)																							AGGGGTACTCACACTCACTTGC	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36607635	36607635	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36607635delA								APOL4 (6756 upstream) : APOL2 (14621 downstream)																							CTCACAAGACAAAACAGCACA	0.249													4	2	---	---	---	---	
CSNK1E	1454	broad.mit.edu	37	22	38779792	38779792	+	Intron	DEL	A	-	-	rs112114000		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38779792delA	uc003avm.1	-						LOC400927_uc010gxm.2_Intron|LOC400927_uc011ans.1_Intron|LOC400927_uc011ant.1_Intron|LOC400927_uc003avr.1_Intron	NM_152221	NP_689407	P49674	KC1E_HUMAN	casein kinase 1 epsilon						DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)					AAACTCTGTTAAAAAAAAAAA	0.353													3	3	---	---	---	---	
PACSIN2	11252	broad.mit.edu	37	22	43396684	43396684	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43396684delC	uc003bdg.3	-							NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				TCAGCCCCAACCCCCACATCA	0.398													4	2	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1410813	1410814	+	Intron	DEL	CC	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1410813_1410814delCC	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CAGGAGGAGACCCTGTACCACC	0.554													5	3	---	---	---	---	
PRRG1	5638	broad.mit.edu	37	X	37299711	37299711	+	Intron	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37299711delC	uc004ddn.2	+						PRRG1_uc004ddo.2_Intron|PRRG1_uc010ngx.1_Intron	NM_000950	NP_000941	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1							extracellular region|integral to plasma membrane	calcium ion binding			ovary(1)|breast(1)	2						TGGTTTGAGGCGGAGATCAAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	52698921	52698921	+	IGR	DEL	C	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52698921delC								SSX7 (14971 upstream) : SSX2 (27025 downstream)																							GCCATCTCATCCCCCAGTGGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53142506	53142507	+	Intron	INS	-	A	A			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53142506_53142507insA	uc004dry.2	+											full-length cDNA clone CS0DC007YA11 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																		AAAACACACACACAAAAAAAAA	0.267													4	2	---	---	---	---	
FAM120C	54954	broad.mit.edu	37	X	54099867	54099868	+	Intron	DEL	TT	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54099867_54099868delTT	uc004dsz.3	-						FAM120C_uc011moh.1_Intron	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954											ovary(1)|central_nervous_system(1)	2						TAGTACAATCtttttttttttt	0.223													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	102724160	102724160	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102724160delA								NGFRAP1 (91161 upstream) : RAB40A (30522 downstream)																							TTTTGCATTTAAAAAAATAGC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	114480217	114480217	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114480217delA								LRCH2 (11582 upstream) : LUZP4 (44075 downstream)																							gtggcaaagcaaaaattttaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	117417364	117417364	+	IGR	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117417364delA								KLHL13 (166576 upstream) : WDR44 (62678 downstream)																							GTTTAAAAAGAAAAAAAATGG	0.378													4	2	---	---	---	---	
DKC1	1736	broad.mit.edu	37	X	153994771	153994771	+	Intron	DEL	A	-	-			TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153994771delA	uc004fmm.2	+						DKC1_uc010nvf.2_Intron|SNORA36A_uc004fmn.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1						cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTTCATTAAGAAAAAAAAAAA	0.418									Congenital_Dyskeratosis				11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59014875	59014875	+	IGR	DEL	T	-	-	rs111879055		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59014875delT								None (None upstream) : None (None downstream)																							aaaactggtctgtttggggat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59018536	59018536	+	IGR	DEL	A	-	-	rs56157184		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59018536delA								None (None upstream) : None (None downstream)																							ATGACTTATCAGAGAACTTTT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59031343	59031343	+	IGR	DEL	A	-	-	rs141871237		TCGA-CZ-5451-01A-01D-1501-10	TCGA-CZ-5451-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59031343delA								None (None upstream) : None (None downstream)																							TCTCAGTAACAAAAGGAACAG	0.284													6	3	---	---	---	---	
