Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GJB3	2707	broad.mit.edu	37	1	35250842	35250842	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35250842G>A	uc001bxx.2	+	2	1094	c.479G>A	c.(478-480)CGC>CAC	p.R160H	GJB3_uc001bxy.2_Missense_Mutation_p.R160H|GJB3_uc001bxz.3_Missense_Mutation_p.R160H|uc010ohs.1_RNA	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	160	Extracellular (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				AATATGCCGCGCCTGGTGCAG	0.552																0.345238	152.121817	155.664236	58	110	KEEP	---	---	---	---	34	30	60	63	-1	capture	Missense_Mutation	SNP	35250842	35250842	GJB3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6346	4
C8B	732	broad.mit.edu	37	1	57395177	57395177	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57395177C>T	uc001cyp.2	-	12	1743	c.1676G>A	c.(1675-1677)GGA>GAA	p.G559E	C8B_uc010oon.1_Missense_Mutation_p.G497E|C8B_uc010ooo.1_Missense_Mutation_p.G507E	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	559	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						CTTACGTCTTCCAGAGCATGA	0.448																0.296774	122.64944	128.402244	46	109	KEEP	---	---	---	---	23	27	63	53	-1	capture	Missense_Mutation	SNP	57395177	57395177	C8B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2394	4
HOOK1	51361	broad.mit.edu	37	1	60294482	60294482	+	Missense_Mutation	SNP	A	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:60294482A>T	uc009wad.2	+	4	282	c.180A>T	c.(178-180)TTA>TTT	p.L60F	HOOK1_uc001czo.2_Missense_Mutation_p.L60F|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Missense_Mutation_p.L18F	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	60	Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					AATCTTGGTTAAGCCGAATTA	0.348																0.321839	78.271396	80.722814	28	59	KEEP	---	---	---	---	18	16	31	41	-1	capture	Missense_Mutation	SNP	60294482	60294482	HOOK1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	167	13	4	4	7207	4
COL11A1	1301	broad.mit.edu	37	1	103453212	103453212	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:103453212G>A	uc001dul.2	-	30	2797	c.2479C>T	c.(2479-2481)CCT>TCT	p.P827S	COL11A1_uc001duk.2_Silent_p.V17V|COL11A1_uc001dum.2_Missense_Mutation_p.P839S|COL11A1_uc001dun.2_Missense_Mutation_p.P788S|COL11A1_uc009weh.2_Missense_Mutation_p.P711S	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	827	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	p.P839S(1)		ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGACCTGAAGGACCTGGGTCT	0.453																0.432836	174.326655	174.853848	58	76	KEEP	---	---	---	---	32	32	41	46	-1	capture	Missense_Mutation	SNP	103453212	103453212	COL11A1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3632	4
PYHIN1	149628	broad.mit.edu	37	1	158912123	158912123	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158912123G>A	uc001ftb.2	+	5	1181	c.936G>A	c.(934-936)CCG>CCA	p.P312P	PYHIN1_uc001ftc.2_Silent_p.P303P|PYHIN1_uc001ftd.2_Silent_p.P312P|PYHIN1_uc001fte.2_Silent_p.P303P	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	312	HIN-200.				cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					AGAAAATTCCGAAGATCAATA	0.378																0.401961	123.756847	124.613435	41	61	KEEP	---	---	---	---	21	21	28	40	-1	capture	Silent	SNP	158912123	158912123	PYHIN1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	12760	4
RASAL2	9462	broad.mit.edu	37	1	178425898	178425898	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:178425898G>T	uc001glr.2	+	11	1956	c.1831G>T	c.(1831-1833)GAT>TAT	p.D611Y	RASAL2_uc001glq.2_Missense_Mutation_p.D752Y|RASAL2_uc009wxc.2_Missense_Mutation_p.D125Y	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	611					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						TGTTCTTGCTGATATTACCAA	0.468																0.022088	-112.509629	14.507941	11	487	KEEP	---	---	---	---	7	5	222	315	0.583333333333	capture	Missense_Mutation	SNP	178425898	178425898	RASAL2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	12959	4
STX6	10228	broad.mit.edu	37	1	180971810	180971810	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180971810A>G	uc010pnq.1	-	3	469	c.232T>C	c.(232-234)TTT>CTT	p.F78L	STX6_uc001goo.2_Missense_Mutation_p.F78L|STX6_uc010pnr.1_Intron	NM_005819	NP_005810	O43752	STX6_HUMAN	syntaxin 6	78	Cytoplasmic (Potential).				Golgi vesicle transport|intracellular protein transport|vesicle fusion	clathrin-coated vesicle|early endosome|integral to membrane|perinuclear region of cytoplasm|plasma membrane|trans-Golgi network membrane	SNAP receptor activity			ovary(1)	1						TCAAGGTTAAATTTTCTAGGA	0.353																0.032051	-25.95584	11.384576	5	151	KEEP	---	---	---	---	1	5	72	91	-1	capture	Missense_Mutation	SNP	180971810	180971810	STX6	1	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	15239	4
CENPF	1063	broad.mit.edu	37	1	214787153	214787153	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214787153A>G	uc001hkm.2	+	2	230	c.56A>G	c.(55-57)AAA>AGA	p.K19R		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	19	Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).|Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	p.K19R(1)		ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GCTCTTCAGAAAATTCAAGAG	0.428	Colon(80;575 1284 11000 14801 43496)															0.353333	178.041814	180.88193	53	97	KEEP	---	---	---	---	22	34	56	46	-1	capture	Missense_Mutation	SNP	214787153	214787153	CENPF	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	3199	4
OBSCN	84033	broad.mit.edu	37	1	228504460	228504460	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228504460G>A	uc009xez.1	+	51	13380	c.13336G>A	c.(13336-13338)GGC>AGC	p.G4446S	OBSCN_uc001hsn.2_Missense_Mutation_p.G4446S	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4446	Ig-like 46.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGTCCGGGCCGGCGCACAGGC	0.672					4006											0.322581	29.675027	30.523005	10	21	KEEP	---	---	---	---	7	6	10	16	-1	capture	Missense_Mutation	SNP	228504460	228504460	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10717	4
OR2L13	284521	broad.mit.edu	37	1	248263034	248263034	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248263034C>T	uc001ids.2	+	3	694	c.357C>T	c.(355-357)TAC>TAT	p.Y119Y		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CCATGGCCTACGACCGTTATT	0.512					85											0.2975	308.843567	323.467223	119	281	KEEP	---	---	---	---	62	60	154	139	-1	capture	Silent	SNP	248263034	248263034	OR2L13	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10910	4
C10orf18	54906	broad.mit.edu	37	10	5791482	5791482	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5791482C>T	uc001iij.2	+	15	6723	c.6098C>T	c.(6097-6099)CCT>CTT	p.P2033L	C10orf18_uc001iik.2_Missense_Mutation_p.P877L	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2033										ovary(1)|central_nervous_system(1)	2						CATCCTGCACCTAGGAGCAGA	0.547																0.016949	-54.790135	7.41209	4	232	KEEP	---	---	---	---	3	2	117	146	-1	capture	Missense_Mutation	SNP	5791482	5791482	C10orf18	10	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	1584	4
ARMC3	219681	broad.mit.edu	37	10	23250972	23250972	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:23250972G>A	uc001irm.3	+	7	780	c.697G>A	c.(697-699)GGA>AGA	p.G233R	ARMC3_uc010qcv.1_Missense_Mutation_p.G233R|ARMC3_uc010qcw.1_Intron	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	233	ARM 6.						binding				0						AGACAATCAAGGATTGGACCA	0.358																0.6	104.288217	104.739252	30	20	KEEP	---	---	---	---	10	22	12	9	-1	capture	Missense_Mutation	SNP	23250972	23250972	ARMC3	10	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	945	4
ZNF248	57209	broad.mit.edu	37	10	38126948	38126948	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:38126948A>G	uc001izd.1	-	4	606	c.107T>C	c.(106-108)GTG>GCG	p.V36A	ZNF248_uc009xmc.2_Missense_Mutation_p.V36A|ZNF248_uc001izb.2_RNA|ZNF248_uc001izc.2_Missense_Mutation_p.V36A|ZNF248_uc010qeu.1_Missense_Mutation_p.V36A	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	36	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTCCAGGATCACATCTCTGTA	0.413																0.495	304.36504	304.369952	99	101	KEEP	---	---	---	---	42	65	55	58	-1	capture	Missense_Mutation	SNP	38126948	38126948	ZNF248	10	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	17673	4
PTEN	5728	broad.mit.edu	37	10	89692907	89692907	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692907A>G	uc001kfb.2	+	6	1422	c.391A>G	c.(391-393)ACT>GCT	p.T131A		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	131	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.T131fs*3(3)|p.?(2)|p.Y27fs*1(2)|p.K128_R130del(2)|p.Y27_N212>Y(2)|p.T131A(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.T131N(1)|p.T131fs*50(1)|p.T131P(1)|p.T131fs*42(1)|p.T131I(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAGGGACGAACTGGTGTAAT	0.398			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.511364	325.760728	325.780696	90	86	KEEP	---	---	---	---	54	45	48	48	-1	capture	Missense_Mutation	SNP	89692907	89692907	PTEN	10	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	12633	4
PHRF1	57661	broad.mit.edu	37	11	608380	608380	+	Missense_Mutation	SNP	A	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:608380A>T	uc001lqe.2	+	14	3055	c.2924A>T	c.(2923-2925)GAC>GTC	p.D975V	PHRF1_uc010qwc.1_Missense_Mutation_p.D974V|PHRF1_uc010qwd.1_Missense_Mutation_p.D973V|PHRF1_uc010qwe.1_Missense_Mutation_p.D971V|PHRF1_uc009ybz.1_Missense_Mutation_p.D765V|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	975							RNA polymerase binding|zinc ion binding				0						CCCAGCCCGGACGTGCTGCAG	0.657																0.272727	15.558227	16.571331	6	16	KEEP	---	---	---	---	5	4	9	12	-1	capture	Missense_Mutation	SNP	608380	608380	PHRF1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	11764	4
OR51D1	390038	broad.mit.edu	37	11	4661587	4661587	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4661587C>T	uc010qyk.1	+	1	567	c.567C>T	c.(565-567)CAC>CAT	p.H189H		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGTCACACACTCCTTCTGTC	0.483																0.224066	133.318056	150.1872	54	187	KEEP	---	---	---	---	26	32	111	86	-1	capture	Silent	SNP	4661587	4661587	OR51D1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	10997	4
PICALM	8301	broad.mit.edu	37	11	85733503	85733503	+	Missense_Mutation	SNP	A	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:85733503A>T	uc001pbm.2	-	4	645	c.359T>A	c.(358-360)ATG>AAG	p.M120K	PICALM_uc001pbl.2_Missense_Mutation_p.M120K|PICALM_uc001pbn.2_Missense_Mutation_p.M120K|PICALM_uc010rtl.1_Missense_Mutation_p.M69K	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	120	ENTH.				clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				AAATGTAGACATGTCATATCC	0.289					415	T	MLLT10|MLL	TALL|AML|								0.321429	108.864906	112.034633	36	76	KEEP	---	---	---	---	19	18	41	36	-1	capture	Missense_Mutation	SNP	85733503	85733503	PICALM	11	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	11783	4
ANO2	57101	broad.mit.edu	37	12	5842030	5842030	+	Splice_Site	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5842030A>G	uc001qnm.2	-	14	1506	c.1434_splice	c.e14+1	p.Q478_splice		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						TGAAAACCAAACCTGGGCACG	0.483																0.080645	2.031176	13.140152	5	57	KEEP	---	---	---	---	4	1	30	34	-1	capture	Splice_Site	SNP	5842030	5842030	ANO2	12	A	G	G	G	1	0	0	0	0	0	0	1	0	26	2	5	3	691	4
LEPREL2	10536	broad.mit.edu	37	12	6946911	6946911	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6946911G>A	uc001qra.1	+	14	1761	c.1727G>A	c.(1726-1728)CGC>CAC	p.R576H	LEPREL2_uc001qqz.1_Missense_Mutation_p.R383H|LEPREL2_uc001qrb.1_Missense_Mutation_p.R383H|GNB3_uc001qrc.2_5'Flank|GNB3_uc001qrd.2_5'Flank	NM_014262	NP_055077	Q8IVL6	P3H3_HUMAN	leprecan-like 2 precursor	576	Fe2OG dioxygenase.				negative regulation of cell proliferation	endoplasmic reticulum	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity				0					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CAAGAGCAGCGCATGGACCTG	0.652																0.416667	43.818222	44.036445	15	21	KEEP	---	---	---	---	8	10	12	11	-1	capture	Missense_Mutation	SNP	6946911	6946911	LEPREL2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8651	4
NOS1	4842	broad.mit.edu	37	12	117768967	117768967	+	Translation_Start_Site	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117768967C>T	uc001twm.1	-	2	594	c.-92G>A	c.(-94--90)CCGTG>CCATG			NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	TCAGGCTACACGGAGAGCAGG	0.582	Esophageal Squamous(162;1748 2599 51982 52956)															0.104167	4.542731	12.022885	5	43	KEEP	---	---	---	---	4	1	17	27	-1	capture	Translation_Start_Site	SNP	117768967	117768967	NOS1	12	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	10448	4
UBC	7316	broad.mit.edu	37	12	125397201	125397201	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125397201G>T	uc001ugs.3	-	2	1565	c.1117C>A	c.(1117-1119)CTG>ATG	p.L373M	UBC_uc001ugr.2_Intron|UBC_uc001ugu.1_Missense_Mutation_p.L373M|UBC_uc001ugt.2_Missense_Mutation_p.L373M|UBC_uc001ugv.2_Intron	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	373	Ubiquitin-like 5.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CGGAGCACCAGGTGCAAGGTG	0.532																0.038902	-68.116983	32.236087	17	420	KEEP	---	---	---	---	8	11	238	241	0.421052631579	capture	Missense_Mutation	SNP	125397201	125397201	UBC	12	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	16724	4
OCA2	4948	broad.mit.edu	37	15	28202861	28202861	+	Missense_Mutation	SNP	C	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28202861C>G	uc001zbh.3	-	16	1767	c.1657G>C	c.(1657-1659)GTC>CTC	p.V553L	OCA2_uc010ayv.2_Missense_Mutation_p.V529L	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	553	Cytoplasmic (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGGCGCCAGACGTGAATCTCG	0.617												Oculocutaneous_Albinism				0.264368	67.489221	71.853911	23	64	KEEP	---	---	---	---	9	15	40	35	-1	capture	Missense_Mutation	SNP	28202861	28202861	OCA2	15	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	10720	4
TRPM1	4308	broad.mit.edu	37	15	31342763	31342763	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:31342763G>A	uc001zfm.2	-	11	1348	c.1220C>T	c.(1219-1221)CCG>CTG	p.P407L	TRPM1_uc010azy.2_Missense_Mutation_p.P314L|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	407	Extracellular (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GCTGTCCGTCGGGGGTGCCAG	0.453																0.356589	135.625979	137.957597	46	83	KEEP	---	---	---	---	25	30	56	43	-1	capture	Missense_Mutation	SNP	31342763	31342763	TRPM1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16468	4
EXD1	161829	broad.mit.edu	37	15	41483752	41483752	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41483752G>A	uc001znk.2	-	8	769	c.578C>T	c.(577-579)ACG>ATG	p.T193M	EXD1_uc001znj.2_5'Flank|EXD1_uc010ucv.1_Missense_Mutation_p.T251M	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	193					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						ATAGCCACCCGTTTCCATGGA	0.383																0.317881	132.056232	136.503124	48	103	KEEP	---	---	---	---	30	21	43	68	-1	capture	Missense_Mutation	SNP	41483752	41483752	EXD1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5252	4
SPG11	80208	broad.mit.edu	37	15	44876437	44876437	+	Missense_Mutation	SNP	T	C	C			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44876437T>C	uc001ztx.2	-	30	5472	c.5441A>G	c.(5440-5442)AAT>AGT	p.N1814S	SPG11_uc010bdw.2_Missense_Mutation_p.N103S|SPG11_uc010ueh.1_Missense_Mutation_p.N1814S|SPG11_uc010uei.1_Missense_Mutation_p.N1814S|SPG11_uc001zty.1_Missense_Mutation_p.N543S	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1814	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTCCTCCTGATTTCTTCCAAG	0.512																0.024845	-31.042124	9.277627	4	157	KEEP	---	---	---	---	2	2	79	88	-1	capture	Missense_Mutation	SNP	44876437	44876437	SPG11	15	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14933	4
SEMA6D	80031	broad.mit.edu	37	15	48056239	48056239	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48056239G>A	uc010bek.2	+	10	1300	c.940G>A	c.(940-942)GGG>AGG	p.G314R	SEMA6D_uc001zvw.2_Missense_Mutation_p.G314R|SEMA6D_uc001zvx.1_Missense_Mutation_p.G314R|SEMA6D_uc001zvy.2_Missense_Mutation_p.G314R|SEMA6D_uc001zvz.2_Missense_Mutation_p.G314R|SEMA6D_uc001zwa.2_Missense_Mutation_p.G314R|SEMA6D_uc001zwb.2_Missense_Mutation_p.G314R|SEMA6D_uc001zwc.2_Missense_Mutation_p.G314R	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	314	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CACTGTGGTCGGGGTGTTTAC	0.483																0.041322	-16.593827	10.747803	5	116	KEEP	---	---	---	---	1	4	58	66	-1	capture	Missense_Mutation	SNP	48056239	48056239	SEMA6D	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13935	4
ALDH1A2	8854	broad.mit.edu	37	15	58253017	58253017	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58253017C>T	uc002aex.2	-	12	1493	c.1435G>A	c.(1435-1437)GCC>ACC	p.A479T	ALDH1A2_uc002aey.2_Missense_Mutation_p.A441T|ALDH1A2_uc010ugv.1_Missense_Mutation_p.A458T|ALDH1A2_uc010ugw.1_Missense_Mutation_p.A450T|ALDH1A2_uc002aew.2_Missense_Mutation_p.A383T	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	479					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	GGGCTCTGGGCATTTAAGGCA	0.408																0.189655	44.075293	54.530807	22	94	KEEP	---	---	---	---	11	13	57	51	-1	capture	Missense_Mutation	SNP	58253017	58253017	ALDH1A2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	491	4
CLDN6	9074	broad.mit.edu	37	16	3065604	3065604	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3065604G>A	uc002csu.3	-	2	479	c.419C>T	c.(418-420)GCG>GTG	p.A140V		NM_021195	NP_067018	P56747	CLD6_HUMAN	claudin 6	140	Extracellular (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						GATGGCATGCGCCGTCCAGCA	0.622																0.432432	96.791194	97.08518	32	42	KEEP	---	---	---	---	14	23	18	29	-1	capture	Missense_Mutation	SNP	3065604	3065604	CLDN6	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3454	4
SCNN1B	6338	broad.mit.edu	37	16	23360038	23360038	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23360038C>T	uc002dln.2	+	2	294	c.118C>T	c.(118-120)CGC>TGC	p.R40C		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	40	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CGGCCCCAAGCGCATCATCTG	0.622																0.121622	9.621297	20.005071	9	65	KEEP	---	---	---	---	4	6	33	37	-1	capture	Missense_Mutation	SNP	23360038	23360038	SCNN1B	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13821	4
ITGAD	3681	broad.mit.edu	37	16	31422517	31422517	+	Missense_Mutation	SNP	G	A	A	rs147338780		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31422517G>A	uc002ebv.1	+	13	1526	c.1477G>A	c.(1477-1479)GTG>ATG	p.V493M	ITGAD_uc010cap.1_Missense_Mutation_p.V493M	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	493	Extracellular (Potential).|FG-GAP 5.				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CCAGGTGTCCGTGTGTCCCTT	0.632																0.216495	94.23891	108.637634	42	152	KEEP	---	---	---	---	25	22	91	89	-1	capture	Missense_Mutation	SNP	31422517	31422517	ITGAD	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7807	4
WDR59	79726	broad.mit.edu	37	16	74976699	74976699	+	Missense_Mutation	SNP	A	T	T	rs11394861		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:74976699A>T	uc002fdh.1	-	7	573	c.471T>A	c.(469-471)AAT>AAA	p.N157K	WDR59_uc002fdi.2_Missense_Mutation_p.N157K|WDR59_uc002fdj.2_Missense_Mutation_p.N157K	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	157	WD 3.									ovary(1)|breast(1)	2						CATTTTTTTTATTCCATTTGA	0.502																0.067797	-4.928797	6.494503	4	55	KEEP	---	---	---	---	0	5	39	25	-1	capture	Missense_Mutation	SNP	74976699	74976699	WDR59	16	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	17189	4
KCNG4	93107	broad.mit.edu	37	16	84270708	84270708	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84270708C>T	uc010voc.1	-	2	505	c.384G>A	c.(382-384)GCG>GCA	p.A128A	KCNG4_uc002fhu.1_Silent_p.A128A	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	128	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						GCTTCCCGGCCGCCAGGAAGC	0.637																0.063158	-5.327561	13.548568	6	89	KEEP	---	---	---	---	3	5	43	58	-1	capture	Silent	SNP	84270708	84270708	KCNG4	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7952	4
TP53	7157	broad.mit.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578203C>T	uc002gim.2	-	6	840	c.646G>A	c.(646-648)GTG>ATG	p.V216M	TP53_uc002gig.1_Missense_Mutation_p.V216M|TP53_uc002gih.2_Missense_Mutation_p.V216M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V84M|TP53_uc010cng.1_Missense_Mutation_p.V84M|TP53_uc002gii.1_Missense_Mutation_p.V84M|TP53_uc010cnh.1_Missense_Mutation_p.V216M|TP53_uc010cni.1_Missense_Mutation_p.V216M|TP53_uc002gij.2_Missense_Mutation_p.V216M|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.V123M|TP53_uc002gio.2_Missense_Mutation_p.V84M|TP53_uc010vug.1_Missense_Mutation_p.V177M	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	216	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|V -> M (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V216M(49)|p.V216del(8)|p.0?(7)|p.V216L(7)|p.V216E(4)|p.V216G(3)|p.V216A(3)|p.V216fs*6(2)|p.V216fs*31(2)|p.H214fs*5(2)|p.K164_P219del(1)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACCACCACACTATGTCGA	0.537	Pancreas(47;798 1329 9957 10801)		111	p.V216M(ECC12-Tumor)|p.V216L(LCLC103H-Tumor)|p.V216M(HT-Tumor)|p.V216M(SNU216-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.610169	112.408356	113.034453	36	23	KEEP	---	---	---	---	15	25	10	15	-1	capture	Missense_Mutation	SNP	7578203	7578203	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16264	4
MGAT5B	146664	broad.mit.edu	37	17	74936837	74936837	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74936837G>A	uc002jti.2	+	13	1885	c.1782G>A	c.(1780-1782)GCG>GCA	p.A594A	MGAT5B_uc002jth.2_Silent_p.A583A	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	585	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						ATCCCTACGCGGAGAACTTCA	0.552																0.03871	-23.178885	12.444088	6	149	KEEP	---	---	---	---	2	4	77	85	-1	capture	Silent	SNP	74936837	74936837	MGAT5B	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9461	4
PAPL	390928	broad.mit.edu	37	19	39597641	39597641	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39597641G>A	uc002oki.2	+	12	1442	c.1168G>A	c.(1168-1170)GTG>ATG	p.V390M	PAPL_uc010egl.2_Intron	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	390						extracellular region	acid phosphatase activity|metal ion binding				0						CTGGAGTGCCGTGCGTGTGAA	0.652																0.142857	15.771943	25.239239	11	66	KEEP	---	---	---	---	3	9	39	32	-1	capture	Missense_Mutation	SNP	39597641	39597641	PAPL	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11331	4
PSG1	5669	broad.mit.edu	37	19	43376198	43376198	+	Splice_Site	SNP	C	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43376198C>A	uc002ovb.2	-	3	569	c.431_splice	c.e3-1	p.L144_splice	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Splice_Site_p.L144_splice|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_Splice_Site|PSG1_uc002our.1_Splice_Site_p.L144_splice|PSG1_uc010eio.1_Splice_Site_p.L144_splice|PSG1_uc002oux.1_Splice_Site_p.L73_splice|PSG1_uc002ouy.1_Splice_Site_p.L144_splice|PSG1_uc002ouz.1_Splice_Site_p.L144_splice|PSG1_uc002ova.1_Intron|PSG1_uc002ovc.2_Intron|PSG1_uc002ovd.1_Splice_Site_p.L144_splice	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				GGAGTCTCCACTGTGCAGAAA	0.527																0.037037	-40.450116	16.000542	9	234	KEEP	---	---	---	---	5	4	133	118	0.444444444444	capture	Splice_Site	SNP	43376198	43376198	PSG1	19	C	A	A	A	1	0	0	0	0	0	0	1	0	260	20	5	4	12548	4
ZNF534	147658	broad.mit.edu	37	19	52942411	52942411	+	Silent	SNP	G	A	A	rs113700997		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942411G>A	uc002pzk.2	+	4	1798	c.1737G>A	c.(1735-1737)GCG>GCA	p.A579A	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Silent_p.A566A	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	579	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACACCTTGCGCGACATAGGA	0.443																0.107143	2.605216	6.892762	3	25	KEEP	---	---	---	---	3	0	8	18	-1	capture	Silent	SNP	52942411	52942411	ZNF534	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17852	4
IL1RN	3557	broad.mit.edu	37	2	113890330	113890330	+	Missense_Mutation	SNP	C	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113890330C>A	uc002tjb.2	+	4	480	c.416C>A	c.(415-417)GCC>GAC	p.A139D	IL1RN_uc002tix.1_RNA|IL1RN_uc002tiy.2_Missense_Mutation_p.A105D|IL1RN_uc002tiz.2_Missense_Mutation_p.A142D|IL1RN_uc002tja.2_Missense_Mutation_p.A121D	NM_173842	NP_776214	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist isoform 1	139					immune response|inflammatory response|response to glucocorticoid stimulus	centrosome|extracellular space|nucleus|plasma membrane	cytokine activity|interleukin-1 receptor antagonist activity			skin(2)	2					Anakinra(DB00026)	TTTGAGTCTGCCGCCTGCCCC	0.572					97							Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				0.025751	-49.672582	8.439121	6	227	KEEP	---	---	---	---	4	3	125	163	0.428571428571	capture	Missense_Mutation	SNP	113890330	113890330	IL1RN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	7588	4
PPIG	9360	broad.mit.edu	37	2	170494029	170494029	+	Missense_Mutation	SNP	G	C	C			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170494029G>C	uc002uez.2	+	14	2481	c.2261G>C	c.(2260-2262)GGA>GCA	p.G754A	PPIG_uc010fpx.2_Missense_Mutation_p.G739A|PPIG_uc010fpy.2_Missense_Mutation_p.G747A|PPIG_uc002ufb.2_Missense_Mutation_p.G754A|PPIG_uc002ufd.2_Missense_Mutation_p.G751A	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G	754					protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	GACAAAAGCGGATGAGTGAGT	0.313																0.162162	29.65084	37.681768	12	62	KEEP	---	---	---	---	6	7	36	31	-1	capture	Missense_Mutation	SNP	170494029	170494029	PPIG	2	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	12225	4
TTN	7273	broad.mit.edu	37	2	179412263	179412263	+	Missense_Mutation	SNP	T	C	C			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179412263T>C	uc010zfg.1	-	288	86610	c.86386A>G	c.(86386-86388)AAG>GAG	p.K28796E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K22491E|TTN_uc010zfi.1_Missense_Mutation_p.K22424E|TTN_uc010zfj.1_Missense_Mutation_p.K22299E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29723							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGTGCGCTTGACACTGGAA	0.413					8722											0.471429	113.974945	114.024185	33	37	KEEP	---	---	---	---	18	16	19	20	-1	capture	Missense_Mutation	SNP	179412263	179412263	TTN	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	16617	4
COL6A3	1293	broad.mit.edu	37	2	238275663	238275663	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238275663G>A	uc002vwl.2	-	11	5452	c.5167C>T	c.(5167-5169)CTT>TTT	p.L1723F	COL6A3_uc002vwo.2_Missense_Mutation_p.L1517F|COL6A3_uc010znj.1_Missense_Mutation_p.L1116F	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1723	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGGTGCTCAAGGCCCACCTTA	0.547																0.337838	76.85306	78.573605	25	49	KEEP	---	---	---	---	15	13	37	25	-1	capture	Missense_Mutation	SNP	238275663	238275663	COL6A3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3666	4
BTBD3	22903	broad.mit.edu	37	20	11900455	11900455	+	Silent	SNP	C	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:11900455C>G	uc002wnz.2	+	3	866	c.507C>G	c.(505-507)GTC>GTG	p.V169V	BTBD3_uc002wny.2_Silent_p.V108V|BTBD3_uc002woa.2_Silent_p.V108V|BTBD3_uc010zrf.1_Silent_p.V18V|BTBD3_uc010zrg.1_Silent_p.V18V|BTBD3_uc010zrh.1_Silent_p.V18V	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN	BTB/POZ domain containing protein 3 isoform a	169	BTB.									ovary(2)|central_nervous_system(1)	3						TACCAGATGTCGAACCTGCTG	0.418																0.013559	-71.366485	8.217895	4	291	KEEP	---	---	---	---	1	3	169	153	-1	capture	Silent	SNP	11900455	11900455	BTBD3	20	C	G	G	G	1	0	0	0	0	0	0	0	1	392	31	4	4	1532	4
DEFB118	117285	broad.mit.edu	37	20	29960755	29960755	+	Nonsense_Mutation	SNP	C	T	T	rs34328728		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:29960755C>T	uc002wvr.2	+	2	180	c.154C>T	c.(154-156)CGA>TGA	p.R52*		NM_054112	NP_473453	Q96PH6	DB118_HUMAN	beta-defensin 118 precursor	52					cell-matrix adhesion|defense response to bacterium|innate immune response|spermatogenesis	extracellular region				ovary(3)|pancreas(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CAAAAATCTTCGAGCTTGCTG	0.438																0.323077	172.751426	178.173475	63	132	KEEP	---	---	---	---	25	39	60	75	-1	capture	Nonsense_Mutation	SNP	29960755	29960755	DEFB118	20	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4364	4
ASXL1	171023	broad.mit.edu	37	20	31022345	31022345	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31022345C>T	uc002wxs.2	+	12	2256	c.1830C>T	c.(1828-1830)GGC>GGT	p.G610G	ASXL1_uc010geb.2_Silent_p.G501G	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	610					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	p.Q592fs*5(1)|p.G610G(1)		haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						GTTGGACTGGCGCCAGGACCC	0.632						F|N|Mis		MDS|CMML								0.309524	67.725952	70.437569	26	58	KEEP	---	---	---	---	16	14	26	46	-1	capture	Silent	SNP	31022345	31022345	ASXL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1057	4
DLGAP4	22839	broad.mit.edu	37	20	35075140	35075140	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35075140G>A	uc002xff.2	+	7	1883	c.1448G>A	c.(1447-1449)TGC>TAC	p.C483Y	DLGAP4_uc010zvp.1_Missense_Mutation_p.C483Y	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	483					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GAGGCGGCCTGCGAGTCAGCC	0.647																0.348485	57.901689	59.240246	23	43	KEEP	---	---	---	---	9	18	26	24	-1	capture	Missense_Mutation	SNP	35075140	35075140	DLGAP4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4520	4
KRTAP19-3	337970	broad.mit.edu	37	21	31864264	31864264	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31864264G>A	uc002yog.1	-	1	12	c.12C>T	c.(10-12)TAC>TAT	p.Y4Y		NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	4						intermediate filament					0						AGTAGCTGCCGTAGTAGCTCA	0.547																0.311111	148.728762	154.451615	56	124	KEEP	---	---	---	---	56	76	102	170	-1	capture	Silent	SNP	31864264	31864264	KRTAP19-3	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8450	4
TPST2	8459	broad.mit.edu	37	22	26937269	26937269	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26937269G>A	uc003acv.2	-	2	496	c.328C>T	c.(328-330)CGC>TGC	p.R110C	TPST2_uc003acw.2_Missense_Mutation_p.R110C|TPST2_uc003acx.2_Missense_Mutation_p.R110C|TPST2_uc011akf.1_Missense_Mutation_p.R110C	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	110	Lumenal (Potential).				peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1						CAGGCCTGGCGCATGGCCAGC	0.697																0.333333	67.120843	69.041278	26	52	KEEP	---	---	---	---	14	20	30	38	-1	capture	Missense_Mutation	SNP	26937269	26937269	TPST2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16311	4
ITPR1	3708	broad.mit.edu	37	3	4816936	4816936	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:4816936G>A	uc003bqa.2	+	44	6194	c.5846G>A	c.(5845-5847)CGT>CAT	p.R1949H	ITPR1_uc010hca.1_Missense_Mutation_p.R1934H|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Missense_Mutation_p.R919H	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	1997	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		AACTTCCTCCGTTGCCAAAAT	0.483					2114											0.28479	238.784747	251.623323	88	221	KEEP	---	---	---	---	43	59	100	146	-1	capture	Missense_Mutation	SNP	4816936	4816936	ITPR1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7843	4
FGD5	152273	broad.mit.edu	37	3	14905722	14905722	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14905722G>A	uc003bzc.2	+	2	2723	c.2613G>A	c.(2611-2613)TCG>TCA	p.S871S	FGD5_uc011avk.1_Silent_p.S871S	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	871					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						AGAGAAGCTCGGAGGAGGAGG	0.597																0.375	127.431291	128.964102	42	70	KEEP	---	---	---	---	18	25	36	43	-1	capture	Silent	SNP	14905722	14905722	FGD5	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5782	4
CTBP1	1487	broad.mit.edu	37	4	1209830	1209830	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1209830G>A	uc003gcv.1	-	5	876	c.711C>T	c.(709-711)TGC>TGT	p.C237C	uc003gcs.1_RNA|CTBP1_uc003gct.1_Silent_p.C218C|CTBP1_uc003gcu.1_Silent_p.C226C|CTBP1_uc003gcw.2_5'Flank	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	C-terminal binding protein 1 isoform 1	237	NAD (By similarity).				interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		CGTTGAGGCCGCAGTGCAGGG	0.637					261											0.068182	-2.007279	6.478085	3	41	KEEP	---	---	---	---	1	2	30	20	-1	capture	Silent	SNP	1209830	1209830	CTBP1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	3961	4
HGFAC	3083	broad.mit.edu	37	4	3449235	3449235	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3449235G>A	uc003ghc.2	+	11	1375	c.1372G>A	c.(1372-1374)GTC>ATC	p.V458I	HGFAC_uc010icw.2_Missense_Mutation_p.V465I	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	458	Peptidase S1.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CAGGGACAGCGTCTCCGTGGT	0.667																0.311037	253.087646	262.58389	93	206	KEEP	---	---	---	---	44	56	112	111	-1	capture	Missense_Mutation	SNP	3449235	3449235	HGFAC	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7011	4
ADRA2C	152	broad.mit.edu	37	4	3769412	3769412	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3769412G>A	uc003ghm.2	+	1	1117	c.1079G>A	c.(1078-1080)CGG>CAG	p.R360Q	ADRA2C_uc010icx.2_Intron	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	360	Cytoplasmic (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	CTGTCGCGCCGGCGCCGGGCG	0.726	Esophageal Squamous(12;454 628 4517 14479)															0.388889	40.928522	41.287492	14	22	KEEP	---	---	---	---	10	5	9	15	-1	capture	Missense_Mutation	SNP	3769412	3769412	ADRA2C	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	339	4
AFM	173	broad.mit.edu	37	4	74354406	74354406	+	Missense_Mutation	SNP	T	C	C	rs139224995	byFrequency	TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74354406T>C	uc003hhb.2	+	7	804	c.773T>C	c.(772-774)CTT>CCT	p.L258P		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	258	Albumin 2.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTATTTCTCTTGTAGAAGAT	0.353																0.358382	213.405968	216.460003	62	111	KEEP	---	---	---	---	40	26	60	57	-1	capture	Missense_Mutation	SNP	74354406	74354406	AFM	4	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	361	4
FAT4	79633	broad.mit.edu	37	4	126373451	126373451	+	Silent	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:126373451G>A	uc003ifj.3	+	9	11280	c.11280G>A	c.(11278-11280)ACG>ACA	p.T3760T	FAT4_uc011cgp.1_Silent_p.T2058T|FAT4_uc003ifi.1_Silent_p.T1238T	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3760	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ACAATAGAACGTTTCTTTTGG	0.453																0.064378	-15.84427	30.11002	15	218	KEEP	---	---	---	---	6	10	123	110	-1	capture	Silent	SNP	126373451	126373451	FAT4	4	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5638	4
ENPP6	133121	broad.mit.edu	37	4	185074883	185074883	+	Missense_Mutation	SNP	C	T	T	rs142786439		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185074883C>T	uc003iwc.2	-	2	387	c.245G>A	c.(244-246)CGC>CAC	p.R82H		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	82	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TTCACAATGGCGGCCTATGTC	0.453																0.086022	2.129568	18.279097	8	85	KEEP	---	---	---	---	5	4	54	42	-1	capture	Missense_Mutation	SNP	185074883	185074883	ENPP6	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5089	4
PLEKHG4B	153478	broad.mit.edu	37	5	163558	163558	+	Missense_Mutation	SNP	C	T	T	rs148435989		TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:163558C>T	uc003jak.2	+	11	2353	c.2303C>T	c.(2302-2304)CCG>CTG	p.P768L		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	768					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AAGAAGCTCCCGCTGTGGCAG	0.652																0.31746	55.681469	57.545806	20	43	KEEP	---	---	---	---	25	28	64	74	-1	capture	Missense_Mutation	SNP	163558	163558	PLEKHG4B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11975	4
IPO11	51194	broad.mit.edu	37	5	61887491	61887491	+	Silent	SNP	T	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:61887491T>A	uc003jtc.2	+	28	2860	c.2670T>A	c.(2668-2670)ACT>ACA	p.T890T	IPO11_uc011cqr.1_Silent_p.T930T|IPO11_uc010iwr.2_Silent_p.T155T|IPO11_uc003jte.2_Silent_p.T9T	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	890						cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		AAACAGGAACTTATAAAGAGT	0.338																0.047619	-10.374096	7.930323	4	80	KEEP	---	---	---	---	3	1	41	52	-1	capture	Silent	SNP	61887491	61887491	IPO11	5	T	A	A	A	1	0	0	0	0	0	0	0	1	717	56	4	4	7716	4
SLC27A6	28965	broad.mit.edu	37	5	128301930	128301930	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128301930G>A	uc003kuy.2	+	2	496	c.100G>A	c.(100-102)GTG>ATG	p.V34M	SLC27A6_uc003kuz.2_Missense_Mutation_p.V34M	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	34	Helical; (Potential).				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CTTCTGGTTCGTGTTGAAGGT	0.463																0.147186	57.599846	85.219548	34	197	KEEP	---	---	---	---	19	18	101	125	-1	capture	Missense_Mutation	SNP	128301930	128301930	SLC27A6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14422	4
PCDHGA1	56114	broad.mit.edu	37	5	140712400	140712400	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140712400C>T	uc003lji.1	+	1	2149	c.2149C>T	c.(2149-2151)CGG>TGG	p.R717W	PCDHGA1_uc011dan.1_Missense_Mutation_p.R717W	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	717	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACAGGCTGCGGCGCTGGCA	0.657																0.433824	169.221553	169.735996	59	77	KEEP	---	---	---	---	35	39	44	57	-1	capture	Missense_Mutation	SNP	140712400	140712400	PCDHGA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11453	4
FAM153C	653316	broad.mit.edu	37	5	177466410	177466410	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177466410G>A	uc011dge.1	+	6	332	c.131G>A	c.(130-132)CGT>CAT	p.R44H	FAM153C_uc003mig.1_Missense_Mutation_p.R44H	NM_001079527	NP_001072995			hypothetical protein LOC653316												0	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTCCACAACGTGGTACGTAT	0.478																0.362434	394.062147	400.360479	137	241	KEEP	---	---	---	---	78	101	160	160	-1	capture	Missense_Mutation	SNP	177466410	177466410	FAM153C	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5416	4
ZC3H12D	340152	broad.mit.edu	37	6	149795611	149795611	+	Silent	SNP	C	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:149795611C>A	uc003qmn.1	-	1	139	c.69G>T	c.(67-69)GTG>GTT	p.V23V	PPIL4_uc010kic.2_Intron|ZC3H12D_uc003qmm.2_Silent_p.V23V|ZC3H12D_uc010kid.2_Silent_p.V23V	NM_207360	NP_997243	A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	23						cytoplasm|nucleus	endonuclease activity|nucleic acid binding|zinc ion binding				0		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		GCTTGCCCAACACCCGGAGCA	0.677																0.461538	36.997666	37.031131	12	14	KEEP	---	---	---	---	9	4	9	7	0.307692307692	capture	Silent	SNP	149795611	149795611	ZC3H12D	6	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	17444	4
CYCS	54205	broad.mit.edu	37	7	25163649	25163649	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:25163649C>T	uc003sxl.2	-	2	235	c.90G>A	c.(88-90)GGG>GGA	p.G30G		NM_018947	NP_061820	P99999	CYC_HUMAN	cytochrome c	30					activation of caspase activity by cytochrome c|DNA fragmentation involved in apoptotic nuclear change|induction of apoptosis by intracellular signals|respiratory electron transport chain|transport	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|mitochondrial matrix|nucleus|protein phosphatase type 2A complex|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding|protein binding			ovary(1)|lung(1)	2					Melatonin(DB01065)|Minocycline(DB01017)	GGAGATTTGGCCCAGTCTTGT	0.443					46											0.026144	-30.976221	6.880306	4	149	KEEP	---	---	---	---	3	1	76	79	-1	capture	Silent	SNP	25163649	25163649	CYCS	7	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	4096	4
NFE2L3	9603	broad.mit.edu	37	7	26225102	26225102	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:26225102G>A	uc003sxq.2	+	4	2056	c.1784G>A	c.(1783-1785)TGT>TAT	p.C595Y		NM_004289	NP_004280	Q9Y4A8	NF2L3_HUMAN	nuclear factor erythroid 2-like 3	595	Basic motif.				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			skin(3)|ovary(1)	4						GCGCAGAACTGTCGTAAACGC	0.368																0.031008	-24.207176	6.87594	4	125	KEEP	---	---	---	---	2	2	67	60	-1	capture	Missense_Mutation	SNP	26225102	26225102	NFE2L3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10276	4
JHDM1D	80853	broad.mit.edu	37	7	139824534	139824534	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139824534C>T	uc003vvm.2	-	7	942	c.938G>A	c.(937-939)CGT>CAT	p.R313H		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	313	JmjC.				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					AGATTCATAACGTGCCAAATT	0.358																0.274725	62.332368	66.494696	25	66	KEEP	---	---	---	---	12	14	35	34	-1	capture	Missense_Mutation	SNP	139824534	139824534	JHDM1D	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7871	4
OR2A2	442361	broad.mit.edu	37	7	143807248	143807248	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143807248C>T	uc011ktz.1	+	1	573	c.573C>T	c.(571-573)ACC>ACT	p.T191T		NM_001005480	NP_001005480	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A,	191	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.0783)					GTGCTGACACCTGGGTTAACC	0.512																0.233898	185.119075	204.236659	69	226	KEEP	---	---	---	---	41	35	133	120	-1	capture	Silent	SNP	143807248	143807248	OR2A2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	10881	4
PLAG1	5324	broad.mit.edu	37	8	57079222	57079222	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:57079222C>T	uc003xsq.3	-	3	1534	c.1083G>A	c.(1081-1083)ATG>ATA	p.M361I	PLAG1_uc003xsr.3_Missense_Mutation_p.M361I|PLAG1_uc010lyi.2_Missense_Mutation_p.M361I|PLAG1_uc010lyj.2_Missense_Mutation_p.M279I	NM_001114635	NP_001108107	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform b	361	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Repression domain; contains 3 sumoylation motifs and massively decrease transcription activity.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.M361I(1)	CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CTTGTAACTCCATCAGGTAAC	0.438					45	T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								0.317164	237.961816	245.93747	85	183	KEEP	---	---	---	---	53	47	103	121	-1	capture	Missense_Mutation	SNP	57079222	57079222	PLAG1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11921	4
MATN2	4147	broad.mit.edu	37	8	99044505	99044505	+	Silent	SNP	T	C	C			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99044505T>C	uc003yic.2	+	16	2772	c.2541T>C	c.(2539-2541)TCT>TCC	p.S847S	MATN2_uc010mbh.1_Silent_p.S806S|MATN2_uc003yid.2_Silent_p.S847S|MATN2_uc003yie.1_Silent_p.S847S|MATN2_uc010mbi.1_Silent_p.S680S|MATN2_uc010mbj.1_Silent_p.S208S|RPL30_uc010mbk.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	847						proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GACAGGACTCTCCAGCAGGGG	0.473																0.296296	25.190027	26.191663	8	19	KEEP	---	---	---	---	3	7	8	13	-1	capture	Silent	SNP	99044505	99044505	MATN2	8	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	9247	4
P2RY8	286530	broad.mit.edu	37	X	1584470	1584470	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584470C>T	uc004cpz.2	-	2	1230	c.982G>A	c.(982-984)GCC>ACC	p.A328T		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	328	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTGGTCCTGGCGGAGAAGAGG	0.682						T	CRLF2	B-ALL|Downs associated ALL								0.327684	152.032194	156.67171	58	119	KEEP	---	---	---	---	36	28	72	62	-1	capture	Missense_Mutation	SNP	1584470	1584470	P2RY8	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11259	4
GEMIN8	54960	broad.mit.edu	37	X	14027285	14027285	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:14027285C>T	uc004cwb.2	-	5	819	c.476G>A	c.(475-477)CGG>CAG	p.R159Q	GEMIN8_uc004cwc.2_Missense_Mutation_p.R159Q|GEMIN8_uc004cwd.2_Missense_Mutation_p.R159Q	NM_017856	NP_060326	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	159	Potential.				spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0						CTGCTGCTGCCGCCCTGAGAA	0.582																0.406091	241.971131	243.486656	80	117	KEEP	---	---	---	---	45	56	66	87	-1	capture	Missense_Mutation	SNP	14027285	14027285	GEMIN8	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6274	4
KLHL34	257240	broad.mit.edu	37	X	21674666	21674666	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21674666G>A	uc004czz.1	-	1	1783	c.1241C>T	c.(1240-1242)GCG>GTG	p.A414V		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	414	Kelch 2.									ovary(1)	1						GTGGGCCCGCGCTTCCCGCAT	0.721																0.391304	25.770477	26.008223	9	14	KEEP	---	---	---	---	5	8	11	17	-1	capture	Missense_Mutation	SNP	21674666	21674666	KLHL34	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8307	4
USP11	8237	broad.mit.edu	37	X	47102906	47102906	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47102906C>T	uc004dhp.2	+	13	1824	c.1824C>T	c.(1822-1824)TAC>TAT	p.Y608Y	USP11_uc004dhq.2_Silent_p.Y335Y	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	608					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						ACTCCTACTACGGCCTGATGC	0.592																0.265193	120.214637	129.237689	48	133	KEEP	---	---	---	---	22	31	78	68	-1	capture	Silent	SNP	47102906	47102906	USP11	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16924	4
ZNF81	347344	broad.mit.edu	37	X	47775654	47775654	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47775654G>A	uc010nhy.1	+	6	1977	c.1609G>A	c.(1609-1611)GAC>AAC	p.D537N		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	537	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)				GGCCTTCACCGACAGGTCAAA	0.443																0.289773	136.554327	143.525216	51	125	KEEP	---	---	---	---	25	30	59	84	-1	capture	Missense_Mutation	SNP	47775654	47775654	ZNF81	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	18050	4
ERCC6L	54821	broad.mit.edu	37	X	71424939	71424939	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71424939C>T	uc004eaq.1	-	2	3775	c.3678G>A	c.(3676-3678)GCG>GCA	p.A1226A	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.A1103A	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	1226	TPR 2.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					TTATGTCAAGCGCTTTAACTA	0.363																0.265306	101.463854	108.777709	39	108	KEEP	---	---	---	---	24	18	58	60	-1	capture	Silent	SNP	71424939	71424939	ERCC6L	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5173	4
TBX22	50945	broad.mit.edu	37	X	79286010	79286010	+	Silent	SNP	C	T	T			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79286010C>T	uc010nmg.1	+	9	1097	c.963C>T	c.(961-963)GGC>GGT	p.G321G	TBX22_uc004edi.1_Silent_p.G201G|TBX22_uc004edj.1_Silent_p.G321G	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	321					multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						GAAGCAGTGGCTCATCTCCAG	0.433					298											0.133971	41.144648	68.321933	28	181	KEEP	---	---	---	---	17	15	116	107	-1	capture	Silent	SNP	79286010	79286010	TBX22	23	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	15545	4
H2BFWT	158983	broad.mit.edu	37	X	103267902	103267902	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103267902G>A	uc004elr.2	-	1	355	c.331C>T	c.(331-333)CAT>TAT	p.H111Y		NM_001002916	NP_001002916	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	111					nucleosome assembly	nuclear membrane|nucleosome	DNA binding			ovary(1)	1						AATATGTCATGAACCAAAGAA	0.637																0.431193	131.574089	132.029038	47	62	KEEP	---	---	---	---	25	27	30	39	-1	capture	Missense_Mutation	SNP	103267902	103267902	H2BFWT	23	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	6859	4
FAM70A	55026	broad.mit.edu	37	X	119394752	119394752	+	Silent	SNP	A	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119394752A>G	uc004eso.3	-	10	1250	c.1023T>C	c.(1021-1023)TTT>TTC	p.F341F	FAM70A_uc004esp.3_Silent_p.F317F|FAM70A_uc010nqo.2_Silent_p.F233F	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	341	Pro-rich.					integral to membrane				lung(1)|breast(1)	2						GTGGCTTTTCAAAAGGTGGAT	0.507																0.026846	-30.026383	6.828674	4	145	KEEP	---	---	---	---	3	2	78	92	-1	capture	Silent	SNP	119394752	119394752	FAM70A	23	A	G	G	G	1	0	0	0	0	0	0	0	1	63	5	3	3	5553	4
F9	2158	broad.mit.edu	37	X	138623341	138623341	+	Missense_Mutation	SNP	T	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138623341T>G	uc004fas.1	+	4	413	c.384T>G	c.(382-384)TGT>TGG	p.C128W	F9_uc004fat.1_Intron	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	128	EGF-like 1; calcium-binding (Potential).				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	GAAAGAACTGTGAATTAGGTA	0.348																0.035398	-18.000001	8.503098	4	109	KEEP	---	---	---	---	2	2	54	61	-1	capture	Missense_Mutation	SNP	138623341	138623341	F9	23	T	G	G	G	1	0	0	0	0	1	0	0	0	764	59	4	4	5305	4
GABRA3	2556	broad.mit.edu	37	X	151336828	151336828	+	Missense_Mutation	SNP	T	A	A			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151336828T>A	uc010ntk.1	-	10	1591	c.1351A>T	c.(1351-1353)AGT>TGT	p.S451C		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	451	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TTGCTGACACTGTTGTAGGTC	0.527	NSCLC(142;2578 2613 10251 16743)															0.263006	243.668919	261.244807	91	255	KEEP	---	---	---	---	51	49	154	119	-1	capture	Missense_Mutation	SNP	151336828	151336828	GABRA3	23	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	6104	4
CTAG2	30848	broad.mit.edu	37	X	153880614	153880614	+	Silent	SNP	T	C	C			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153880614T>C	uc004fmi.1	-	2	614	c.561A>G	c.(559-561)CCA>CCG	p.P187P	CTAG2_uc004fmh.1_Intron	NM_020994	NP_066274	O75638	CTAG2_HUMAN	cancer/testis antigen 2 isoform LAGE-1b	187	Poly-Pro.					centrosome				pancreas(1)	1	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTCCCTCGGGTGGCGGCGGGC	0.602																0.027624	-35.953353	8.569472	5	176	KEEP	---	---	---	---	4	4	142	114	-1	capture	Silent	SNP	153880614	153880614	CTAG2	23	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	3956	4
F8	2157	broad.mit.edu	37	X	154156957	154156957	+	Missense_Mutation	SNP	T	G	G			TCGA-02-0055-01	TCGA-02-0055-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154156957T>G	uc004fmt.2	-	14	5279	c.5108A>C	c.(5107-5109)GAA>GCA	p.E1703A		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1703					acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GCTCTGATTTTCATCCTCATC	0.408					359											0.030075	-23.004366	9.21429	4	129	KEEP	---	---	---	---	3	1	59	73	-1	capture	Missense_Mutation	SNP	154156957	154156957	F8	23	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	5304	4
