Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AADACL4	343066	broad.mit.edu	37	1	12726313	12726313	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12726313G>A	uc001auf.2	+	4	791	c.791G>A	c.(790-792)CGT>CAT	p.R264H		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	264	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CTCTCCTGGCGTGACGCCATC	0.498																0.464286	324.983389	325.23165	104	120	KEEP	---	---	---	---	40	67	66	58	-1	capture	Missense_Mutation	SNP	12726313	12726313	AADACL4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13	15
MDM4	4194	broad.mit.edu	37	1	204507404	204507404	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204507404C>G	uc001hba.2	+	7	641	c.479C>G	c.(478-480)ACC>AGC	p.T160S	MDM4_uc001hbd.1_RNA|MDM4_uc010pqw.1_RNA|MDM4_uc010pqx.1_Missense_Mutation_p.T33S|MDM4_uc001hay.1_Missense_Mutation_p.T160S|MDM4_uc001hbb.2_Missense_Mutation_p.T33S|MDM4_uc010pqy.1_Intron|MDM4_uc001hbc.2_RNA|MDM4_uc009xbe.1_RNA	NM_002393	NP_002384	O15151	MDM4_HUMAN	mouse double minute 4 homolog	160					apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding	p.T160S(1)		upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ACACTGCCTACCTCAGAGCAT	0.393					191	A		GBM|bladder|retinoblastoma								0.397849	265.515624	267.213002	74	112	KEEP	---	---	---	---	35	44	64	62	-1	capture	Missense_Mutation	SNP	204507404	204507404	MDM4	1	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	9327	15
CR1L	1379	broad.mit.edu	37	1	207868047	207868047	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207868047G>T	uc001hga.3	+	5	934	c.813G>T	c.(811-813)AAG>AAT	p.K271N	CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	271	Sushi 4.					cytoplasm|extracellular region|membrane					0						CCCATGTGAAGTGCCAGGCCC	0.507																0.142857	57.839445	85.380692	32	192	KEEP	---	---	---	---	19	13	89	108	0.59375	capture	Missense_Mutation	SNP	207868047	207868047	CR1L	1	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	3806	15
USH2A	7399	broad.mit.edu	37	1	216052218	216052218	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216052218T>G	uc001hku.1	-	42	8833	c.8446A>C	c.(8446-8448)ACT>CCT	p.T2816P		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2816	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGGGGTGAGTGGTAACATAG	0.458													HNSCC(13;0.011)			0.448718	227.556683	227.90896	70	86	KEEP	---	---	---	---	30	44	51	43	-1	capture	Missense_Mutation	SNP	216052218	216052218	USH2A	1	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	16918	15
CRTAC1	55118	broad.mit.edu	37	10	99696002	99696002	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:99696002C>T	uc001kou.1	-	3	702	c.346G>A	c.(346-348)GGG>AGG	p.G116R	CRTAC1_uc001kov.2_Missense_Mutation_p.G105R|CRTAC1_uc001kot.1_5'UTR	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	116	FG-GAP 2; atypical.					proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GCTGTGACCCCGATGGCGTTC	0.632																0.232558	24.187111	26.962843	10	33	KEEP	---	---	---	---	10	3	23	22	-1	capture	Missense_Mutation	SNP	99696002	99696002	CRTAC1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3861	15
LRRC56	115399	broad.mit.edu	37	11	544759	544759	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:544759G>A	uc010qvz.1	+	6	810	c.305G>A	c.(304-306)GGC>GAC	p.G102D		NM_198075	NP_932341	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	102	LRR 1.									skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGCTGAACGGCAGCCACCTG	0.701																0.647059	35.72892	36.052676	11	6	KEEP	---	---	---	---	6	5	5	3	-1	capture	Missense_Mutation	SNP	544759	544759	LRRC56	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8927	15
SLC22A25	387601	broad.mit.edu	37	11	62995959	62995959	+	Silent	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62995959G>A	uc001nwr.1	-	2	480	c.480C>T	c.(478-480)GGC>GGT	p.G160G	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_Intron|SLC22A25_uc001nwt.1_Silent_p.G160G	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	160	Helical; Name=2; (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						CATATAGGTTGCCTCCCACCA	0.408																0.457143	94.899956	95.010677	32	38	KEEP	---	---	---	---	21	12	18	22	-1	capture	Silent	SNP	62995959	62995959	SLC22A25	11	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	14346	15
EXPH5	23086	broad.mit.edu	37	11	108382300	108382300	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108382300C>T	uc001pkk.2	-	6	4045	c.3934G>A	c.(3934-3936)GAA>AAA	p.E1312K	EXPH5_uc010rvy.1_Missense_Mutation_p.E1124K|EXPH5_uc010rvz.1_Missense_Mutation_p.E1156K|EXPH5_uc010rwa.1_Missense_Mutation_p.E1236K	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1312					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTTAGATTTTCACATGAAGGT	0.413																0.264516	107.102314	114.873544	41	114	KEEP	---	---	---	---	26	18	71	57	-1	capture	Missense_Mutation	SNP	108382300	108382300	EXPH5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	5277	15
C12orf11	55726	broad.mit.edu	37	12	27059333	27059333	+	Silent	SNP	G	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27059333G>T	uc001rhk.3	-	16	2520	c.1983C>A	c.(1981-1983)ATC>ATA	p.I661I	C12orf11_uc001rhj.3_Silent_p.I229I|C12orf11_uc010sjk.1_Silent_p.I560I	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN	hypothetical protein LOC55726	661					cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)					TGGCAGTATTGATTCTATTAC	0.308																0.117391	31.656311	64.765811	27	203	KEEP	---	---	---	---	19	11	99	123	0.633333333333	capture	Silent	SNP	27059333	27059333	C12orf11	12	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	1661	15
LRRK2	120892	broad.mit.edu	37	12	40668431	40668431	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40668431C>G	uc001rmg.3	+	15	1824	c.1703C>G	c.(1702-1704)TCT>TGT	p.S568C	LRRK2_uc001rmh.1_Missense_Mutation_p.S190C	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	568					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAAGTAATTTCTTCTATTGTA	0.358					1771											0.227119	194.672845	214.831022	67	228	KEEP	---	---	---	---	44	28	133	117	-1	capture	Missense_Mutation	SNP	40668431	40668431	LRRK2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	8948	15
ANKRD52	283373	broad.mit.edu	37	12	56638930	56638930	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56638930A>G	uc001skm.3	-	22	2539	c.2449T>C	c.(2449-2451)TCG>CCG	p.S817P		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	817	ANK 23.						protein binding			ovary(2)	2						TCCAGGTACGAAAACGGGCTG	0.522																0.409357	244.722329	245.948777	70	101	KEEP	---	---	---	---	39	46	49	62	-1	capture	Missense_Mutation	SNP	56638930	56638930	ANKRD52	12	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	673	15
ANKRD52	283373	broad.mit.edu	37	12	56639372	56639372	+	Silent	SNP	A	C	C			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56639372A>C	uc001skm.3	-	21	2283	c.2193T>G	c.(2191-2193)ACT>ACG	p.T731T		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	731	ANK 21.						protein binding			ovary(2)	2						CCTCACAGCCAGTCACTGCCT	0.587																0.6	126.93955	127.51011	39	26	KEEP	---	---	---	---	24	24	25	17	-1	capture	Silent	SNP	56639372	56639372	ANKRD52	12	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	673	15
IL22	50616	broad.mit.edu	37	12	68647046	68647046	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68647046C>G	uc001sty.1	-	1	236	c.183G>C	c.(181-183)AAG>AAC	p.K61N	IL22_uc010stb.1_Missense_Mutation_p.K61N	NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22 precursor	61					acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		TGTATACCTCCTTAGCCAGCA	0.483																0.346154	126.815147	129.541057	45	85	KEEP	---	---	---	---	23	29	42	53	-1	capture	Missense_Mutation	SNP	68647046	68647046	IL22	12	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	7595	15
RPLP0	6175	broad.mit.edu	37	12	120636422	120636422	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120636422C>T	uc001txp.2	-	6	823	c.586G>A	c.(586-588)GGC>AGC	p.G196S	RPLP0_uc001txq.2_Missense_Mutation_p.G196S|RPLP0_uc001txr.2_Intron|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	196					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TAGATGCTGCCATTGTCGAAC	0.532																0.033708	-14.758913	6.337283	3	86	KEEP	---	---	---	---	0	3	57	48	-1	capture	Missense_Mutation	SNP	120636422	120636422	RPLP0	12	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	13496	15
HIP1R	9026	broad.mit.edu	37	12	123346052	123346052	+	Silent	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123346052G>A	uc001udj.1	+	31	3209	c.3150G>A	c.(3148-3150)CAG>CAA	p.Q1050Q	HIP1R_uc001udk.1_Silent_p.Q315Q	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	1050					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		CCCCCAGACAGGACCACCAGG	0.677																0.107692	7.57621	17.498048	7	58	KEEP	---	---	---	---	2	7	22	43	-1	capture	Silent	SNP	123346052	123346052	HIP1R	12	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7040	15
NALCN	259232	broad.mit.edu	37	13	102047697	102047697	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:102047697C>T	uc001vox.1	-	3	317	c.128G>A	c.(127-129)CGC>CAC	p.R43H	NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Missense_Mutation_p.R43H|NALCN_uc001vpa.2_Missense_Mutation_p.R43H	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	43	Helical; Name=S1 of repeat I; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGCACAGATGCGCAGCAAAGA	0.433																0.129032	17.33898	29.799841	12	81	KEEP	---	---	---	---	10	6	32	54	-1	capture	Missense_Mutation	SNP	102047697	102047697	NALCN	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10057	15
OR4N2	390429	broad.mit.edu	37	14	20295961	20295961	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20295961G>A	uc010tkv.1	+	1	354	c.354G>A	c.(352-354)ATG>ATA	p.M118I		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTGTTGTGATGGCCTTTGACC	0.517																0.046122	-65.147412	39.771643	22	455	KEEP	---	---	---	---	20	19	312	264	-1	capture	Missense_Mutation	SNP	20295961	20295961	OR4N2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	10981	15
SIN3A	25942	broad.mit.edu	37	15	75705213	75705213	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75705213A>G	uc002bai.2	-	5	906	c.647T>C	c.(646-648)ATC>ACC	p.I216T	SIN3A_uc002baj.2_Missense_Mutation_p.I216T|SIN3A_uc010uml.1_Missense_Mutation_p.I216T	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	216	Interaction with REST (By similarity).			I -> T (in Ref. 3; BAC04801).	blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						ctgtggctggATGCCATGGGT	0.279																0.102564	0.675686	6.832831	4	35	KEEP	---	---	---	---	7	12	21	21	-1	capture	Missense_Mutation	SNP	75705213	75705213	SIN3A	15	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	14218	15
DHX38	9785	broad.mit.edu	37	16	72130894	72130894	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72130894G>A	uc002fcb.2	+	3	852	c.497G>A	c.(496-498)CGC>CAC	p.R166H	TXNL4B_uc010vmo.1_5'Flank|DHX38_uc010vmp.1_Intron|DHX38_uc010cgn.1_RNA	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	166					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)				GACTATGACCGCAAGAGGGAC	0.488	Melanoma(97;711 1442 7855 13832 28836)															0.038835	-15.694379	7.968331	4	99	KEEP	---	---	---	---	3	1	47	57	-1	capture	Missense_Mutation	SNP	72130894	72130894	DHX38	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4469	15
OR3A1	4994	broad.mit.edu	37	17	3195464	3195464	+	Missense_Mutation	SNP	C	T	T	rs143631940		TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3195464C>T	uc002fvh.1	-	1	413	c.413G>A	c.(412-414)CGC>CAC	p.R138H		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						CTGACTCATGCGGGTGCTGTA	0.582	GBM(20;287 516 18743 28660 36594)															0.020833	-42.352737	6.977666	4	188	KEEP	---	---	---	---	1	3	111	102	-1	capture	Missense_Mutation	SNP	3195464	3195464	OR3A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10941	15
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	Pancreas(47;798 1329 9957 10801)	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	p.R248L(NCIH211-Tumor)|p.R248L(NB4-Tumor)|p.R248L(PC14-Tumor)|p.R248L(KYO1-Tumor)|p.R248L(PCM6-Tumor)|p.R248L(NUDHL1-Tumor)|p.R248L(BL41-Tumor)|p.R248Q(FADU-Tumor)|p.R248L(CI1-Tumor)|p.R248L(SW1463-Tumor)|p.R248L(COLO699-Tumor)|p.R248L(HS683-Tumor)|p.R248*(DB-Tumor)|p.R248L(HCC1143-Tumor)|p.R248L(NCIN87-Tumor)|p.R248A(SF126-Tumor)|p.R248L(PANC02.03-Tumor)|p.R248L(HEC1B-Tumor)|p.R248L(PECAPJ15-Tumor)|p.R248L(LNCAPCLONEFGC-Tumor)|p.R248L(NIHOVCAR3-Tumor)|p.R248L(NUDUL1-Tumor)|p.R248L(ONCODG1-Tumor)|p.R248L(RT112-Tumor)|p.R248L(SF295-Tumor)|p.R248L(P12ICHIKAWA-Tumor)|p.R248L(DND41-Tumor)|p.R248Q(SBC5-Tumor)|p.R248L(KOPN8-Tumor)|p.R248L(KASUMI1-Tumor)|p.R248L(EM2-Tumor)|p.R248L(SKUT1-Tumor)|p.R248L(NCCSTCK140-Tumor)|p.R248L(TE6-Tumor)|p.R248L(MOLM6-Tumor)|p.R248L(SEM-Tumor)|p.R248L(NAMALWA-Tumor)|p.R248L(CA46-Tumor)|p.R248L(639V-Tumor)|p.R248L(SKM1-Tumor)|p.R248Q(NCIH1573-Tumor)|p.R248Q(NCIH1618-Tumor)|p.R248L(HCC70-Tumor)|p.R248L(WSUDLCL2-Tumor)|p.R248L(HEC1A-Tumor)|p.R248L(KYSE150-Tumor)|p.R248L(HSC4-Tumor)|p.R248L(CL40-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.945205	250.35514	260.533338	69	4	KEEP	---	---	---	---	49	31	2	3	-1	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	15
CALR3	125972	broad.mit.edu	37	19	16593572	16593572	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16593572C>T	uc002ned.2	-	6	766	c.703G>A	c.(703-705)GCC>ACC	p.A235T	MED26_uc002nee.2_RNA	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor	235	4 X approximate repeats.|P-domain.|1-4.				protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						CTGGTGCTGGCGTCCAGAAAA	0.458																0.462963	78.887831	78.949919	25	29	KEEP	---	---	---	---	17	12	18	11	-1	capture	Missense_Mutation	SNP	16593572	16593572	CALR3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2569	15
ZNF790	388536	broad.mit.edu	37	19	37310870	37310870	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37310870G>A	uc002oew.2	-	5	495	c.376C>T	c.(376-378)CAG>TAG	p.Q126*	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTTTGAAACTGAGTGTTGCCT	0.383																0.420074	339.720251	341.222223	113	156	KEEP	---	---	---	---	55	69	93	74	-1	capture	Nonsense_Mutation	SNP	37310870	37310870	ZNF790	19	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	18038	15
SIGLEC6	946	broad.mit.edu	37	19	52033694	52033694	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52033694C>T	uc002pwy.2	-	4	913	c.751G>A	c.(751-753)GCA>ACA	p.A251T	SIGLEC6_uc002pwz.2_Intron|SIGLEC6_uc002pxa.2_Missense_Mutation_p.A251T|SIGLEC6_uc010ydb.1_Intron|SIGLEC6_uc010ydc.1_Missense_Mutation_p.A251T|SIGLEC6_uc010eoz.1_Missense_Mutation_p.A229T|SIGLEC6_uc010epb.1_Missense_Mutation_p.A204T|SIGLEC6_uc010epa.1_Missense_Mutation_p.A240T	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	251	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TTCCTACCTGCGCTGTTTCCT	0.562																0.222222	19.581469	22.136402	8	28	KEEP	---	---	---	---	3	8	15	20	-1	capture	Missense_Mutation	SNP	52033694	52033694	SIGLEC6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14205	15
OLA1	29789	broad.mit.edu	37	2	174945887	174945887	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174945887G>C	uc002uih.2	-	9	1145	c.959C>G	c.(958-960)ACC>AGC	p.T320S	OLA1_uc002uii.2_Missense_Mutation_p.T162S|OLA1_uc010fqq.2_Missense_Mutation_p.T299S|OLA1_uc002uij.2_Missense_Mutation_p.T162S|OLA1_uc002uik.2_Missense_Mutation_p.T290S|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1	320					ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						TACCCTGATGGTCCATGCACG	0.418																0.04717	-10.297857	12.837918	5	101	KEEP	---	---	---	---	0	5	63	47	-1	capture	Missense_Mutation	SNP	174945887	174945887	OLA1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	10755	15
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.311321	90.333576	93.69546	33	73	KEEP	---	---	---	---	21	15	41	37	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	15
DEFB125	245938	broad.mit.edu	37	20	77035	77035	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:77035C>T	uc002wcw.2	+	2	448	c.448C>T	c.(448-450)CAG>TAG	p.Q150*		NM_153325	NP_697020	Q8N687	DB125_HUMAN	defensin, beta 125 preproprotein	150					defense response to bacterium	extracellular region				ovary(1)|central_nervous_system(1)|skin(1)	3		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.156)			ACCACCTTCTCAGACAGCTCT	0.428																0.47013	538.020613	538.321486	181	204	KEEP	---	---	---	---	94	110	103	128	-1	capture	Nonsense_Mutation	SNP	77035	77035	DEFB125	20	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	4369	15
ZNF343	79175	broad.mit.edu	37	20	2464182	2464182	+	Silent	SNP	A	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2464182A>G	uc002wge.1	-	6	1913	c.1425T>C	c.(1423-1425)AGT>AGC	p.S475S	ZNF343_uc010gao.1_Silent_p.S475S|ZNF343_uc002wgd.1_Silent_p.S385S	NM_024325	NP_077301	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	475	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						GTGATTTCCGACTAAAGCCTC	0.527																0.030303	-17.059959	6.895466	3	96	KEEP	---	---	---	---	2	2	47	53	-1	capture	Silent	SNP	2464182	2464182	ZNF343	20	A	G	G	G	1	0	0	0	0	0	0	0	1	128	10	3	3	17738	15
HMOX1	3162	broad.mit.edu	37	22	35783113	35783113	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:35783113G>A	uc003ant.1	+	3	660	c.580G>A	c.(580-582)GCA>ACA	p.A194T		NM_002133	NP_002124	P09601	HMOX1_HUMAN	heme oxygenase (decyclizing) 1	194					angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)	GATGACTCCCGCAGTCAGGCA	0.622																0.467742	178.246367	178.357698	58	66	KEEP	---	---	---	---	34	29	31	39	-1	capture	Missense_Mutation	SNP	35783113	35783113	HMOX1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7168	15
PROS1	5627	broad.mit.edu	37	3	93611922	93611922	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:93611922A>G	uc003drb.3	-	10	1351	c.1010T>C	c.(1009-1011)GTG>GCG	p.V337A	PROS1_uc010hoo.2_Missense_Mutation_p.V206A|PROS1_uc003dqz.3_Missense_Mutation_p.V206A	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	337	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	GTACAGTATCACGCCTTCTGA	0.398																0.04	-10.238629	6.864561	3	72	KEEP	---	---	---	---	0	3	39	38	-1	capture	Missense_Mutation	SNP	93611922	93611922	PROS1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	12454	15
C3orf22	152065	broad.mit.edu	37	3	126268815	126268815	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126268815G>A	uc003ejb.2	-	4	651	c.322C>T	c.(322-324)CGC>TGC	p.R108C		NM_152533	NP_689746	Q8N5N4	CC022_HUMAN	hypothetical protein LOC152065	108											0				GBM - Glioblastoma multiforme(114;0.147)		GGGAAGCGGCGACTCAGCAAC	0.632																0.177419	23.492393	29.564733	11	51	KEEP	---	---	---	---	4	8	24	30	-1	capture	Missense_Mutation	SNP	126268815	126268815	C3orf22	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2195	15
CHST2	9435	broad.mit.edu	37	3	142841108	142841108	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142841108C>T	uc003evm.2	+	2	2339	c.1450C>T	c.(1450-1452)CGG>TGG	p.R484W		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	484	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3						CAATGCCTGGCGGACCGCCCT	0.607																0.16092	24.800206	34.316559	14	73	KEEP	---	---	---	---	6	11	51	46	-1	capture	Missense_Mutation	SNP	142841108	142841108	CHST2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3369	15
ZNF721	170960	broad.mit.edu	37	4	437518	437518	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:437518C>G	uc003gag.2	-	3	1429	c.738G>C	c.(736-738)GAG>GAC	p.E246D	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Missense_Mutation_p.E278D|ZNF721_uc010ibe.2_Missense_Mutation_p.E234D	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	246						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TGTAGGGTTTCTCTCCAGTAT	0.368																0.163043	36.165152	46.091082	15	77	KEEP	---	---	---	---	9	7	38	40	-1	capture	Missense_Mutation	SNP	437518	437518	ZNF721	4	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	17998	15
FAM193A	8603	broad.mit.edu	37	4	2661629	2661629	+	Silent	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2661629C>T	uc010icl.2	+	8	1071	c.720C>T	c.(718-720)CTC>CTT	p.L240L	FAM193A_uc010ick.2_Silent_p.L440L|FAM193A_uc003gfd.2_Silent_p.L240L|FAM193A_uc011bvm.1_Silent_p.L264L|FAM193A_uc011bvn.1_Silent_p.L240L|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Silent_p.L94L	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	240										ovary(3)	3						TTCACCAGCTCCCACTTCAAG	0.562																0.207317	76.956205	89.976677	34	130	KEEP	---	---	---	---	19	21	79	69	-1	capture	Silent	SNP	2661629	2661629	FAM193A	4	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	5476	15
ZNF518B	85460	broad.mit.edu	37	4	10446518	10446518	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10446518C>T	uc003gmn.2	-	3	1922	c.1435G>A	c.(1435-1437)GTT>ATT	p.V479I		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	479					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						TTTAAGGCAACGGAAGGAAAA	0.348																0.483871	196.103234	196.130813	60	64	KEEP	---	---	---	---	35	27	32	36	-1	capture	Missense_Mutation	SNP	10446518	10446518	ZNF518B	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17842	15
EXOC1	55763	broad.mit.edu	37	4	56750010	56750010	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56750010C>T	uc003hbe.1	+	10	1404	c.1246C>T	c.(1246-1248)CGA>TGA	p.R416*	EXOC1_uc003hbf.1_Nonsense_Mutation_p.R416*|EXOC1_uc003hbg.1_Nonsense_Mutation_p.R416*	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1	416					exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					TTATTTATCCCGACTATATGA	0.299																0.184211	17.204881	20.757412	7	31	KEEP	---	---	---	---	3	4	14	21	-1	capture	Nonsense_Mutation	SNP	56750010	56750010	EXOC1	4	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	5256	15
SLC12A2	6558	broad.mit.edu	37	5	127420118	127420118	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127420118G>C	uc003kus.2	+	1	636	c.472G>C	c.(472-474)GAT>CAT	p.D158H	FLJ33630_uc003kun.2_5'Flank|FLJ33630_uc003kuo.2_5'Flank|FLJ33630_uc003kup.1_5'Flank|FLJ33630_uc003kuq.1_5'Flank|FLJ33630_uc003kur.2_5'Flank|SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.D158H	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	158	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAGCCTGTCAGATGCTGCCGG	0.692																0.457143	48.890738	48.947236	16	19	KEEP	---	---	---	---	8	12	11	10	-1	capture	Missense_Mutation	SNP	127420118	127420118	SLC12A2	5	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14276	15
PCDHA10	56139	broad.mit.edu	37	5	140237249	140237249	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140237249G>C	uc003lhx.2	+	1	1616	c.1616G>C	c.(1615-1617)GGG>GCG	p.G539A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.G539A	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	539	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGCGATGGGGGCGTGCCG	0.687																0.079365	-4.129366	7.504374	5	58	KEEP	---	---	---	---	3	4	31	35	-1	capture	Missense_Mutation	SNP	140237249	140237249	PCDHA10	5	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	11423	15
MYOZ3	91977	broad.mit.edu	37	5	150050115	150050115	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150050115G>A	uc003lss.2	+	3	718	c.131G>A	c.(130-132)CGC>CAC	p.R44H	MYOZ3_uc003lsr.2_Missense_Mutation_p.R44H	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3	44						sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGTCACTACGCAACAACAGA	0.607																0.25	21.184715	23.002534	8	24	KEEP	---	---	---	---	3	7	13	13	-1	capture	Missense_Mutation	SNP	150050115	150050115	MYOZ3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10007	15
PSMB8	5696	broad.mit.edu	37	6	32809494	32809494	+	Missense_Mutation	SNP	C	T	T	rs78945358	by1000genomes	TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32809494C>T	uc003oce.2	-	5	599	c.556G>A	c.(556-558)GTG>ATG	p.V186M	TAP2_uc011dqf.1_5'Flank|TAP2_uc003ocb.1_5'Flank|TAP2_uc003ocd.2_5'Flank|PSMB8_uc003ocf.2_Missense_Mutation_p.V182M	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	186					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						TGTTCATCCACGTAGTAGAGT	0.463	NSCLC(48;53 1172 10859 13624 22883)															0.236364	96.559926	107.031227	39	126	KEEP	---	---	---	---	23	17	78	59	-1	capture	Missense_Mutation	SNP	32809494	32809494	PSMB8	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12578	15
FABP7	2173	broad.mit.edu	37	6	123101455	123101455	+	Silent	SNP	G	A	A			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:123101455G>A	uc003pzf.2	+	2	387	c.93G>A	c.(91-93)AGG>AGA	p.R31R	FABP7_uc003pzd.2_Silent_p.R31R|FABP7_uc003pze.1_Silent_p.R31R	NM_001446	NP_001437	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain	31					negative regulation of cell proliferation	cytoplasm	lipid binding|transporter activity				0				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|gamma-Homolinolenic acid(DB00154)|Icosapent(DB00159)	TTGCCACTAGGCAGGTGGGAA	0.448																0.107692	7.473695	17.397436	7	58	KEEP	---	---	---	---	6	3	28	31	-1	capture	Silent	SNP	123101455	123101455	FABP7	6	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5316	15
DYNC1I1	1780	broad.mit.edu	37	7	95657586	95657586	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95657586C>T	uc003uoc.3	+	11	1397	c.1120C>T	c.(1120-1122)CGA>TGA	p.R374*	DYNC1I1_uc003uod.3_Nonsense_Mutation_p.R357*|DYNC1I1_uc003uob.2_Nonsense_Mutation_p.R337*|DYNC1I1_uc003uoe.3_Nonsense_Mutation_p.R354*|DYNC1I1_uc010lfl.2_Nonsense_Mutation_p.R363*	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	374	WD 2.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCGCAGTCATCGAAGGACTCC	0.547																0.190751	75.27495	90.738073	33	140	KEEP	---	---	---	---	19	22	92	66	-1	capture	Nonsense_Mutation	SNP	95657586	95657586	DYNC1I1	7	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4797	15
JPH1	56704	broad.mit.edu	37	8	75156952	75156952	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:75156952A>G	uc003yae.2	-	4	1757	c.1717T>C	c.(1717-1719)TCC>CCC	p.S573P	JPH1_uc003yaf.2_Missense_Mutation_p.S573P|JPH1_uc003yag.1_Missense_Mutation_p.S437P	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	573	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GACTGGCTGGATCCATCGCCG	0.552																0.019324	-45.463167	8.238684	4	203	KEEP	---	---	---	---	5	12	129	86	-1	capture	Missense_Mutation	SNP	75156952	75156952	JPH1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	7883	15
P2RY8	286530	broad.mit.edu	37	X	1584564	1584564	+	Silent	SNP	C	T	T			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584564C>T	uc004cpz.2	-	2	1136	c.888G>A	c.(886-888)GCG>GCA	p.A296A		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	296	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATTCCCGGGACGCAAAGTAAT	0.602						T	CRLF2	B-ALL|Downs associated ALL								0.27	67.080357	71.85394	27	73	KEEP	---	---	---	---	17	12	45	42	-1	capture	Silent	SNP	1584564	1584564	P2RY8	23	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11259	15
MCL1	4170	broad.mit.edu	37	1	150550855	150550856	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150550855_150550856delGA	uc001euz.2	-	2	930_931	c.800_801delTC	c.(799-801)CTCfs	p.L267fs	MCL1_uc010pch.1_Frame_Shift_Del_p.L157fs|MCL1_uc001eva.2_Intron	NM_021960	NP_068779	Q07820	MCL1_HUMAN	myeloid cell leukemia sequence 1 isoform 1	267	BH1.				anti-apoptosis|apoptosis|cell fate determination|cellular homeostasis|multicellular organismal development|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nucleoplasm	BH3 domain binding|protein binding|protein channel activity|protein heterodimerization activity				0	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CAAAAGAAATGAGAGTCACAAT	0.436					115											0.18			24	106		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	150550855	150550856	MCL1	1	GA	-	-	-	1	0	1	0	1	0	0	0	0	574	45	5	5	9297	15
C10orf46	143384	broad.mit.edu	37	10	120513921	120513923	+	In_Frame_Del	DEL	GGA	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:120513921_120513923delGGA	uc001lds.1	-	1	836_838	c.352_354delTCC	c.(352-354)TCCdel	p.S118del	C10orf46_uc010qst.1_RNA	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46	118					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		ACTTGGAGGTGGAGGTGTTGATG	0.621																0.33			3	6		---	---	---	---						capture_indel	In_Frame_Del	DEL	120513921	120513923	C10orf46	10	GGA	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	1592	15
CREBZF	58487	broad.mit.edu	37	11	85375242	85375244	+	In_Frame_Del	DEL	CTT	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:85375242_85375244delCTT	uc001pas.2	-	1	939_941	c.676_678delAAG	c.(676-678)AAGdel	p.K226del	CREBZF_uc010rtc.1_RNA|CREBZF_uc010rtd.1_RNA	NM_001039618	NP_001034707	Q9NS37	ZHANG_HUMAN	HCF-binding transcription factor Zhangfei	226	Basic motif.				negative regulation of gene expression, epigenetic|negative regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|response to virus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				TCACGTACTCCTTCTTCTTCAGT	0.384	NSCLC(172;674 2044 9050 18334 41735)													OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.41			82	119		---	---	---	---						capture_indel	In_Frame_Del	DEL	85375242	85375244	CREBZF	11	CTT	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	3828	15
MIA2	117153	broad.mit.edu	37	14	39703346	39703348	+	In_Frame_Del	DEL	CTT	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:39703346_39703348delCTT	uc001wux.2	+	1	222_224	c.28_30delCTT	c.(28-30)CTTdel	p.L12del	MIA2_uc010amy.1_5'UTR	NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	12						extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		TCACAGAATCCTTCTTCTGGCTA	0.424																0.36			34	60		---	---	---	---						capture_indel	In_Frame_Del	DEL	39703346	39703348	MIA2	14	CTT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	9476	15
ITGB1BP1	9270	broad.mit.edu	37	2	9547680	9547681	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:9547680_9547681delAC	uc002qzj.2	-	6	605_606	c.428_429delGT	c.(427-429)TGTfs	p.C143fs	ITGB1BP1_uc002qzk.2_Intron|ITGB1BP1_uc002qzl.2_Intron|ITGB1BP1_uc002qzm.2_RNA|ITGB1BP1_uc010yiy.1_Frame_Shift_Del_p.C99fs|ITGB1BP1_uc002qzn.1_Frame_Shift_Del_p.C143fs	NM_004763	NP_004754	O14713	ITBP1_HUMAN	integrin cytoplasmic domain-associated protein 1	143	PID.				cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		CGTCATCGTAACACACCATCCG	0.480																0.16			15	80		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	9547680	9547681	ITGB1BP1	2	AC	-	-	-	1	0	1	0	1	0	0	0	0	24	2	5	5	7814	15
CEP250	11190	broad.mit.edu	37	20	34084435	34084436	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34084435_34084436delAG	uc002xcm.2	+	26	3868_3869	c.3197_3198delAG	c.(3196-3198)CAGfs	p.Q1066fs	CEP250_uc010zve.1_Frame_Shift_Del_p.Q434fs	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	1066	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GAAAAGGAACAGAGACTCCTTG	0.480																0.38			59	95		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	34084435	34084436	CEP250	20	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	3220	15
MYH9	4627	broad.mit.edu	37	22	36745230	36745232	+	In_Frame_Del	DEL	TGA	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:36745230_36745232delTGA	uc003apg.2	-	2	281_283	c.50_52delTCA	c.(49-54)ATCAAC>AAC	p.I17del	MYH9_uc003api.1_In_Frame_Del_p.I17del	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	17	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						AGCGGATTGTTGATGAAGTTTTT	0.542					1624	T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				0.64			38	21		---	---	---	---						capture_indel	In_Frame_Del	DEL	36745230	36745232	MYH9	22	TGA	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	9952	15
PIK3R1	5295	broad.mit.edu	37	5	67591126	67591127	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591126_67591127delGA	uc003jva.2	+	13	2279_2280	c.1719_1720delGA	c.(1717-1722)CTGAGAfs	p.L573fs	PIK3R1_uc003jvb.2_Frame_Shift_Del_p.L573fs|PIK3R1_uc003jvc.2_Frame_Shift_Del_p.L273fs|PIK3R1_uc003jvd.2_Frame_Shift_Del_p.L303fs|PIK3R1_uc003jve.2_Frame_Shift_Del_p.L252fs|PIK3R1_uc011crb.1_Frame_Shift_Del_p.L243fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	573_574					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.R574_T576del(2)|p.L570_D578del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TTATCCAGCTGAGAAAGACGAG	0.381					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.43			59	79		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67591126	67591127	PIK3R1	5	GA	-	-	-	1	0	1	0	1	0	0	0	0	574	45	5	5	11821	15
CCND3	896	broad.mit.edu	37	6	41903737	41903738	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41903737_41903738insG	uc003orn.2	-	5	984_985	c.819_820insC	c.(817-822)TCCAGCfs	p.S273fs	CCND3_uc003orp.2_Frame_Shift_Ins_p.S192fs|CCND3_uc011duk.1_Frame_Shift_Ins_p.S77fs|CCND3_uc003orm.2_Frame_Shift_Ins_p.S223fs|CCND3_uc003oro.2_Frame_Shift_Ins_p.S201fs	NM_001760	NP_001751	P30281	CCND3_HUMAN	cyclin D3 isoform 2	273_274					cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCTTGGCTGCTGGAGCCCCGGG	0.649					70	T	IGH@	MM								0.02			12	493		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	41903737	41903738	CCND3	6	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	2889	15
ATRX	546	broad.mit.edu	37	X	76938089	76938092	+	Frame_Shift_Del	DEL	TCTC	-	-	rs141180098		TCGA-06-0129-01	TCGA-06-0129-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76938089_76938092delTCTC	uc004ecp.3	-	9	2888_2891	c.2656_2659delGAGA	c.(2656-2661)GAGACTfs	p.E886fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.E848fs|ATRX_uc004eco.3_Frame_Shift_Del_p.E671fs|ATRX_uc004ecr.2_Frame_Shift_Del_p.E818fs|ATRX_uc010nlx.1_Frame_Shift_Del_p.E857fs|ATRX_uc010nly.1_Frame_Shift_Del_p.E831fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	886_887					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	GAAGAGAAAGTCTCTCTCTCTTGT	0.412					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.83			344	68		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	76938089	76938092	ATRX	23	TCTC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	1199	15
