Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16918727	16918727	+	5'UTR	SNP	G	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918727G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAGGTGCCTGAACTCAGAGC	0.463													2	16	---	---	---	---	PASS
GPATCH3	63906	broad.mit.edu	37	1	27217386	27217386	+	3'UTR	SNP	A	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27217386A>C	uc001bne.2	-	7					GPN2_uc001bnd.1_5'Flank|GPATCH3_uc009vsp.1_3'UTR	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3							intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GGAACAAAACACCCTGAACCA	0.537													9	33	---	---	---	---	PASS
SPATA1	64173	broad.mit.edu	37	1	85009894	85009894	+	Missense_Mutation	SNP	A	G	G	rs12143652	byFrequency	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85009894A>G	uc001djz.1	+	9	992	c.793A>G	c.(793-795)AAA>GAA	p.K265E	SPATA1_uc001djy.1_RNA	NM_001081472	NP_001074941			spermatogenesis associated 1											central_nervous_system(1)	1				Epithelial(280;4.36e-10)|all cancers(265;7.1e-09)|BRCA - Breast invasive adenocarcinoma(282;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(397;0.00286)|KIRC - Kidney renal clear cell carcinoma(1967;0.0111)		GACAGCTGAAAAAGAGTACAT	0.373													7	8	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104120424	104120424	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104120424G>C	uc001duq.2	+	11	1919	c.1303G>C	c.(1303-1305)GGG>CGG	p.G435R	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.G435R|AMY2B_uc001dus.1_RNA	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	435					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AGTGGCTTTTGGGAGAGGAAA	0.363													5	389	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713773	142713773	+	Intron	SNP	C	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713773C>G	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TCTTTTTCCACATTGTCATTT	0.284													6	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713774	142713774	+	Intron	SNP	A	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713774A>G	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CTTTTTCCACATTGTCATTTT	0.284													6	80	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152192307	152192307	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192307G>T	uc001ezt.1	-	3	1874	c.1798C>A	c.(1798-1800)CAC>AAC	p.H600N		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	600	6.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTAGATCCGTGTTGACCGTAG	0.557													47	427	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152733157	152733157	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152733157G>A	uc001fal.1	+	2	1151	c.1093G>A	c.(1093-1095)GCC>ACC	p.A365T		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	365	Pro-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTGGGGCGCCTCCTGCCC	0.662													10	79	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176668379	176668379	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176668379G>A	uc001gkz.2	+	8	4054	c.2890G>A	c.(2890-2892)GAC>AAC	p.D964N	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	964					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GGTCCAAGCCGACACCCTCAC	0.577													23	158	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109382170	109382170	+	Silent	SNP	A	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109382170A>G	uc002tem.3	+	20	5301	c.5175A>G	c.(5173-5175)GAA>GAG	p.E1725E		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1725	RanBP2-type 7.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CTAAGAAGGAAGGACAGTGGG	0.418													5	135	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114356221	114356221	+	Silent	SNP	C	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114356221C>T	uc002tkh.2	+	6	757	c.699C>T	c.(697-699)CCC>CCT	p.P233P	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						GTGAGGGGCCCGGAGGAGCCT	0.657													3	5	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176622807	176622807	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176622807G>A	uc003iuf.2	-	2	953	c.149C>T	c.(148-150)GCG>GTG	p.A50V	GPM6A_uc011ckj.1_Missense_Mutation_p.A43V|GPM6A_uc003iug.2_Missense_Mutation_p.A50V|GPM6A_uc003iuh.2_Missense_Mutation_p.A39V	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	50	Extracellular (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TCCAGAAAGCGCTTCATGACC	0.488													5	155	---	---	---	---	PASS
EDIL3	10085	broad.mit.edu	37	5	83360583	83360583	+	Silent	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83360583G>A	uc003kio.1	-	8	1307	c.888C>T	c.(886-888)CTC>CTT	p.L296L	EDIL3_uc003kip.1_Silent_p.L286L|EDIL3_uc011ctt.1_Silent_p.L73L	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	296	F5/8 type C 1.				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		CTTGGGGATAGAGTCTTACAT	0.378													14	70	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140187163	140187163	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140187163C>A	uc003lhi.2	+	1	492	c.391C>A	c.(391-393)CCG>ACG	p.P131T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.P131T|PCDHA4_uc011daa.1_Missense_Mutation_p.P131T	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	131	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGATAACCCGCCGGTGTTCCC	0.592													4	150	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140723819	140723819	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723819G>T	uc003ljm.1	+	1	219	c.219G>T	c.(217-219)CAG>CAT	p.Q73H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.Q73H	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	73	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAGGACGCAGCTTTTCTCTC	0.592											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	163	---	---	---	---	PASS
TCERG1	10915	broad.mit.edu	37	5	145890177	145890177	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145890177C>A	uc003lob.2	+	22	3309	c.3269C>A	c.(3268-3270)TCG>TAG	p.S1090*	TCERG1_uc003loc.2_Nonsense_Mutation_p.S1069*	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1	1090					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCACAGCATCGGAGCCCACG	0.463													3	97	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74491004	74491004	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74491004C>A	uc003php.2	+	17	2350	c.1925C>A	c.(1924-1926)ACA>AAA	p.T642K	CD109_uc010kaz.2_Missense_Mutation_p.T642K|CD109_uc003phq.2_Missense_Mutation_p.T642K|CD109_uc010kba.2_Missense_Mutation_p.T565K	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	642	Bait region (approximate) (By similarity).					anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TGGGTATTGACAGATGCAAAC	0.318													3	72	---	---	---	---	PASS
SEC63	11231	broad.mit.edu	37	6	108214751	108214751	+	Missense_Mutation	SNP	T	C	C	rs79703886	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108214751T>C	uc003psc.3	-	16	1878	c.1609A>G	c.(1609-1611)ACA>GCA	p.T537A	SEC63_uc003psb.3_Missense_Mutation_p.T397A	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	537	SEC63 1.|Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		AGCACAGGTGTAGGTTTTTTT	0.323													3	172	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74298857	74298857	+	RNA	SNP	T	C	C	rs148673816	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74298857T>C	uc011kfj.1	-	6		c.810A>G						P0CL84	ST3L2_HUMAN	Homo sapiens cDNA FLJ76564 complete cds.							nucleus	binding				0						CTCTCCTGCATATCACCCAGG	0.378													3	8	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131172448	131172448	+	Silent	SNP	T	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131172448T>G	uc011kpm.1	+	18	2233	c.2169T>G	c.(2167-2169)ACT>ACG	p.T723T	MKLN1_uc011kpl.1_Silent_p.T700T|MKLN1_uc003vqs.2_Silent_p.T516T|MKLN1_uc003vqu.2_3'UTR	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	723					signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					ACAGCATGACTCCTCCTAAAG	0.433													12	56	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131172449	131172449	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131172449C>A	uc011kpm.1	+	18	2234	c.2170C>A	c.(2170-2172)CCT>ACT	p.P724T	MKLN1_uc011kpl.1_Missense_Mutation_p.P701T|MKLN1_uc003vqs.2_Missense_Mutation_p.P517T|MKLN1_uc003vqu.2_3'UTR	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	724					signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					CAGCATGACTCCTCCTAAAGG	0.433													12	56	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52320734	52320734	+	Silent	SNP	G	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52320734G>T	uc003xqu.3	-	17	3551	c.3450C>A	c.(3448-3450)ATC>ATA	p.I1150I	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1150					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CATATGGTGGGATCCCGTGGT	0.448													20	163	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144940706	144940706	+	Missense_Mutation	SNP	C	T	T	rs112377501		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940706C>T	uc003zaa.1	-	2	14739	c.14726G>A	c.(14725-14727)CGC>CAC	p.R4909H		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	4909	Plectin 61.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCTCCTGGCGGCCGGGCTG	0.701													13	125	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	69634783	69634783	+	RNA	SNP	G	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69634783G>T	uc004afu.3	-	3		c.288C>A								Homo sapiens aquaporin 7 pseudogene 2, mRNA (cDNA clone IMAGE:30406582).																		GTGCTGGGTTGTTCTCCTGGT	0.577													5	27	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85597623	85597623	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85597623G>A	uc004amo.1	-	17	2453	c.2192C>T	c.(2191-2193)TCA>TTA	p.S731L		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	731					protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						CATCTGTGGTGACTTTTTGGA	0.358													22	178	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	118950296	118950296	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118950296G>A	uc004bjn.2	+	2	1660	c.1279G>A	c.(1279-1281)GAG>AAG	p.E427K	PAPPA_uc011lxp.1_Missense_Mutation_p.E220K|PAPPA_uc011lxq.1_Missense_Mutation_p.E220K	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	427	Metalloprotease.				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						CTGTGACCCCGAGTGCAACCA	0.632													4	61	---	---	---	---	PASS
NR6A1	2649	broad.mit.edu	37	9	127316735	127316735	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127316735C>T	uc004bor.1	-	3	435	c.257G>A	c.(256-258)CGG>CAG	p.R86Q	NR6A1_uc004boq.1_Missense_Mutation_p.R82Q|NR6A1_uc010mwq.1_Missense_Mutation_p.R82Q	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	86	Nuclear receptor.				cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						GCAAATGCTCCGCTTGAAAAA	0.527													12	111	---	---	---	---	PASS
IFIT1	3434	broad.mit.edu	37	10	91162497	91162497	+	Silent	SNP	A	G	G	rs303211	byFrequency	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91162497A>G	uc001kgi.2	+	2	613	c.465A>G	c.(463-465)AAA>AAG	p.K155K	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|IFIT1_uc009xtt.2_Silent_p.K155K|IFIT1_uc001kgj.2_Silent_p.K124K	NM_001548	NP_001539	P09914	IFIT1_HUMAN	interferon-induced protein with	155	TPR 3.				cellular response to exogenous dsRNA|intracellular transport of viral proteins in host cell|negative regulation of defense response to virus by host|negative regulation of helicase activity|negative regulation of protein binding|negative regulation of viral genome replication|positive regulation of viral genome replication|response to virus|type I interferon-mediated signaling pathway	cytoplasm	protein binding				0						GTGGAGGAAAAAATTATGAAC	0.488													3	134	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94390060	94390060	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94390060A>G	uc001kic.2	+	12	1741	c.1433A>G	c.(1432-1434)GAA>GGA	p.E478G	KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	478	Potential.				blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						CTTGTTAAAGAAGAATATATC	0.343													7	46	---	---	---	---	PASS
COL17A1	1308	broad.mit.edu	37	10	105798253	105798253	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105798253G>A	uc001kxr.2	-	45	3150	c.2981C>T	c.(2980-2982)CCG>CTG	p.P994L		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	994	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCCCTGGCGGGCCTGACAC	0.597													23	165	---	---	---	---	PASS
ARHGAP20	57569	broad.mit.edu	37	11	110450382	110450382	+	Silent	SNP	C	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110450382C>T	uc001pkz.1	-	16	3573	c.3288G>A	c.(3286-3288)AGG>AGA	p.R1096R	ARHGAP20_uc001pky.1_Silent_p.R1073R|ARHGAP20_uc009yyb.1_Silent_p.R1060R|ARHGAP20_uc001pla.1_Silent_p.R1060R|ARHGAP20_uc001plb.2_Silent_p.R639R	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1096					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CTTCAGCTGCCCTTAAGGGCA	0.522													4	139	---	---	---	---	PASS
PANX3	116337	broad.mit.edu	37	11	124481615	124481615	+	Missense_Mutation	SNP	G	A	A	rs142639637	byFrequency	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124481615G>A	uc001qah.2	+	1	163	c.163G>A	c.(163-165)GCC>ACC	p.A55T		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	55	Helical; (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CCTGGCATTCGCCCAGGAGTT	0.587													14	37	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9574030	9574030	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9574030T>G	uc010sgs.1	-	20	2201	c.2006A>C	c.(2005-2007)AAC>ACC	p.N669T	DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						TAGCGGCTGGTTGGAGACCCC	0.597													9	87	---	---	---	---	PASS
RERG	85004	broad.mit.edu	37	12	15261984	15261984	+	3'UTR	SNP	G	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15261984G>T	uc001rcs.2	-	4					RERG_uc001rct.2_3'UTR|RERG_uc010shu.1_3'UTR	NM_032918	NP_116307	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor						negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity			lung(1)	1						TTTTATTTTTGAAAGGGGAAC	0.418													9	92	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46243943	46243943	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46243943A>T	uc001ros.1	+	15	2037	c.2037A>T	c.(2035-2037)CAA>CAT	p.Q679H	ARID2_uc001ror.2_Missense_Mutation_p.Q679H|ARID2_uc009zkg.1_Missense_Mutation_p.Q135H|ARID2_uc009zkh.1_Missense_Mutation_p.Q306H|ARID2_uc001rou.1_Missense_Mutation_p.Q13H	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	679					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CTGTGGCACAAACTGTTTCAA	0.413													17	125	---	---	---	---	PASS
NAB2	4665	broad.mit.edu	37	12	57485457	57485457	+	Silent	SNP	T	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57485457T>C	uc001smz.2	+	2	1011	c.633T>C	c.(631-633)CCT>CCC	p.P211P		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	211					cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TCTCCCCCCCTGCAGGGGGAG	0.711													6	49	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547138	132547138	+	Silent	SNP	A	G	G	rs111782215	byFrequency	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547138A>G	uc001ujn.2	+	46	8261	c.8226A>G	c.(8224-8226)CAA>CAG	p.Q2742Q	EP400_uc001ujl.2_Silent_p.Q2741Q|EP400_uc001ujm.2_Silent_p.Q2661Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2778	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacagcagcagc	0.328													3	75	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49076874	49076874	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49076874C>A	uc001vch.2	-	11	1474	c.1103G>T	c.(1102-1104)CGC>CTC	p.R368L	RCBTB2_uc010tgg.1_Missense_Mutation_p.R373L|RCBTB2_uc001vci.2_Missense_Mutation_p.R344L|RCBTB2_uc010tgh.1_Missense_Mutation_p.R94L|RCBTB2_uc001vcj.2_Missense_Mutation_p.R320L|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_3'UTR	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	368	RCC1 6.						Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		GGAGAGGAGGCGCCACGTGAC	0.577													15	106	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76407282	76407282	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76407282C>A	uc001vjv.2	+	13	3106	c.2346C>A	c.(2344-2346)TTC>TTA	p.F782L	LMO7_uc010thv.1_Missense_Mutation_p.F733L|LMO7_uc001vjt.1_Missense_Mutation_p.F681L|LMO7_uc010thw.1_Missense_Mutation_p.F632L|LMO7_uc001vjw.1_Missense_Mutation_p.F688L	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	1067	PDZ.					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CTGGGATCTTCGTAGCATCAG	0.403													3	50	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114780695	114780695	+	Silent	SNP	C	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114780695C>T	uc001vui.2	-	14	1526	c.1395G>A	c.(1393-1395)AAG>AAA	p.K465K	RASA3_uc010tkk.1_Silent_p.K433K|RASA3_uc001vuj.2_Silent_p.K82K	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	465	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CCTGGAAGCGCTTGGCCGCCG	0.627													5	145	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41634587	41634587	+	Missense_Mutation	SNP	A	G	G	rs7178634	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41634587A>G	uc001zns.3	+	2	327	c.97A>G	c.(97-99)ACC>GCC	p.T33A	NUSAP1_uc001znq.3_5'UTR|NUSAP1_uc001znr.3_Missense_Mutation_p.T33A|NUSAP1_uc010bce.2_Missense_Mutation_p.T33A|NUSAP1_uc001znt.3_Missense_Mutation_p.T33A|NUSAP1_uc001znv.3_Missense_Mutation_p.T33A|NUSAP1_uc001znu.3_Missense_Mutation_p.T33A|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_5'UTR	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	33					cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CTTGCAGGCAACCAAGTTGTT	0.318													5	11	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41634588	41634588	+	Missense_Mutation	SNP	C	A	A	rs7178777	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41634588C>A	uc001zns.3	+	2	328	c.98C>A	c.(97-99)ACC>AAC	p.T33N	NUSAP1_uc001znq.3_5'UTR|NUSAP1_uc001znr.3_Missense_Mutation_p.T33N|NUSAP1_uc010bce.2_Missense_Mutation_p.T33N|NUSAP1_uc001znt.3_Missense_Mutation_p.T33N|NUSAP1_uc001znv.3_Missense_Mutation_p.T33N|NUSAP1_uc001znu.3_Missense_Mutation_p.T33N|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_5'UTR	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	33					cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		TTGCAGGCAACCAAGTTGTTA	0.323													5	11	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79291122	79291122	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79291122C>A	uc002beq.2	-	19	3215	c.2840G>T	c.(2839-2841)CGC>CTC	p.R947L	RASGRF1_uc002bep.2_Missense_Mutation_p.R931L|RASGRF1_uc010blm.1_Missense_Mutation_p.R856L|RASGRF1_uc002ber.3_Missense_Mutation_p.R931L|RASGRF1_uc010unh.1_Missense_Mutation_p.R342L|RASGRF1_uc002beo.2_Missense_Mutation_p.R163L	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	949					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GGCTGCTCTGCGGATCACAAA	0.612													13	69	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74336163	74336163	+	Silent	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74336163G>A	uc002fcq.2	+	5	543	c.411G>A	c.(409-411)GCG>GCA	p.A137A	PSMD7_uc010vmr.1_Silent_p.A60A	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7	137					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						CTACAGAAGCGTACATTTCAG	0.433													11	116	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48270010	48270010	+	Silent	SNP	G	A	A	rs140024722		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48270010G>A	uc002iqm.2	-	28	2046	c.1920C>T	c.(1918-1920)CCC>CCT	p.P640P		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	640	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	CCTGGAATCCGGGGGAGCCAG	0.602			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						19	166	---	---	---	---	PASS
ZNF585B	92285	broad.mit.edu	37	19	37677246	37677246	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37677246G>C	uc002ofq.2	-	5	1447	c.1193C>G	c.(1192-1194)ACA>AGA	p.T398R	uc002ofp.1_5'Flank|ZNF585B_uc002ofr.1_Missense_Mutation_p.T212R	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B	398	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGATGCACTGTGAGTGCTGA	0.413													3	91	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	C	C	rs145412486	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628236G>C	uc010ztl.1	+	3	180	c.148G>C	c.(148-150)GCT>CCT	p.A50P	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A2P					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGGGAAAATGGCTTTGTTGGC	0.333													3	92	---	---	---	---	PASS
DSN1	79980	broad.mit.edu	37	20	35399437	35399437	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35399437C>T	uc010gfr.2	-	3	567	c.194G>A	c.(193-195)TGT>TAT	p.C65Y	DSN1_uc002xfz.2_Missense_Mutation_p.C65Y|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Missense_Mutation_p.C65Y|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Missense_Mutation_p.C49Y|DSN1_uc002xgb.2_Missense_Mutation_p.C49Y	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,	65					cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				GCTGAGATCACAATTTCCCCC	0.478													11	186	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23264852	23264852	+	RNA	SNP	G	A	A	rs143968317	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23264852G>A	uc011aim.1	+	379		c.16673G>A								Parts of antibodies, mostly variable regions.												0						GGTGTGTCTCGTAAGTGACTT	0.607													8	77	---	---	---	---	PASS
SUSD2	56241	broad.mit.edu	37	22	24581177	24581177	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24581177G>C	uc002zzn.1	+	6	942	c.898G>C	c.(898-900)GAG>CAG	p.E300Q		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	300	AMOP.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						GGAGGAGCTGGAGGATCAGCT	0.672													10	46	---	---	---	---	PASS
TDGF3	6998	broad.mit.edu	37	X	109764689	109764689	+	RNA	SNP	G	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109764689G>A	uc004eos.1	+	1		c.1150G>A				NR_002718				Human (clone CR-3) teratocarcinoma-derived growth factor 3 (TDGF3) mRNA, complete cds.												0						CACGATGTGCGCAAAGAGAAC	0.572													20	40	---	---	---	---	PASS
NADK	65220	broad.mit.edu	37	1	1688587	1688588	+	Intron	INS	-	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1688587_1688588insC	uc009vkw.2	-						NADK_uc001aic.2_Intron|NADK_uc001aid.3_Intron|NADK_uc001aie.2_Frame_Shift_Ins_p.G246fs|NADK_uc010nyv.1_Intron|NADK_uc009vkx.1_Intron	NM_023018	NP_075394	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process|NAD metabolic process|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|NAD+ kinase activity|protein binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		CTCCATGTGCACCCCAGGCCCC	0.634													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61546218	61546218	+	Intron	DEL	A	-	-	rs35281857		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61546218delA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AAAAACTGTCAAAAAAAAAAA	0.299													4	2	---	---	---	---	
ACTR3	10096	broad.mit.edu	37	2	114699661	114699661	+	Intron	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114699661delT	uc002tkx.1	+						ACTR3_uc010yyc.1_Intron|ACTR3_uc010yyd.1_Intron	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog						cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						TTCTGAAGAGTTTTTTTTTTT	0.249													4	2	---	---	---	---	
STK36	27148	broad.mit.edu	37	2	219540243	219540243	+	Intron	DEL	C	-	-	rs33970984		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219540243delC	uc002viu.2	+						STK36_uc002viv.2_Intron	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36						cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		CACACGGAATCtttttttttt	0.259													50	7	---	---	---	---	
MLPH	79083	broad.mit.edu	37	2	238419911	238419912	+	Intron	DEL	TT	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238419911_238419912delTT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TTCTGGCTGCtttttttttttt	0.104													4	2	---	---	---	---	
APPL1	26060	broad.mit.edu	37	3	57269427	57269427	+	Intron	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57269427delA	uc003dio.2	+						APPL1_uc010hnb.2_Intron|APPL1_uc011bey.1_Intron	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH						apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		AACTAAGAACAAAAAAAAAAG	0.279													4	2	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153842161	153842162	+	Intron	INS	-	TTTT	TTTT	rs66618151		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153842161_153842162insTTTT	uc011bog.1	+						SGEF_uc011boh.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTGCttttccttttttttttt	0.248													6	3	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180372433	180372434	+	Intron	INS	-	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180372433_180372434insA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			aaagaaaaaggaaaaaaaaaaa	0.302													5	4	---	---	---	---	
CCDC158	339965	broad.mit.edu	37	4	77272457	77272457	+	Intron	DEL	A	-	-	rs112268994		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272457delA	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						TGTACGATTTAAAAAAAAAAC	0.174													4	4	---	---	---	---	
FAM153B	202134	broad.mit.edu	37	5	175524560	175524560	+	Intron	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175524560delA	uc003mdk.2	+						FAM153B_uc010jjy.1_Intron	NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134											ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		atttcatctcaaaaaaaaaaa	0.179													6	3	---	---	---	---	
BTNL9	153579	broad.mit.edu	37	5	180486891	180486892	+	3'UTR	INS	-	G	G	rs151240170	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180486891_180486892insG	uc003mmt.2	+	11						NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor							integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACTGGCCCCGGGGGGCCCCC	0.683													7	4	---	---	---	---	
HLA-A	3105	broad.mit.edu	37	6	29911457	29911458	+	Intron	INS	-	T	T	rs140855897	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911457_29911458insT	uc003nol.2	+						HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Intron|HLA-A_uc003nok.2_Intron|HLA-A_uc003non.2_Intron|HLA-A_uc003noo.2_Intron|HLA-A_uc010jrr.2_Intron|HLA-A_uc003nom.2_Intron|HLA-A_uc010klp.2_Intron|HLA-A_uc011dmc.1_Intron|HLA-A_uc011dmd.1_Intron	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ATCCTCCTGGGTTCCAGATCCT	0.545									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			4	2	---	---	---	---	
PHF3	23469	broad.mit.edu	37	6	64356299	64356299	+	Intron	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64356299delT	uc003pen.2	+						PHF3_uc010kaf.1_Intron|PHF3_uc003pem.2_Intron|PHF3_uc010kag.1_Intron|PHF3_uc010kah.1_Intron|PHF3_uc011dxs.1_Intron|PHF3_uc003peo.2_Intron			Q92576	PHF3_HUMAN	RecName: Full=PHD finger protein 3;						multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CAAGTGAGGATTTTTTTTTTA	0.249													4	2	---	---	---	---	
FAM135A	57579	broad.mit.edu	37	6	71232015	71232020	+	Intron	DEL	TTTATA	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71232015_71232020delTTTATA	uc003pfj.2	+						FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfk.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_5'Flank|FAM135A_uc003pfo.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c											central_nervous_system(1)	1						ATCATAATAGTTTATATTTATATATG	0.252													4	5	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90409616	90409616	+	Intron	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90409616delA	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAAAACTAGTAAAAAAAAAAC	0.338													4	2	---	---	---	---	
HDAC2	3066	broad.mit.edu	37	6	114266377	114266377	+	Intron	DEL	G	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114266377delG	uc003pwd.1	-						HDAC2_uc003pwc.1_Intron|HDAC2_uc003pwe.1_Intron	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2						blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	aaaaaaAAAAGAATAATCAGT	0.129													6	3	---	---	---	---	
RAC1	5879	broad.mit.edu	37	7	6439959	6439959	+	Intron	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6439959delT	uc003spx.2	+						RAC1_uc003spw.2_Intron	NM_006908	NP_008839	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)	CATGATTGGGttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64039219	64039219	+	Intron	DEL	T	-	-	rs151239431		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64039219delT	uc003ttc.1	+											Homo sapiens cDNA FLJ43440 fis, clone OCBBF2030517.																		CCTTTTTAGAttttttttttt	0.264													5	3	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92140456	92140456	+	Intron	DEL	T	-	-	rs34961886		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92140456delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AGTTAAAGACttttttttttt	0.114													6	3	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108151485	108151485	+	Intron	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108151485delA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						CTCAAATTGGAAAAAAAAAAA	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	130525844	130525844	+	IGR	DEL	C	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130525844delC								KLF14 (106984 upstream) : MIR29A (35662 downstream)																							CAGttctttgctttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142021522	142021523	+	Intron	DEL	CA	-	-	rs72430962		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142021522_142021523delCA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TTCTGCAACTCAGGGCTGGGGA	0.520													2	5	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66499823	66499824	+	Frame_Shift_Ins	INS	-	TC	TC			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499823_66499824insTC	uc004aee.1	+	1	633_634	c.633_634insTC	c.(631-636)TATACAfs	p.Y211fs	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						CCACCTTCTATACAGTTATGCG	0.599													80	8	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69391298	69391299	+	Intron	INS	-	TA	TA			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69391298_69391299insTA	uc004afn.2	+						ANKRD20A4_uc010mnw.1_Intron	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						CTACTCCATCTTATACATTAGG	0.317													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99685055	99685056	+	IGR	INS	-	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99685055_99685056insA								LOC441454 (12319 upstream) : FAM22G (5536 downstream)																							gactccgtctcaaaaaaaaaaa	0.178													6	3	---	---	---	---	
PKN3	29941	broad.mit.edu	37	9	131478876	131478876	+	Intron	DEL	C	-	-	rs10819432	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131478876delC	uc004bvw.2	+						PKN3_uc010myh.2_Intron|PKN3_uc011mbk.1_Intron	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						gactgtgtctcaaaaaaaaaa	0.229													9	5	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598532	131598533	+	Intron	INS	-	TT	TT			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598532_131598533insTT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	ttccttctttctctctctctct	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42597576	42597576	+	IGR	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42597576delT								None (None upstream) : LOC441666 (229739 downstream)																							aatggattcattgaatggaat	0.000													4	2	---	---	---	---	
GFRA1	2674	broad.mit.edu	37	10	117849200	117849201	+	Intron	INS	-	C	C			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117849200_117849201insC	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)		CCCGTGTTTCACCCCCCCACCA	0.485													148	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9681924	9681924	+	IGR	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9681924delA								WEE1 (70613 upstream) : SWAP70 (3704 downstream)																							acttcgtctcaaaaaaaaaaa	0.209													6	4	---	---	---	---	
SF3B2	10992	broad.mit.edu	37	11	65825443	65825444	+	Intron	INS	-	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65825443_65825444insA	uc001ogy.1	+							NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2						interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						aactccgtctcaaaaaaaaaaa	0.183													4	2	---	---	---	---	
CORO1B	57175	broad.mit.edu	37	11	67207355	67207355	+	Intron	DEL	C	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67207355delC	uc001olj.1	-						PTPRCAP_uc001oli.1_5'Flank|CORO1B_uc009yrs.1_Intron|CORO1B_uc001olk.1_Intron|CORO1B_uc009yrt.1_Intron|CORO1B_uc009yru.1_Intron|CORO1B_uc001oll.1_Intron	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			ACCCTCACCGCCCCCCCCACC	0.637													4	2	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74980343	74980343	+	Intron	DEL	C	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74980343delC	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TGCCCTGGGACCCCCCCCCAC	0.682													4	3	---	---	---	---	
CCDC90B	60492	broad.mit.edu	37	11	82989634	82989635	+	Intron	INS	-	T	T			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82989634_82989635insT	uc001pae.2	-						CCDC90B_uc001pac.2_Intron|CCDC90B_uc001pad.2_Intron|CCDC90B_uc001paf.2_Intron	NM_021825	NP_068597	Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B precursor							integral to membrane|mitochondrion|mitochondrion					0		Acute lymphoblastic leukemia(157;0.103)				TTTATTCAATGTTTTTTTTTGT	0.327													4	3	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118243701	118243701	+	Intron	DEL	A	-	-	rs34104337		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118243701delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		ccccagctctaaaaaaaaaaa	0.139													6	3	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	415910	415910	+	Intron	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:415910delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						ctccatctccaaaaaaaaaaa	0.124			T 	NUP98	AML								5	3	---	---	---	---	
PSPC1	55269	broad.mit.edu	37	13	20279633	20279634	+	Intron	INS	-	A	A			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20279633_20279634insA	uc001uml.2	-						PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		ctctctgtctcaaaaaaaaaaa	0.129													3	3	---	---	---	---	
DCAF4	26094	broad.mit.edu	37	14	73412936	73412937	+	Intron	DEL	AA	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73412936_73412937delAA	uc001xng.2	+						DCAF4_uc001xnj.2_Intron|DCAF4_uc010ttr.1_Intron|DCAF4_uc001xnh.2_Intron|DCAF4_uc010tts.1_Intron|DCAF4_uc010ttt.1_Intron|DCAF4_uc001xni.2_Intron|DCAF4_uc001xnk.2_Intron	NM_015604	NP_056419	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4 isoform 1							CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)|skin(1)	3						ttgtctctacaaaaaaaaaaaa	0.045													4	2	---	---	---	---	
TTLL5	23093	broad.mit.edu	37	14	76420617	76420619	+	Intron	DEL	AAG	-	-	rs145807913		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76420617_76420619delAAG	uc001xrx.2	+						TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		aaaaaaaaaaaagagctttccac	0.030													4	2	---	---	---	---	
GTF2A1	2957	broad.mit.edu	37	14	81686923	81686923	+	5'UTR	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81686923delA	uc001xvf.1	-	1					GTF2A1_uc010atb.1_5'UTR|GTF2A1_uc001xvg.1_Intron|GTF2A1_uc001xvh.1_Intron|uc001xvj.2_5'Flank	NM_015859	NP_056943	P52655	TF2AA_HUMAN	TFIIA alpha, p55 isoform 1						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)		AAACAAAACCAAAAAAAAAAA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95516588	95516610	+	IGR	DEL	GGAAGGAAGGAAGGAAAGAAGAA	-	-	rs36211516		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95516588_95516610delGGAAGGAAGGAAGGAAAGAAGAA								GSC (280089 upstream) : DICER1 (35955 downstream)																							aagaaggaagggaaggaaggaaggaaagaagaaggaaggaagg	0.063													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107130970	107130971	+	Intron	INS	-	TC	TC	rs1964192	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107130970_107130971insTC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TGCCGCTGATTCCCCCAACGTT	0.604													40	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22691260	22691260	+	IGR	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22691260delT								MIR1268 (177980 upstream) : GOLGA8DP (11025 downstream)																							GGTTGCTTCATCTAGGAGAAG	0.473													4	3	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99459491	99459491	+	Intron	DEL	T	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99459491delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron|IGF1R_uc010urr.1_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TATCTTCTGGttttttttttt	0.224													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													5	5	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76445728	76445740	+	Intron	DEL	GCCACCACTCCCT	-	-	rs6501214	by1000genomes	TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76445728_76445740delGCCACCACTCCCT	uc010dhp.1	-						DNAH17_uc002jvq.2_5'UTR|DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACCACTCCCCGCCACCACTCCCTGCCACCTGTG	0.404													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36913800	36913800	+	IGR	DEL	A	-	-			TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36913800delA								ZFP82 (4250 upstream) : ZNF566 (22222 downstream)																							CTTTGTCATTAAAAAAAAAAA	0.194													6	3	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49963971	49963972	+	Intron	INS	-	T	T	rs35639941		TCGA-G9-6336-01A-11D-1786-08	TCGA-G9-6336-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963971_49963972insT	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		acacccggccattttttttttt	0.005													4	3	---	---	---	---	
