Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCC	9696	broad.mit.edu	37	1	17295800	17295800	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17295800C>G	uc001azt.2	+	32	5335	c.5266C>G	c.(5266-5268)CTG>GTG	p.L1756V	CROCC_uc001azu.2_Missense_Mutation_p.L1059V|CROCC_uc001azv.2_Missense_Mutation_p.L92V	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1756					cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCAGAAGGCTCTGACCGCCTG	0.652													7	12	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476353	33476353	+	3'UTR	SNP	C	T	T	rs66599471		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476353C>T	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCCTTCCCCTCTGCCCAGC	0.552													5	47	---	---	---	---	PASS
GJB3	2707	broad.mit.edu	37	1	35250643	35250643	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35250643C>A	uc001bxx.2	+	2	895	c.280C>A	c.(280-282)CAC>AAC	p.H94N	GJB3_uc001bxy.2_Missense_Mutation_p.H94N|GJB3_uc001bxz.3_Missense_Mutation_p.H94N|uc010ohs.1_RNA	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	94	Helical; (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GGTCATCCTGCACGTGGCCTA	0.632													12	114	---	---	---	---	PASS
C1orf163	65260	broad.mit.edu	37	1	53153432	53153432	+	Missense_Mutation	SNP	T	C	C	rs443751	byFrequency	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53153432T>C	uc001cui.1	-	3	696	c.656A>G	c.(655-657)AAA>AGA	p.K219R		NM_023077	NP_075565	Q96BR5	SELR1_HUMAN	hypothetical protein LOC65260	219	Sel1-like 5.						binding				0						CTGCTGTTCTTTGTGTAGCTG	0.532													3	105	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55521763	55521763	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55521763C>T	uc001cyf.1	+	6	1188	c.897C>T	c.(895-897)GCC>GCT	p.A299A	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	299	Peptidase S8.				cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						TCCTCAACGCCGCCTGCCAGC	0.692													3	11	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107867346	107867346	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107867346C>T	uc001dvh.3	+	3	1407	c.689C>T	c.(688-690)GCG>GTG	p.A230V	NTNG1_uc001dvf.3_Missense_Mutation_p.A230V|NTNG1_uc010out.1_Missense_Mutation_p.A230V|NTNG1_uc001dvc.3_Missense_Mutation_p.A230V|NTNG1_uc001dvd.1_Missense_Mutation_p.A230V	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	230	Laminin N-terminal.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GACAGGTTCGCGTTTTTTGCT	0.428													12	89	---	---	---	---	PASS
TRIM45	80263	broad.mit.edu	37	1	117661174	117661174	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117661174C>A	uc001egz.2	-	2	1292	c.704G>T	c.(703-705)GGG>GTG	p.G235V	TRIM45_uc009whe.2_Missense_Mutation_p.G235V|TRIM45_uc001eha.2_Missense_Mutation_p.G131V	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1	235						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CACAGAGTCCCCATGCTTGTG	0.577													4	148	---	---	---	---	PASS
FCGR1B	2210	broad.mit.edu	37	1	120928466	120928466	+	Intron	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120928466G>A	uc001eip.2	-						FCGR1B_uc001eiq.2_Intron|FCGR1B_uc010oxl.1_RNA|FCGR1B_uc009whr.2_3'UTR	NM_001017986	NP_001017986	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor						interferon-gamma-mediated signaling pathway	integral to membrane|plasma membrane	IgG binding|immunoglobulin receptor activity				0	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		TTCCTGCCTCGCAGGGTCTTG	0.502													7	42	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148251952	148251952	+	Intron	SNP	C	A	A	rs113737426		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148251952C>A	uc001eqe.2	-						LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|uc010pah.1_Missense_Mutation_p.V245L|uc010pai.1_Missense_Mutation_p.V245L|uc001eqz.2_Missense_Mutation_p.V733L|uc001erb.2_Missense_Mutation_p.V457L|uc001erd.3_Missense_Mutation_p.V843L|uc001erc.3_RNA|uc010paj.1_Missense_Mutation_p.V342L			Q86T75	NBPFB_HUMAN	SubName: Full=cDNA FLJ78770;							cytoplasm					0						CTATTGTCCACGTAAAGGGCG	0.443													6	353	---	---	---	---	PASS
RGS5	8490	broad.mit.edu	37	1	163122355	163122355	+	Silent	SNP	C	T	T	rs150796534		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163122355C>T	uc001gcn.2	-	4	616	c.369G>A	c.(367-369)ACG>ACA	p.T123T	RGS5_uc009wvb.2_RNA	NM_003617	NP_003608	O15539	RGS5_HUMAN	regulator of G-protein signalling 5	123	RGS.				negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity				0			LUSC - Lung squamous cell carcinoma(543;0.187)			TAGGAGCCTCCGTTTGAATGA	0.473													126	555	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276100	186276100	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276100A>C	uc001gru.3	+	7	1300	c.1249A>C	c.(1249-1251)ACC>CCC	p.T417P	PRG4_uc001grt.3_Missense_Mutation_p.T376P|PRG4_uc009wyl.2_Missense_Mutation_p.T324P|PRG4_uc009wym.2_Missense_Mutation_p.T283P|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	417	9.|59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACCCACCACCACCAAGGAGCC	0.652													7	59	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230838910	230838910	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230838910C>A	uc001hty.3	-	5	1943	c.1435G>T	c.(1435-1437)GCC>TCC	p.A479S	AGT_uc009xfe.2_3'UTR|AGT_uc009xff.2_Missense_Mutation_p.A451S	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	479					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	AGCGGGTTGGCCACGCGGCCC	0.607													8	120	---	---	---	---	PASS
OR2M3	127062	broad.mit.edu	37	1	248367247	248367247	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248367247G>A	uc010pzg.1	+	1	878	c.878G>A	c.(877-879)CGC>CAC	p.R293H		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TACAGCCTCCGCAACAAGGAG	0.473													19	156	---	---	---	---	PASS
KYNU	8942	broad.mit.edu	37	2	143712411	143712411	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143712411G>T	uc002tvl.2	+	5	536	c.406G>T	c.(406-408)GCT>TCT	p.A136S	KYNU_uc002tvk.2_Missense_Mutation_p.A136S|KYNU_uc010fnm.2_Missense_Mutation_p.A136S	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a	136					anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	CCTAATGAATGCTTTGACTGT	0.284													4	144	---	---	---	---	PASS
COBLL1	22837	broad.mit.edu	37	2	165600183	165600183	+	Intron	SNP	T	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165600183T>G	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron|COBLL1_uc002uct.2_Missense_Mutation_p.N82H	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1											ovary(2)|pancreas(1)	3						GATATTTCATTTACTCCAGCG	0.383													16	79	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175618298	175618298	+	Silent	SNP	G	A	A	rs137852798		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175618298G>A	uc002ujd.2	-	7	864	c.786C>T	c.(784-786)AAC>AAT	p.N262N	uc002uiw.2_Intron|CHRNA1_uc002uje.2_Silent_p.N237N|CHRNA1_uc002ujf.3_Silent_p.N237N	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a	262	Helical.		N -> K (in SCCMS).		muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GGATGATGACGTTGACGATGA	0.577													7	203	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219353102	219353102	+	Silent	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219353102G>T	uc002vie.2	-	15	1968	c.1515C>A	c.(1513-1515)CTC>CTA	p.L505L	USP37_uc010fvs.1_Silent_p.L505L|USP37_uc010zkf.1_Silent_p.L505L|USP37_uc002vif.2_Silent_p.L505L|USP37_uc002vig.2_Silent_p.L433L	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	505					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GGTCAATAGAGAGGTCATTAA	0.338													22	151	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38833623	38833623	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38833623G>A	uc003ciq.2	-	2	307	c.307C>T	c.(307-309)CGG>TGG	p.R103W		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	103					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GCACTAAACCGGGAAATGGTC	0.448													5	291	---	---	---	---	PASS
CXCR6	10663	broad.mit.edu	37	3	45988802	45988802	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45988802G>A	uc003cpc.1	+	2	910	c.829G>A	c.(829-831)GCA>ACA	p.A277T	FYCO1_uc003cpb.3_Intron|FYCO1_uc011bal.1_Intron|CXCR6_uc010hix.1_Missense_Mutation_p.A277T	NM_006564	NP_006555	O00574	CXCR6_HUMAN	G protein-coupled receptor TYMSTR	277	Helical; Name=7; (Potential).				viral genome replication	integral to plasma membrane	coreceptor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		AGAGGCCATCGCATACCTGAG	0.507													15	122	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108347996	108347996	+	Silent	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108347996A>G	uc003dxd.2	+	8	1091	c.669A>G	c.(667-669)GAA>GAG	p.E223E	DZIP3_uc003dxf.1_Silent_p.E223E|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Silent_p.E223E	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	223					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						ATCCTACAGAAGATGAAGATT	0.289													15	168	---	---	---	---	PASS
LRRC15	131578	broad.mit.edu	37	3	194081448	194081448	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194081448C>T	uc003ftu.2	-	2	411	c.325G>A	c.(325-327)GCC>ACC	p.A109T	LRRC15_uc003ftt.2_Missense_Mutation_p.A115T	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	109	LRR 3.|Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TTGTTGTTGGCGAGGCTGAGA	0.597													30	105	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1980396	1980396	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1980396C>T	uc003gdz.3	+	22	4034	c.3858C>T	c.(3856-3858)GAC>GAT	p.D1286D	WHSC1_uc003geb.3_Silent_p.D1286D|WHSC1_uc003gec.3_Silent_p.D1286D|WHSC1_uc003ged.3_Silent_p.D1286D|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Silent_p.D505D|WHSC1_uc011bvh.1_Silent_p.D347D|WHSC1_uc010icf.2_Silent_p.D634D	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	1286	PHD-type 4; atypical.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ATCATTGTGACGTGTGTGGCA	0.522			T	IGH@	MM								25	100	---	---	---	---	PASS
PACRGL	133015	broad.mit.edu	37	4	20714532	20714532	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20714532T>A	uc010iek.2	+	6	879	c.488T>A	c.(487-489)CTA>CAA	p.L163Q	PACRGL_uc003gpu.2_RNA|PACRGL_uc010iei.1_Missense_Mutation_p.L211Q|PACRGL_uc003gpz.2_Missense_Mutation_p.L163Q|PACRGL_uc011bxm.1_Missense_Mutation_p.L110Q|PACRGL_uc003gqa.2_Intron|PACRGL_uc003gpx.3_RNA|PACRGL_uc003gpv.2_Missense_Mutation_p.L163Q|PACRGL_uc003gpw.2_RNA|PACRGL_uc010iej.1_RNA|PACRGL_uc011bxn.1_Intron|PACRGL_uc003gpy.2_Missense_Mutation_p.L110Q	NM_145048	NP_659485	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like isoform 1	163							binding				0						ATTCCTGTGCTAAAGGCAGCT	0.333													57	362	---	---	---	---	PASS
LIMCH1	22998	broad.mit.edu	37	4	41621474	41621474	+	Intron	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41621474G>A	uc003gvu.3	+						LIMCH1_uc003gvt.1_3'UTR|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Intron|LIMCH1_uc003gvz.3_Intron|LIMCH1_uc011byu.1_Intron|LIMCH1_uc003gwc.3_Intron|LIMCH1_uc003gwd.3_Intron|LIMCH1_uc011byv.1_Intron|LIMCH1_uc003gwb.1_3'UTR	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CCTGAGCACCGCTGCCCTCTT	0.547													11	60	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121719544	121719544	+	Missense_Mutation	SNP	A	G	G	rs140634372	byFrequency	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121719544A>G	uc003idn.2	-	10	1316	c.1066T>C	c.(1066-1068)TCT>CCT	p.S356P	PRDM5_uc003ido.2_Missense_Mutation_p.S325P|PRDM5_uc010ine.2_Missense_Mutation_p.S325P	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	356	C2H2-type 7.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						CTCTTGAAAGACTTATTACAA	0.348													13	100	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151738393	151738393	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151738393C>T	uc010ipj.2	-	31	5662	c.5188G>A	c.(5188-5190)GCA>ACA	p.A1730T	LRBA_uc003ilt.3_Missense_Mutation_p.A389T|LRBA_uc003ilu.3_Missense_Mutation_p.A1730T	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1730						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GACTTTTTTGCTGCAACAATG	0.363													16	108	---	---	---	---	PASS
PRSS48	345062	broad.mit.edu	37	4	152212529	152212529	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152212529G>A	uc011cif.1	+	5	911	c.911G>A	c.(910-912)GGC>GAC	p.G304D	PRSS48_uc011cig.1_Missense_Mutation_p.G161D	NM_183375	NP_899231	Q7RTY5	PRS48_HUMAN	epidermis-specific serine protease-like protein	304					proteolysis	extracellular region	serine-type endopeptidase activity			large_intestine(1)	1						CACAGAGTAGGCACTGTAGCT	0.502													5	141	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	173068	173068	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173068C>T	uc003jak.2	+	15	3089	c.3039C>T	c.(3037-3039)TGC>TGT	p.C1013C		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	1013	PH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCGTTTGCTGCGGGAGGAAGA	0.512													24	148	---	---	---	---	PASS
MCC	4163	broad.mit.edu	37	5	112418689	112418689	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112418689G>C	uc003kqj.3	-	9	1612	c.1082C>G	c.(1081-1083)GCT>GGT	p.A361G	MCC_uc003kqk.3_RNA|MCC_uc003kql.3_Missense_Mutation_p.A551G|MCC_uc011cwb.1_Missense_Mutation_p.A361G|MCC_uc010jcd.1_Missense_Mutation_p.A323G	NM_002387	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 2	361					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CAGGTGTTCAGCCACACTGCT	0.418													26	102	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140262046	140262046	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140262046C>T	uc003lif.2	+	1	193	c.193C>T	c.(193-195)CGG>TGG	p.R65W	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.R65W|PCDHA13_uc003lid.2_Missense_Mutation_p.R65W	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	65	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCCTGTTCCGGGTGGCGTC	0.617													9	265	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294582	28294582	+	Silent	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294582G>T	uc003nla.2	-	4	982	c.582C>A	c.(580-582)ATC>ATA	p.I194I	ZNF323_uc003nld.2_Silent_p.I194I|ZNF323_uc010jra.2_Silent_p.I194I|ZNF323_uc003nlb.2_Silent_p.I35I|ZNF323_uc010jrb.2_Silent_p.I35I|ZNF323_uc003nlc.2_Silent_p.I194I	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	194					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TTTCTTTTAAGATTTCTTGCT	0.363													16	173	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294583	28294583	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294583A>T	uc003nla.2	-	4	981	c.581T>A	c.(580-582)ATC>AAC	p.I194N	ZNF323_uc003nld.2_Missense_Mutation_p.I194N|ZNF323_uc010jra.2_Missense_Mutation_p.I194N|ZNF323_uc003nlb.2_Missense_Mutation_p.I35N|ZNF323_uc010jrb.2_Missense_Mutation_p.I35N|ZNF323_uc003nlc.2_Missense_Mutation_p.I194N	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	194					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TTCTTTTAAGATTTCTTGCTT	0.363													16	172	---	---	---	---	PASS
PRPH2	5961	broad.mit.edu	37	6	42689807	42689807	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42689807G>T	uc003osk.2	-	1	552	c.266C>A	c.(265-267)GCC>GAC	p.A89D		NM_000322	NP_000313	P23942	PRPH2_HUMAN	peripherin 2	89	Cytoplasmic (Potential).				cell adhesion|visual perception	integral to membrane				ovary(4)|central_nervous_system(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			GGCATACTTGGCTGGGTCCAG	0.537													17	106	---	---	---	---	PASS
ICK	22858	broad.mit.edu	37	6	52897365	52897365	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52897365T>G	uc003pbh.2	-	5	734	c.244A>C	c.(244-246)ATG>CTG	p.M82L	ICK_uc003pbi.2_Missense_Mutation_p.M82L|ICK_uc003pbj.2_Missense_Mutation_p.M82L	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase	82	Protein kinase.				intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					TTTTCCTTCATGTACTCGAAG	0.308													16	68	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76024107	76024107	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76024107C>G	uc003pia.2	-	5	1814	c.1441G>C	c.(1441-1443)GAA>CAA	p.E481Q	FILIP1_uc003phy.1_Missense_Mutation_p.E481Q|FILIP1_uc003phz.2_Missense_Mutation_p.E382Q|FILIP1_uc010kbe.2_Missense_Mutation_p.E484Q|FILIP1_uc003pib.1_Missense_Mutation_p.E233Q	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	481	Potential.									skin(3)|ovary(1)	4						TCAGAACATTCCAATTCTTTA	0.373													4	262	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132203595	132203595	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132203595C>T	uc011ecf.1	+	21	2231	c.2211C>T	c.(2209-2211)TAC>TAT	p.Y737Y		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	737	Nuclease.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	AAGTGAGTTACGGGTTCCTCT	0.383													32	179	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137322646	137322646	+	3'UTR	SNP	T	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137322646T>G	uc003qhj.2	-	7					IL20RA_uc011edl.1_3'UTR|IL20RA_uc003qhk.2_3'UTR|IL20RA_uc003qhi.2_3'UTR	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor							integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		ATCAAAGGGGTGACTCACTTG	0.403													14	92	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48318519	48318519	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48318519A>T	uc003toq.2	+	18	7753	c.7728A>T	c.(7726-7728)TTA>TTT	p.L2576F	ABCA13_uc010kys.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2576					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TAGCTACTTTAAAAAAAATAG	0.313													7	200	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89906575	89906575	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89906575A>G	uc010lep.2	+	11	1333	c.1082A>G	c.(1081-1083)TAT>TGT	p.Y361C	C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.Y36C|C7orf63_uc011khj.1_Missense_Mutation_p.Y343C|C7orf63_uc011khk.1_5'Flank	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	361							binding			ovary(1)	1						TCTAATTCCTATGAAGATTTT	0.299													5	90	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100681694	100681694	+	Missense_Mutation	SNP	T	C	C	rs145648330		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100681694T>C	uc003uxp.1	+	3	7050	c.6997T>C	c.(6997-6999)TCT>CCT	p.S2333P	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2333	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|37.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACCTCAACTTCTAGTGAAGG	0.478													5	445	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121652283	121652283	+	Silent	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121652283G>A	uc003vjy.2	+	12	3578	c.3183G>A	c.(3181-3183)GAG>GAA	p.E1061E	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1061	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						CTTTCAATGAGATGGTTTACC	0.348													32	195	---	---	---	---	PASS
SLC39A14	23516	broad.mit.edu	37	8	22265850	22265850	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22265850G>A	uc003xbq.3	+	3	473	c.298G>A	c.(298-300)GCC>ACC	p.A100T	SLC39A14_uc011kzg.1_Missense_Mutation_p.A100T|SLC39A14_uc003xbp.3_Missense_Mutation_p.A100T|SLC39A14_uc011kzh.1_Missense_Mutation_p.A100T	NM_001128431	NP_001121903	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter),	100	Extracellular (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lamellipodium|plasma membrane	zinc ion transmembrane transporter activity				0				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		CCTCTTCACTGCCCACAATTT	0.587													5	146	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41800403	41800403	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41800403A>C	uc010lxb.2	-	15	2888	c.2344T>G	c.(2344-2346)TCC>GCC	p.S782A	MYST3_uc010lxc.2_Missense_Mutation_p.S782A|MYST3_uc003xon.3_Missense_Mutation_p.S782A|MYST3_uc010lxd.2_Missense_Mutation_p.S782A	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	782	Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			ACAGAGTTGGACACTATGACT	0.488													14	213	---	---	---	---	PASS
CA8	767	broad.mit.edu	37	8	61144866	61144866	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61144866C>T	uc003xtz.1	-	4	738	c.490G>A	c.(490-492)GCC>ACC	p.A164T	CA8_uc003xua.1_Missense_Mutation_p.A164T	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII	164					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)				GCAATGATGGCGATTCCGTGC	0.433													6	146	---	---	---	---	PASS
COPS5	10987	broad.mit.edu	37	8	67973868	67973868	+	Intron	SNP	T	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67973868T>C	uc003xxe.2	-						CSPP1_uc003xxg.1_5'Flank|CSPP1_uc003xxh.1_5'Flank|CSPP1_uc003xxi.2_5'Flank|CSPP1_uc003xxj.2_5'Flank|COPS5_uc003xxd.2_5'UTR|COPS5_uc003xxf.2_Intron|COPS5_uc010lyv.1_Intron	NM_006837	NP_006828	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5						cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CCGCTTGTTGTTCTCCCCTTA	0.512													2	11	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100866139	100866139	+	Missense_Mutation	SNP	G	A	A	rs142957181		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100866139G>A	uc003yiv.2	+	56	10708	c.10597G>A	c.(10597-10599)GTG>ATG	p.V3533M	VPS13B_uc003yiw.2_Missense_Mutation_p.V3508M	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3533					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCGGTTATACGTGGAAGACAC	0.408													6	319	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110457746	110457746	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110457746G>A	uc003yne.2	+	38	5752	c.5648G>A	c.(5647-5649)CGC>CAC	p.R1883H		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1883	Extracellular (Potential).|IPT/TIG 11.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTCTACTGCCGCACTCCCGCT	0.438										HNSCC(38;0.096)			11	45	---	---	---	---	PASS
CA9	768	broad.mit.edu	37	9	35674081	35674081	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35674081G>A	uc003zxo.3	+	1	167	c.125G>A	c.(124-126)CGG>CAG	p.R42Q	C9orf100_uc003zxl.2_RNA|CA9_uc003zxn.1_RNA|CA9_uc003zxp.3_Missense_Mutation_p.R42Q	NM_001216	NP_001207	Q16790	CAH9_HUMAN	carbonic anhydrase IX precursor	42	Extracellular.|Proteoglycan-like (PG).				one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding			ovary(4)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGGTTGCCCCGGATGCAGGAG	0.622													15	81	---	---	---	---	PASS
TJP2	9414	broad.mit.edu	37	9	71841089	71841089	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71841089A>G	uc004ahe.2	+	7	1408	c.1208A>G	c.(1207-1209)GAA>GGA	p.E403G	TJP2_uc011lrs.1_Missense_Mutation_p.E380G|TJP2_uc011lrt.1_Missense_Mutation_p.E380G|TJP2_uc004ahd.2_Missense_Mutation_p.E403G|TJP2_uc004ahf.2_Missense_Mutation_p.E403G|TJP2_uc011lru.1_Missense_Mutation_p.E407G|TJP2_uc011lrv.1_Missense_Mutation_p.E425G	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	403					cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						TCAGAAATAGAAGGTAAAGGA	0.433													11	53	---	---	---	---	PASS
ZBTB34	403341	broad.mit.edu	37	9	129642273	129642273	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129642273C>T	uc004bqm.3	+	2	680	c.583C>T	c.(583-585)CAG>TAG	p.Q195*		NM_001099270	NP_001092740	Q8NCN2	ZBT34_HUMAN	zinc finger and BTB domain containing 34	195					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CAGCCGCTTACAGGAGGAGGG	0.582													16	83	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070111	141070111	+	Silent	SNP	T	C	C	rs139643347	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070111T>C	uc004com.2	+	3	270	c.9T>C	c.(7-9)TCT>TCC	p.S3S	TUBBP5_uc010ncq.2_Silent_p.S117S					RecName: Full=Putative tubulin beta-4q chain;												0						CCATGGACTCTGTGCGCTCGG	0.697													5	91	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070139	141070139	+	Missense_Mutation	SNP	C	T	T	rs143443709	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070139C>T	uc004com.2	+	3	298	c.37C>T	c.(37-39)CTC>TTC	p.L13F	TUBBP5_uc010ncq.2_Missense_Mutation_p.L127F					RecName: Full=Putative tubulin beta-4q chain;												0						CGGGCAGGTCCTCAGGCCAGA	0.667													5	92	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64159482	64159482	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64159482C>T	uc001jly.3	+	5	1265	c.1203C>T	c.(1201-1203)GGC>GGT	p.G401G	ZNF365_uc001jmb.3_Intron|ZNF365_uc001jmc.2_Intron|ZNF365_uc001jlz.3_Silent_p.G386G|ZNF365_uc001jma.3_RNA	NM_014951	NP_055766	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform A	Error:Variant_position_missing_in_Q70YC4_after_alignment										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGGGGTTTGGCCGCAAAGGCA	0.537													4	121	---	---	---	---	PASS
DHX32	55760	broad.mit.edu	37	10	127525312	127525312	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127525312C>A	uc001ljf.1	-	11	2667	c.2176G>T	c.(2176-2178)GAA>TAA	p.E726*	BCCIP_uc001ljd.3_Intron|DHX32_uc001lje.1_Nonsense_Mutation_p.E350*|DHX32_uc001ljg.1_Nonsense_Mutation_p.E726*|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	726						mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATTTGCTGTTCCTTATTCATT	0.473													11	90	---	---	---	---	PASS
LOC653544	653544	broad.mit.edu	37	10	135491019	135491019	+	Silent	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135491019C>T	uc010qvi.1	+	1	741	c.630C>T	c.(628-630)CAC>CAT	p.H210H		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	210						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGGCCAGGCACCCGGGACAGG	0.711													4	33	---	---	---	---	PASS
KRTAP5-4	387267	broad.mit.edu	37	11	1643252	1643252	+	Silent	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1643252A>G	uc009ycy.1	-	1	117	c.30T>C	c.(28-30)TGT>TGC	p.C10C		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	24						keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		agccagagccacagcccccac	0.254													9	49	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401517	46401517	+	3'UTR	SNP	A	G	G	rs61882687	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401517A>G	uc001ncn.1	+	32					DGKZ_uc001nch.1_3'UTR|DGKZ_uc001ncj.1_3'UTR|DGKZ_uc010rgr.1_3'UTR|DGKZ_uc001nck.1_3'UTR|DGKZ_uc001ncl.2_3'UTR|DGKZ_uc001ncm.2_3'UTR|DGKZ_uc009yky.1_3'UTR|DGKZ_uc010rgs.1_3'UTR|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CACGGGCAGCAGGAGGGACAA	0.682													3	10	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56185673	56185673	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185673G>T	uc010rji.1	-	1	36	c.36C>A	c.(34-36)TTC>TTA	p.F12L		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	12	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CTTTCAGAATGAATACAGTGA	0.398													6	235	---	---	---	---	PASS
HRASLS5	117245	broad.mit.edu	37	11	63235886	63235886	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63235886A>T	uc001nwy.2	-	4	601	c.427T>A	c.(427-429)TAT>AAT	p.Y143N	HRASLS5_uc001nwz.2_Missense_Mutation_p.Y133N|HRASLS5_uc010rmq.1_Missense_Mutation_p.Y143N|HRASLS5_uc009yos.2_Intron	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5 isoform 1	143										ovary(1)	1						CAGTGCTCATAGCCAATTCGA	0.418													7	180	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74883495	74883495	+	Missense_Mutation	SNP	G	A	A	rs150167315		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74883495G>A	uc001owb.2	+	7	1240	c.853G>A	c.(853-855)GGT>AGT	p.G285S	SLCO2B1_uc010rrq.1_Missense_Mutation_p.G30S|SLCO2B1_uc010rrr.1_Missense_Mutation_p.G141S|SLCO2B1_uc010rrs.1_Missense_Mutation_p.G169S|SLCO2B1_uc001owc.2_Missense_Mutation_p.G58S|SLCO2B1_uc001owd.2_Missense_Mutation_p.G263S	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	285	Helical; Name=6; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	CATCGCTGCCGGTGCAGTGGC	0.562													4	118	---	---	---	---	PASS
MMP12	4321	broad.mit.edu	37	11	102742648	102742648	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102742648C>A	uc001phk.2	-	3	430	c.385G>T	c.(385-387)GAT>TAT	p.D129Y		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	129					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	TAGTCAACATCCTCACGGTTC	0.393													10	44	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103339328	103339328	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103339328G>T	uc001pho.2	+	88	12804	c.12660G>T	c.(12658-12660)TTG>TTT	p.L4220F	DYNC2H1_uc001phn.1_Missense_Mutation_p.L4227F|DYNC2H1_uc009yxe.1_Missense_Mutation_p.L833F	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4220					cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCAGTGGCTTGTTACTAGAAG	0.393													7	13	---	---	---	---	PASS
DDI1	414301	broad.mit.edu	37	11	103907489	103907489	+	5'UTR	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103907489G>A	uc001phr.2	+	1					PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1						proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		ACGCAGGCCCGCCCCAGCCCG	0.577													17	96	---	---	---	---	PASS
HINFP	25988	broad.mit.edu	37	11	119002676	119002676	+	Silent	SNP	C	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119002676C>G	uc001pvp.2	+	6	849	c.660C>G	c.(658-660)CGC>CGG	p.R220R	HINFP_uc001pvq.2_Silent_p.R220R|HINFP_uc001pvr.2_5'UTR	NM_015517	NP_056332	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	220	C2H2-type 4; degenerate.				DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ACATCCGTCGCCAGACCTCAT	0.557													21	120	---	---	---	---	PASS
LOC642846	642846	broad.mit.edu	37	12	9451621	9451621	+	Intron	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9451621C>T	uc010sgq.1	+						LOC642846_uc010sgp.1_Intron|LOC642846_uc009zgn.1_3'UTR|LOC642846_uc001qvo.2_Intron|LOC642846_uc001qvp.2_5'Flank					SubName: Full=cDNA FLJ60032, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-);												0						AGTGTTCCTACTCTCTGGGTG	0.483													2	2	---	---	---	---	PASS
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13028751G>C	uc010sho.1	+	1	341	c.319G>C	c.(319-321)GGC>CGC	p.G107R		NR_003932				SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;												0						GGTGTTTGACGGCATCCCACC	0.612													4	20	---	---	---	---	PASS
OR10P1	121130	broad.mit.edu	37	12	56030939	56030939	+	Silent	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56030939G>A	uc010spq.1	+	1	264	c.264G>A	c.(262-264)CCG>CCA	p.P88P		NM_206899	NP_996782	Q8NGE3	O10P1_HUMAN	olfactory receptor, family 10, subfamily P,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2						TGGGCTCCCCGCATCCCCAGG	0.602													29	148	---	---	---	---	PASS
SPRYD4	283377	broad.mit.edu	37	12	56863081	56863081	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56863081T>C	uc001sli.3	+	2	419	c.344T>C	c.(343-345)ATT>ACT	p.I115T	SPRYD4_uc010sqo.1_Missense_Mutation_p.I103T	NM_207344	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	115	B30.2/SPRY.					nucleus					0						GATAGCTGCATTGGTGTTGAT	0.567													52	256	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131498747	131498747	+	Silent	SNP	C	T	T	rs144882598	byFrequency	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131498747C>T	uc001uit.3	+	13	1894	c.1335C>T	c.(1333-1335)ATC>ATT	p.I445I	GPR133_uc010tbm.1_Silent_p.I477I	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	445	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCCCAAGGATCGCGGAGGCCA	0.577													19	106	---	---	---	---	PASS
NEK5	341676	broad.mit.edu	37	13	52661539	52661539	+	Silent	SNP	T	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52661539T>G	uc001vge.2	-	15	1467	c.1327A>C	c.(1327-1329)AGA>CGA	p.R443R		NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	443							ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		CCATTACTTCTTAGCTCTTGT	0.383													37	118	---	---	---	---	PASS
EDNRB	1910	broad.mit.edu	37	13	78493499	78493499	+	5'Flank	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78493499G>C	uc001vko.2	-						uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Intron|EDNRB_uc010aez.1_5'Flank|EDNRB_uc001vkp.1_Intron|EDNRB_uc010afa.1_Translation_Start_Site	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)	TTCAATCAATGATTTTAATTC	0.423											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	59	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23862693	23862693	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23862693T>C	uc001wjv.2	-	23	3030	c.2963A>G	c.(2962-2964)GAT>GGT	p.D988G		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	988	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GATGATTTCATCCAGCCCAGC	0.527													61	253	---	---	---	---	PASS
PSME2	5721	broad.mit.edu	37	14	24613439	24613439	+	Silent	SNP	G	A	A	rs17101478	byFrequency	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24613439G>A	uc001wmj.2	-	8	524	c.459C>T	c.(457-459)GTC>GTT	p.V153V	FAM158A_uc001wmi.2_5'Flank|PSME2_uc001wmk.2_Silent_p.V76V|RNF31_uc001wml.1_5'Flank	NM_002818	NP_002809	Q9UL46	PSME2_HUMAN	proteasome activator subunit 2	153					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome activator complex					0				GBM - Glioblastoma multiforme(265;0.00839)		CTTTGGTCTTGACGGCATTCA	0.537													62	266	---	---	---	---	PASS
SLC39A9	55334	broad.mit.edu	37	14	69925198	69925198	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69925198A>C	uc001xle.2	+	7	1492	c.812A>C	c.(811-813)CAC>CCC	p.H271P	SLC39A9_uc010aqx.2_Missense_Mutation_p.H248P|SLC39A9_uc001xlf.3_Intron|SLC39A9_uc001xlg.3_RNA	NM_018375	NP_060845	Q9NUM3	S39A9_HUMAN	solute carrier family 39 (zinc transporter),	271					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		GGAATAGGGCACAGCCACAAG	0.597													22	115	---	---	---	---	PASS
C14orf178	283579	broad.mit.edu	37	14	78227450	78227450	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78227450A>G	uc001xug.1	+	2	523	c.65A>G	c.(64-66)CAA>CGA	p.Q22R	SNW1_uc001xuf.2_Intron|SNW1_uc010tvm.1_Intron|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Intron|C14orf178_uc001xuh.1_RNA	NM_174943	NP_777603	Q8N769	CN178_HUMAN	hypothetical protein LOC283579	22										ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		CCCAATCAACAACCCACCTGG	0.587													19	98	---	---	---	---	PASS
MIR409	574413	broad.mit.edu	37	14	101531657	101531657	+	RNA	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101531657C>A	hsa-mir-409|MI0001735	+			c.21C>A			MIR412_hsa-mir-412|MI0002464_5'Flank|uc010txp.1_5'Flank|MIR369_hsa-mir-369|MI0000777_5'Flank|MIR410_hsa-mir-410|MI0002465_5'Flank|MIR656_hsa-mir-656|MI0003678_5'Flank																	0						GGAGAGGTTACCCGAGCAACT	0.587													9	35	---	---	---	---	PASS
CKB	1152	broad.mit.edu	37	14	103986922	103986922	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103986922C>A	uc001ynf.1	-	6	741	c.661G>T	c.(661-663)GAC>TAC	p.D221Y	CKB_uc001yne.1_Missense_Mutation_p.D43Y|CKB_uc010awr.1_Missense_Mutation_p.D152Y	NM_001823	NP_001814	P12277	KCRB_HUMAN	brain creatine kinase	221	Phosphagen kinase C-terminal.				creatine metabolic process	cytosol	ATP binding|creatine kinase activity				0		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	GTCTTATTGTCATTGTGCCTG	0.597													3	33	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105622204	105622204	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105622204C>T	uc001yqg.2	-	4	1002	c.598G>A	c.(598-600)GAG>AAG	p.E200K	JAG2_uc001yqh.2_Missense_Mutation_p.E200K	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	200	DSL.|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TAGTAGTTCTCGTCGCAGCGC	0.627													6	23	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106816011	106816011	+	RNA	SNP	A	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106816011A>C	uc010tyt.1	-	342		c.13148T>G								Parts of antibodies, mostly variable regions.												0						CACCAGCTGCACCTGACACTG	0.532													7	19	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													4	45	---	---	---	---	PASS
IVD	3712	broad.mit.edu	37	15	40698128	40698128	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40698128C>T	uc001zls.3	+	1	443	c.109C>T	c.(109-111)CCC>TCC	p.P37S	IVD_uc001zlq.2_Missense_Mutation_p.P37S	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1	34					leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		CTCGCTTTTGCCCGTGGACGA	0.672													3	42	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52058730	52058730	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52058730A>G	uc002abk.2	+	2	313	c.92A>G	c.(91-93)CAG>CGG	p.Q31R	TMOD2_uc002abl.3_Missense_Mutation_p.Q31R|TMOD2_uc010bfb.2_5'UTR	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	31					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		GAACTGAAACAGTTGGAAAAT	0.418													29	132	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53081026	53081026	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53081026C>A	uc002aci.1	-	1	1184	c.1056G>T	c.(1054-1056)AAG>AAT	p.K352N		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	352	CUT.				endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		CCTGCAGCCACTTCCACATCC	0.657													20	62	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65491058	65491058	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65491058G>T	uc002aon.2	-	9	1747	c.1566C>A	c.(1564-1566)TAC>TAA	p.Y522*		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	522					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						AAGTGCCCTTGTAGCCAGTCA	0.572													7	78	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78211648	78211648	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78211648A>G	uc010bky.2	-	11	883	c.119T>C	c.(118-120)CTA>CCA	p.L40P		NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						CGCCAGGGATAGGGGCTCAGC	0.522													4	100	---	---	---	---	PASS
CLDN9	9080	broad.mit.edu	37	16	3063524	3063524	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3063524G>C	uc010uwo.1	+	1	1068	c.161G>C	c.(160-162)TGC>TCC	p.C54S		NM_020982	NP_066192	O95484	CLD9_HUMAN	claudin 9	54	Extracellular (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						TGGATGTCCTGCGTGGTGCAG	0.657													24	130	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4937215	4937215	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4937215G>A	uc002cyd.1	-	21	2618	c.2528C>T	c.(2527-2529)GCC>GTC	p.A843V		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	843	Spectrin 4.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GAACTTGGCGGCAAGTGCTGC	0.483													5	322	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27373986	27373986	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27373986G>T	uc002don.2	+	11	1555	c.1313G>T	c.(1312-1314)AGT>ATT	p.S438I	IL4R_uc002dop.3_Missense_Mutation_p.S423I|IL4R_uc010bxy.2_Missense_Mutation_p.S438I|IL4R_uc002doo.2_Missense_Mutation_p.S278I	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	438	Cytoplasmic (Potential).|Required for IRS1 activation and IL4- induced cell growth.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CCTTCGGGAAGTACGAGTGCT	0.612													35	141	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195519	3195519	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195519C>T	uc002fvh.1	-	1	358	c.358G>A	c.(358-360)GCC>ACC	p.A120T		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	120	Helical; Name=3; (Potential).			A -> D (in Ref. 6; AAA18347).	sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						TAGGCCATGGCGGTCAGCAGG	0.612													9	120	---	---	---	---	PASS
CHRNB1	1140	broad.mit.edu	37	17	7349658	7349658	+	Intron	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7349658G>C	uc002ghb.2	+						CHRNB1_uc010vty.1_Intron|CHRNB1_uc010vtz.1_5'UTR	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit						behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				gtgtgtgtgtgtgtgtgtgtg	0.010													2	0	---	---	---	---	PASS
UBB	7314	broad.mit.edu	37	17	16285383	16285383	+	Silent	SNP	T	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285383T>C	uc002gpx.2	+	2	300	c.162T>C	c.(160-162)CGT>CGC	p.R54R	UBB_uc010vwe.1_Silent_p.R54R	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	54	Ubiquitin-like 1.	Activating enzyme.			activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	p.R54C(1)		skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		AAGATGGCCGTACTCTTTCTG	0.542													3	126	---	---	---	---	PASS
FLCN	201163	broad.mit.edu	37	17	17124625	17124625	+	Intron	SNP	C	T	T	rs41400246	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17124625C>T	uc002gra.3	-						PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_3'UTR	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1						regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						CCCCACCTAGCTGGGGAACAG	0.468									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				4	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21730916	21730916	+	Missense_Mutation	SNP	G	T	T	rs111245273	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21730916G>T	uc002gyy.3	+	2	343	c.218G>T	c.(217-219)CGG>CTG	p.R73L						SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GTCCTGCGTCGGAGAGGTGGT	0.552													4	77	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904193	21904193	+	RNA	SNP	C	G	G	rs9904221	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904193C>G	uc002gza.2	+	1		c.132C>G				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						cagcctcaggcctgccaggac	0.000													6	51	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904197	21904197	+	RNA	SNP	C	T	T	rs9904223	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904197C>T	uc002gza.2	+	1		c.136C>T				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ctcaggcctgccaggacggtg	0.000													6	49	---	---	---	---	PASS
ARMC7	79637	broad.mit.edu	37	17	73125173	73125173	+	3'UTR	SNP	A	G	G	rs2291027	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73125173A>G	uc002jmw.1	+	3					ARMC7_uc010wru.1_3'UTR|ARMC7_uc010dga.1_RNA	NM_024585	NP_078861	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7								binding			pancreas(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			CTACTGCTGGAGACCACAGTC	0.632													17	30	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753607	76753607	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753607G>C	uc002lmt.2	+	2	1616	c.1616G>C	c.(1615-1617)GGC>GCC	p.G539A	SALL3_uc010dra.2_Missense_Mutation_p.G146A	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	539					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGCGCGCACGGCTACGCCGAC	0.731													6	10	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940554	22940554	+	Silent	SNP	A	G	G	rs12980594		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940554A>G	uc010xrh.1	-	5	1884	c.1884T>C	c.(1882-1884)ACT>ACC	p.T628T		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGAGTTGAGGACT	0.363													5	112	---	---	---	---	PASS
ZNF587	84914	broad.mit.edu	37	19	58352939	58352939	+	Intron	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58352939G>A	uc002qqb.2	+						uc002qqh.1_Silent_p.G249G|ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|uc010yhj.1_Silent_p.G299G|ZNF587_uc002qqj.1_Intron	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		AACCTTATGGGTGTGAAGAAT	0.403													5	8	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8755243	8755243	+	Silent	SNP	T	C	C	rs2235613	byFrequency	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8755243T>C	uc002wnb.2	+	27	2991	c.2988T>C	c.(2986-2988)GCT>GCC	p.A996A	PLCB1_uc010zrb.1_Silent_p.A895A|PLCB1_uc002wna.2_Silent_p.A996A|PLCB1_uc002wnc.1_Silent_p.A895A|PLCB1_uc002wnd.1_Silent_p.A573A	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	996					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						ACCTCGCTGCTCTGGATGCTG	0.443													5	223	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9364889	9364889	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9364889G>A	uc002wnf.2	+	13	1031	c.895G>A	c.(895-897)GAT>AAT	p.D299N	PLCB4_uc010gbw.1_Missense_Mutation_p.D299N|PLCB4_uc010gbx.2_Missense_Mutation_p.D299N|PLCB4_uc002wne.2_Missense_Mutation_p.D299N|PLCB4_uc002wnh.2_Missense_Mutation_p.D146N	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	299					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TCTGATGTCAGATGAAAACGC	0.408													12	226	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33575015	33575015	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33575015G>A	uc002xbi.1	+	14	1290	c.1198G>A	c.(1198-1200)GCC>ACC	p.A400T		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	358	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GATCGTGGGCGCCCTCCTGCA	0.587													14	166	---	---	---	---	PASS
KCNB1	3745	broad.mit.edu	37	20	47989612	47989612	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47989612C>T	uc002xur.1	-	2	2649	c.2485G>A	c.(2485-2487)GAA>AAA	p.E829K	KCNB1_uc002xus.1_Missense_Mutation_p.E829K	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	829	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TTGCACTTTTCCTGACCACTG	0.522													7	162	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45523339	45523339	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45523339A>G	uc002zea.2	+	23	3876	c.3707A>G	c.(3706-3708)AAC>AGC	p.N1236S	TRAPPC10_uc010gpo.2_Missense_Mutation_p.N947S|TRAPPC10_uc011afa.1_Missense_Mutation_p.N614S	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1236					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAGGTCTTCAACTCCAGCTCG	0.622													7	39	---	---	---	---	PASS
GNB1L	54584	broad.mit.edu	37	22	19808139	19808139	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19808139T>G	uc002zqe.1	-	3	630	c.236A>C	c.(235-237)CAG>CCG	p.Q79P	GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqf.1_Missense_Mutation_p.Q79P	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein	79	WD 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					CTGGCGCCCCTGGGGCAGCGT	0.657													5	68	---	---	---	---	PASS
LOC644165	644165	broad.mit.edu	37	22	25040745	25040745	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25040745C>T	uc011ajv.1	+	2	568	c.211C>T	c.(211-213)CGC>TGC	p.R71C		NR_024494				Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).												0						ACTGGCAGCGCGCCGTCATCG	0.617													3	12	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26423244	26423244	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26423244G>A	uc003abz.1	+	43	7554	c.7304G>A	c.(7303-7305)CGC>CAC	p.R2435H	MYO18B_uc003aca.1_Missense_Mutation_p.R2316H|MYO18B_uc010guy.1_Missense_Mutation_p.R2317H|MYO18B_uc010guz.1_Missense_Mutation_p.R2315H|MYO18B_uc011aka.1_Missense_Mutation_p.R1589H|MYO18B_uc011akb.1_Missense_Mutation_p.R1948H|MYO18B_uc010gva.1_Missense_Mutation_p.R418H|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2435						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						GACTACGAACGCAAGACCAAA	0.562													4	146	---	---	---	---	PASS
GLRA2	2742	broad.mit.edu	37	X	14748515	14748515	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14748515C>T	uc010nep.2	+	10	1599	c.1267C>T	c.(1267-1269)CGA>TGA	p.R423*	GLRA2_uc010neq.2_Nonsense_Mutation_p.R423*|GLRA2_uc004cwe.3_Nonsense_Mutation_p.R423*|GLRA2_uc011mio.1_Nonsense_Mutation_p.R334*|GLRA2_uc011mip.1_Nonsense_Mutation_p.R401*	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A	423	Cytoplasmic (Probable).				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	CACGATATCTCGAGCTGCCTT	0.473													50	71	---	---	---	---	PASS
TEX13B	56156	broad.mit.edu	37	X	107225170	107225170	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107225170A>G	uc004enn.1	-	2	281	c.188T>C	c.(187-189)GTC>GCC	p.V63A		NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B	63										ovary(1)	1						GGCCTCTTTGACCTCGCTGGG	0.597													16	171	---	---	---	---	PASS
GPR50	9248	broad.mit.edu	37	X	150348254	150348254	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150348254G>A	uc010ntg.1	+	2	334	c.199G>A	c.(199-201)GTG>ATG	p.V67M	uc004fes.1_5'Flank|GPR50_uc011myc.1_Missense_Mutation_p.V67M	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	67	Helical; Name=2; (Potential).				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CAACATCTTCGTGGTCAGTCT	0.483													16	437	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	8802	8802	+	RNA	SNP	T	C	C			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:8802T>C	uc011mfi.1	+	1		c.140T>C			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		CCTCACTCATTTACACCAACC	0.438													5	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13464	13464	+	RNA	SNP	C	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13464C>T	uc004cox.3	+	1		c.1128C>T			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CTCACCATTGGCAGCCTAGCA	0.448													5	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	2627074	2627074	+	IGR	DEL	C	-	-	rs148069132	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2627074delC								MMEL1 (62593 upstream) : ACTRT2 (310972 downstream)																							AGCACCCACACCAACAGGTGA	0.612													4	3	---	---	---	---	
CLSTN1	22883	broad.mit.edu	37	1	9797317	9797317	+	Intron	DEL	G	-	-	rs34403180		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9797317delG	uc001aqh.2	-						CLSTN1_uc001aqi.2_Intron|CLSTN1_uc010oag.1_Intron	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1						homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CAAACTGGATGGGGGGGGAAG	0.557													7	5	---	---	---	---	
CELA2A	63036	broad.mit.edu	37	1	15783097	15783097	+	5'Flank	DEL	A	-	-	rs34325326		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15783097delA	uc001awk.2	+							NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						AGGAAATGGGAAAAAAAAAAT	0.383													2	5	---	---	---	---	
HSPG2	3339	broad.mit.edu	37	1	22161636	22161636	+	Intron	DEL	T	-	-	rs71569850		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22161636delT	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGTCCACttcttttttttttt	0.040													3	3	---	---	---	---	
SSBP3	23648	broad.mit.edu	37	1	54870494	54870494	+	Intron	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54870494delT	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0						GGGGGGGGGGTGTCAAGAAAT	0.468													23	10	---	---	---	---	
PTPN22	26191	broad.mit.edu	37	1	114380071	114380072	+	Intron	INS	-	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114380071_114380072insA	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		gactccatctcaaaaaaaaaaa	0.035													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120495937	120495937	+	Intron	DEL	A	-	-	rs72047996		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120495937delA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		actctgtgtcaaaaaaaaaaa	0.070			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142535627	142535636	+	IGR	DEL	AATGGAATGG	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142535627_142535636delAATGGAATGG								None (None upstream) : None (None downstream)																							aatggagtaaaatggaatggaatggaatcg	0.024													4	2	---	---	---	---	
SLC41A1	254428	broad.mit.edu	37	1	205768014	205768021	+	Intron	DEL	AGAGTGGA	-	-	rs41264903		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205768014_205768021delAGAGTGGA	uc001hdh.1	-						uc001hdi.1_5'Flank	NM_173854	NP_776253	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 member 1							integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			skin(2)	2	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			ACAAAAAGAGAGAGTGGAAGTGCCAGGT	0.534													87	7	---	---	---	---	
GFPT1	2673	broad.mit.edu	37	2	69555227	69555227	+	Intron	DEL	A	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69555227delA	uc002sfh.2	-							NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						actccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
LYG2	254773	broad.mit.edu	37	2	99870873	99870893	+	Intron	DEL	AGATAGTATTCTCACAGGCTC	-	-	rs80345491		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99870873_99870893delAGATAGTATTCTCACAGGCTC	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_5'Flank|LYG2_uc002szx.1_Intron	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						CCCTGTTTCAAGATAGTATTCTCACAGGCTCAGTACATAGT	0.308													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																							tcaccaccatcaccactgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130751835	130751836	+	IGR	DEL	AG	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130751835_130751836delAG								RAB6C (11524 upstream) : LOC440905 (31736 downstream)																							AAAGAAAGAAAGAaagaaaatg	0.173													4	2	---	---	---	---	
MARCH7	64844	broad.mit.edu	37	2	160616015	160616015	+	Intron	DEL	T	-	-	rs34264670		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160616015delT	uc002uax.2	+						MARCH7_uc010foq.2_Intron|MARCH7_uc010zcn.1_Intron|MARCH7_uc010for.2_Intron|MARCH7_uc002uay.2_Intron	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin								ligase activity|zinc ion binding				0						AATTTCataattttttttttt	0.279													7	8	---	---	---	---	
METTL8	79828	broad.mit.edu	37	2	172195464	172195464	+	Intron	DEL	T	-	-	rs113891597		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172195464delT	uc010zdo.1	-						METTL8_uc002ugu.3_Intron|METTL8_uc002ugv.3_Intron|METTL8_uc002ugt.3_Intron|METTL8_uc002ugs.3_Intron|METTL8_uc010zdp.1_Intron	NM_024770	NP_079046	B3KW44	B3KW44_HUMAN	methyltransferase like 8								methyltransferase activity			ovary(1)	1						AAACAGACAATTTTTTTTTTT	0.289													4	2	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1443812	1443812	+	Intron	DEL	A	-	-	rs72185294		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1443812delA	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGCATTGGCCAAAAAAAAAAA	0.368													4	2	---	---	---	---	
WDR52	55779	broad.mit.edu	37	3	113079774	113079774	+	Intron	DEL	A	-	-	rs111698499		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113079774delA	uc003ead.1	-									Q96MT7	WDR52_HUMAN	RecName: Full=WD repeat protein 52.; Flags: Fragment;											central_nervous_system(1)	1						CTACTAATATAAAAAAAAAAA	0.358													8	4	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140139744	140139744	+	Intron	DEL	C	-	-	rs11338320		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140139744delC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AGTCCTATTGCGCAGCTAGGT	0.517										HNSCC(16;0.037)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183867467	183867467	+	IGR	DEL	C	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183867467delC								EIF2B5 (4369 upstream) : DVL3 (5817 downstream)																							ttagGCCTTTCCTTTCAGTGG	0.239													24	9	---	---	---	---	
ANAPC4	29945	broad.mit.edu	37	4	25415552	25415553	+	Intron	INS	-	GT	GT	rs142610646	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25415552_25415553insGT	uc003gro.2	+						ANAPC4_uc003grp.2_Intron|ANAPC4_uc003grq.2_5'UTR	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				TTCTTACACACgtgtgtgtgtg	0.163													5	5	---	---	---	---	
NMU	10874	broad.mit.edu	37	4	56475551	56475552	+	Intron	INS	-	A	A	rs35666427		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56475551_56475552insA	uc003hbc.2	-						NMU_uc003hbd.1_Intron|NMU_uc010igv.1_Intron|NMU_uc010igw.1_Intron|NMU_uc010igx.1_Intron	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		CTTCTAACCAGAAAAAAAAAAA	0.342													3	3	---	---	---	---	
SNHG8	100093630	broad.mit.edu	37	4	119200694	119200694	+	Intron	DEL	A	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119200694delA	uc003iby.2	+							NR_003584				Homo sapiens, clone IMAGE:4249217, mRNA.												0						TTGAGTTAACAACCAACTGAA	0.383													4	4	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154215279	154215280	+	Intron	INS	-	A	A	rs148467106	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154215279_154215280insA	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TCTGAAGAGACAAAATCTCTTC	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190818970	190818974	+	Intron	DEL	AGGAA	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818970_190818974delAGGAA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		agggagagcgaggaaaggaaaggaa	0.000													3	3	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10405428	10405429	+	Intron	INS	-	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10405428_10405429insT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CCCAATGAATGTTTTTTTTTTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26853213	26853216	+	IGR	DEL	TTTT	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26853213_26853216delTTTT								None (None upstream) : CDH9 (27493 downstream)																							cttccttccGtttttttttttttt	0.010													4	2	---	---	---	---	
ANKRD55	79722	broad.mit.edu	37	5	55431092	55431095	+	Intron	DEL	TCCC	-	-	rs60728986		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55431092_55431095delTCCC	uc003jqu.2	-							NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				cttccttctttccctccctccctc	0.000													6	3	---	---	---	---	
ZFYVE16	9765	broad.mit.edu	37	5	79745169	79745169	+	Intron	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79745169delT	uc003kgr.3	+						ZFYVE16_uc003kgp.2_Intron|ZFYVE16_uc003kgq.3_Intron|ZFYVE16_uc003kgs.3_Intron|ZFYVE16_uc003kgt.3_Intron	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16						BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		ACATTTGCTGTTTAATCAACA	0.264													4	2	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80513388	80513390	+	Intron	DEL	CTC	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80513388_80513390delCTC	uc003kha.1	+						RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ttttttttttctcttcttttttt	0.148													87	7	---	---	---	---	
ZKSCAN3	80317	broad.mit.edu	37	6	28327932	28327932	+	Intron	DEL	T	-	-	rs113424723		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327932delT	uc003nle.3	+						ZKSCAN3_uc010jrc.2_Intron|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						ctcagaataatttttttttta	0.050													6	4	---	---	---	---	
KIFC1	3833	broad.mit.edu	37	6	33359615	33359616	+	5'UTR	INS	-	GG	GG	rs144537761	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33359615_33359616insGG	uc003oef.3	+	1					KIFC1_uc011drf.1_5'UTR	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1						blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						TCAAAAGTGGCGGGTGTGGCGC	0.678													6	3	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152734821	152734822	+	Intron	INS	-	G	G	rs138384898	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152734821_152734822insG	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAATGGAAAAAGTACTTTTAAA	0.287										HNSCC(10;0.0054)			4	7	---	---	---	---	
PSMB1	5689	broad.mit.edu	37	6	170835857	170835858	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170835857_170835858insTGTGTG	uc003qxq.2	-							NM_002793		P20618	PSB1_HUMAN	proteasome beta 1 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)	GCTTTTTCCTTtgtgtgtgtgt	0.287													4	2	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5965102	5965102	+	Intron	DEL	A	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5965102delA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		tgtctcaaacaaaaaaaaaaa	0.129													10	5	---	---	---	---	
STARD3NL	83930	broad.mit.edu	37	7	38256581	38256587	+	Intron	DEL	TGTGAGA	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38256581_38256587delTGTGAGA	uc003tfr.2	+						STARD3NL_uc003tfs.2_Intron|STARD3NL_uc003tft.2_Intron	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog							integral to membrane|late endosome membrane				ovary(1)	1						ACCTTCACAGTGTGAGATGCCTAGTGT	0.512													228	10	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107338763	107338764	+	Intron	INS	-	T	T	rs80047783		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107338763_107338764insT	uc003vep.2	+						SLC26A4_uc011kmb.1_Intron|SLC26A4_uc011kmc.1_Intron|SLC26A4_uc011kmd.1_Intron	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						AGCTGAATGTCttttttttttt	0.213									Pendred_syndrome				4	2	---	---	---	---	
PODXL	5420	broad.mit.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	-	-	rs11277659		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131241030_131241035delGGCGAC	uc003vqw.3	-	1	342_347	c.84_89delGTCGCC	c.(82-90)CCGTCGCCC>CCC	p.28_30PSP>P	PODXL_uc003vqx.3_In_Frame_Del_p.28_30PSP>P	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	28_30	Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.573													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	10396564	10396564	+	Intron	DEL	A	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10396564delA	uc010lru.2	-						PRSS55_uc003wtb.2_Intron					Homo sapiens cDNA, FLJ97155.																		catataacagaaaaaaaaaaa	0.085													5	3	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94740321	94740321	+	Intron	DEL	A	-	-	rs77899597		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94740321delA	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_Intron|FAM92A1_uc003yfw.3_Intron|FAM92A1_uc010mar.2_Intron	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGACATGGACATTTTTTTGAA	0.219													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66471182	66471182	+	IGR	DEL	G	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66471182delG								FAM74A4 (976796 upstream) : LOC442421 (25288 downstream)																							gtgaggctttgcaataaactc	0.000													2	4	---	---	---	---	
SLC28A3	64078	broad.mit.edu	37	9	86924468	86924469	+	Intron	DEL	TC	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86924468_86924469delTC	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron|SLC28A3_uc010mqb.2_Intron	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						aaaaaagaaaTCAAATGGGGAT	0.193													96	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6043010	6043011	+	IGR	DEL	TG	-	-	rs55755804		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6043010_6043011delTG								IL15RA (22868 upstream) : IL2RA (10495 downstream)																							AAGGAGACCAtgtgtgtgtgtg	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38944608	38944609	+	IGR	DEL	AT	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38944608_38944609delAT								LOC399744 (203528 upstream) : None (None downstream)																							TTATAGTGACATGTATGAAAAC	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42392387	42392387	+	IGR	DEL	A	-	-	rs66654883		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42392387delA								None (None upstream) : LOC441666 (434928 downstream)																							aatggattcgaaatgtaatca	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396712	42396712	+	IGR	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396712delT								None (None upstream) : LOC441666 (430603 downstream)																							ttgaacggaatcaaatggaat	0.000													267	7	---	---	---	---	
SUPV3L1	6832	broad.mit.edu	37	10	70960397	70960397	+	Intron	DEL	A	-	-	rs35423280		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70960397delA	uc001jpe.1	+						SUPV3L1_uc010qjd.1_Intron	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor						DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						AAACTGCATTAAAAAAAGCCC	0.408													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													4	2	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105561300	105561301	+	Intron	INS	-	ACACAC	ACACAC	rs148335179	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105561300_105561301insACACAC	uc001kxj.1	-							NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		tatgtctAAATacacacacaca	0.139													5	3	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116228179	116228180	+	Intron	INS	-	T	T	rs111922820	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116228179_116228180insT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		gactacaggcgccgccaccacc	0.000													4	3	---	---	---	---	
EBF3	253738	broad.mit.edu	37	10	131671688	131671689	+	Intron	INS	-	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131671688_131671689insA	uc001lki.1	-							NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GCATCGCAAATAAAAAAAGACA	0.515													94	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	321076	321077	+	Intron	INS	-	A	A	rs144605457	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:321076_321077insA	uc001loz.2	+						IFITM3_uc001lpa.2_5'Flank					Homo sapiens cDNA clone IMAGE:5200448, partial cds.																		TAGTGGTGTGGGGTCCTGGAGA	0.609													4	3	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11285719	11285720	+	Intron	INS	-	AC	AC	rs146193223	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11285719_11285720insAC	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						CAGTTTTTcatacacacacaca	0.218										HNSCC(22;0.051)			2	4	---	---	---	---	
PPFIBP1	8496	broad.mit.edu	37	12	27845851	27845852	+	3'UTR	INS	-	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27845851_27845852insT	uc001ric.1	+	29					PPFIBP1_uc001rib.1_3'UTR|PPFIBP1_uc001ria.2_3'UTR|PPFIBP1_uc001rid.1_3'UTR|PPFIBP1_uc001rif.1_3'UTR	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					AGTGCTTAGTCTTTTTTCTACT	0.421													40	7	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50535722	50535723	+	Intron	INS	-	A	A	rs35739493		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50535722_50535723insA	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						gactccgtctcaaaaaaaaaaa	0.124													9	5	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104086413	104086416	+	Intron	DEL	GAGA	-	-	rs71809816		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104086413_104086416delGAGA	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						gcacgtgtgtgaGAGAGAGAGAGA	0.118													4	4	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965106	117965107	+	Intron	DEL	AG	-	-	rs68177299		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965106_117965107delAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacacagacacacacac	0.223													6	3	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25049929	25049930	+	Intron	INS	-	T	T	rs34628702		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25049929_25049930insT	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TGCCTTCTGCCttttttttttt	0.183													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20138377	20138377	+	IGR	DEL	A	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20138377delA								P704P (118105 upstream) : OR4Q3 (77210 downstream)																							CAaaagaaagaaagaaagaaa	0.214													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	42968553	42968572	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCC	-	-	rs36206652		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42968553_42968572delTTCCTTCCTTCCTTCCTTCC								LRFN5 (594803 upstream) : None (None downstream)																							ctcctttcttttccttccttccttccttccttccttcctt	0.091													4	4	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72818780	72818784	+	Intron	DEL	TTCTT	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72818780_72818784delTTCTT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		AAAATAACACTTCTTTTCTTTAACC	0.356													47	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99439134	99439135	+	IGR	INS	-	TTTTTTTTTTTTTTTTT	TTTTTTTTTTTTTTTTT			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99439134_99439135insTTTTTTTTTTTTTTTTT								C14orf177 (255037 upstream) : BCL11B (196492 downstream)																							ctacacacttcttttttttttt	0.153													4	2	---	---	---	---	
CKB	1152	broad.mit.edu	37	14	103987483	103987485	+	Intron	DEL	CCT	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103987483_103987485delCCT	uc001ynf.1	-						CKB_uc001yne.1_Intron|CKB_uc010awr.1_Intron	NM_001823	NP_001814	P12277	KCRB_HUMAN	brain creatine kinase						creatine metabolic process	cytosol	ATP binding|creatine kinase activity				0		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	CCGGCCCCTCcctcctcctcctc	0.700													4	2	---	---	---	---	
MTA1	9112	broad.mit.edu	37	14	105905492	105905493	+	Intron	INS	-	T	T	rs140601392	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905492_105905493insT	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GAGCTCTGCCCCCACCCCTGAG	0.644													3	4	---	---	---	---	
CEP152	22995	broad.mit.edu	37	15	49058985	49058985	+	Intron	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49058985delT	uc001zwy.2	-						CEP152_uc001zwz.2_Intron|CEP152_uc001zxa.1_Intron	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa						centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		ACACTGATCCTTTTTTTTTTT	0.348													4	3	---	---	---	---	
IDH3A	3419	broad.mit.edu	37	15	78450167	78450167	+	Intron	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78450167delT	uc002bdd.2	+						IDH3A_uc010umt.1_Intron|IDH3A_uc010umu.1_Intron|IDH3A_uc002bde.2_Intron|IDH3A_uc010umv.1_Intron|IDH3A_uc002bdf.2_Intron|IDH3A_uc002bdg.2_5'Flank	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha						carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	TCTTTCTTTCTTTtttttttt	0.179													4	2	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10782946	10782946	+	Intron	DEL	T	-	-	rs75922928		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10782946delT	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						atcaggactcttttttttttt	0.169													4	2	---	---	---	---	
POLR3E	55718	broad.mit.edu	37	16	22339679	22339680	+	Intron	INS	-	G	G			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22339679_22339680insG	uc002dkk.2	+						POLR3E_uc002dkj.1_3'UTR|POLR3E_uc002dkm.2_Intron|POLR3E_uc010vbr.1_Intron|POLR3E_uc002dkl.2_Intron|POLR3E_uc010vbs.1_Intron|POLR3E_uc010vbt.1_Intron	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E						innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		ggtttgtggctgcccaaggccc	0.356													5	3	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83984412	83984415	+	Intron	DEL	ACAC	-	-	rs139038786	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984412_83984415delACAC	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						tggcacacgtacacacatgcacac	0.029													4	2	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2075774	2075774	+	Intron	DEL	T	-	-	rs75172492		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2075774delT	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						TCGAGAGGGCTTTTTTTTTTC	0.428													4	2	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8408461	8408461	+	Intron	DEL	C	-	-	rs67610561		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8408461delC	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						tagattccagccccagccccc	0.234													5	8	---	---	---	---	
TNS4	84951	broad.mit.edu	37	17	38638838	38638839	+	Intron	DEL	AC	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38638838_38638839delAC	uc010cxb.2	-						TNS4_uc002huu.3_5'Flank	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			tctactaaagacacacacacac	0.000													4	2	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61409218	61409229	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs72013408		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61409218_61409229delTGTGTGTGTGTG	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						tgtgtgtgtctgtgtgtgtgtgtgtgtgtgtg	0.255													4	4	---	---	---	---	
FASN	2194	broad.mit.edu	37	17	80039811	80039813	+	Intron	DEL	AGA	-	-	rs60574681		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80039811_80039813delAGA	uc002kdu.2	-						FASN_uc002kdv.1_Intron	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase						energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	ggctgcggggagaaggtgggggt	0.167													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10153	10154	+	IGR	INS	-	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10153_10154insT								None (None upstream) : USP14 (148329 downstream)																							acccttaaccctaacccttaac	0.000													6	6	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13612545	13612545	+	Intron	DEL	C	-	-	rs11311417		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13612545delC	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_5'UTR|C18orf1_uc002ksf.2_5'UTR|C18orf1_uc002ksg.1_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CAGAAACACACCCCCCCCCCC	0.597													4	7	---	---	---	---	
ZNF532	55205	broad.mit.edu	37	18	56650988	56650989	+	Intron	INS	-	T	T	rs143271933	by1000genomes	TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56650988_56650989insT	uc002lho.2	+						ZNF532_uc002lhp.2_Intron|ZNF532_uc010xeg.1_Intron|ZNF532_uc002lhr.2_Intron|ZNF532_uc002lhs.2_Intron|ZNF532_uc010xeh.1_Intron	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						gccccactggcagagcaatgcc	0.233													4	2	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1049490	1049491	+	Intron	INS	-	T	T	rs79814850		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1049490_1049491insT	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCCGTGAGCCCCCCCACCAC	0.450													4	2	---	---	---	---	
CDKN2D	1032	broad.mit.edu	37	19	10679068	10679070	+	Intron	DEL	AGA	-	-	rs33926515		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10679068_10679070delAGA	uc002mpa.2	-						KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.2_Intron	NM_001800	NP_001791	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D						anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding				0			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GAAAGCCTAGAGAAGAAGGACCG	0.616									Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12670275	12670276	+	IGR	INS	-	A	A			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12670275_12670276insA								ZNF709 (7919 upstream) : ZNF490 (16644 downstream)																							actccatctccaaaaaaaaaaa	0.252													8	4	---	---	---	---	
LPHN1	22859	broad.mit.edu	37	19	14274278	14274281	+	Intron	DEL	GAGA	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14274278_14274281delGAGA	uc010xnn.1	-						LPHN1_uc010xno.1_Intron|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						cgagagggaggagagagagagaga	0.471													4	2	---	---	---	---	
C19orf42	79086	broad.mit.edu	37	19	16770671	16770672	+	Intron	INS	-	T	T			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16770671_16770672insT	uc002ner.2	-						TMEM38A_uc002nes.2_5'Flank|C19orf42_uc002neo.1_Intron|C19orf42_uc002nep.1_Intron	NM_024104	NP_077009	Q9BQ49	CS042_HUMAN	hypothetical protein LOC79086 precursor							integral to membrane					0						GGGCCTGCGGCTTGGGGGCGGG	0.678													4	2	---	---	---	---	
C19orf2	8725	broad.mit.edu	37	19	30417141	30417148	+	Intron	DEL	TCCTTCCT	-	-	rs72474373		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30417141_30417148delTCCTTCCT	uc002nsq.2	+							NM_134447	NP_604431	O94763	RMP_HUMAN	RPB5-mediating protein isoform b						protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		tcttcctctctccttccttccttccttc	0.000													4	2	---	---	---	---	
PLEKHG2	64857	broad.mit.edu	37	19	39913185	39913185	+	Intron	DEL	T	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39913185delT	uc010xuz.1	+						PLEKHG2_uc010xuy.1_Intron|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Intron	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			acccggctaattttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56040963	56040969	+	IGR	DEL	AGAGAGG	-	-	rs71830799		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56040963_56040969delAGAGAGG								SSC5D (10498 upstream) : SBK2 (132 downstream)																							TGCAGCCTGCAGAGAGGAGAGAGGAGG	0.643													2	5	---	---	---	---	
TH1L	51497	broad.mit.edu	37	20	57564216	57564219	+	Intron	DEL	AGAA	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57564216_57564219delAGAA	uc002yag.2	+						TH1L_uc010zzu.1_Intron|TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			CCTTACACTGAGAAAGAAAAGTGT	0.328													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28793489	28793490	+	Intron	INS	-	T	T	rs144948060		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28793489_28793490insT	uc002ymh.2	-											Homo sapiens, clone IMAGE:5227164, mRNA.																		atttttttttcttttttttttt	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755961	44755961	+	IGR	DEL	C	-	-			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755961delC								CRYAA (163048 upstream) : SIK1 (78437 downstream)																							accatcaccaccatcaccacc	0.000													5	3	---	---	---	---	
CCT8L2	150160	broad.mit.edu	37	22	17075872	17075872	+	5'Flank	DEL	A	-	-	rs148690764		TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17075872delA	uc002zlp.1	-							NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1						cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CACAGTAATGAAAAAAAAAAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58979593	58979594	+	IGR	INS	-	CCATT	CCATT			TCGA-EJ-5504-01A-01D-1576-08	TCGA-EJ-5504-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58979593_58979594insCCATT								None (None upstream) : None (None downstream)																							atttcatttcaccattccattc	0.005													4	4	---	---	---	---	
