Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF1	65121	broad.mit.edu	37	1	12855774	12855774	+	Missense_Mutation	SNP	A	G	G	rs75985223	byFrequency	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12855774A>G	uc001auj.1	+	4	1157	c.1054A>G	c.(1054-1056)AAA>GAA	p.K352E		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	352	LRR 2.										0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCTCTCAAAACCCTCAT	0.552													6	285	---	---	---	---	PASS
TMEM51	55092	broad.mit.edu	37	1	15546032	15546032	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15546032C>T	uc001avw.3	+	4	1074	c.555C>T	c.(553-555)AAC>AAT	p.N185N	TMEM51_uc010obk.1_Silent_p.N185N|TMEM51_uc001avz.2_3'UTR|TMEM51_uc001avy.2_Silent_p.N185N|TMEM51_uc001avx.2_Silent_p.N185N	NM_001136216	NP_001129688	Q9NW97	TMM51_HUMAN	transmembrane protein 51	185						integral to membrane					0		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		GCCCTGGGAACCCCCCTGACA	0.547													23	76	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70502287	70502287	+	Silent	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70502287T>C	uc001dep.2	+	18	2184	c.2154T>C	c.(2152-2154)CAT>CAC	p.H718H	LRRC7_uc009wbg.2_Intron|LRRC7_uc001deq.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	718						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						ATGCAGTACATAATTCTTTGT	0.413													7	169	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145273385	145273385	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145273385G>A	uc001emn.3	+	3	609	c.239G>A	c.(238-240)GGC>GAC	p.G80D	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.G80D|NOTCH2NL_uc001emo.2_Missense_Mutation_p.G80D|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	80	EGF-like 3.				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						CTGAATGGCGGCACATGCCAT	0.532													7	493	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191256	152191256	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191256C>T	uc001ezt.1	-	3	2925	c.2849G>A	c.(2848-2850)GGC>GAC	p.G950D		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	950	10.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGACCTGAGCCAGATCCATG	0.547													265	245	---	---	---	---	PASS
S100A7L2	645922	broad.mit.edu	37	1	153410763	153410763	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153410763C>T	uc010pdx.1	-	2	154	c.76G>A	c.(76-78)GCG>ACG	p.A26T		NM_001045479	NP_001038944			S100 calcium binding protein A7-like 2											ovary(1)	1	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGAAACATCGCGACTATGTCC	0.433													16	160	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158325960	158325960	+	Intron	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158325960G>A	uc001fse.2	+						CD1E_uc010pid.1_Silent_p.G321G|CD1E_uc010pie.1_Silent_p.G224G|CD1E_uc010pif.1_Silent_p.G134G|CD1E_uc001fsd.2_Intron|CD1E_uc001fsk.2_Intron|CD1E_uc001fsj.2_Intron|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Intron|CD1E_uc001fry.2_Intron|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Intron|CD1E_uc009wsv.2_Intron|CD1E_uc001frz.2_Intron|CD1E_uc009wsw.2_Intron	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor						antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					TGAGTGTGGGGCTGAGGAAAT	0.428													8	23	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240072560	240072560	+	3'UTR	SNP	A	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240072560A>G	uc001hyp.2	+	5						NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	CAAAACGCACACATCAACCCA	0.502													18	28	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243327906	243327906	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243327906G>T	uc001hzs.2	-	13	3764	c.3356C>A	c.(3355-3357)GCT>GAT	p.A1119D	CEP170_uc001hzt.2_Missense_Mutation_p.A1021D|CEP170_uc001hzu.2_Missense_Mutation_p.A1021D|CEP170_uc001hzv.1_Missense_Mutation_p.A497D	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1119	Targeting to microtubules.|Targeting to centrosomes.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TGCTTTGTCAGCATCAGCAAG	0.478													15	47	---	---	---	---	PASS
TMEM18	129787	broad.mit.edu	37	2	669565	669565	+	3'UTR	SNP	A	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:669565A>T	uc002qwl.2	-	5					TMEM18_uc002qwk.2_RNA	NM_152834	NP_690047	Q96B42	TMM18_HUMAN	transmembrane protein 18						cell migration	integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		GCAAACTCCAAGCAGCTGCTG	0.443													24	50	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25469138	25469138	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25469138C>T	uc002rgc.2	-	11	1577	c.1320G>A	c.(1318-1320)TGG>TGA	p.W440*	DNMT3A_uc002rgd.2_Nonsense_Mutation_p.W440*|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Nonsense_Mutation_p.W251*	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	440					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGTTCCACCCACATGTCCG	0.547			Mis|F|N|S		AML								61	146	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28117448	28117448	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28117448C>T	uc002rlr.2	+	3	343	c.25C>T	c.(25-27)CGA>TGA	p.R9*	BRE_uc002rlp.1_Nonsense_Mutation_p.R9*|BRE_uc002rlq.2_Nonsense_Mutation_p.R9*|BRE_uc002rls.2_Nonsense_Mutation_p.R9*|BRE_uc002rlt.2_Nonsense_Mutation_p.R9*|BRE_uc002rlu.2_Nonsense_Mutation_p.R9*	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A	9					apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding	p.R9L(1)		lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GGCCTTGAACCGAATATCTCC	0.418													80	268	---	---	---	---	PASS
ASPRV1	151516	broad.mit.edu	37	2	70188955	70188955	+	5'UTR	SNP	G	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70188955G>C	uc002sfz.3	-	1						NM_152792	NP_690005	Q53RT3	APRV1_HUMAN	aspartic peptidase, retroviral-like 1 precursor						protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1						CCCAAGAAAGGCCAGCCTCTG	0.582													4	4	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173850293	173850293	+	Intron	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173850293G>T	uc002uhv.3	+						RAPGEF4_uc002uhu.2_3'UTR|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron|RAPGEF4_uc010zef.1_Intron|RAPGEF4_uc010zeg.1_Intron|RAPGEF4_uc010fqp.1_Intron|RAPGEF4_uc010zeh.1_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GGGAAGCCAGGCTGCTAACGC	0.557													8	98	---	---	---	---	PASS
PRKAG3	53632	broad.mit.edu	37	2	219691759	219691759	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219691759C>T	uc002vjb.1	-	10	1079	c.1060G>A	c.(1060-1062)GGC>AGC	p.G354S	PRKAG3_uc010zkn.1_RNA|PRKAG3_uc010fvy.1_Silent_p.S395S	NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	354					cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)|lung(1)	2		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGGAATGTGCCGATGCCCAAA	0.597													38	143	---	---	---	---	PASS
C2orf54	79919	broad.mit.edu	37	2	241831176	241831176	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241831176C>T	uc002wae.3	-	2	678	c.519G>A	c.(517-519)TCG>TCA	p.S173S	C2orf54_uc002wac.2_Silent_p.S5S|C2orf54_uc002wad.2_Silent_p.S24S	NM_001085437	NP_001078906	Q08AI8	CB054_HUMAN	hypothetical protein LOC79919 isoform 1	173				S -> P (in Ref. 1; BAB15445).							0		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		CCGCGTTCAGCGAACCTGCAA	0.647													20	55	---	---	---	---	PASS
DCLK3	85443	broad.mit.edu	37	3	36778888	36778888	+	Silent	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36778888G>A	uc003cgi.2	-	2	1754	c.1263C>T	c.(1261-1263)TAC>TAT	p.Y421Y		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	421	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						TGTCTGTTTCGTAGACTTCAT	0.502													19	95	---	---	---	---	PASS
VPRBP	9730	broad.mit.edu	37	3	51456279	51456279	+	Silent	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51456279G>A	uc003dbe.1	-	15	3456	c.3288C>T	c.(3286-3288)TTC>TTT	p.F1096F	VPRBP_uc003dbf.1_Silent_p.F372F	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	1096	WD 1.|WD repeat-like region.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CACAGCAGGTGAAGCCACTCT	0.502													5	12	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66436782	66436782	+	Intron	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66436782G>T	uc003dmx.2	-						SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Intron|LRIG1_uc003dmw.2_Intron|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGAGGAACCAGCTGCTGTTCA	0.537													6	108	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955069	113955069	+	3'UTR	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955069G>A	uc010hqo.2	-	1					ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				AAAAAAAAAAGAAAACCCACA	0.428													8	100	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121413151	121413151	+	Silent	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121413151T>C	uc003eei.3	-	13	6330	c.6204A>G	c.(6202-6204)GAA>GAG	p.E2068E	GOLGB1_uc010hrc.2_Silent_p.E2073E|GOLGB1_uc003eej.3_Silent_p.E2034E|GOLGB1_uc011bjm.1_Silent_p.E1954E|GOLGB1_uc010hrd.1_Silent_p.E2032E	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2068	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TTTTGCGGTGTTCAACTGCTT	0.403													4	317	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121417605	121417605	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121417605T>C	uc003eei.3	-	13	1876	c.1750A>G	c.(1750-1752)AGG>GGG	p.R584G	GOLGB1_uc010hrc.2_Missense_Mutation_p.R589G|GOLGB1_uc003eej.3_Missense_Mutation_p.R550G|GOLGB1_uc011bjm.1_Missense_Mutation_p.R470G|GOLGB1_uc010hrd.1_Missense_Mutation_p.R548G	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	584	Potential.|Cytoplasmic (Potential).				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TCCTCAGCCCTTTTTCCCTGG	0.363													5	231	---	---	---	---	PASS
CCNL1	57018	broad.mit.edu	37	3	156870748	156870748	+	Intron	SNP	A	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156870748A>G	uc003fbf.2	-						CCNL1_uc003fbd.1_Intron|CCNL1_uc003fbe.2_5'UTR|CCNL1_uc003fbg.2_Intron|CCNL1_uc011bor.1_Intron|CCNL1_uc003fbi.1_Intron	NM_020307	NP_064703	Q9UK58	CCNL1_HUMAN	cyclin L1						regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nuclear speck	protein kinase binding			lung(3)|breast(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			TCAGATAGAAACATAAATTCA	0.299													8	45	---	---	---	---	PASS
BCL6	604	broad.mit.edu	37	3	187451335	187451335	+	Silent	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187451335G>A	uc003frp.3	-	3	604	c.147C>T	c.(145-147)GTC>GTT	p.V49V	BCL6_uc011bsf.1_Silent_p.V49V|BCL6_uc010hza.2_5'UTR|BCL6_uc003frq.1_Silent_p.V49V	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	49	BTB.				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		AGGCCATGAGGACCGTTTTAT	0.507			T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								11	190	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195410687	195410687	+	Missense_Mutation	SNP	T	A	A	rs6583274	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195410687T>A	uc003fuw.2	+	13	1778	c.584T>A	c.(583-585)GTG>GAG	p.V195E	SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						CCCTTTGAGGTGCACTGGAGG	0.567													3	20	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195410689	195410689	+	Missense_Mutation	SNP	C	T	T	rs6583275	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195410689C>T	uc003fuw.2	+	13	1780	c.586C>T	c.(586-588)CAC>TAC	p.H196Y	SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						CTTTGAGGTGCACTGGAGGAA	0.567													3	20	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85603587	85603587	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85603587G>A	uc003hpd.2	-	64	10171	c.9763C>T	c.(9763-9765)CCA>TCA	p.P3255S	WDFY3_uc003hpc.2_Missense_Mutation_p.P10S	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3255						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCAGGAGCTGGTGTTTCAGGA	0.318													21	75	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94376877	94376877	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94376877C>T	uc011cdt.1	+	11	1868	c.1610C>T	c.(1609-1611)ACG>ATG	p.T537M	GRID2_uc011cdu.1_Missense_Mutation_p.T442M	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	537	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	GTGGACTTTACGACACGTTAC	0.433													46	114	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114302736	114302736	+	3'UTR	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114302736C>T	uc003ibe.3	+	46					ANK2_uc003ibd.3_3'UTR|ANK2_uc003ibf.3_3'UTR|ANK2_uc011cgc.1_3'UTR|ANK2_uc003ibg.3_3'UTR|ANK2_uc003ibh.3_3'UTR|ANK2_uc011cgd.1_3'UTR|ANK2_uc010imr.2_Silent_p.R168R|ANK2_uc010ims.2_Silent_p.R107R	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACCTCCAGCGCGATCTCCAGC	0.552													5	20	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80513248	80513248	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80513248A>C	uc003kha.1	+	25	3508	c.3508A>C	c.(3508-3510)AAC>CAC	p.N1170H	RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	1170	Ras-GEF.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AGGAACACCAAACTTTACTGA	0.403													13	217	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127855010	127855010	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127855010C>T	uc003kuu.2	-	5	1023	c.584G>A	c.(583-585)CGC>CAC	p.R195H	FBN2_uc003kuv.2_Missense_Mutation_p.R162H|FBN2_uc003kuw.3_Missense_Mutation_p.R195H|FBN2_uc003kux.1_Missense_Mutation_p.R195H	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	195	EGF-like 3.			GPNR -> AQP (in Ref. 1; AAA18950).	bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAAGCACAGCGGTTGGGTCC	0.408													5	82	---	---	---	---	PASS
SLC25A27	9481	broad.mit.edu	37	6	46623671	46623671	+	Silent	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46623671C>A	uc003oyh.2	+	2	449	c.198C>A	c.(196-198)GCC>GCA	p.A66A	SLC25A27_uc011dwb.1_Silent_p.A66A|SLC25A27_uc003oyg.2_Silent_p.A66A|SLC25A27_uc011dwc.1_5'UTR|SLC25A27_uc003oyi.2_5'Flank	NM_004277	NP_004268	O95847	UCP4_HUMAN	solute carrier family 25, member 27	66	Solcar 1.				generation of precursor metabolites and energy|transport	integral to membrane|mitochondrial inner membrane					0			Lung(136;0.192)			GAGAATCTGCCCCCTATAGGG	0.502													4	140	---	---	---	---	PASS
CBX3	11335	broad.mit.edu	37	7	26251843	26251843	+	3'UTR	SNP	C	T	T	rs9768418	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26251843C>T	uc003sxt.2	+	6					CBX3_uc003sxu.2_3'UTR|CBX3_uc003sxv.2_3'UTR	NM_007276	NP_009207	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome, centromeric region|nuclear centromeric heterochromatin|nuclear euchromatin|nuclear inner membrane|spindle	enzyme binding|protein domain specific binding			ovary(1)	1						TCACATTGTTCTTTtatatat	0.264													4	18	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32867064	32867064	+	Intron	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32867064C>T	uc011kai.1	+						uc003tda.1_RNA	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						AGAAGTGAAGCGAGAACTGAT	0.299													15	23	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48315047	48315047	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48315047C>T	uc003toq.2	+	17	5809	c.5784C>T	c.(5782-5784)GTC>GTT	p.V1928V	ABCA13_uc010kyr.2_Silent_p.V1431V	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1928					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TACCGTTTGTCCCACCTTCAA	0.363													88	250	---	---	---	---	PASS
LRRC17	10234	broad.mit.edu	37	7	102574825	102574825	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102574825G>C	uc003vau.2	+	2	854	c.465G>C	c.(463-465)TTG>TTC	p.L155F	FBXL13_uc010liq.1_Intron|FBXL13_uc003vaq.2_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|LRRC17_uc003vat.2_Missense_Mutation_p.L155F	NM_001031692	NP_001026862	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17 isoform 1	155					bone marrow development|negative regulation of osteoclast differentiation|ossification	extracellular space				ovary(1)	1						CACCTCTCTTGAGCTACCTGC	0.458													41	120	---	---	---	---	PASS
MYC	4609	broad.mit.edu	37	8	128748713	128748713	+	5'UTR	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128748713C>T	uc003ysh.1	+	2					uc003ysg.2_5'Flank|MYC_uc003ysi.2_5'UTR	NM_002467	NP_002458	P01106	MYC_HUMAN	myc proto-oncogene protein						branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)		TGCACTGGAACTTACAACACC	0.647		3	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL						OREG0018981	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	PASS
TAL2	6887	broad.mit.edu	37	9	108425025	108425025	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108425025A>C	uc004bct.2	+	1	288	c.248A>C	c.(247-249)CAC>CCC	p.H83P		NM_005421	NP_005412	Q16559	TAL2_HUMAN	T-cell acute lymphocytic leukemia 2	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						CAAGGACCCCACCTGCCAGGC	0.552			T	TRB@	T-ALL								8	51	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													9	87	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136324223	136324223	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136324223G>A	uc004cdv.3	+	29	4649	c.4205G>A	c.(4204-4206)CGG>CAG	p.R1402Q	ADAMTS13_uc004cdp.3_3'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.R1346Q|ADAMTS13_uc004cdu.1_Missense_Mutation_p.R1315Q|ADAMTS13_uc004cdw.3_Missense_Mutation_p.R1346Q|ADAMTS13_uc004cdx.3_Missense_Mutation_p.R1315Q|ADAMTS13_uc004cdz.3_Missense_Mutation_p.R1072Q|ADAMTS13_uc004ceb.3_Missense_Mutation_p.R198Q|C9orf7_uc011mdg.1_5'Flank|C9orf7_uc004cec.2_5'Flank|C9orf7_uc011mdh.1_5'Flank|C9orf7_uc011mdi.1_5'Flank|C9orf7_uc010nan.2_5'Flank	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1402	CUB 2.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCCAGCCTGCGGGGCCAGTAC	0.587													7	26	---	---	---	---	PASS
TUBB8	347688	broad.mit.edu	37	10	94018	94018	+	Missense_Mutation	SNP	T	C	C	rs9329307		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94018T>C	uc001ifi.2	-	4	314	c.314A>G	c.(313-315)CAC>CGC	p.H105R	TUBB8_uc009xhe.2_Missense_Mutation_p.H68R|TUBB8_uc010pzs.1_Missense_Mutation_p.H33R	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 isoform 1	105					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TTCGGTGTAGTGTCCCTTGGC	0.587													4	43	---	---	---	---	PASS
AGAP6	414189	broad.mit.edu	37	10	51754173	51754173	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51754173G>T	uc001jix.3	+	4	778	c.380G>T	c.(379-381)AGC>ATC	p.S127I		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	127					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						ATAAGAAGAAGCAACTGTACA	0.269													4	99	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70940278	70940278	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70940278C>T	uc001jpe.1	+	1	286	c.231C>T	c.(229-231)GAC>GAT	p.D77D	SUPV3L1_uc010qjd.1_Translation_Start_Site	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	77					DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						CCAGCGCCGACGGCGACGTCG	0.652													31	78	---	---	---	---	PASS
IFIT1	3434	broad.mit.edu	37	10	91162072	91162072	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91162072C>A	uc001kgi.2	+	2	188	c.40C>A	c.(40-42)CTG>ATG	p.L14M	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|IFIT1_uc009xtt.2_Missense_Mutation_p.L14M|IFIT1_uc001kgj.2_Translation_Start_Site	NM_001548	NP_001539	P09914	IFIT1_HUMAN	interferon-induced protein with	14					cellular response to exogenous dsRNA|intracellular transport of viral proteins in host cell|negative regulation of defense response to virus by host|negative regulation of helicase activity|negative regulation of protein binding|negative regulation of viral genome replication|positive regulation of viral genome replication|response to virus|type I interferon-mediated signaling pathway	cytoplasm	protein binding				0						CAAGGATAGTCTGGAGCAATT	0.353													17	144	---	---	---	---	PASS
C10orf76	79591	broad.mit.edu	37	10	103789494	103789494	+	Silent	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103789494G>A	uc009xwy.1	-	5	417	c.315C>T	c.(313-315)TGC>TGT	p.C105C	C10orf76_uc001kui.2_Silent_p.C105C	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591	105						integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GAATGAGTGCGCACAGGGTCT	0.483													4	141	---	---	---	---	PASS
ACADSB	36	broad.mit.edu	37	10	124813364	124813364	+	3'UTR	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124813364C>T	uc001lhb.2	+	11					ACADSB_uc010qub.1_3'UTR	NM_001609	NP_001600	P45954	ACDSB_HUMAN	acyl-Coenzyme A dehydrogenase, short/branched						branched chain family amino acid catabolic process|fatty acid metabolic process	mitochondrial matrix	flavin adenine dinucleotide binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)	AAGTGCCTTGCGTGGGAATAA	0.443													8	37	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135714	55135714	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135714A>T	uc010rif.1	+	1	355	c.355A>T	c.(355-357)ACC>TCC	p.T119S		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	119	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGAGAAAAAGACCATTTCCTT	0.388													11	364	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798451	55798451	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798451C>T	uc010riw.1	+	1	557	c.557C>T	c.(556-558)GCT>GTT	p.A186V		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					CCTCTTCTGGCTTTATCATGT	0.418													7	574	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108180931	108180931	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108180931T>C	uc001pkb.1	+	39	6192	c.5807T>C	c.(5806-5808)TTA>TCA	p.L1936S	ATM_uc009yxr.1_Missense_Mutation_p.L1936S|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.L588S|ATM_uc001pkg.1_Missense_Mutation_p.L293S|ATM_uc009yxt.1_Missense_Mutation_p.L50S	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1936					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TGGCTGGATTTAAATTATCTA	0.318			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			37	91	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113704218	113704218	+	Nonsense_Mutation	SNP	G	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113704218G>C	uc001poh.2	-	7	716	c.683C>G	c.(682-684)TCA>TGA	p.S228*	USP28_uc010rwy.1_Nonsense_Mutation_p.S103*|USP28_uc001poi.2_Translation_Start_Site|USP28_uc001poj.3_Nonsense_Mutation_p.S228*|USP28_uc010rwz.1_Nonsense_Mutation_p.S228*	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	228					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTTTCTATTTGATCCCATCAT	0.383													5	123	---	---	---	---	PASS
APOLD1	81575	broad.mit.edu	37	12	12938592	12938592	+	Intron	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12938592C>A	uc001rau.3	+						DDX47_uc001rav.2_Intron|APOLD1_uc001raw.3_5'UTR	NM_001130415	NP_001123887	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1 isoform 1						angiogenesis|cell differentiation|lipid transport|lipoprotein metabolic process	extracellular region|integral to membrane|plasma membrane	lipid binding			ovary(1)	1		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		GAAACAGCCTCAGATTTTACT	0.448													25	85	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78515855	78515855	+	Silent	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78515855G>T	uc001syp.2	+	16	4058	c.3885G>T	c.(3883-3885)ACG>ACT	p.T1295T	NAV3_uc001syo.2_Silent_p.T1295T|NAV3_uc010sub.1_Silent_p.T795T|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1295	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CGTCCGGTACGGGCAGCATGG	0.532										HNSCC(70;0.22)			3	69	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80750271	80750271	+	5'UTR	SNP	C	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80750271C>G	uc009zsg.1	+	1					uc001szd.2_5'UTR					RecName: Full=Uncharacterized protein C12orf64;																		GGCCACAGTCCTCTTTCTTGC	0.328													22	99	---	---	---	---	PASS
ISCU	23479	broad.mit.edu	37	12	108958127	108958127	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108958127C>A	uc010sxc.1	+	2	292	c.187C>A	c.(187-189)CTG>ATG	p.L63M	SART3_uc001tmz.1_5'Flank|SART3_uc009zux.1_5'Flank|SART3_uc010swx.1_5'Flank|SART3_uc010swz.1_5'Flank|SART3_uc001tna.1_5'Flank|SART3_uc001tnb.2_5'Flank|ISCU_uc010sxa.1_Missense_Mutation_p.L63M|ISCU_uc010sxb.1_Missense_Mutation_p.L63M|ISCU_uc001tnc.3_Missense_Mutation_p.L38M|ISCU_uc009zuy.2_Missense_Mutation_p.L38M|ISCU_uc010sxd.1_Missense_Mutation_p.L63M	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform	63					iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						TGGAACTGGACTGGTGGGGGC	0.343													22	78	---	---	---	---	PASS
FAM124A	220108	broad.mit.edu	37	13	51826251	51826251	+	Missense_Mutation	SNP	G	C	C	rs146463367		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51826251G>C	uc001vfg.1	+	3	879	c.748G>C	c.(748-750)GTG>CTG	p.V250L	FAM124A_uc001vfe.2_Missense_Mutation_p.V250L|FAM124A_uc001vff.1_Missense_Mutation_p.V286L	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	250										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		AGGCGAGCTCGTGCCTCTCCT	0.632													9	36	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23885344	23885344	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23885344G>A	uc001wjx.2	-	34	4928	c.4822C>T	c.(4822-4824)CGC>TGC	p.R1608C		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1608	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCCTCGTTGCGGCTGCGTGTC	0.622													58	118	---	---	---	---	PASS
NUMB	8650	broad.mit.edu	37	14	73743464	73743464	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73743464T>G	uc001xny.1	-	13	2098	c.1778A>C	c.(1777-1779)GAT>GCT	p.D593A	NUMB_uc010aro.1_Missense_Mutation_p.D398A|NUMB_uc010arp.1_Missense_Mutation_p.D387A|NUMB_uc010arq.1_Missense_Mutation_p.D447A|NUMB_uc010arr.1_Missense_Mutation_p.D436A|NUMB_uc001xoa.1_Missense_Mutation_p.D545A|NUMB_uc001xnz.1_Missense_Mutation_p.D582A|NUMB_uc001xob.1_Missense_Mutation_p.D534A|NUMB_uc001xod.1_Missense_Mutation_p.D545A|NUMB_uc001xoc.1_Missense_Mutation_p.D593A|NUMB_uc010ars.1_Missense_Mutation_p.D582A|NUMB_uc010ttz.1_Missense_Mutation_p.D291A	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1	593					axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		CCTGCCATCATCTACACCATT	0.527													17	36	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89168815	89168815	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89168815A>G	uc001xxg.2	-	15	2399	c.2213T>C	c.(2212-2214)TTG>TCG	p.L738S	EML5_uc001xxh.1_5'UTR	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	738	WD 11.					cytoplasm|microtubule				ovary(3)	3						GTAGTCTTTCAAAGGATGAAT	0.388													8	58	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51750826	51750826	+	Splice_Site	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51750826T>C	uc002abf.2	-	35	8236	c.8011_splice	c.e35-1	p.A2671_splice	DMXL2_uc002abd.2_Splice_Site_p.A763_splice|DMXL2_uc010ufy.1_Splice_Site_p.A2672_splice|DMXL2_uc010bfa.2_Splice_Site_p.A2035_splice	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ACAATTTGCCTATAAAGCAAA	0.348													32	79	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70960502	70960502	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70960502T>C	uc002asr.2	-	16	2625	c.2521A>G	c.(2521-2523)ATA>GTA	p.I841V	UACA_uc010uke.1_Missense_Mutation_p.I732V|UACA_uc002asq.2_Missense_Mutation_p.I828V|UACA_uc010bin.1_Missense_Mutation_p.I816V	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	841	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						AGAGCGTGTATTTTCTCCTGG	0.348													38	162	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71305231	71305231	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71305231T>C	uc002asw.2	+	14	1929	c.1682T>C	c.(1681-1683)ATT>ACT	p.I561T	LRRC49_uc002asu.2_Missense_Mutation_p.I551T|LRRC49_uc002asx.2_Missense_Mutation_p.I517T|LRRC49_uc010ukf.1_Missense_Mutation_p.I566T|LRRC49_uc002asy.2_Missense_Mutation_p.I267T|LRRC49_uc002asz.2_Missense_Mutation_p.I533T	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	561						cytoplasm|microtubule				ovary(1)	1						TATCGTCTGATTTCCATTCTG	0.373													44	146	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85467288	85467288	+	Missense_Mutation	SNP	G	A	A	rs141708518		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85467288G>A	uc002blg.2	+	12	1232	c.1030G>A	c.(1030-1032)GGA>AGA	p.G344R	SLC28A1_uc010upd.1_Missense_Mutation_p.G266R|SLC28A1_uc010bnb.2_Missense_Mutation_p.G344R|SLC28A1_uc010upe.1_Missense_Mutation_p.G344R|SLC28A1_uc010upf.1_Missense_Mutation_p.G344R|SLC28A1_uc010upg.1_Missense_Mutation_p.G344R	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	344					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGTCATGACCGGAGGTTACGC	0.552													3	103	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20548412	20548412	+	3'UTR	SNP	A	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20548412A>C	uc002dhj.3	-	15					ACSM2B_uc002dhk.3_3'UTR	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						tccctttcTTATTTCAATATC	0.144													13	20	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	23999908	23999908	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23999908C>T	uc002dmd.2	+	3	482	c.285C>T	c.(283-285)TCC>TCT	p.S95S	PRKCB_uc002dme.2_Silent_p.S95S	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	95					apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	GTCCAGCCTCCGATGTAAGTA	0.468													4	89	---	---	---	---	PASS
ZNF629	23361	broad.mit.edu	37	16	30794780	30794780	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30794780T>C	uc002dzs.1	-	3	1077	c.869A>G	c.(868-870)TAC>TGC	p.Y290C		NM_001080417	NP_001073886	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	290	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)			GGGGCACTTGTAGGGTTTCTC	0.647													3	70	---	---	---	---	PASS
GPR114	221188	broad.mit.edu	37	16	57595999	57595999	+	5'UTR	SNP	A	G	G	rs1004363	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57595999A>G	uc002elx.3	+	2					GPR114_uc010vhr.1_5'UTR|GPR114_uc002ely.2_5'UTR	NM_153837	NP_722579	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						GAGACTCTGCACAGGGCATGG	0.453													3	53	---	---	---	---	PASS
CDH13	1012	broad.mit.edu	37	16	83065742	83065742	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83065742C>T	uc002fgx.2	+	3	405	c.285C>T	c.(283-285)TTC>TTT	p.F95F	CDH13_uc010chh.2_Silent_p.F95F|CDH13_uc010vns.1_Silent_p.F142F|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Silent_p.F95F	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	95					adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AAACTCTGTTCGTCCATGCAC	0.522													7	33	---	---	---	---	PASS
TMEM220	388335	broad.mit.edu	37	17	10628403	10628403	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10628403G>A	uc002gmx.2	-	4	690	c.212C>T	c.(211-213)ACG>ATG	p.T71M	TMEM220_uc002gmy.2_Missense_Mutation_p.T61M	NM_001004313	NP_001004313	Q6QAJ8	TM220_HUMAN	transmembrane protein 220	71	Helical; (Potential).					integral to membrane					0						AGCCCACACCGTACAAAAGAG	0.448													4	137	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15995320	15995320	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15995320G>A	uc002gpo.2	-	22	3113	c.2873C>T	c.(2872-2874)GCT>GTT	p.A958V	NCOR1_uc002gpn.2_Missense_Mutation_p.A974V|NCOR1_uc002gpp.1_Missense_Mutation_p.A865V|NCOR1_uc002gpq.1_5'UTR|NCOR1_uc002gpr.2_Missense_Mutation_p.A865V	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	958					cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGGTAGAGAGCATAGCCGCT	0.428													4	166	---	---	---	---	PASS
UBB	7314	broad.mit.edu	37	17	16285790	16285790	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285790C>A	uc002gpx.2	+	2	707	c.569C>A	c.(568-570)CCC>CAC	p.P190H	UBB_uc010vwe.1_Missense_Mutation_p.P114H	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	190	Ubiquitin-like 3.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		GGCATCCCCCCCGACCAGCAG	0.552													3	80	---	---	---	---	PASS
CCDC144NL	339184	broad.mit.edu	37	17	20768623	20768623	+	3'UTR	SNP	A	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768623A>G	uc002gyf.2	-	4						NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						CAGTTTAATAAAAGAGTTCAT	0.308													3	18	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587708	43587708	+	Intron	SNP	A	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587708A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						AACAACCACCATCTCCAAATC	0.348													5	61	---	---	---	---	PASS
HOXB13	10481	broad.mit.edu	37	17	46804355	46804355	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46804355T>C	uc002ioa.2	-	2	808	c.652A>G	c.(652-654)AAG>GAG	p.K218E	hsa-mir-3185|MI0014227_5'Flank	NM_006361	NP_006352	Q92826	HXB13_HUMAN	homeobox B13	218	Homeobox.				angiogenesis|epidermis development|response to wounding		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ATGCGTTTCTTGCGGCCGCGA	0.622													20	67	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75205504	75205504	+	Silent	SNP	C	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75205504C>G	uc002jto.2	+	14	1824	c.1557C>G	c.(1555-1557)CTC>CTG	p.L519L	SEC14L1_uc010dhc.2_Silent_p.L519L|SEC14L1_uc010wth.1_Silent_p.L519L|SEC14L1_uc002jtm.2_Silent_p.L519L|SEC14L1_uc010wti.1_Silent_p.L485L|SEC14L1_uc010wtj.1_Silent_p.L79L|SEC14L1_uc002jtr.2_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	519					transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						ACCTGAAGCTCTGGACTGAGA	0.587													9	30	---	---	---	---	PASS
TNRC6C	57690	broad.mit.edu	37	17	76045907	76045907	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76045907A>C	uc002jud.2	+	4	1364	c.764A>C	c.(763-765)AAC>ACC	p.N255T	TNRC6C_uc002juf.2_Missense_Mutation_p.N255T|TNRC6C_uc002jue.2_Missense_Mutation_p.N255T	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2	255	Sufficient for interaction with argonaute family proteins.|Gly-rich.				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCCCCAGGTAACCCTGCCACA	0.498													5	44	---	---	---	---	PASS
ANKRD24	170961	broad.mit.edu	37	19	4207577	4207577	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4207577C>T	uc010dtt.1	+	9	893	c.617C>T	c.(616-618)GCC>GTC	p.A206V	ANKRD24_uc002lzs.2_Missense_Mutation_p.A177V|ANKRD24_uc002lzt.2_Missense_Mutation_p.A178V	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	206	ANK 4.										0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CAAGGGGCTGCCGCGAACGAT	0.443											OREG0025162	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	81	---	---	---	---	PASS
OR7A5	26659	broad.mit.edu	37	19	14938449	14938449	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938449G>T	uc002mzw.2	-	1	828	c.605C>A	c.(604-606)ACA>AAA	p.T202K	OR7A5_uc010xoa.1_Missense_Mutation_p.T202K	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2						CAGCGCAACTGTAAAATATAT	0.428													5	95	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22836775	22836775	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22836775C>T	uc002nqw.3	+	3	332	c.88C>T	c.(88-90)CCT>TCT	p.P30S		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	30	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AGGAAAAGAACCTTGGAATGT	0.423													42	102	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39088138	39088138	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39088138C>T	uc002oix.1	-	23	1874	c.1766G>A	c.(1765-1767)CGC>CAC	p.R589H	MAP4K1_uc002oiw.1_Missense_Mutation_p.R176H|MAP4K1_uc002oiy.1_Missense_Mutation_p.R589H|MAP4K1_uc010xug.1_Missense_Mutation_p.A231T	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	589	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGCCAGTAGGCGGTGGGGGCT	0.572													4	142	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40383986	40383986	+	Silent	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40383986G>A	uc002omp.3	-	21	9632	c.9624C>T	c.(9622-9624)TGC>TGT	p.C3208C		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3208	TIL 7.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCAGCAGCCGCAGCCGTTGT	0.667													7	30	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42260828	42260828	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42260828C>A	uc002orm.2	+	2	534	c.385C>A	c.(385-387)CTT>ATT	p.L129I		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	129	Ig-like V-type.				cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		AAAGTCAGATCTTGTGAATGA	0.473													6	480	---	---	---	---	PASS
TMEM143	55260	broad.mit.edu	37	19	48836733	48836733	+	Intron	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48836733G>A	uc002pix.1	-						TMEM143_uc002piw.1_RNA|TMEM143_uc002piy.1_Intron|TMEM143_uc010xzn.1_Intron|TMEM143_uc010elw.1_Intron|TMEM143_uc010xzo.1_Intron	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143							integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		CACTGAGATCGGGGAAGATTC	0.602											OREG0025605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	35	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11098863	11098863	+	5'UTR	SNP	A	G	G	rs75318310	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098863A>G	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccagcctccaactcccccttc	0.000													3	12	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47773103	47773103	+	Silent	SNP	C	A	A	rs2249057	byFrequency	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47773103C>A	uc002zji.3	+	10	1649	c.1542C>A	c.(1540-1542)TCC>TCA	p.S514S	PCNT_uc002zjj.2_Silent_p.S396S	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	514	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AGCATGAGTCCGAACTGGAGC	0.483													3	103	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25016442	25016442	+	Missense_Mutation	SNP	C	T	T	rs3895576	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016442C>T	uc003aan.1	+	8	1017	c.530C>T	c.(529-531)GCC>GTC	p.A177V	GGT1_uc003aas.1_Missense_Mutation_p.A177V|GGT1_uc003aat.1_Missense_Mutation_p.A177V|GGT1_uc003aau.1_Missense_Mutation_p.A177V|GGT1_uc003aav.1_Missense_Mutation_p.A177V|GGT1_uc003aaw.1_Missense_Mutation_p.A177V|GGT1_uc003aax.1_Missense_Mutation_p.A177V	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	177	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TTGGCGGCAGCCCTGGAAAAC	0.687													4	36	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31662009	31662009	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31662009G>T	uc003akh.2	+	8	1077	c.932G>T	c.(931-933)CGC>CTC	p.R311L	LIMK2_uc003akg.2_Missense_Mutation_p.R228L|LIMK2_uc003aki.2_Missense_Mutation_p.R65L|LIMK2_uc003akj.2_Missense_Mutation_p.R290L|LIMK2_uc003akk.2_Missense_Mutation_p.R290L|LIMK2_uc011aln.1_Missense_Mutation_p.R228L	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	311						mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						GACATCAGCCGCTCAGAATCC	0.582													3	98	---	---	---	---	PASS
ATXN3L	92552	broad.mit.edu	37	X	13337265	13337265	+	Silent	SNP	C	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13337265C>T	uc010ned.2	-	1	1254	c.789G>A	c.(787-789)TCG>TCA	p.S263S		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	263					protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						GAAGATCTTGCGATGTGTTTC	0.433													203	192	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99551705	99551705	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99551705T>C	uc010nmz.2	-	6	4693	c.3017A>G	c.(3016-3018)GAC>GGC	p.D1006G	PCDH19_uc004efw.3_Missense_Mutation_p.D958G|PCDH19_uc004efx.3_Missense_Mutation_p.D959G	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	1006	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GCCGCAGTCGTCATAAGCCTC	0.577													3	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3031	3031	+	5'Flank	SNP	G	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3031G>A	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		GCCGCTATTAAAGGTTCGTTT	0.448													4	0	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7854	7854	+	RNA	SNP	T	C	C			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7854T>C	uc004cou.3	+	1		c.269T>C			uc011mfi.1_5'Flank|uc004cov.3_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP42.																		AACAGACGAGGTCAACGATCC	0.498													4	2	---	---	---	---	PASS
MASP2	10747	broad.mit.edu	37	1	11094757	11094758	+	Intron	INS	-	A	A	rs113585596		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11094757_11094758insA	uc001aru.2	-							NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform						complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		ccctgtctcagaaaaaaaaaaa	0.173													4	3	---	---	---	---	
MKNK1	8569	broad.mit.edu	37	1	47059548	47059549	+	Intron	DEL	GT	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47059548_47059549delGT	uc001cqb.2	-						MKNK1_uc010omd.1_Intron|MKNK1_uc001cqc.2_Intron|MKNK1_uc009vyi.2_Intron|MKNK1_uc010ome.1_Intron|MKNK1_uc009vyj.2_Intron|MKNK1_uc001cqd.2_Intron|MKNK1_uc010omf.1_Intron	NM_003684	NP_003675	Q9BUB5	MKNK1_HUMAN	MAP kinase-interacting serine/threonine kinase 1						intracellular protein kinase cascade|peptidyl-serine phosphorylation|regulation of translation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2	Acute lymphoblastic leukemia(166;0.155)					aaaaaaaaaagtaaataaaTAT	0.183													4	2	---	---	---	---	
VTCN1	79679	broad.mit.edu	37	1	117715063	117715064	+	Intron	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117715063_117715064insA	uc001ehb.2	-						VTCN1_uc001ehc.2_Intron|VTCN1_uc009whf.1_Intron	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation							integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		ACTGGTCCAAGAGAGTGAGAAC	0.475													169	58	---	---	---	---	
GPATCH4	54865	broad.mit.edu	37	1	156565503	156565504	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156565503_156565504insT	uc001fpm.2	-	8	668_669	c.629_630insA	c.(628-630)AAGfs	p.K210fs	APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Frame_Shift_Ins_p.K205fs	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	205	Potential.					intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTTCTTTTTCTTTTTTTTGGG	0.535													313	7	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237806919	237806920	+	Intron	INS	-	T	T	rs113722212		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237806919_237806920insT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAAttttttccttttttttttt	0.119													6	4	---	---	---	---	
MAP4K3	8491	broad.mit.edu	37	2	39505528	39505529	+	Intron	INS	-	A	A	rs74990371		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39505528_39505529insA	uc002rro.2	-						MAP4K3_uc002rrp.2_Intron|MAP4K3_uc010yns.1_Intron	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase						JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				aaaaaaaaaagaatatacaaaa	0.277													43	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133034804	133034805	+	IGR	INS	-	GAA	GAA	rs36141853		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133034804_133034805insGAA								NCRNA00164 (19262 upstream) : GPR39 (139342 downstream)																							aaggaaggaaggaaggaaggaa	0.203													7	4	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	169994159	169994160	+	Intron	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169994159_169994160insA	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AGAGAACTTGCAAAAAAAAAAA	0.376													4	2	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216191333	216191333	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216191333delA	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	actttgtctcaaaaaaaaaaa	0.174			T	ALK	ALCL								4	2	---	---	---	---	
GLB1	2720	broad.mit.edu	37	3	33075271	33075271	+	Intron	DEL	A	-	-	rs71687294		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33075271delA	uc003cfi.1	-						GLB1_uc003cfh.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein						carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				agactgtctcaaaaaaaaaaa	0.224													5	3	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53139428	53139431	+	Intron	DEL	CCCG	-	-	rs60969367		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53139428_53139431delCCCG	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		agactctatcCCCGCCCCCCCCCC	0.270													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	84741480	84741480	+	Intron	DEL	A	-	-	rs140144338		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84741480delA	uc003dqi.2	-											Homo sapiens cDNA clone IMAGE:4824471.																		CCTGTCCCAGAAAAAAAAAAA	0.388													5	3	---	---	---	---	
GUCA1C	9626	broad.mit.edu	37	3	108627204	108627204	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108627204delA	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						TCATTTAAACAAAAAAAAAAA	0.318													4	2	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184571999	184571999	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184571999delA	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CAAAGGAAGGACCATGTCAGG	0.463													55	22	---	---	---	---	
POLR2B	5431	broad.mit.edu	37	4	57889309	57889309	+	Intron	DEL	T	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57889309delT	uc003hcl.1	+						POLR2B_uc011cae.1_Intron|POLR2B_uc011caf.1_Intron|POLR2B_uc003hcm.1_Intron	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					CTTCATAGACTTTTTTTTTTG	0.368													6	3	---	---	---	---	
SCAMP1	9522	broad.mit.edu	37	5	77755186	77755186	+	Splice_Site	DEL	G	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77755186delG	uc003kfl.2	+	10	1009	c.852_splice	c.e10+1	p.K284_splice	SCAMP1_uc010jaa.2_Splice_Site|SCAMP1_uc011ctc.1_Splice_Site|SCAMP1_uc011ctd.1_Splice_Site|SCAMP1_uc003kfm.2_Splice_Site|SCAMP1_uc003kfn.2_Splice_Site_p.K22_splice	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		GTTCAAAAAAGTAAGTGAAAT	0.323													18	8	---	---	---	---	
PRRC1	133619	broad.mit.edu	37	5	126883337	126883341	+	Intron	DEL	AGAGT	-	-	rs72094974		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126883337_126883341delAGAGT	uc003kuk.2	+						PRRC1_uc003kuj.3_Intron	NM_130809	NP_570721	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1							Golgi apparatus					0		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		GAATTAATACAGAGTAATTTTATCT	0.278													3	3	---	---	---	---	
SLC12A2	6558	broad.mit.edu	37	5	127487249	127487249	+	Intron	DEL	T	-	-	rs146057040		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127487249delT	uc003kus.2	+						SLC12A2_uc010jdf.2_Intron|SLC12A2_uc010jdg.2_Intron	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12						potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	ACTCCTAAAGTTTTTTTTTTT	0.229													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	132078667	132078670	+	IGR	DEL	CTTC	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132078667_132078670delCTTC								KIF3A (5402 upstream) : CCNI2 (4467 downstream)																							tccctcctttcttccttccttcct	0.000													4	2	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866030	162866031	+	Intron	INS	-	A	A	rs72299838		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866030_162866031insA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		gactccttctcaaaaaaaaaaa	0.168													5	5	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	178012595	178012596	+	Intron	INS	-	G	G			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178012595_178012596insG	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TGGATGGCGCTGGGGTAACACT	0.614													2	4	---	---	---	---	
CNOT6	57472	broad.mit.edu	37	5	179980216	179980217	+	Intron	INS	-	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179980216_179980217insT	uc003mlx.2	+						CNOT6_uc010jld.2_Intron|CNOT6_uc010jle.2_Intron	NM_015455	NP_056270	Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		ttctCTGGCAGTTTTTTTTTTT	0.158													3	3	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70609058	70609058	+	Intron	DEL	T	-	-	rs112888229		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70609058delT	uc003pfc.1	+							NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ttctttttaattttttttttt	0.124													9	5	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150094487	150094501	+	Intron	DEL	GTTTTGTTTTGTTTT	-	-	rs71672010		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150094487_150094501delGTTTTGTTTTGTTTT	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		TGTAGAAGGAgttttgttttgttttgttttgtttt	0.130													4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5985001	5985001	+	Intron	DEL	G	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5985001delG	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron|RSPH10B2_uc011jwk.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tgtaatcccagcactttggga	0.119													3	3	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121513382	121513383	+	5'UTR	INS	-	CA	CA	rs146505882	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121513382_121513383insCA	uc003vjy.2	+	1					PTPRZ1_uc003vjz.2_5'UTR	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						tctctctctctcacacacacac	0.243													3	3	---	---	---	---	
POT1	25913	broad.mit.edu	37	7	124465432	124465433	+	Intron	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124465432_124465433insA	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						TTTCATGAGAGAAAAAAAAAGG	0.287													73	10	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141374031	141374032	+	Intron	DEL	AC	-	-	rs35125206		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141374031_141374032delAC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					CTGCAGAAAAacacacacacac	0.490													4	2	---	---	---	---	
TUSC3	7991	broad.mit.edu	37	8	15531507	15531510	+	Intron	DEL	ACAC	-	-	rs113421840		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15531507_15531510delACAC	uc003wwt.2	+						TUSC3_uc003wwr.2_Intron|TUSC3_uc003wws.2_Intron|TUSC3_uc003wwu.2_Intron|TUSC3_uc003wwv.2_Intron|TUSC3_uc003www.2_Intron|TUSC3_uc003wwx.2_Intron|TUSC3_uc003wwy.2_Intron	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a						cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		ACATGTGCATACACACACACACAC	0.284													3	4	---	---	---	---	
DPY19L4	286148	broad.mit.edu	37	8	95768112	95768113	+	Intron	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95768112_95768113insA	uc003ygx.2	+							NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4							integral to membrane				ovary(2)	2	Breast(36;3.85e-06)					gactccatctcaaaaaaaaaaa	0.000													11	5	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													10	5	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				4	2	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17463094	17463096	+	Intron	DEL	TAA	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17463094_17463096delTAA	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		AAGAAACTGCTAATGTTTACGTT	0.340													30	7	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70706573	70706574	+	3'UTR	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70706573_70706574insA	uc001jou.2	+	15						NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						TACCTTTGAATAAAAAAACCTC	0.267													3	4	---	---	---	---	
TNKS2	80351	broad.mit.edu	37	10	93614656	93614656	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93614656delA	uc001khp.2	+							NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related						positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				actctgtctcaaaaaaaaaaa	0.095													3	3	---	---	---	---	
SF3B2	10992	broad.mit.edu	37	11	65825443	65825444	+	Intron	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825443_65825444insA	uc001ogy.1	+							NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						aactccgtctcaaaaaaaaaaa	0.183													5	3	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72296159	72296159	+	Intron	DEL	T	-	-	rs5792596		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72296159delT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AAGTGTTTTGTTTTTTTTTtt	0.284											OREG0021196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	6	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89925063	89925063	+	3'UTR	DEL	T	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89925063delT	uc001pdf.3	+	19					NAALAD2_uc009yvx.2_3'UTR|NAALAD2_uc009yvy.2_3'UTR	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTGCAAAGCCTTTTTTTTTTG	0.299													7	4	---	---	---	---	
C11orf63	79864	broad.mit.edu	37	11	122805949	122805949	+	Intron	DEL	T	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122805949delT	uc001pym.2	+							NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1											ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AAGAGTCCACttttttttttt	0.244													3	3	---	---	---	---	
CDKN1B	1027	broad.mit.edu	37	12	12870993	12870994	+	Frame_Shift_Ins	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12870993_12870994insA	uc001rat.2	+	1	692_693	c.220_221insA	c.(220-222)TACfs	p.Y74fs		NM_004064	NP_004055	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B	74				Y->F: No change in binding CDK4 and no inhibition of CDK4 activity. Translocates to nucleus. No effect on in vitro phosphorylation of CDK4 by CCNH-CDK7.	autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity			ovary(1)|lung(1)	2		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		AGAGGGCAAGTACGAGTGGCAA	0.589									Multiple_Endocrine_Neoplasia_type_1|Multiple_Endocrine_Neoplasia_type_4				50	49	---	---	---	---	
CCDC91	55297	broad.mit.edu	37	12	28412396	28412396	+	Intron	DEL	G	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28412396delG	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rip.1_Intron	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					CCAGGAATTAGGGTTTTTTTT	0.403													97	8	---	---	---	---	
PDZRN4	29951	broad.mit.edu	37	12	41961406	41961407	+	Intron	INS	-	TT	TT	rs34848026		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41961406_41961407insTT	uc010skn.1	+						PDZRN4_uc001rmq.3_Intron|PDZRN4_uc009zjz.2_Intron|PDZRN4_uc001rmr.2_Intron	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2								ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CATAAGAGTCCTTTTTTTTTTT	0.361													4	3	---	---	---	---	
YEATS4	8089	broad.mit.edu	37	12	69759837	69759837	+	Intron	DEL	T	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69759837delT	uc001sux.2	+							NM_006530	NP_006521	O95619	YETS4_HUMAN	glioma-amplified sequence-41						histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			TTCAAAATCCTTTTTTTTTTC	0.284													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101776631	101776631	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101776631delA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						ctctgtctttaaaaaaaaaaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124719601	124719603	+	IGR	DEL	CAT	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719601_124719603delCAT								ZNF664 (219634 upstream) : FAM101A (54107 downstream)																							ccatcatcaccatcaccatcacc	0.000													4	2	---	---	---	---	
KLF5	688	broad.mit.edu	37	13	73650108	73650109	+	3'UTR	INS	-	A	A	rs148760123	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73650108_73650109insA	uc001vje.2	+	4					KLF5_uc001vjd.2_3'UTR	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5						transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		ACAACAAAAACAAACAAAAGCA	0.396													7	11	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42277638	42277639	+	Intron	INS	-	GAGG	GAGG	rs142271830	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42277638_42277639insGAGG	uc001wvm.2	+						LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		aaggaagaatcgagggagggag	0.099										HNSCC(30;0.082)			4	2	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27633310	27633310	+	Intron	DEL	A	-	-	rs142153057		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633310delA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		ggaagaaaggaaggaaggaag	0.000													7	4	---	---	---	---	
C15orf29	79768	broad.mit.edu	37	15	34456098	34456098	+	Intron	DEL	T	-	-	rs5811822		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34456098delT	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989	Q9H079	CO029_HUMAN	hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)		GTCCTCAttcttttttttttt	0.169													4	2	---	---	---	---	
SPINT1	6692	broad.mit.edu	37	15	41145073	41145073	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41145073delA	uc001zna.2	+						SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Intron	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1							extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		catctctaataaaaaaaaaaa	0.139													6	3	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65844283	65844283	+	Intron	DEL	A	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65844283delA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						acagtgaaggaaaaaaaaaaa	0.124													5	3	---	---	---	---	
IDH3A	3419	broad.mit.edu	37	15	78454888	78454888	+	Intron	DEL	T	-	-	rs140707702		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78454888delT	uc002bdd.2	+						IDH3A_uc010umt.1_Intron|IDH3A_uc010umu.1_Intron|IDH3A_uc002bde.2_Intron|IDH3A_uc010umv.1_Intron|IDH3A_uc002bdf.2_Intron|IDH3A_uc002bdg.2_Intron	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha						carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	ttctcctctgttttttttttt	0.174													4	2	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1396789	1396806	+	Intron	DEL	GCAGGTGGGGCCAGCGGG	-	-	rs3215518		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396789_1396806delGCAGGTGGGGCCAGCGGG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGGCCATTCTGCAGGTGGGGCCAGCGGGGCAGGTGGGG	0.716													10	5	---	---	---	---	
LOC339047	339047	broad.mit.edu	37	16	16437571	16437572	+	Intron	DEL	TG	-	-			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16437571_16437572delTG	uc002dev.3	+						LOC339047_uc010vae.1_Intron|LOC339047_uc002dew.3_Intron	NM_178541	NP_848636			hypothetical protein LOC339047												0						TCTtgtgtgttgtgtgtgtgtg	0.035													4	2	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													5	3	---	---	---	---	
FMNL1	752	broad.mit.edu	37	17	43309962	43309963	+	Intron	DEL	GT	-	-	rs116695289	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43309962_43309963delGT	uc002iin.2	+						FMNL1_uc002iio.2_Intron|FMNL1_uc002iip.1_5'Flank	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						gcatgtatgagtgtgtgtgtgt	0.337													5	3	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50234898	50234899	+	Intron	DEL	CG	-	-	rs67822192		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50234898_50234899delCG	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			CACCCCCCCCCGCAAAACACAC	0.525													4	2	---	---	---	---	
EXOC7	23265	broad.mit.edu	37	17	74090830	74090830	+	Intron	DEL	T	-	-	rs35625794		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74090830delT	uc002jqs.2	-						EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron|EXOC7_uc002jqu.2_Intron	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			TTTCAAAGtcttttttttttt	0.234													7	4	---	---	---	---	
ZNF528	84436	broad.mit.edu	37	19	52908919	52908920	+	Intron	INS	-	T	T	rs148360120	by1000genomes	TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52908919_52908920insT	uc002pzh.2	+						ZNF528_uc002pzi.2_Intron	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CCCTGGATTAATTTTTTTTGTA	0.322													2	4	---	---	---	---	
MAVS	57506	broad.mit.edu	37	20	3835071	3835072	+	Intron	INS	-	AAAAAAAAAA	AAAAAAAAAA	rs143700590		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3835071_3835072insAAAAAAAAAA	uc002wjw.3	+						MAVS_uc002wjv.2_Intron|MAVS_uc010zqn.1_Intron|MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_5'Flank	NM_020746	NP_065797	Q7Z434	MAVS_HUMAN	virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0						gactcgctctcaaaaaaaaaaa	0.163													5	3	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32376884	32376885	+	Intron	INS	-	T	T			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32376884_32376885insT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron|ZNF341_uc002wzz.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CAGGCCTCTCCttttttttttt	0.327													8	4	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133212	34133213	+	Intron	DEL	GC	-	-	rs8133271		TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133212_34133213delGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						gtgcgtgcgtgcgtgtgtgtgt	0.277													7	8	---	---	---	---	
CYorf15B	84663	broad.mit.edu	37	Y	21758038	21758039	+	5'Flank	INS	-	A	A			TCGA-EJ-5518-01A-01D-1576-08	TCGA-EJ-5518-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21758038_21758039insA	uc011nay.1	+							NM_032576	NP_115965	Q9BZA4	CY15B_HUMAN	lipopolysaccaride-specific response 5-like												0						CTACTTCTTGGAAAAAAAAAAA	0.376													4	2	---	---	---	---	
