Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
LRP8	7804	broad.mit.edu	37	1	53728131	53728131	+	Silent	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53728131G>A	uc001cvi.1	-	11	1903	c.1761C>T	c.(1759-1761)AAC>AAT	p.N587N	LRP8_uc001cvh.1_Silent_p.N140N|LRP8_uc001cvk.1_Silent_p.N417N|LRP8_uc001cvj.1_Silent_p.N587N|LRP8_uc001cvl.1_Silent_p.N458N|LRP8_uc001cvm.1_Silent_p.N172N	NM_004631	NP_004622	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein	587	LDL-receptor class B 3.|Extracellular (Potential).				cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0						GGGTGATTCCGTTGGGCCATT	0.537													5	206	---	---	---	---	PASS
PRKAA2	5563	broad.mit.edu	37	1	57173364	57173364	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57173364T>A	uc001cyk.3	+	9	1708	c.1637T>A	c.(1636-1638)CTG>CAG	p.L546Q		NM_006252	NP_006243	P54646	AAPK2_HUMAN	AMP-activated protein kinase alpha 2 catalytic	546					carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6						TGTGCCAGTCTGATTACTACT	0.388													4	142	---	---	---	---	PASS
GSTM5	2949	broad.mit.edu	37	1	110257972	110257972	+	Intron	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110257972C>T	uc001dyn.2	+						GSTM5_uc010ovu.1_Missense_Mutation_p.T185M	NM_000851	NP_000842	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity			central_nervous_system(6)	6		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	gtattgagtacgggcttcatg	0.184													6	6	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152185882	152185882	+	Silent	SNP	G	A	A	rs41266126	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152185882G>A	uc001ezt.1	-	3	8299	c.8223C>T	c.(8221-8223)GGC>GGT	p.G2741G		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2741	30.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAAGACTGGCCTGTGCTAG	0.577													5	46	---	---	---	---	PASS
TDRD10	126668	broad.mit.edu	37	1	154520110	154520110	+	3'UTR	SNP	G	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154520110G>C	uc009wow.2	+	12					TDRD10_uc001ffd.2_Intron|TDRD10_uc001ffe.2_Intron	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a								nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GAACTGGCTCGGGTGGGCCTT	0.507													6	49	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158637764	158637764	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158637764T>C	uc001fst.1	-	15	2121	c.1922A>G	c.(1921-1923)CAG>CGG	p.Q641R		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	641	Spectrin 7.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GCCAGTTTTCTGTATGTTTTC	0.468													12	130	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167095421	167095421	+	Silent	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167095421C>T	uc001geb.1	+	5	1053	c.1053C>T	c.(1051-1053)TAC>TAT	p.Y351Y		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	351					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						AGAAACTGTACGAGCAGTGGA	0.662													5	18	---	---	---	---	PASS
OR2M1P	388762	broad.mit.edu	37	1	248285934	248285934	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248285934G>A	uc001idy.1	+	1	497	c.497G>A	c.(496-498)CGT>CAT	p.R166H		NR_002141				RecName: Full=Olfactory receptor 2M5;												0						GGAGAGGGTCGTCGCAAAGCT	0.468													24	249	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343988	248343988	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343988G>A	uc010pzf.1	+	1	701	c.701G>A	c.(700-702)CGT>CAT	p.R234H		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAGAGGGTCGTTGCAAAGCT	0.468													35	79	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685462	248685462	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685462G>A	uc001ien.1	+	1	515	c.515G>A	c.(514-516)CGC>CAC	p.R172H		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGGTCATCGCACACTGGAT	0.552													4	66	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95514946	95514946	+	RNA	SNP	C	T	T	rs143937878	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95514946C>T	uc010fhp.2	-	4		c.505G>A				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						ACTACTGTACCGTCTCAGCCT	0.308													4	228	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179432336	179432336	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179432336G>A	uc010zfg.1	-	275	71043	c.70819C>T	c.(70819-70821)CCC>TCC	p.P23607S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P17302S|TTN_uc010zfi.1_Missense_Mutation_p.P17235S|TTN_uc010zfj.1_Missense_Mutation_p.P17110S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24534							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCAGAGGGTTTACTTATT	0.388													6	92	---	---	---	---	PASS
TKT	7086	broad.mit.edu	37	3	53263147	53263147	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53263147T>A	uc003dgo.2	-	10	1381	c.1271A>T	c.(1270-1272)GAC>GTC	p.D424V	TKT_uc003dgp.2_Missense_Mutation_p.D56V|TKT_uc011beo.1_Missense_Mutation_p.D377V|TKT_uc003dgq.2_Missense_Mutation_p.D424V|TKT_uc011beq.1_Missense_Mutation_p.D432V|TKT_uc011ber.1_Missense_Mutation_p.D226V|TKT_uc011bep.1_Missense_Mutation_p.D341V	NM_001135055	NP_001128527	P29401	TKT_HUMAN	transketolase isoform 1	424					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|transketolase activity			ovary(2)	2		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)	Thiamine(DB00152)	GGAGGGCCCGTCTTCCCCTGG	0.572													5	157	---	---	---	---	PASS
CEP97	79598	broad.mit.edu	37	3	101450746	101450746	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101450746A>T	uc003dvk.1	+	5	537	c.510A>T	c.(508-510)AGA>AGT	p.R170S	CEP97_uc010hpm.1_Missense_Mutation_p.R136S|CEP97_uc011bhf.1_Missense_Mutation_p.R170S|CEP97_uc003dvl.1_5'UTR|CEP97_uc003dvm.1_Missense_Mutation_p.R8S	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	170						centrosome|nucleus	protein binding			ovary(2)	2						ACCTACCCAGAAGTCTTGCTA	0.373													7	140	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155506852	155506852	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155506852A>G	uc003iod.1	-	5	1787	c.1729T>C	c.(1729-1731)TCA>CCA	p.S577P	FGA_uc003ioe.1_Missense_Mutation_p.S577P|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	577	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CTGTAACTTGAAGATTTACCA	0.443													25	82	---	---	---	---	PASS
BRD9	65980	broad.mit.edu	37	5	889273	889273	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:889273G>A	uc003jbq.2	-	5	636	c.469C>T	c.(469-471)CCC>TCC	p.P157S	BRD9_uc003jbl.2_Missense_Mutation_p.P41S|BRD9_uc003jbm.2_RNA|BRD9_uc003jbn.2_RNA|BRD9_uc011cmb.1_Missense_Mutation_p.P104S|BRD9_uc003jbo.2_Missense_Mutation_p.P41S|BRD9_uc011cmc.1_RNA	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1	157	Bromo.						nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			AATCCATGGGGATCTTTTCTG	0.343													13	15	---	---	---	---	PASS
PIK3R1	5295	broad.mit.edu	37	5	67522457	67522457	+	5'UTR	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67522457C>A	uc003jva.2	+	2					PIK3R1_uc003jvb.2_5'Flank	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding			endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AATCAGACTGCTCTGTACAAC	0.408			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			4	18	---	---	---	---	PASS
GFM2	84340	broad.mit.edu	37	5	74056731	74056731	+	Silent	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74056731T>C	uc003kdh.1	-	3	448	c.144A>G	c.(142-144)CTA>CTG	p.L48L	GFM2_uc003kdi.1_Silent_p.L48L|GFM2_uc010izj.1_Silent_p.L80L|GFM2_uc010izk.1_RNA|GFM2_uc003kdj.1_Silent_p.L48L|GFM2_uc010izl.1_Silent_p.L48L	NM_032380	NP_115756	Q969S9	RRF2M_HUMAN	mitochondrial elongation factor G2 isoform 1	48					mitochondrial translation|ribosome disassembly	mitochondrion	GTP binding|GTPase activity				0		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		TTGTACCTGGTAGAGAACTGC	0.338													6	174	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140516811	140516811	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140516811G>A	uc003liq.2	+	1	2012	c.1795G>A	c.(1795-1797)GCC>ACC	p.A599T		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	599	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCCAGAACGCCTGGCTGTC	0.716													20	62	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590277	140590277	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590277G>A	uc003liz.2	+	1	1987	c.1798G>A	c.(1798-1800)GCC>ACC	p.A600T	PCDHB12_uc011dak.1_Missense_Mutation_p.A263T	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	600	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCCAGAACGCCTGGCTGTC	0.716													7	234	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158204425	158204425	+	Silent	SNP	A	G	G	rs1368298	byFrequency	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158204425A>G	uc010jip.2	-	10	1334	c.1032T>C	c.(1030-1032)TAT>TAC	p.Y344Y	EBF1_uc011ddw.1_Silent_p.Y212Y|EBF1_uc011ddx.1_Silent_p.Y345Y|EBF1_uc003lxl.3_Silent_p.Y313Y	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	344	IPT/TIG.				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTTACCTGTATAAATGAATC	0.458			T	HMGA2	lipoma								4	122	---	---	---	---	PASS
GCNT2	2651	broad.mit.edu	37	6	10586319	10586319	+	Intron	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10586319T>C	uc010joo.2	+						GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Intron|GCNT2_uc003mzd.2_Intron|GCNT2_uc003mze.2_Missense_Mutation_p.Y33H	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GCCAAAAAGTTATGAGAAGCT	0.388													4	156	---	---	---	---	PASS
HIST1H3C	8352	broad.mit.edu	37	6	26046086	26046086	+	3'UTR	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26046086C>T	uc003nfv.2	+	1					HIST1H2BB_uc003nfu.2_5'Flank	NM_003531	NP_003522	P68431	H31_HUMAN	histone cluster 1, H3c						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						AGGCTCTTTTCAGAGCCACTC	0.443													5	21	---	---	---	---	PASS
OPN5	221391	broad.mit.edu	37	6	47763181	47763181	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47763181C>T	uc003ozc.2	+	4	643	c.638C>T	c.(637-639)GCT>GTT	p.A213V	OPN5_uc003ozd.2_Missense_Mutation_p.A48V	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	213	Helical; Name=5; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1						CTCCCAACGGCTGTGATCGTG	0.542													32	80	---	---	---	---	PASS
GCK	2645	broad.mit.edu	37	7	44185094	44185094	+	Splice_Site	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44185094A>G	uc003tkl.2	-	9	1723	c.1253_splice	c.e9+1	p.S418_splice	GCK_uc003tkh.1_Splice_Site_p.S91_splice|GCK_uc003tki.1_Intron|GCK_uc003tkj.1_Splice_Site_p.S417_splice|GCK_uc003tkk.1_Splice_Site_p.S419_splice	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1						cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						GGGCGGGCTCACCTGGGGTGC	0.627													3	9	---	---	---	---	PASS
METTL2B	55798	broad.mit.edu	37	7	128119379	128119379	+	Missense_Mutation	SNP	T	C	C	rs2896399		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128119379T>C	uc003vnf.2	+	3	407	c.370T>C	c.(370-372)TGT>CGT	p.C124R	METTL2B_uc003vng.2_Missense_Mutation_p.C59R|METTL2B_uc011kop.1_5'UTR	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B	124							methyltransferase activity			skin(1)	1						GAGTGAAGTATGTGAATGTAG	0.408													3	59	---	---	---	---	PASS
ATP6V1F	9296	broad.mit.edu	37	7	128503029	128503029	+	Missense_Mutation	SNP	G	A	A	rs10958		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128503029G>A	uc003voc.1	+	1	132	c.71G>A	c.(70-72)GGC>GAC	p.G24D	KCP_uc003vob.1_RNA	NM_004231	NP_004222	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kD, V1	24					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|membrane fraction|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATPase activity, uncoupled|hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						CTGCTGGGCGGCATAGGGGAG	0.582											OREG0018299	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	99	---	---	---	---	PASS
DLGAP2	9228	broad.mit.edu	37	8	1626466	1626466	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1626466C>T	uc003wpl.2	+	9	2232	c.2135C>T	c.(2134-2136)ACG>ATG	p.T712M	DLGAP2_uc003wpm.2_Missense_Mutation_p.T698M	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	791					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CACATCACCACGGAGGACAAA	0.622													17	53	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68950516	68950516	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68950516A>T	uc003xxv.1	+	7	855	c.828A>T	c.(826-828)AAA>AAT	p.K276N	PREX2_uc003xxu.1_Missense_Mutation_p.K276N|PREX2_uc011lez.1_Missense_Mutation_p.K211N	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	276	PH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TGTACTGCAAAAGAAAACACA	0.333													14	33	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139642957	139642957	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139642957G>T	uc003yvd.2	-	50	4091	c.3644C>A	c.(3643-3645)CCA>CAA	p.P1215Q	COL22A1_uc011ljo.1_Missense_Mutation_p.P495Q	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1215	Pro-rich.|Gly-rich.|Collagen-like 11.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTGGATTCCTGGTGGTCCAGC	0.478										HNSCC(7;0.00092)			4	172	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	17131	17131	+	Silent	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17131G>A	uc010mgm.1	-	7	860	c.717C>T	c.(715-717)GGC>GGT	p.G239G	WASH5P_uc003zfr.2_RNA|WASH5P_uc011llq.1_RNA|WASH5P_uc003zfu.1_Silent_p.G252G	NM_182905	NP_878908			WAS protein family homolog 1												0						CAGGCACCTGGCCCAGGTCTG	0.597													3	33	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18504896	18504896	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18504896T>C	uc003zne.3	+	2	260	c.133T>C	c.(133-135)TGC>CGC	p.C45R	ADAMTSL1_uc003znb.2_Missense_Mutation_p.C45R|ADAMTSL1_uc003znc.3_Missense_Mutation_p.C45R	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	45	TSP type-1 1.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		ATGGAGTGAATGCTCACGCAC	0.607													11	98	---	---	---	---	PASS
DENND4C	55667	broad.mit.edu	37	9	19360324	19360324	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19360324C>A	uc003znq.2	+	24	4421	c.4388C>A	c.(4387-4389)TCT>TAT	p.S1463Y	DENND4C_uc011lnc.1_Missense_Mutation_p.S793Y|DENND4C_uc011lnd.1_Missense_Mutation_p.S751Y|DENND4C_uc003znr.2_Missense_Mutation_p.S751Y|DENND4C_uc003zns.2_Missense_Mutation_p.S645Y	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1463						integral to membrane				ovary(1)|skin(1)	2						GAACTTGAATCTTTGCTAGAA	0.378													4	146	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	117052373	117052373	+	Silent	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117052373A>G	uc011lxl.1	+	46	4242	c.4242A>G	c.(4240-4242)CCA>CCG	p.P1414P	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1414	Pro-rich.|Collagen-like 13.|Triple-helical region.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						CAGGGGCCCCAGGCCGGAGGG	0.642													3	89	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24508665	24508665	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24508665C>T	uc001iru.3	+	2	584	c.181C>T	c.(181-183)CGC>TGC	p.R61C	KIAA1217_uc001irs.2_5'UTR|KIAA1217_uc001irt.3_Missense_Mutation_p.R61C|KIAA1217_uc010qcy.1_Missense_Mutation_p.R61C|KIAA1217_uc010qcz.1_Missense_Mutation_p.R61C	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	61					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						CAAGTCTTCCCGCAATATCCC	0.498													12	57	---	---	---	---	PASS
OR4X1	390113	broad.mit.edu	37	11	48286184	48286184	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48286184A>G	uc010rht.1	+	1	772	c.772A>G	c.(772-774)AGG>GGG	p.R258G		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3						GGTCTATATTAGGCCCTGTGT	0.493													3	221	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	55064978	55064978	+	RNA	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55064978T>C	uc001nhl.1	-	2		c.445A>G								Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit20-11-30-F.																		GTTCTGGTGGTTTCCATGTTC	0.408													12	36	---	---	---	---	PASS
CLEC1A	51267	broad.mit.edu	37	12	10233907	10233907	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10233907T>A	uc001qxb.2	-	3	404	c.320A>T	c.(319-321)AAT>ATT	p.N107I	CLEC1A_uc009zhf.2_Missense_Mutation_p.N19I|CLEC1A_uc001qxc.2_Missense_Mutation_p.N19I|CLEC1A_uc001qxd.2_Missense_Mutation_p.N64I|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	107	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						AAGCTTTATATTCTGGACTTG	0.448													5	92	---	---	---	---	PASS
HTR7P1	93164	broad.mit.edu	37	12	13155157	13155157	+	RNA	SNP	T	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13155157T>G	uc010shq.1	+	1		c.1782T>G			HEBP1_uc001rbd.2_5'Flank|HEBP1_uc001rbf.2_5'Flank|HTR7P1_uc001rbh.2_Intron	NR_002774				Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 pseudogene (HTR7P), non-coding RNA.												0						CACGATTTACTCCACCGCAGT	0.478													3	13	---	---	---	---	PASS
ANAPC7	51434	broad.mit.edu	37	12	110815282	110815282	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110815282C>A	uc001tqo.2	-	9	1376	c.1375G>T	c.(1375-1377)GAG>TAG	p.E459*	ANAPC7_uc001tqp.3_Nonsense_Mutation_p.E459*	NM_016238	NP_057322	Q9UJX3	APC7_HUMAN	anaphase-promoting complex subunit 7 isoform a	459	TPR 5.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0						TTGGCTTTCTCCTGTGTCACT	0.418													4	123	---	---	---	---	PASS
RASAL1	8437	broad.mit.edu	37	12	113573237	113573237	+	Missense_Mutation	SNP	C	G	G	rs7960087	byFrequency	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113573237C>G	uc001tum.1	-	2	324	c.31G>C	c.(31-33)GTG>CTG	p.V11L	RASAL1_uc010syp.1_Missense_Mutation_p.V11L|RASAL1_uc001tul.2_Missense_Mutation_p.V11L|RASAL1_uc001tun.1_Missense_Mutation_p.V11L|RASAL1_uc010syq.1_Missense_Mutation_p.V11L|RASAL1_uc001tuo.3_Missense_Mutation_p.V11L|RASAL1_uc010syr.1_Missense_Mutation_p.V11L	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	11	C2 1.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						CCCTCCACCACGCGAACATTC	0.677													5	9	---	---	---	---	PASS
WSB2	55884	broad.mit.edu	37	12	118480735	118480735	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118480735C>A	uc001twr.2	-	4	568	c.470G>T	c.(469-471)AGA>ATA	p.R157I	WSB2_uc010sza.1_5'UTR|WSB2_uc010szb.1_Intron|WSB2_uc009zws.1_Missense_Mutation_p.R157I	NM_018639	NP_061109	Q9NYS7	WSB2_HUMAN	WD SOCS-box protein 2	157	WD 2.				intracellular signal transduction					ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTCAGATCTCTCACGACATC	0.562													4	141	---	---	---	---	PASS
LRRC43	254050	broad.mit.edu	37	12	122669084	122669084	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122669084C>T	uc009zxm.2	+	2	194	c.169C>T	c.(169-171)CCT>TCT	p.P57S	LRRC43_uc001ubw.3_5'UTR|LRRC43_uc009zxl.1_RNA	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1	57											0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GCGCTTTCTTCCTCAAACTTG	0.562													3	33	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20006620	20006620	+	Silent	SNP	C	T	T	rs147012324	byFrequency	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20006620C>T	uc001umd.2	-	17	1426	c.1215G>A	c.(1213-1215)TCG>TCA	p.S405S	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Silent_p.S294S|TPTE2_uc001ume.2_Silent_p.S328S|TPTE2_uc009zzm.2_Silent_p.S76S|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Silent_p.S76S	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	405	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TACCACGAATCGAATAAATAA	0.388													7	33	---	---	---	---	PASS
PSPC1	55269	broad.mit.edu	37	13	20277328	20277328	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20277328C>T	uc001uml.2	-	9	1745	c.1559G>A	c.(1558-1560)CGT>CAT	p.R520H	PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1	520					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		ATATCTACGACGCTTATTAGG	0.433													7	81	---	---	---	---	PASS
TM9SF1	10548	broad.mit.edu	37	14	24682652	24682652	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24682652C>G	uc010tob.1	-	1	706	c.72G>C	c.(70-72)GAG>GAC	p.E24D	CHMP4A_uc001wni.2_Missense_Mutation_p.E41D|CHMP4A_uc010toc.1_RNA|CHMP4A_uc001wnj.2_Missense_Mutation_p.E41D|MDP1_uc001wnk.1_3'UTR|CHMP4A_uc001wnm.1_3'UTR	NM_006405	NP_006396	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1 isoform a	Error:Variant_position_missing_in_O15321_after_alignment					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0183)		TCATCGCGAGCTCGCCTCTCC	0.672													6	50	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3658496	3658496	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3658496G>A	uc002cvp.2	-	2	1097	c.470C>T	c.(469-471)GCA>GTA	p.A157V	BTBD12_uc002cvq.1_Missense_Mutation_p.A157V	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	157	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						GGTGTTTTGTGCTGTTTCCCG	0.483								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				6	142	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	29110458	29110458	+	Intron	SNP	T	C	C	rs151074589	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29110458T>C	uc010vct.1	-						RRN3P2_uc002dsf.3_RNA|RRN3P2_uc002dsg.3_RNA|RRN3P2_uc010vdn.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAATTTTGAGTGGATAGTGAT	0.328													3	59	---	---	---	---	PASS
ZNF747	65988	broad.mit.edu	37	16	30545567	30545567	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30545567C>A	uc002dyn.2	-	1	628	c.434G>T	c.(433-435)CGG>CTG	p.R145L	ZNF768_uc010vex.1_5'UTR|ZNF747_uc002dyo.1_Missense_Mutation_p.R145L|ZNF747_uc010vey.1_Missense_Mutation_p.R145L|uc002dyp.1_5'Flank	NM_023931	NP_076420	Q9BV97	ZN747_HUMAN	zinc finger protein 747	145					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						CCTGGGCAGCCGGATCCCACA	0.637													3	5	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68846165	68846165	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68846165C>T	uc002ewg.1	+	8	1260	c.1136C>T	c.(1135-1137)ACG>ATG	p.T379M	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.T379M	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	379	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.S337_T379del(3)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AATCCCACCACGGTAATTCTA	0.453			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				6	65	---	---	---	---	PASS
VAC14	55697	broad.mit.edu	37	16	70818709	70818709	+	Silent	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70818709G>A	uc002ezm.2	-	4	714	c.456C>T	c.(454-456)AGC>AGT	p.S152S	VAC14_uc010cfw.2_5'UTR|VAC14_uc002ezn.2_5'UTR	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog	152					interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				GCTCAGATCCGCTTTTCACAT	0.502													8	165	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425702	74425702	+	Silent	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425702G>A	uc010vmt.1	+	6	874	c.873G>A	c.(871-873)GCG>GCA	p.A291A						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		aggccgaggcggaaaaaccac	0.388													4	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425703	74425703	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425703G>A	uc010vmt.1	+	6	875	c.874G>A	c.(874-876)GAA>AAA	p.E292K						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		ggccgaggcggaaaaaccacc	0.393													4	63	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425732	74425732	+	Missense_Mutation	SNP	G	T	T	rs77563894		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425732G>T	uc010vmt.1	+	6	904	c.903G>T	c.(901-903)AGG>AGT	p.R301S						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		agaggtggagggtgGATGAGG	0.348													5	45	---	---	---	---	PASS
SERPINF1	5176	broad.mit.edu	37	17	1679918	1679918	+	Silent	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1679918C>T	uc002ftl.2	+	7	1036	c.879C>T	c.(877-879)CTC>CTT	p.L293L	SERPINF1_uc010cjw.2_Silent_p.L106L	NM_002615	NP_002606	P36955	PEDF_HUMAN	serine (or cysteine) proteinase inhibitor, clade	293					cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity			ovary(1)	1						AGGAGAGCCTCACCTCCGAGT	0.522													5	166	---	---	---	---	PASS
TAOK1	57551	broad.mit.edu	37	17	27844648	27844648	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27844648A>C	uc002hdz.1	+	16	2076	c.1882A>C	c.(1882-1884)AAC>CAC	p.N628H	TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Missense_Mutation_p.N628H	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	628	Potential.				mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			TGGGCGTCATAACTTAGAGCA	0.368													28	97	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33504058	33504058	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33504058A>G	uc002hja.2	+	16	2151	c.2054A>G	c.(2053-2055)GAG>GGG	p.E685G	UNC45B_uc002hjb.2_Missense_Mutation_p.E683G|UNC45B_uc002hjc.2_Missense_Mutation_p.E683G|UNC45B_uc010cto.2_Missense_Mutation_p.E604G	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	685					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				CTGGCTTTGGAGGGCACAGAT	0.572													3	133	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234350	45234350	+	Silent	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234350C>T	uc002ild.3	-	7	898	c.771G>A	c.(769-771)CAG>CAA	p.Q257Q	CDC27_uc002ile.3_Silent_p.Q257Q|CDC27_uc002ilf.3_Silent_p.Q257Q|CDC27_uc010wkp.1_Silent_p.Q196Q|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	257					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TATTTTGAACCTGTTTAGATA	0.383													6	59	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234386	45234386	+	Silent	SNP	G	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234386G>T	uc002ild.3	-	7	862	c.735C>A	c.(733-735)GTC>GTA	p.V245V	CDC27_uc002ile.3_Silent_p.V245V|CDC27_uc002ilf.3_Silent_p.V245V|CDC27_uc010wkp.1_Silent_p.V184V|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TTCCCAGTGGGACAGTATCAG	0.358													4	46	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56082986	56082986	+	Intron	SNP	T	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56082986T>C	uc002ivi.2	-						SFRS1_uc002ivj.2_3'UTR	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		GAACTTTCCATTGAAAGATCT	0.408													3	85	---	---	---	---	PASS
ZNF709	163051	broad.mit.edu	37	19	12575501	12575501	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12575501C>A	uc002mtv.3	-	4	1396	c.1235G>T	c.(1234-1236)AGA>ATA	p.R412I	ZNF709_uc002mtw.3_Missense_Mutation_p.R380I|ZNF709_uc002mtx.3_Missense_Mutation_p.R412I	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	412	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGTGTGAGTTCTTTCATGCAT	0.418													4	123	---	---	---	---	PASS
EMR2	30817	broad.mit.edu	37	19	14875286	14875286	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14875286A>C	uc002mzp.1	-	11	1499	c.1043T>G	c.(1042-1044)CTT>CGT	p.L348R	EMR2_uc010dzs.1_5'UTR|EMR2_uc010xnw.1_Missense_Mutation_p.L348R|EMR2_uc002mzo.1_Missense_Mutation_p.L348R|EMR2_uc002mzq.1_Missense_Mutation_p.L299R|EMR2_uc002mzr.1_Missense_Mutation_p.L299R|EMR2_uc002mzs.1_Missense_Mutation_p.L206R|EMR2_uc002mzt.1_Missense_Mutation_p.L255R|EMR2_uc002mzu.1_Missense_Mutation_p.L255R|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_RNA	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	348	Extracellular (Potential).				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						CCCATTGGAAAGGTTCTTGCT	0.577													3	63	---	---	---	---	PASS
PSG11	5680	broad.mit.edu	37	19	43519267	43519267	+	Splice_Site	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43519267C>A	uc002ovm.1	-	4	1071	c.964_splice	c.e4+1	p.A322_splice	PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG11_uc002ovn.1_Splice_Site_p.A328_splice|PSG11_uc002ovo.1_Splice_Site_p.A200_splice|PSG11_uc002ovp.1_Splice_Site_p.A200_splice	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN	pregnancy specific beta-1-glycoprotein 11						female pregnancy	extracellular region					0		Prostate(69;0.00682)				GATCCACTTACCAATGACTCT	0.473													12	158	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51361766	51361766	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51361766A>C	uc002pts.1	+	4	586	c.545A>C	c.(544-546)GAC>GCC	p.D182A	KLK3_uc010ycj.1_Missense_Mutation_p.D141A|KLK3_uc002ptr.1_Missense_Mutation_p.D139A|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	182	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		ATTTCCAATGACGTGTGTGCG	0.547													6	175	---	---	---	---	PASS
MBOAT7	79143	broad.mit.edu	37	19	54692085	54692085	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54692085A>C	uc002qdq.2	-	4	458	c.192T>G	c.(190-192)ATT>ATG	p.I64M	MBOAT7_uc010erg.2_5'Flank|MBOAT7_uc010yem.1_Missense_Mutation_p.I46M|MBOAT7_uc002qdr.2_Missense_Mutation_p.I64M|MBOAT7_uc002qds.2_Missense_Mutation_p.S34A|MBOAT7_uc010yen.1_Missense_Mutation_p.S34A|MBOAT7_uc002qdt.3_Missense_Mutation_p.I64M|TSEN34_uc010yeo.1_5'Flank|TSEN34_uc002qdu.2_5'Flank|TSEN34_uc002qdv.2_5'Flank	NM_024298	NP_077274	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain	64	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCTGGGCCTGAATGAGGGCCC	0.607													3	97	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54721090	54721090	+	Missense_Mutation	SNP	A	G	G	rs141841040	byFrequency	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54721090A>G	uc002qef.1	-	13	1879	c.1768T>C	c.(1768-1770)TCC>CCC	p.S590P	LILRB3_uc002qee.1_Missense_Mutation_p.S591P|LILRB3_uc002qeh.1_Missense_Mutation_p.S590P|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.S590P|LILRA6_uc002qek.1_Missense_Mutation_p.S591P|LILRB3_uc010erh.1_Missense_Mutation_p.S607P|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Missense_Mutation_p.S590P|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S591P|LILRB3_uc002qep.1_Missense_Mutation_p.S591P|LILRB3_uc002qeq.1_Missense_Mutation_p.S590P|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S591P	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	590	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACATCCTGGGAGGCTTCAGAT	0.637													3	99	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625875	29625875	+	Missense_Mutation	SNP	T	C	C	rs143761036	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625875T>C	uc010ztl.1	+	2	61	c.29T>C	c.(28-30)ATC>ACC	p.I10T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGTACAGAATCGCCCTGAAA	0.353													9	69	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628263	29628263	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628263A>G	uc010ztl.1	+	3	207	c.175A>G	c.(175-177)ATT>GTT	p.I59V	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.I11V					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAGCTGCTTTATTAGATGCAA	0.363													3	86	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415470	57415470	+	Silent	SNP	C	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415470C>T	uc002xzt.2	+	1	676	c.309C>T	c.(307-309)TAC>TAT	p.Y103Y	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCTAGAGTACGAGGAAGAGT	0.627			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			32	91	---	---	---	---	PASS
AGPAT3	56894	broad.mit.edu	37	21	45400973	45400973	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45400973C>A	uc002zdv.2	+	9	1169	c.947C>A	c.(946-948)ACC>AAC	p.T316N	AGPAT3_uc002zdw.2_Missense_Mutation_p.T316N|AGPAT3_uc002zdx.2_Missense_Mutation_p.T403N|AGPAT3_uc002zdy.2_Missense_Mutation_p.T254N	NM_020132	NP_064517	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	316	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		TCCTGGGCCACCATTCTCCTG	0.552													4	121	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994200	140994200	+	Missense_Mutation	SNP	T	C	C	rs57227275	byFrequency	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994200T>C	uc004fbt.2	+	4	1296	c.1010T>C	c.(1009-1011)CTT>CCT	p.L337P	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	337				L -> P (in Ref. 2; AAC24227).			protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CCCCAGTCTCTTCTCCAGATT	0.463										HNSCC(15;0.026)			3	159	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17275557	17275558	+	Intron	INS	-	CTTAGAT	CTTAGAT			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17275557_17275558insCTTAGAT	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_Intron	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ctgtgccaccacttagatctca	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766729	91766730	+	IGR	INS	-	AG	AG	rs141003417		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766729_91766730insAG								None (None upstream) : LOC654342 (38462 downstream)																							GGAGCTGTAACACTATTTGTGA	0.317													6	3	---	---	---	---	
EOMES	8320	broad.mit.edu	37	3	27763406	27763408	+	In_Frame_Del	DEL	GCG	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27763406_27763408delGCG	uc003cdx.2	-	1	378_380	c.378_380delCGC	c.(376-381)GCCGCG>GCG	p.126_127AA>A	EOMES_uc003cdy.3_In_Frame_Del_p.126_127AA>A|EOMES_uc010hfn.2_In_Frame_Del_p.126_127AA>A|EOMES_uc011axc.1_Intron	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin	126_127	Ala-rich.				CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						ggccgcagccgcggcggcggcgg	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142895155	142895155	+	IGR	DEL	C	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142895155delC								CHST2 (53345 upstream) : SLC9A9 (88910 downstream)																							GGCCTCAGGGCCCCCCCCCAG	0.746													4	2	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148859319	148859319	+	Intron	DEL	T	-	-	rs10718838		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148859319delT	uc003ewu.1	+						HPS3_uc003ewt.1_Intron|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			tttttttttgttttttttttt	0.224									Hermansky-Pudlak_syndrome				5	4	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16572323	16572323	+	Intron	DEL	T	-	-	rs68191869		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16572323delT	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						ATGATTTCACttttttttttt	0.144													4	2	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	80074815	80074816	+	Intron	DEL	AC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80074815_80074816delAC	uc003kgz.2	+							NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ttttttttttactttttttttt	0.134								MMR					4	2	---	---	---	---	
SPDEF	25803	broad.mit.edu	37	6	34507005	34507006	+	Intron	INS	-	C	C			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34507005_34507006insC	uc003ojq.1	-						SPDEF_uc011dsq.1_Intron	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription						negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5						GCCCTGCAGCGCCCCTTGGGCA	0.629													126	31	---	---	---	---	
UBR2	23304	broad.mit.edu	37	6	42609419	42609427	+	In_Frame_Del	DEL	CTAGTAAAC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42609419_42609427delCTAGTAAAC	uc011dur.1	+	17	2020_2028	c.2020_2028delCTAGTAAAC	c.(2020-2028)CTAGTAAACdel	p.LVN674del	UBR2_uc011dus.1_In_Frame_Del_p.LVN319del|UBR2_uc010jxv.1_In_Frame_Del_p.LVN178del|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	674_676					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGGGTTCTCTCTAGTAAACCAGGTAAGTG	0.411													88	31	---	---	---	---	
TULP4	56995	broad.mit.edu	37	6	158882455	158882456	+	Intron	INS	-	AAG	AAG	rs113168644		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158882455_158882456insAAG	uc003qrf.2	+						TULP4_uc011efo.1_Intron|TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1						intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		aaaaaaaaaaaaaaggaaaaaa	0.168													8	5	---	---	---	---	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20824941_20824943delGCC	uc003suy.2	-	3	680_682	c.439_441delGGC	c.(439-441)GGCdel	p.G147del	SP8_uc003suz.2_In_Frame_Del_p.G165del	NM_198956	NP_945194	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor isoform 2	147					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						GCGCGGAGGAgccgccgccgccg	0.493													5	3	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73456758	73456758	+	Intron	DEL	A	-	-	rs72489767		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456758delA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	accttgtgtcaaaaaaaaaaa	0.239			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	2	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92146721	92146721	+	Frame_Shift_Del	DEL	T	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92146721delT	uc003uly.2	-	5	1204	c.1108delA	c.(1108-1110)ATTfs	p.I370fs	PEX1_uc011khr.1_Frame_Shift_Del_p.I162fs|PEX1_uc010ley.2_Frame_Shift_Del_p.I370fs|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	370					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TCTGACCTAATTTTTTTTTGA	0.353													167	7	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66499953	66499955	+	3'UTR	DEL	TTC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499953_66499955delTTC	uc004aee.1	+	1					LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						CTTCAGCCTGTTCTTCTTCAGTC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													7	4	---	---	---	---	
C10orf68	79741	broad.mit.edu	37	10	32856936	32856937	+	Intron	INS	-	G	G	rs35386168		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32856936_32856937insG	uc001iwn.3	+						CCDC7_uc001iwj.2_Intron|CCDC7_uc001iwk.2_Intron|CCDC7_uc009xlv.2_Intron|C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						GTTTTTGGGttttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42408305	42408306	+	IGR	INS	-	T	T			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42408305_42408306insT								None (None upstream) : LOC441666 (419009 downstream)																							ttgaaacactctttttgcagaa	0.000													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112657654	112657654	+	Intron	DEL	T	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112657654delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AGAGGCATGCTTTTTTTTTTT	0.264													4	2	---	---	---	---	
CDCA3	83461	broad.mit.edu	37	12	6959169	6959169	+	Intron	DEL	T	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6959169delT	uc001qrg.2	-						CDCA3_uc001qre.2_Intron|uc001qrf.1_5'Flank|USP5_uc001qri.3_5'Flank|USP5_uc001qrh.3_5'Flank	NM_031299	NP_112589	Q99618	CDCA3_HUMAN	cell division cycle associated 3						cell division|mitosis	cytosol					0						AAGGGAGCAAttttttttttt	0.239													4	2	---	---	---	---	
WBP11	51729	broad.mit.edu	37	12	14954063	14954064	+	Intron	INS	-	A	A	rs150029016	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14954063_14954064insA	uc001rci.2	-						C12orf60_uc001rcj.3_5'Flank	NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11						mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						AATCAAATTTGAAAAATAAAAT	0.312													4	2	---	---	---	---	
GYS2	2998	broad.mit.edu	37	12	21715633	21715637	+	Intron	DEL	AAAAA	-	-	rs144048267		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21715633_21715637delAAAAA	uc001rfb.2	-							NM_021957	NP_068776	P54840	GYS2_HUMAN	glycogen synthase 2						glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2						AAGATTCTCCaaaaaaaaaaaaaaa	0.263													6	3	---	---	---	---	
GXYLT1	283464	broad.mit.edu	37	12	42503345	42503346	+	Intron	DEL	AG	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42503345_42503346delAG	uc001rms.3	-						GXYLT1_uc001rmt.3_Intron	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						aaaaaaaaaaaGACACTAGGGG	0.307													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109578021	109578024	+	Intron	DEL	TTCC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109578021_109578024delTTCC	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TCTCAGAAGTttccttccttcctt	0.250													5	3	---	---	---	---	
TRMT5	57570	broad.mit.edu	37	14	61439184	61439185	+	3'UTR	INS	-	GGC	GGC			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61439184_61439185insGGC	uc001xff.3	-	5						NM_020810	NP_065861	Q32P41	TRMT5_HUMAN	tRNA methyltransferase 5							cytoplasm	tRNA (guanine-N1-)-methyltransferase activity			central_nervous_system(2)|large_intestine(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0873)		CTCTTGGGCATggcggcggcgg	0.500													9	5	---	---	---	---	
RAD51	5888	broad.mit.edu	37	15	40993575	40993575	+	Intron	DEL	T	-	-	rs67977099		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40993575delT	uc001zmi.3	+						RAD51_uc010bbw.2_Intron|RAD51_uc010bbx.2_Intron|RAD51_uc001zmk.3_Intron|RAD51_uc001zml.3_Intron|RAD51_uc001zmm.1_Intron|RAD51_uc001zmn.1_Intron	NM_002875	NP_002866	Q06609	RAD51_HUMAN	RAD51 homolog protein isoform 1						DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		tttttctttcttttttttttt	0.124								Homologous_recombination					4	2	---	---	---	---	
ZFYVE19	84936	broad.mit.edu	37	15	41104772	41104789	+	Intron	DEL	AAAGAAAGAAAGAAAGAA	-	-	rs147351188		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41104772_41104789delAAAGAAAGAAAGAAAGAA	uc001zmt.1	+						ZFYVE19_uc001zmu.1_Intron|ZFYVE19_uc001zmv.1_Intron|ZFYVE19_uc001zmw.1_Intron|ZFYVE19_uc001zmx.1_Intron|ZFYVE19_uc010bcc.1_Intron	NM_001077268	NP_001070736	Q96K21	ZFY19_HUMAN	zinc finger, FYVE domain containing 19								zinc ion binding				0		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		agaaagaaagaaagaaagaaagaaagaaaaaattatta	0.170													3	3	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	85958947	85958947	+	Intron	DEL	T	-	-	rs35819058		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85958947delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						ATACCGTTTCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7642926	7642926	+	Intron	DEL	T	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7642926delT	uc002giu.1	+						DNAH2_uc002git.2_Intron|DNAH2_uc010vuk.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTTCTTCTTCTTTTTTTTTTT	0.413													5	3	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10424897	10424898	+	Intron	INS	-	ATAT	ATAT	rs145532418	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10424897_10424898insATAT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTATTGATGTCATatatatata	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20680269	20680270	+	IGR	INS	-	AAC	AAC	rs111615294		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20680269_20680270insAAC								LGALS9B (309421 upstream) : CCDC144NL (86440 downstream)																							ACATCTGGAAAaacaacaacaa	0.173													8	5	---	---	---	---	
BSG	682	broad.mit.edu	37	19	581145	581158	+	Intron	DEL	CCCGGACCCAGCCC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:581145_581158delCCCGGACCCAGCCC	uc002loz.2	+						BSG_uc002loy.2_Intron|BSG_uc002lpa.2_Intron|BSG_uc002lpb.2_Intron|BSG_uc010drr.2_Intron|BSG_uc002lpc.2_Intron|BSG_uc002lpd.2_5'Flank	NM_001728	NP_001719	P35613	BASI_HUMAN	basigin isoform 1 precursor						blood coagulation|cell surface receptor linked signaling pathway|leukocyte migration|pyruvate metabolic process	Golgi membrane|integral to membrane|melanosome	lactate transmembrane transporter activity|mannose binding|protein binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTGGGGGTCCCGGACCCAGCCCTCCGGACTGG	0.710													18	7	---	---	---	---	
ANGPTL4	51129	broad.mit.edu	37	19	8434339	8434339	+	Intron	DEL	C	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8434339delC	uc002mjq.1	+						ANGPTL4_uc002mjr.1_Intron|ANGPTL4_uc010xkc.1_Intron	NM_139314	NP_647475	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4 protein isoform a precursor						angiogenesis|cell differentiation|cellular lipid metabolic process|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|positive regulation of angiogenesis|response to hypoxia|signal transduction|triglyceride homeostasis	extracellular space|proteinaceous extracellular matrix	enzyme inhibitor activity|receptor binding			ovary(1)	1						ccaagctggtctttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16823289	16823289	+	IGR	DEL	T	-	-	rs36044959		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16823289delT								TMEM38A (23475 upstream) : NWD1 (7498 downstream)																							tttcatttccttttttttttt	0.134													4	2	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49963971	49963972	+	Intron	INS	-	T	T	rs35639941		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963971_49963972insT	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		acacccggccattttttttttt	0.005													6	7	---	---	---	---	
SIGLEC5	8778	broad.mit.edu	37	19	52115343	52115344	+	3'UTR	INS	-	TCATCTGTTTTCTTTCTGC	TCATCTGTTTTCTTTCTGC	rs143349422	by1000genomes	TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52115343_52115344insTCATCTGTTTTCTTTCTGC	uc002pxe.2	-	9						NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor						cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		ctctaattccaTCTGCTTGGAG	0.248													3	5	---	---	---	---	
ZNF761	388561	broad.mit.edu	37	19	53946133	53946133	+	Intron	DEL	A	-	-	rs35108555		TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53946133delA	uc010eqp.2	+						LOC147804_uc002qbo.2_RNA|LOC147804_uc002qbq.2_RNA|LOC147804_uc002qbp.2_RNA|ZNF761_uc002qbr.2_Intron|ZNF761_uc010ydy.1_5'Flank	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		TCATGTTGTGAAAAAAAAAAT	0.348													4	3	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	21989941	21989942	+	Intron	DEL	TC	-	-			TCGA-G9-6365-01A-11D-1786-08	TCGA-G9-6365-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21989941_21989942delTC	uc004dag.2	+						SMS_uc011mjq.1_Intron|SMS_uc004daf.1_Intron	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	TTGGGTGACATCTCTCTCTCTC	0.366													4	2	---	---	---	---	
