Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CAMTA1	23261	broad.mit.edu	37	1	7798426	7798426	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7798426C>T	uc001aoi.2	+	16	4273	c.4066C>T	c.(4066-4068)CGG>TGG	p.R1356W	CAMTA1_uc010nzv.1_Missense_Mutation_p.R443W|CAMTA1_uc001aok.3_Missense_Mutation_p.R399W|CAMTA1_uc001aoj.2_Missense_Mutation_p.R312W	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1356					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GGTGCGTCCACGGGAACCAAT	0.512																0.389474	113.956141	114.971976	37	58	KEEP	---	---	---	---	18	22	36	28	-1	capture	Missense_Mutation	SNP	7798426	7798426	CAMTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	2589	23
PADI3	51702	broad.mit.edu	37	1	17575699	17575699	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17575699G>A	uc001bai.2	+	1	107	c.67G>A	c.(67-69)GTG>ATG	p.V23M		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	23					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGTGGCTGGCGTGGAGACCCT	0.617																0.311321	86.633783	89.995704	33	73	KEEP	---	---	---	---	19	21	49	38	-1	capture	Missense_Mutation	SNP	17575699	17575699	PADI3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11283	23
GRHL3	57822	broad.mit.edu	37	1	24663202	24663202	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24663202C>T	uc001biy.2	+	4	558	c.512C>T	c.(511-513)CCC>CTC	p.P171L	GRHL3_uc001bix.2_Missense_Mutation_p.P166L|GRHL3_uc001biz.2_Missense_Mutation_p.P73L	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	166					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		TACCTGTTACCCACCACTGAT	0.602																0.364103	213.374882	216.542005	71	124	KEEP	---	---	---	---	37	43	68	75	-1	capture	Missense_Mutation	SNP	24663202	24663202	GRHL3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6698	23
MCOLN3	55283	broad.mit.edu	37	1	85499910	85499910	+	Missense_Mutation	SNP	C	T	T	rs144793042	byFrequency	TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85499910C>T	uc001dkp.2	-	4	514	c.421G>A	c.(421-423)GTT>ATT	p.V141I	MCOLN3_uc001dkq.2_Missense_Mutation_p.V85I|MCOLN3_uc001dkr.2_Missense_Mutation_p.V141I|MCOLN3_uc001dks.3_5'UTR	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	141						integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGATTCCCAACGGAGACATTG	0.468																0.285714	63.26444	66.72648	24	60	KEEP	---	---	---	---	13	11	37	32	-1	capture	Missense_Mutation	SNP	85499910	85499910	MCOLN3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9310	23
RGL1	23179	broad.mit.edu	37	1	183895313	183895313	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183895313A>T	uc001gqo.2	+	18	2351	c.2194A>T	c.(2194-2196)AAA>TAA	p.K732*	RGL1_uc001gqm.2_Nonsense_Mutation_p.K767*|RGL1_uc010pog.1_Nonsense_Mutation_p.K730*|RGL1_uc010poh.1_Nonsense_Mutation_p.K730*|RGL1_uc010poi.1_Nonsense_Mutation_p.K703*	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	732	Ras-associating.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						CATTTTGCGCAAAAAGAACTC	0.443					871											0.34	138.064109	141.465635	51	99	KEEP	---	---	---	---	27	31	59	52	-1	capture	Nonsense_Mutation	SNP	183895313	183895313	RGL1	1	A	T	T	T	1	0	0	0	0	0	1	0	0	65	5	5	4	13171	23
DISP1	84976	broad.mit.edu	37	1	223116326	223116326	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:223116326G>A	uc001hnu.1	+	2	308	c.161G>A	c.(160-162)GGA>GAA	p.G54E		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	54					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		AGTCCAAATGGATGCCTGCAA	0.507																0.448276	158.902474	159.16937	52	64	KEEP	---	---	---	---	20	33	28	37	-1	capture	Missense_Mutation	SNP	223116326	223116326	DISP1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4497	23
RYR2	6262	broad.mit.edu	37	1	237780709	237780709	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237780709G>C	uc001hyl.1	+	38	5959	c.5839G>C	c.(5839-5841)GTC>CTC	p.V1947L		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1947	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATACAACGAAGTCATGCAAGC	0.448																0.275862	45.672773	48.297781	16	42	KEEP	---	---	---	---	5	11	29	19	-1	capture	Missense_Mutation	SNP	237780709	237780709	RYR2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	13661	23
RYR2	6262	broad.mit.edu	37	1	237863752	237863752	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237863752G>A	uc001hyl.1	+	65	9472	c.9352G>A	c.(9352-9354)GGA>AGA	p.G3118R	RYR2_uc010pxz.1_Missense_Mutation_p.G73R	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3118					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCATCAGTTCGGAGAAGACCT	0.373																0.423077	34.513795	34.649333	11	15	KEEP	---	---	---	---	3	9	9	8	-1	capture	Missense_Mutation	SNP	237863752	237863752	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13661	23
PCDH15	65217	broad.mit.edu	37	10	55755492	55755492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:55755492G>A	uc001jju.1	-	21	3180	c.2785C>T	c.(2785-2787)CGA>TGA	p.R929*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.R934*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.R941*|PCDH15_uc010qht.1_Nonsense_Mutation_p.R936*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.R929*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.R892*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.R858*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.R934*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.R929*|PCDH15_uc010qia.1_Nonsense_Mutation_p.R907*|PCDH15_uc010qib.1_Nonsense_Mutation_p.R907*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.R929*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	929	Extracellular (Potential).|Cadherin 9.				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTGTATATTCGTTTACTAAAG	0.408					1612								HNSCC(58;0.16)			0.075758	-0.880181	11.299322	5	61	KEEP	---	---	---	---	4	2	35	29	-1	capture	Nonsense_Mutation	SNP	55755492	55755492	PCDH15	10	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	11414	23
STAMBPL1	57559	broad.mit.edu	37	10	90665247	90665247	+	Silent	SNP	A	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90665247A>T	uc001kfk.2	+	3	501	c.78A>T	c.(76-78)CCA>CCT	p.P26P	STAMBPL1_uc010qmx.1_Silent_p.P26P|STAMBPL1_uc009xto.2_RNA|STAMBPL1_uc001kfl.2_Silent_p.P26P|STAMBPL1_uc001kfm.2_5'Flank	NM_020799	NP_065850	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	26							metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		CCCTAAGCCCAGAAGAGCGAG	0.418																0.622642	115.888695	116.588943	33	20	KEEP	---	---	---	---	21	14	12	10	-1	capture	Silent	SNP	90665247	90665247	STAMBPL1	10	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	15141	23
OR51S1	119692	broad.mit.edu	37	11	4870156	4870156	+	Missense_Mutation	SNP	C	T	T	rs143553379		TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4870156C>T	uc010qyo.1	-	1	283	c.283G>A	c.(283-285)GCT>ACT	p.A95T		NM_001004758	NP_001004758	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGAGCACCAGCAAGGGCGATG	0.537																0.413043	151.583688	152.509553	57	81	KEEP	---	---	---	---	26	31	48	41	-1	capture	Missense_Mutation	SNP	4870156	4870156	OR51S1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	11009	23
C11orf16	56673	broad.mit.edu	37	11	8953775	8953775	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:8953775G>A	uc001mhb.3	-	2	205	c.81C>T	c.(79-81)GAC>GAT	p.D27D	C11orf16_uc001mhc.3_Silent_p.D27D	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	27										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GAGCAGCACCGTCCCAGCCAG	0.622																0.538462	23.126009	23.142735	7	6	KEEP	---	---	---	---	5	5	5	4	-1	capture	Silent	SNP	8953775	8953775	C11orf16	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1618	23
FOLH1	2346	broad.mit.edu	37	11	49175930	49175930	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:49175930G>A	uc001ngy.2	-	16	1999	c.1738C>T	c.(1738-1740)CGA>TGA	p.R580*	FOLH1_uc001ngx.2_Nonsense_Mutation_p.R12*|FOLH1_uc001ngz.2_Nonsense_Mutation_p.R580*|FOLH1_uc009yly.2_Nonsense_Mutation_p.R565*|FOLH1_uc009ylz.2_Nonsense_Mutation_p.R565*|FOLH1_uc009yma.2_Nonsense_Mutation_p.R272*	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	580	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	ATCCCTCCTCGAACCTGGGCC	0.413																0.368421	144.392448	146.395325	49	84	KEEP	---	---	---	---	29	41	64	88	-1	capture	Nonsense_Mutation	SNP	49175930	49175930	FOLH1	11	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5923	23
OR5D18	219438	broad.mit.edu	37	11	55587854	55587854	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587854C>A	uc010rin.1	+	1	749	c.749C>A	c.(748-750)ACC>AAC	p.T250N		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	250	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				ACTGCCATCACCATCTTCCAT	0.517																0.360656	129.162453	131.249323	44	78	KEEP	---	---	---	---	23	25	38	45	0.520833333333	capture	Missense_Mutation	SNP	55587854	55587854	OR5D18	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11061	23
MS4A7	58475	broad.mit.edu	37	11	60150731	60150731	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60150731C>T	uc001npe.2	+	2	262	c.117C>T	c.(115-117)AAC>AAT	p.N39N	MS4A7_uc001npf.2_Silent_p.N39N|MS4A7_uc001npg.2_Silent_p.N39N|MS4A7_uc001nph.2_Silent_p.N39N|MS4A14_uc001npi.2_Intron|MS4A7_uc009ymx.1_Silent_p.N39N	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	39	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2						ACCTGCAGAACGGGCTGCCAA	0.438																0.463415	109.216085	109.313398	38	44	KEEP	---	---	---	---	17	21	24	23	-1	capture	Silent	SNP	60150731	60150731	MS4A7	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9776	23
FAU	2197	broad.mit.edu	37	11	64889007	64889007	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64889007A>G	uc001ocx.2	-	3	292	c.185T>C	c.(184-186)CTG>CCG	p.L62P	FAU_uc001ocy.1_Missense_Mutation_p.L62P|MRPL49_uc001ocz.1_5'Flank|MRPL49_uc001oda.1_5'Flank	NM_001997	NP_001988	P35544	UBIM_HUMAN	ubiquitin-like protein fubi and ribosomal	62											0						CAGGGTAGTCAGGGCCTCCAC	0.612																0.03	-17.364863	6.882773	3	97	KEEP	---	---	---	---	1	2	48	56	-1	capture	Missense_Mutation	SNP	64889007	64889007	FAU	11	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5640	23
FOLH1B	219595	broad.mit.edu	37	11	89424164	89424164	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89424164C>T	uc001pda.2	+	11	1340	c.814C>T	c.(814-816)CGA>TGA	p.R272*		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	272					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GGCCCAGGTTCGAGGAGGGAT	0.408																0.032468	-27.87636	8.824327	5	149	KEEP	---	---	---	---	11	12	143	103	-1	capture	Nonsense_Mutation	SNP	89424164	89424164	FOLH1B	11	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	5924	23
MPZL2	10205	broad.mit.edu	37	11	118130818	118130818	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118130818G>A	uc001psn.2	-	4	676	c.535C>T	c.(535-537)CGG>TGG	p.R179W	MPZL2_uc001pso.2_Missense_Mutation_p.R179W|MPZL2_uc001psp.1_Missense_Mutation_p.R179W	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor	179	Cytoplasmic (Potential).				anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		CGCTTTTTCCGGTAATGCTGG	0.478																0.362117	412.559696	418.563238	130	229	KEEP	---	---	---	---	77	62	141	116	-1	capture	Missense_Mutation	SNP	118130818	118130818	MPZL2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	9662	23
CHEK1	1111	broad.mit.edu	37	11	125503112	125503112	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125503112G>A	uc009zbo.2	+	6	1371	c.479G>A	c.(478-480)CGT>CAT	p.R160H	CHEK1_uc010sbh.1_Missense_Mutation_p.R176H|CHEK1_uc010sbi.1_Missense_Mutation_p.R160H|CHEK1_uc001qcf.3_Missense_Mutation_p.R160H|CHEK1_uc009zbp.2_Missense_Mutation_p.R160H|CHEK1_uc001qcg.3_Missense_Mutation_p.R160H|CHEK1_uc009zbq.2_Missense_Mutation_p.R160H|CHEK1_uc001qci.1_RNA	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	160	Protein kinase.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	p.R160H(1)		central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		TATAATAATCGTGAGCGTTTG	0.363					124						Other_conserved_DNA_damage_response_genes					0.362319	145.609393	147.912627	50	88	KEEP	---	---	---	---	33	21	49	53	-1	capture	Missense_Mutation	SNP	125503112	125503112	CHEK1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3300	23
TEAD4	7004	broad.mit.edu	37	12	3128315	3128315	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3128315C>T	uc010sej.1	+	8	836	c.559C>T	c.(559-561)CAG>TAG	p.Q187*	TEAD4_uc010sek.1_Nonsense_Mutation_p.Q144*|TEAD4_uc001qln.2_Nonsense_Mutation_p.Q59*	NM_003213	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4 isoform 1	188					hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			CTATGCTGTCCAGCCTCCGCT	0.677																0.479452	107.516842	107.543877	35	38	KEEP	---	---	---	---	27	23	19	35	-1	capture	Nonsense_Mutation	SNP	3128315	3128315	TEAD4	12	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	15626	23
TAS2R30	259293	broad.mit.edu	37	12	11286159	11286159	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11286159G>A	uc009zhs.1	-	1	685	c.685C>T	c.(685-687)CAA>TAA	p.Q229*	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_001097643	NP_001091112			type 2 taste receptor member 30												0						GTCACAGTTTGCAAAGCTTTT	0.418																0.023739	-72.814925	12.223405	8	329	KEEP	---	---	---	---	4	4	206	164	-1	capture	Nonsense_Mutation	SNP	11286159	11286159	TAS2R30	12	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	15461	23
PIK3C2G	5288	broad.mit.edu	37	12	18658236	18658236	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18658236A>G	uc001rdt.2	+	23	3157	c.3041A>G	c.(3040-3042)AAC>AGC	p.N1014S	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.N1055S|PIK3C2G_uc010sic.1_Missense_Mutation_p.N833S	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1014	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	p.N1014S(1)		lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GCCTTGAGGAACTTTTTCTAC	0.378					655											0.5	41.325597	41.325597	11	11	KEEP	---	---	---	---	9	5	10	2	-1	capture	Missense_Mutation	SNP	18658236	18658236	PIK3C2G	12	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	11814	23
PPFIBP1	8496	broad.mit.edu	37	12	27841240	27841240	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27841240G>A	uc001ric.1	+	25	2775	c.2398G>A	c.(2398-2400)GCC>ACC	p.A800T	PPFIBP1_uc010sjr.1_Missense_Mutation_p.A631T|PPFIBP1_uc001rib.1_Missense_Mutation_p.A794T|PPFIBP1_uc001ria.2_Missense_Mutation_p.A769T|PPFIBP1_uc001rid.1_Missense_Mutation_p.A647T|PPFIBP1_uc001rif.1_Missense_Mutation_p.A307T	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1	800					cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					GAATACCATCGCCCCATCAGA	0.468																0.410127	483.208047	485.985224	162	233	KEEP	---	---	---	---	84	92	131	120	-1	capture	Missense_Mutation	SNP	27841240	27841240	PPFIBP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12214	23
SCN8A	6334	broad.mit.edu	37	12	52200784	52200784	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52200784C>T	uc001ryw.2	+	27	5692	c.5514C>T	c.(5512-5514)AGC>AGT	p.S1838S		NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1838					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	CAATGGTGAGCGGGGATCGCA	0.562																0.025157	-33.342892	6.424745	4	155	KEEP	---	---	---	---	0	4	90	76	-1	capture	Silent	SNP	52200784	52200784	SCN8A	12	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	13817	23
LUM	4060	broad.mit.edu	37	12	91502375	91502375	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91502375G>T	uc001tbm.2	-	2	771	c.382C>A	c.(382-384)CTG>ATG	p.L128M	LUM_uc001tbn.2_Intron	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	128	LRR 3.				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent	p.L128M(1)		central_nervous_system(2)	2						GACTCTGTCAGGTTGTTGTGG	0.418																0.432624	189.353441	189.911731	61	80	KEEP	---	---	---	---	36	34	56	37	0.514285714286	capture	Missense_Mutation	SNP	91502375	91502375	LUM	12	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	9000	23
SDS	10993	broad.mit.edu	37	12	113835119	113835119	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113835119G>A	uc001tvg.2	-	6	626	c.504C>T	c.(502-504)GGC>GGT	p.G168G	SDS_uc001tvh.1_Silent_p.G168G	NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	168					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	GGCCCCCGCCGCCCACTGACA	0.662																0.406593	105.462834	106.154264	37	54	KEEP	---	---	---	---	20	24	28	34	-1	capture	Silent	SNP	113835119	113835119	SDS	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13868	23
FAM123A	219287	broad.mit.edu	37	13	25745233	25745233	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25745233G>A	uc001uqb.2	-	1	625	c.525C>T	c.(523-525)AAC>AAT	p.N175N	FAM123A_uc001uqa.2_Silent_p.N175N|FAM123A_uc001uqc.2_Silent_p.N175N	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	175										ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CTCCCTTGCCGTTTTCCGAGC	0.677																0.363636	20.590739	20.95192	8	14	KEEP	---	---	---	---	2	6	10	6	-1	capture	Silent	SNP	25745233	25745233	FAM123A	13	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5376	23
PAN3	255967	broad.mit.edu	37	13	28840979	28840979	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28840979A>T	uc001urz.2	+	9	1109	c.1101A>T	c.(1099-1101)AAA>AAT	p.K367N	PAN3_uc010tdo.1_Missense_Mutation_p.K513N|PAN3_uc001ury.2_Missense_Mutation_p.K201N|PAN3_uc001urx.2_Missense_Mutation_p.K313N	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	513	Protein kinase.|Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TAAACAGCAAAGATGATCTGC	0.373																0.427184	128.778445	129.255698	44	59	KEEP	---	---	---	---	24	23	27	40	-1	capture	Missense_Mutation	SNP	28840979	28840979	PAN3	13	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	11319	23
STARD13	90627	broad.mit.edu	37	13	33704189	33704189	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33704189G>A	uc001uuw.2	-	5	751	c.625C>T	c.(625-627)CGC>TGC	p.R209C	STARD13_uc001uuu.2_Missense_Mutation_p.R201C|STARD13_uc001uuv.2_Missense_Mutation_p.R91C|STARD13_uc001uux.2_Missense_Mutation_p.R174C|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.R194C	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	209					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GGCTGGCTGCGACTGTCGCTG	0.627																0.472222	50.070603	50.094813	17	19	KEEP	---	---	---	---	10	10	16	7	-1	capture	Missense_Mutation	SNP	33704189	33704189	STARD13	13	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15146	23
LRFN5	145581	broad.mit.edu	37	14	42356674	42356674	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42356674T>A	uc001wvm.2	+	3	2044	c.846T>A	c.(844-846)TTT>TTA	p.F282L	LRFN5_uc010ana.2_Missense_Mutation_p.F282L	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	282	Extracellular (Potential).|LRRCT.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AAGAAGAGTTTTTGTGTGAGC	0.502													HNSCC(30;0.082)			0.398693	173.238895	174.613681	61	92	KEEP	---	---	---	---	35	28	55	44	-1	capture	Missense_Mutation	SNP	42356674	42356674	LRFN5	14	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	8857	23
PPP2R5E	5529	broad.mit.edu	37	14	63858710	63858710	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63858710C>A	uc001xgd.1	-	9	1473	c.883G>T	c.(883-885)GAT>TAT	p.D295Y	PPP2R5E_uc010tsf.1_Missense_Mutation_p.D219Y|PPP2R5E_uc010tsg.1_Missense_Mutation_p.D219Y|PPP2R5E_uc001xge.2_Missense_Mutation_p.D295Y|PPP2R5E_uc010tsh.1_Missense_Mutation_p.D295Y|PPP2R5E_uc001xgf.1_RNA	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,	295					signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		AGTGAAGGATCTTTCTCCAGA	0.294																0.06383	-2.61594	6.688483	3	44	KEEP	---	---	---	---	2	1	21	29	0.333333333333	capture	Missense_Mutation	SNP	63858710	63858710	PPP2R5E	14	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	12297	23
PAPLN	89932	broad.mit.edu	37	14	73717702	73717702	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73717702G>A	uc010ttx.1	+	6	716	c.553G>A	c.(553-555)GTC>ATC	p.V185I	PAPLN_uc001xnw.3_Missense_Mutation_p.V185I|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.V185I	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	185						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CTGCTACCCCGTCGCAGGCAC	0.632																0.390625	148.022733	149.363254	50	78	KEEP	---	---	---	---	31	24	45	45	-1	capture	Missense_Mutation	SNP	73717702	73717702	PAPLN	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11332	23
CRIP1	1396	broad.mit.edu	37	14	105954816	105954816	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105954816C>T	uc001yri.3	+	5	316	c.202C>T	c.(202-204)CGG>TGG	p.R68W	C14orf80_uc001yrj.2_5'Flank|C14orf80_uc001yrk.2_5'Flank|C14orf80_uc001yrn.2_5'Flank|C14orf80_uc001yro.2_5'Flank|C14orf80_uc001yrm.2_5'Flank	NM_001311	NP_001302	P50238	CRIP1_HUMAN	cysteine-rich protein 1 (intestinal)	68	Gly-rich.				cell proliferation	cytoplasm	zinc ion binding				0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.235)		AGGCTTTGGGCGGGGCGGAGC	0.547																0.214286	43.521682	50.911039	21	77	KEEP	---	---	---	---	12	12	39	46	-1	capture	Missense_Mutation	SNP	105954816	105954816	CRIP1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3839	23
HDC	3067	broad.mit.edu	37	15	50549631	50549631	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50549631G>A	uc001zxz.2	-	4	538	c.432C>T	c.(430-432)GGC>GGT	p.G144G	HDC_uc010uff.1_Silent_p.G144G|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Silent_p.G144G	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	144					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CCTGCAGGACGCCTCCGCCCT	0.562	GBM(95;1627 1936 6910 9570)															0.377193	122.694	124.203949	43	71	KEEP	---	---	---	---	28	27	45	39	-1	capture	Silent	SNP	50549631	50549631	HDC	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6942	23
ADCY9	115	broad.mit.edu	37	16	4033425	4033425	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4033425G>A	uc002cvx.2	-	7	2866	c.2327C>T	c.(2326-2328)CCC>CTC	p.P776L		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	776	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						CGTCTTCACGGGGGAGTTCTT	0.562																0.363636	12.997324	13.177172	4	7	KEEP	---	---	---	---	0	4	6	2	-1	capture	Missense_Mutation	SNP	4033425	4033425	ADCY9	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	301	23
MYH11	4629	broad.mit.edu	37	16	15844112	15844112	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15844112C>T	uc002ddy.2	-	16	2048	c.1941G>A	c.(1939-1941)AAG>AAA	p.K647K	MYH11_uc002ddv.2_Silent_p.K654K|MYH11_uc002ddw.2_Silent_p.K647K|MYH11_uc002ddx.2_Silent_p.K654K|MYH11_uc010bvg.2_Silent_p.K479K|MYH11_uc002dea.1_Silent_p.K353K	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	647	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						GGAACATGCCCTTCTTGGTCT	0.627					1257	T	CBFB	AML								0.327586	57.803972	59.33359	19	39	KEEP	---	---	---	---	8	13	28	14	-1	capture	Silent	SNP	15844112	15844112	MYH11	16	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	9941	23
CD2BP2	10421	broad.mit.edu	37	16	30364599	30364599	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30364599G>A	uc002dxr.2	-	5	1071	c.818C>T	c.(817-819)TCG>TTG	p.S273L	CD2BP2_uc002dxs.2_Missense_Mutation_p.S273L	NM_006110	NP_006101	O95400	CD2B2_HUMAN	CD2 antigen (cytoplasmic tail) binding protein	273					assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding			ovary(1)	1						ATCTCCCCGCGACTCTGCTTC	0.572																0.061947	-8.166777	14.448512	7	106	KEEP	---	---	---	---	6	2	70	46	-1	capture	Missense_Mutation	SNP	30364599	30364599	CD2BP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2966	23
HYDIN	54768	broad.mit.edu	37	16	70867931	70867931	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70867931C>T	uc002ezr.2	-	79	13663	c.13535G>A	c.(13534-13536)CGC>CAC	p.R4512H	HYDIN_uc010cfy.2_RNA	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	4513										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GAAGAGGGGGCGCAGGAGCCC	0.557																0.627907	77.524055	78.140316	27	16	KEEP	---	---	---	---	25	16	37	18	-1	capture	Missense_Mutation	SNP	70867931	70867931	HYDIN	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7392	23
HYDIN	54768	broad.mit.edu	37	16	71026070	71026070	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71026070G>T	uc002ezr.2	-	24	3816	c.3688C>A	c.(3688-3690)CAG>AAG	p.Q1230K		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1230										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GACTCCATCTGGGACACTGGG	0.498																0.448598	152.088539	152.334651	48	59	KEEP	---	---	---	---	28	23	36	35	0.549019607843	capture	Missense_Mutation	SNP	71026070	71026070	HYDIN	16	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	7392	23
YWHAE	7531	broad.mit.edu	37	17	1257637	1257637	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1257637C>T	uc002fsj.2	-	5	735	c.583G>A	c.(583-585)GCA>ACA	p.A195T	YWHAE_uc002fsk.2_Missense_Mutation_p.A173T|YWHAE_uc010vqh.1_RNA|YWHAE_uc010vqi.1_RNA	NM_006761	NP_006752	P62258	1433E_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	195					apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		GCTGCTTTTGCCAACCTAAAG	0.348																0.052632	-5.425808	6.629641	3	54	KEEP	---	---	---	---	1	2	30	29	-1	capture	Missense_Mutation	SNP	1257637	1257637	YWHAE	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17383	23
SLFN12L	342615	broad.mit.edu	37	17	33806205	33806205	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33806205C>T	uc002hjn.2	-	3	1990	c.1111G>A	c.(1111-1113)GTG>ATG	p.V371M		NM_001145027	NP_001138499			schlafen family member 12-like											ovary(1)	1						TTATCTTTCACGTGCCAGGAA	0.448																0.333333	8.021446	8.243128	3	6	KEEP	---	---	---	---	1	2	4	3	-1	capture	Missense_Mutation	SNP	33806205	33806205	SLFN12L	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14627	23
KRT13	3860	broad.mit.edu	37	17	39659272	39659272	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39659272G>A	uc002hwu.1	-	4	877	c.814C>T	c.(814-816)CGC>TGC	p.R272C	KRT13_uc002hwv.1_Missense_Mutation_p.R272C|KRT13_uc002hww.2_Missense_Mutation_p.R165C|KRT13_uc010wfr.1_Missense_Mutation_p.R165C|KRT13_uc010cxo.2_Missense_Mutation_p.R272C|KRT13_uc002hwx.1_Missense_Mutation_p.R260C	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	272	Linker 12.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				GCCAGCACGCGGGTCAGGTCA	0.602																0.404494	560.284873	563.810197	180	265	KEEP	---	---	---	---	124	74	194	111	-1	capture	Missense_Mutation	SNP	39659272	39659272	KRT13	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8370	23
DHX58	79132	broad.mit.edu	37	17	40259776	40259776	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40259776C>T	uc002hyw.3	-	8	1066	c.843G>A	c.(841-843)GCG>GCA	p.A281A	DHX58_uc002hyv.3_RNA|DHX58_uc010wgf.1_Silent_p.A274A	NM_024119	NP_077024	Q96C10	DHX58_HUMAN	RNA helicase LGP2	281					innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding				0		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCAGGTGAAGCGCATACACCC	0.657																0.2	5.617523	6.874863	3	12	KEEP	---	---	---	---	2	1	7	6	-1	capture	Silent	SNP	40259776	40259776	DHX58	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4472	23
B4GALNT2	124872	broad.mit.edu	37	17	47246247	47246247	+	Nonsense_Mutation	SNP	C	T	T	rs112740954	byFrequency;by1000genomes	TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47246247C>T	uc002ion.2	+	10	1539	c.1480C>T	c.(1480-1482)CGA>TGA	p.R494*	B4GALNT2_uc010wlt.1_Nonsense_Mutation_p.R408*|B4GALNT2_uc010wlu.1_Nonsense_Mutation_p.R434*	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	494	Lumenal (Potential).				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			CCGCCTGCAACGAGTGGCTCA	0.592	GBM(124;244 1635 8663 18097 33175)															0.333333	28.3421	29.079069	10	20	KEEP	---	---	---	---	7	3	16	6	-1	capture	Nonsense_Mutation	SNP	47246247	47246247	B4GALNT2	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	1256	23
FASN	2194	broad.mit.edu	37	17	80045208	80045208	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80045208C>T	uc002kdu.2	-	20	3333	c.3216G>A	c.(3214-3216)AAG>AAA	p.K1072K	FASN_uc002kdw.1_Silent_p.K288K	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1072					energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	TACCTTGGGCCTTGTCCTGCA	0.672	Colon(59;314 1043 11189 28578 32273)				1201											0.576923	48.925827	49.059508	15	11	KEEP	---	---	---	---	10	6	10	5	-1	capture	Silent	SNP	80045208	80045208	FASN	17	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5629	23
ZNF521	25925	broad.mit.edu	37	18	22902139	22902139	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:22902139T>C	uc002kvk.2	-	3	300	c.53A>G	c.(52-54)AAA>AGA	p.K18R	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.K18R|ZNF521_uc002kvl.2_5'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	18					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTCTTCAAGTTTACAGTTGGG	0.423					266	T	PAX5	ALL								0.393035	283.890065	285.901124	79	122	KEEP	---	---	---	---	49	34	68	65	-1	capture	Missense_Mutation	SNP	22902139	22902139	ZNF521	18	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	17844	23
SS18	6760	broad.mit.edu	37	18	23618584	23618584	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:23618584C>T	uc002kvm.2	-	7	893	c.815G>A	c.(814-816)GGG>GAG	p.G272E	SS18_uc002kvn.2_Missense_Mutation_p.G272E|SS18_uc010xbf.1_Missense_Mutation_p.G190E|SS18_uc010xbg.1_Missense_Mutation_p.G220E|SS18_uc010xbh.1_Missense_Mutation_p.G220E|SS18_uc010xbi.1_Missense_Mutation_p.G249E|SS18_uc010dlz.1_Missense_Mutation_p.G220E	NM_001007559	NP_001007560	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	272	Gln-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding		SS18/SSX1(1169)|SS18/SSX2(702)|SS18/SSX4(12)	soft_tissue(1883)|ovary(1)	1884	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					GTATTGGTCCCCGTAATAGTC	0.438					177	T	SSX1| SSX2	synovial sarcoma								0.331429	169.422177	173.812898	58	117	KEEP	---	---	---	---	31	31	62	65	-1	capture	Missense_Mutation	SNP	23618584	23618584	SS18	18	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15067	23
TJP3	27134	broad.mit.edu	37	19	3746600	3746600	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3746600C>T	uc010xhv.1	+	16	2227	c.2227C>T	c.(2227-2229)CGC>TGC	p.R743C	TJP3_uc010xhs.1_Missense_Mutation_p.R710C|TJP3_uc010xht.1_Missense_Mutation_p.R674C|TJP3_uc010xhu.1_Missense_Mutation_p.R719C|TJP3_uc010xhw.1_Missense_Mutation_p.R729C	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	724	Guanylate kinase-like.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGCACTGCGCCAGTGGCT	0.647																0.259259	17.913653	19.330242	7	20	KEEP	---	---	---	---	1	7	17	19	-1	capture	Missense_Mutation	SNP	3746600	3746600	TJP3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15816	23
CARM1	10498	broad.mit.edu	37	19	11022906	11022906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11022906C>T	uc002mpz.2	+	5	731	c.605C>T	c.(604-606)GCC>GTC	p.A202V	CARM1_uc010dxn.2_RNA|CARM1_uc002mqa.2_5'UTR	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	202					cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						TCGTTTTTTGCCGCCCAAGCT	0.622																0.011605	-132.881884	8.497295	6	511	KEEP	---	---	---	---	6	2	287	288	-1	capture	Missense_Mutation	SNP	11022906	11022906	CARM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2631	23
CPAMD8	27151	broad.mit.edu	37	19	17007075	17007075	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17007075C>T	uc002nfb.2	-	41	5511	c.5479G>A	c.(5479-5481)GGG>AGG	p.G1827R	CPAMD8_uc010xpj.1_5'UTR|CPAMD8_uc002nfd.1_Missense_Mutation_p.G292R	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1780						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						TGTAAAGGCCCCGGGGCCACA	0.677					1067											0.303797	62.40717	65.10052	24	55	KEEP	---	---	---	---	14	10	30	28	-1	capture	Missense_Mutation	SNP	17007075	17007075	CPAMD8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3760	23
CPAMD8	27151	broad.mit.edu	37	19	17025572	17025572	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17025572G>A	uc002nfb.2	-	28	3854	c.3822C>T	c.(3820-3822)TTC>TTT	p.F1274F		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1227						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GGGGGTCCACGAAGATAAAGC	0.458					1067											0.289474	51.911135	54.941068	22	54	KEEP	---	---	---	---	18	10	34	32	-1	capture	Silent	SNP	17025572	17025572	CPAMD8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	3760	23
PSG4	5672	broad.mit.edu	37	19	43702421	43702421	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43702421G>C	uc002ovy.2	-	3	539	c.437C>G	c.(436-438)ACT>AGT	p.T146S	PSG6_uc010xwk.1_5'UTR|PSG4_uc002owa.2_RNA|PSG4_uc002owb.2_Intron|PSG4_uc002ovz.2_Missense_Mutation_p.T146S	NM_002780	NP_002771	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4 isoform	146					defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)				GGGCTTGGGAGTCTCCACTGT	0.517																0.268437	289.99408	306.387625	91	248	KEEP	---	---	---	---	51	51	147	126	-1	capture	Missense_Mutation	SNP	43702421	43702421	PSG4	19	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	12552	23
NLRP2	55655	broad.mit.edu	37	19	55505643	55505643	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55505643G>A	uc002qij.2	+	11	2801	c.2715G>A	c.(2713-2715)TGG>TGA	p.W905*	NLRP2_uc010yfp.1_Nonsense_Mutation_p.W882*|NLRP2_uc010esn.2_Nonsense_Mutation_p.W881*|NLRP2_uc010eso.2_Nonsense_Mutation_p.W902*|NLRP2_uc010esp.2_Nonsense_Mutation_p.W883*	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	905	LRR 4.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CTAGGCTTTGGAACTGCGACA	0.483																0.197183	62.524734	74.649154	28	114	KEEP	---	---	---	---	15	14	65	58	-1	capture	Nonsense_Mutation	SNP	55505643	55505643	NLRP2	19	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	10384	23
NLRP8	126205	broad.mit.edu	37	19	56459556	56459556	+	Silent	SNP	C	T	T	rs146471073		TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56459556C>T	uc002qmh.2	+	1	359	c.288C>T	c.(286-288)CGC>CGT	p.R96R	NLRP8_uc010etg.2_Silent_p.R96R	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	96	DAPIN.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTGGACGACGCGCTTGGGATG	0.507																0.296296	63.767243	66.774057	24	57	KEEP	---	---	---	---	17	8	39	21	-1	capture	Silent	SNP	56459556	56459556	NLRP8	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10390	23
C2orf78	388960	broad.mit.edu	37	2	74040759	74040759	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74040759T>A	uc002sjr.1	+	2	374	c.253T>A	c.(253-255)TCT>ACT	p.S85T		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	85	Ser-rich.									ovary(2)	2						GCCATCAGCCTCTGGCACCTC	0.527																0.04918	-6.820149	6.340154	3	58	KEEP	---	---	---	---	3	0	49	24	-1	capture	Missense_Mutation	SNP	74040759	74040759	C2orf78	2	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	2175	23
EDAR	10913	broad.mit.edu	37	2	109526984	109526984	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109526984G>A	uc002teq.3	-	9	1166	c.735C>T	c.(733-735)AAC>AAT	p.N245N	EDAR_uc010fjn.2_Silent_p.N277N|EDAR_uc010yws.1_Silent_p.N277N	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor	245	Cytoplasmic (Potential).				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						ACATCACCACGTTGTCTGCAG	0.552																0.465116	58.79227	58.838117	20	23	KEEP	---	---	---	---	10	11	16	8	-1	capture	Silent	SNP	109526984	109526984	EDAR	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4860	23
PCDP1	200373	broad.mit.edu	37	2	120385326	120385326	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:120385326C>T	uc002tmb.2	+	17	1848	c.756C>T	c.(754-756)TTC>TTT	p.F252F	PCDP1_uc010yyq.1_Silent_p.F382F	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	538						cilium	calmodulin binding				0	Colorectal(110;0.196)					CCTTCGCTTTCCCAGACTGCA	0.557																0.376238	224.044949	226.762907	76	126	KEEP	---	---	---	---	52	33	66	67	-1	capture	Silent	SNP	120385326	120385326	PCDP1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	11475	23
POTEE	445582	broad.mit.edu	37	2	131976471	131976471	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131976471G>A	uc002tsn.2	+	1	548	c.496G>A	c.(496-498)GTG>ATG	p.V166M	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Translation_Start_Site|POTEE_uc002tsl.2_Translation_Start_Site	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	166							ATP binding				0						GGACACTGACGTGAACAAGAA	0.592																0.14786	64.37264	94.97822	38	219	KEEP	---	---	---	---	37	39	129	137	-1	capture	Missense_Mutation	SNP	131976471	131976471	POTEE	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12165	23
THSD7B	80731	broad.mit.edu	37	2	137814211	137814211	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137814211C>T	uc002tva.1	+	2	268	c.268C>T	c.(268-270)CGC>TGC	p.R90C	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCTTACGCTCGCGGTGAAGT	0.542																0.458824	115.292468	115.419993	39	46	KEEP	---	---	---	---	22	18	28	21	-1	capture	Missense_Mutation	SNP	137814211	137814211	THSD7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15765	23
XIRP2	129446	broad.mit.edu	37	2	168101563	168101563	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168101563A>G	uc002udx.2	+	8	3679	c.3661A>G	c.(3661-3663)AAA>GAA	p.K1221E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.K1046E|XIRP2_uc010fpq.2_Missense_Mutation_p.K999E|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1046					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGAAGTTTTGAAAAAGATCAA	0.308																0.373134	85.460034	86.40646	25	42	KEEP	---	---	---	---	12	13	19	24	-1	capture	Missense_Mutation	SNP	168101563	168101563	XIRP2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	17311	23
TTN	7273	broad.mit.edu	37	2	179469622	179469622	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179469622C>T	uc010zfg.1	-	230	46714	c.46490G>A	c.(46489-46491)CGC>CAC	p.R15497H	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9192H|TTN_uc010zfi.1_Missense_Mutation_p.R9125H|TTN_uc010zfj.1_Missense_Mutation_p.R9000H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16424							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGGATGGGCGGTCTGGAAA	0.418					8722											0.484848	138.283304	138.303462	48	51	KEEP	---	---	---	---	25	24	29	25	-1	capture	Missense_Mutation	SNP	179469622	179469622	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16617	23
UGT1A5	54579	broad.mit.edu	37	2	234621856	234621856	+	Silent	SNP	C	T	T	rs17874940		TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234621856C>T	uc002vuw.2	+	1	219	c.219C>T	c.(217-219)AAC>AAT	p.N73N	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Silent_p.N73N	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	73					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		AAGAAGAGAACTTTTTCACCC	0.512																0.347518	137.52504	140.42209	49	92	KEEP	---	---	---	---	26	26	51	50	-1	capture	Silent	SNP	234621856	234621856	UGT1A5	2	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	16830	23
SLC32A1	140679	broad.mit.edu	37	20	37356997	37356997	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37356997G>A	uc002xjc.2	+	2	1556	c.1293G>A	c.(1291-1293)TGG>TGA	p.W431*		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	431	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TGAAGTCCTGGGGGCTGACGC	0.662																0.478873	105.649107	105.676357	34	37	KEEP	---	---	---	---	15	19	25	16	-1	capture	Nonsense_Mutation	SNP	37356997	37356997	SLC32A1	20	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	14457	23
SEMG1	6406	broad.mit.edu	37	20	43837278	43837278	+	Missense_Mutation	SNP	G	A	A	rs79500955	byFrequency;by1000genomes	TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43837278G>A	uc002xni.2	+	2	1397	c.1340G>A	c.(1339-1341)CGT>CAT	p.R447H	SEMG1_uc002xnj.2_Missense_Mutation_p.R387H|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.R387H	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	447	42 AA repeat 3.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				GACAGTGATCGTCATTTGGCA	0.398																0.38587	211.884326	213.984357	71	113	KEEP	---	---	---	---	46	36	69	58	-1	capture	Missense_Mutation	SNP	43837278	43837278	SEMG1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13937	23
EYA2	2139	broad.mit.edu	37	20	45811961	45811961	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:45811961G>C	uc002xsm.2	+	15	1832	c.1458G>C	c.(1456-1458)AGG>AGC	p.R486S	EYA2_uc010ghp.2_Missense_Mutation_p.R407S|EYA2_uc002xsn.2_Missense_Mutation_p.R491S|EYA2_uc002xso.2_Missense_Mutation_p.R486S|EYA2_uc002xsp.2_Missense_Mutation_p.R486S|EYA2_uc002xsq.2_Missense_Mutation_p.R456S	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a	486					DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				GCTTCGAGAGGATAATGCAGA	0.343	Pancreas(120;56 1725 18501 25218 43520)															0.26087	96.195607	102.148323	30	85	KEEP	---	---	---	---	20	15	50	47	-1	capture	Missense_Mutation	SNP	45811961	45811961	EYA2	20	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	5284	23
C21orf29	54084	broad.mit.edu	37	21	45948429	45948429	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45948429C>T	uc002zfe.1	-	6	894	c.828G>A	c.(826-828)CCG>CCA	p.P276P	C21orf29_uc010gpv.1_Silent_p.P208P	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	276					cell adhesion	extracellular region	structural molecule activity				0						CCTCGGTACACGGTGGCTGGG	0.577																0.4	130.784963	131.744454	44	66	KEEP	---	---	---	---	17	28	39	28	-1	capture	Silent	SNP	45948429	45948429	C21orf29	21	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2105	23
GRM7	2917	broad.mit.edu	37	3	6903093	6903093	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:6903093G>T	uc003bqm.2	+	1	292	c.18G>T	c.(16-18)AAG>AAT	p.K6N	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.K6N|GRM7_uc003bql.2_Missense_Mutation_p.K6N	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	6					negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	AGCTGAGGAAGCTGCTCCGCG	0.721																0.333333	15.943057	16.38634	6	12	KEEP	---	---	---	---	5	2	12	2	0.714285714286	capture	Missense_Mutation	SNP	6903093	6903093	GRM7	3	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	6735	23
PRKCD	5580	broad.mit.edu	37	3	53213676	53213676	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53213676C>T	uc003dgl.2	+	4	552	c.199C>T	c.(199-201)CGC>TGC	p.R67C	PRKCD_uc003dgm.2_Missense_Mutation_p.R67C|PRKCD_uc003dgn.2_Missense_Mutation_p.R67C	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	67	C2.	Interaction with phosphotyrosine- containing peptide.			activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding	p.R67C(1)		central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		CTATGAGGGGCGCGTCATCCA	0.582					215											0.4375	59.164398	59.327408	21	27	KEEP	---	---	---	---	11	10	19	13	-1	capture	Missense_Mutation	SNP	53213676	53213676	PRKCD	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12405	23
ST6GAL1	6480	broad.mit.edu	37	3	186791960	186791960	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186791960C>T	uc003frb.2	+	7	1250	c.818C>T	c.(817-819)CCG>CTG	p.P273L	ST6GAL1_uc003frc.2_Missense_Mutation_p.P42L|ST6GAL1_uc003frd.2_Missense_Mutation_p.P273L	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide	273	Lumenal (Potential).				humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	p.P273L(1)		central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		TACCAGAATCCGGATTATAAT	0.488																0.302013	137.327416	142.536621	45	104	KEEP	---	---	---	---	26	20	60	51	-1	capture	Missense_Mutation	SNP	186791960	186791960	ST6GAL1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15111	23
UGT2A1	10941	broad.mit.edu	37	4	70455275	70455275	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70455275G>A	uc003hem.3	-	6	1462	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	UGT2A1_uc011caq.1_Missense_Mutation_p.R633C|UGT2A1_uc010ihu.2_Missense_Mutation_p.R467C|UGT2A1_uc010iht.2_Missense_Mutation_p.R423C|UGT2A1_uc010ihs.2_Missense_Mutation_p.R468C	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	467	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						CCTTTGTGGCGCATGACAAAC	0.478																0.369231	206.258255	209.185004	72	123	KEEP	---	---	---	---	45	30	62	70	-1	capture	Missense_Mutation	SNP	70455275	70455275	UGT2A1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16835	23
FRAS1	80144	broad.mit.edu	37	4	79362349	79362349	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79362349C>A	uc003hlb.2	+	41	6003	c.5563C>A	c.(5563-5565)CAC>AAC	p.H1855N	FRAS1_uc003hkw.2_Missense_Mutation_p.H1855N|FRAS1_uc010ijj.1_Missense_Mutation_p.H275N	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1854	CSPG 7.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ACTCTCATTTCACCATTTTTT	0.418																0.458333	67.143531	67.216297	22	26	KEEP	---	---	---	---	16	11	17	10	0.407407407407	capture	Missense_Mutation	SNP	79362349	79362349	FRAS1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	5986	23
OSTC	58505	broad.mit.edu	37	4	109571929	109571929	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:109571929T>C	uc003hzb.1	+	1	189	c.118T>C	c.(118-120)TCT>CCT	p.S40P		NM_021227	NP_067050	Q9NRP0	OSTC_HUMAN	DC2 protein	40	Helical; (Potential).					integral to membrane|oligosaccharyltransferase complex				breast(1)	1						GGTGGTGGTGTCTTACTTCCT	0.612																0.041096	-10.027522	6.502465	3	70	KEEP	---	---	---	---	3	0	43	39	-1	capture	Missense_Mutation	SNP	109571929	109571929	OSTC	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	11200	23
DCHS2	54798	broad.mit.edu	37	4	155226289	155226289	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155226289G>A	uc003inw.2	-	16	3990	c.3990C>T	c.(3988-3990)ACC>ACT	p.T1330T		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1330	Cadherin 11.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTCAAGTATGGTGGTTGTCA	0.343																0.34	47.056528	48.18954	17	33	KEEP	---	---	---	---	11	6	20	18	-1	capture	Silent	SNP	155226289	155226289	DCHS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4247	23
TKTL2	84076	broad.mit.edu	37	4	164393803	164393803	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164393803G>A	uc003iqp.3	-	1	1245	c.1084C>T	c.(1084-1086)CGT>TGT	p.R362C		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	362						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TCTATGAAACGCTCAGGGTGT	0.368																0.435714	187.256379	187.760255	61	79	KEEP	---	---	---	---	36	27	41	42	-1	capture	Missense_Mutation	SNP	164393803	164393803	TKTL2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15821	23
IRF2	3660	broad.mit.edu	37	4	185329382	185329382	+	Silent	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185329382A>G	uc003iwf.3	-	6	659	c.459T>C	c.(457-459)GAT>GAC	p.D153D		NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2	153					blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CAGGAGAAAGATCACTTACTC	0.388																0.075472	1.514188	21.105605	8	98	KEEP	---	---	---	---	4	5	48	59	-1	capture	Silent	SNP	185329382	185329382	IRF2	4	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	7751	23
TERT	7015	broad.mit.edu	37	5	1280302	1280302	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1280302C>A	uc003jcb.1	-	4	1979	c.1921G>T	c.(1921-1923)GGA>TGA	p.G641*	TERT_uc003jbz.1_5'UTR|TERT_uc003jca.1_Nonsense_Mutation_p.G641*|TERT_uc003jcc.1_Nonsense_Mutation_p.G641*|TERT_uc003jcd.1_RNA|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	641	Reverse transcriptase.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GTTCTGGCTCCCACGACGTAG	0.557					563							TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				0.362319	144.416303	146.716575	50	88	KEEP	---	---	---	---	24	34	47	53	0.586206896552	capture	Nonsense_Mutation	SNP	1280302	1280302	TERT	5	C	A	A	A	1	0	0	0	0	0	1	0	0	286	22	5	4	15649	23
SLC6A3	6531	broad.mit.edu	37	5	1422128	1422128	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1422128G>A	uc003jck.2	-	5	776	c.655C>T	c.(655-657)CGT>TGT	p.R219C		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	219	Extracellular (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	AGCACGCCACGTCTGCAGAGG	0.667																0.282353	59.15823	62.77988	24	61	KEEP	---	---	---	---	14	14	39	26	-1	capture	Missense_Mutation	SNP	1422128	1422128	SLC6A3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14577	23
PCDHA1	56147	broad.mit.edu	37	5	140166017	140166017	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140166017G>A	uc003lhb.2	+	1	142	c.142G>A	c.(142-144)GTT>ATT	p.V48I	PCDHA1_uc003lha.2_Missense_Mutation_p.V48I|PCDHA1_uc003lgz.2_Missense_Mutation_p.V48I	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	48	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTTGGCCGCGTTGCTCAGGA	0.627																0.38255	165.540617	167.341901	57	92	KEEP	---	---	---	---	39	26	50	49	-1	capture	Missense_Mutation	SNP	140166017	140166017	PCDHA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11422	23
FAT2	2196	broad.mit.edu	37	5	150924338	150924338	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150924338C>T	uc003lue.3	-	9	6363	c.6350G>A	c.(6349-6351)CGA>CAA	p.R2117Q	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2117	Extracellular (Potential).|Cadherin 18.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGGTCAATTCGGAAATATGT	0.433																0.44385	253.581158	254.097011	83	104	KEEP	---	---	---	---	45	43	61	48	-1	capture	Missense_Mutation	SNP	150924338	150924338	FAT2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5636	23
GABRA1	2554	broad.mit.edu	37	5	161318009	161318009	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161318009T>C	uc010jiw.2	+	9	1277	c.809T>C	c.(808-810)GTC>GCC	p.V270A	GABRA1_uc010jix.2_Missense_Mutation_p.V270A|GABRA1_uc010jiy.2_Missense_Mutation_p.V270A|GABRA1_uc003lyx.3_Missense_Mutation_p.V270A|GABRA1_uc010jiz.2_Missense_Mutation_p.V270A|GABRA1_uc010jja.2_Missense_Mutation_p.V270A|GABRA1_uc010jjb.2_Missense_Mutation_p.V270A	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	270	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	CTCTCACAAGTCTCCTTCTGG	0.408																0.388889	118.819756	119.787892	35	55	KEEP	---	---	---	---	24	16	30	31	-1	capture	Missense_Mutation	SNP	161318009	161318009	GABRA1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6102	23
TAP1	6890	broad.mit.edu	37	6	32815851	32815851	+	Missense_Mutation	SNP	G	A	A	rs149070070	byFrequency	TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32815851G>A	uc003ocg.2	-	8	1920	c.1765C>T	c.(1765-1767)CGC>TGC	p.R589C	TAP1_uc011dqi.1_Missense_Mutation_p.R328C	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	589	Cytoplasmic (Potential).|ABC transporter.				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						TCGCCAGGGCGTAGGGTGAAT	0.582																0.529412	53.14686	53.172144	18	16	KEEP	---	---	---	---	7	11	9	8	-1	capture	Missense_Mutation	SNP	32815851	32815851	TAP1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15438	23
RUNX2	860	broad.mit.edu	37	6	45514681	45514681	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45514681C>T	uc011dvx.1	+	9	1415	c.1205C>T	c.(1204-1206)CCG>CTG	p.P402L	RUNX2_uc011dvy.1_Missense_Mutation_p.P380L|RUNX2_uc003oxt.2_Missense_Mutation_p.P388L	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	402	Interaction with MYST3 (By similarity).|Pro/Ser/Thr-rich.|Interaction with MYST4.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						ACTTACACCCCGCCAGTCACC	0.577					190											0.495413	168.046996	168.048971	54	55	KEEP	---	---	---	---	37	26	38	32	-1	capture	Missense_Mutation	SNP	45514681	45514681	RUNX2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13640	23
ZNF292	23036	broad.mit.edu	37	6	87969728	87969728	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87969728A>G	uc003plm.3	+	8	6422	c.6381A>G	c.(6379-6381)ATA>ATG	p.I2127M		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2127	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CCTTTACGATACAGCAAAACT	0.438																0.379032	170.503483	172.092646	47	77	KEEP	---	---	---	---	20	31	37	41	-1	capture	Missense_Mutation	SNP	87969728	87969728	ZNF292	6	A	G	G	G	1	0	0	0	0	1	0	0	0	176	14	3	3	17706	23
LAMA2	3908	broad.mit.edu	37	6	129371228	129371228	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129371228C>T	uc003qbn.2	+	2	383	c.278C>T	c.(277-279)CCA>CTA	p.P93L	LAMA2_uc003qbo.2_Missense_Mutation_p.P93L	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	93	Laminin N-terminal.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AGCAGCAATCCAAACCGTATG	0.438																0.298246	42.548631	44.625173	17	40	KEEP	---	---	---	---	14	4	24	20	-1	capture	Missense_Mutation	SNP	129371228	129371228	LAMA2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8526	23
GRM1	2911	broad.mit.edu	37	6	146720521	146720521	+	Silent	SNP	C	T	T	rs145874853	byFrequency	TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146720521C>T	uc010khw.1	+	8	2816	c.2346C>T	c.(2344-2346)AAC>AAT	p.N782N	GRM1_uc010khv.1_Silent_p.N782N|GRM1_uc003qll.2_Silent_p.N782N|GRM1_uc011edz.1_Silent_p.N782N|GRM1_uc011eea.1_Silent_p.N782N	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	782	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CCAACTTCAACGAGGCCAAAT	0.502																0.137143	36.603679	58.885532	24	151	KEEP	---	---	---	---	10	18	76	86	-1	capture	Silent	SNP	146720521	146720521	GRM1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6729	23
GRM1	2911	broad.mit.edu	37	6	146755247	146755247	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146755247G>A	uc010khw.1	+	9	3370	c.2900G>A	c.(2899-2901)CGC>CAC	p.R967H	GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	967	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	p.R967H(1)		lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CAGCCGATTCGCTTTAGCCCG	0.602																0.369697	171.836007	174.295798	61	104	KEEP	---	---	---	---	44	41	63	69	-1	capture	Missense_Mutation	SNP	146755247	146755247	GRM1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6729	23
C6orf211	79624	broad.mit.edu	37	6	151789616	151789616	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151789616C>G	uc003qok.1	+	5	956	c.697C>G	c.(697-699)CTT>GTT	p.L233V	C6orf211_uc011ees.1_Missense_Mutation_p.L114V	NM_024573	NP_078849	Q9H993	CF211_HUMAN	hypothetical protein LOC79624	233							protein binding				0			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TTGGTCATTGCTTAGCAATTG	0.328																0.130137	36.118	55.55212	19	127	KEEP	---	---	---	---	14	6	78	55	-1	capture	Missense_Mutation	SNP	151789616	151789616	C6orf211	6	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	2331	23
MYCT1	80177	broad.mit.edu	37	6	153043291	153043291	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:153043291G>A	uc003qpd.3	+	2	619	c.611G>A	c.(610-612)CGT>CAT	p.R204H	MYCT1_uc010kjc.1_Missense_Mutation_p.R156H|MYCT1_uc003qpc.3_Missense_Mutation_p.R204H	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	204						nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		AGTCTGAGCCGTCCTGACTAC	0.532																0.42029	175.728636	176.493253	58	80	KEEP	---	---	---	---	35	29	37	47	-1	capture	Missense_Mutation	SNP	153043291	153043291	MYCT1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9932	23
HDAC9	9734	broad.mit.edu	37	7	18788727	18788727	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18788727G>A	uc003suh.2	+	13	2041	c.2000G>A	c.(1999-2001)CGA>CAA	p.R667Q	HDAC9_uc003sue.2_Missense_Mutation_p.R667Q|HDAC9_uc011jyd.1_Missense_Mutation_p.R667Q|HDAC9_uc003sui.2_Missense_Mutation_p.R670Q|HDAC9_uc003suj.2_Missense_Mutation_p.R626Q|HDAC9_uc003sua.1_Missense_Mutation_p.R645Q|HDAC9_uc010kue.1_Missense_Mutation_p.R322Q	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	667	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	ATCTGGTCACGACTGCAAGAA	0.438																0.369565	50.773097	51.456771	17	29	KEEP	---	---	---	---	11	11	14	18	-1	capture	Missense_Mutation	SNP	18788727	18788727	HDAC9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6941	23
ZPBP	11055	broad.mit.edu	37	7	50097612	50097612	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50097612G>A	uc003tou.2	-	4	530	c.460C>T	c.(460-462)CGT>TGT	p.R154C	ZPBP_uc011kci.1_Missense_Mutation_p.R80C|ZPBP_uc010kyw.2_Missense_Mutation_p.R153C	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	154					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					AGTTGAAGACGTTTAACAATT	0.294																0.223404	52.037066	58.640326	21	73	KEEP	---	---	---	---	11	10	42	39	-1	capture	Missense_Mutation	SNP	50097612	50097612	ZPBP	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18095	23
POM121L12	285877	broad.mit.edu	37	7	53103630	53103630	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103630C>T	uc003tpz.2	+	1	282	c.266C>T	c.(265-267)CCG>CTG	p.P89L		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	89											0						CCCGCCAAGCCGCAGCGGGTG	0.692																0.387755	54.737892	55.269146	19	30	KEEP	---	---	---	---	8	15	27	23	-1	capture	Missense_Mutation	SNP	53103630	53103630	POM121L12	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12143	23
SEMA3C	10512	broad.mit.edu	37	7	80387693	80387693	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80387693C>T	uc003uhj.2	-	15	2159	c.1597G>A	c.(1597-1599)GCC>ACC	p.A533T	SEMA3C_uc011kgw.1_Missense_Mutation_p.A551T	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	533					immune response|response to drug	membrane	receptor activity			ovary(1)	1						CCATCCCAGGCGCAATAAGGG	0.537																0.111111	18.965296	47.204849	21	168	KEEP	---	---	---	---	15	7	93	85	-1	capture	Missense_Mutation	SNP	80387693	80387693	SEMA3C	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13919	23
PDK4	5166	broad.mit.edu	37	7	95216404	95216404	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95216404C>T	uc003uoa.2	-	10	1333	c.1013G>A	c.(1012-1014)CGT>CAT	p.R338H	PDK4_uc003unz.2_Missense_Mutation_p.R126H	NM_002612	NP_002603	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase 4 precursor	338	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity				0	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TGCATACAGACGAGAAATTGG	0.378					1033											0.142857	8.919544	14.085753	6	36	KEEP	---	---	---	---	5	3	22	16	-1	capture	Missense_Mutation	SNP	95216404	95216404	PDK4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11581	23
KEL	3792	broad.mit.edu	37	7	142650962	142650962	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142650962C>T	uc003wcb.2	-	9	1216	c.1006G>A	c.(1006-1008)GTG>ATG	p.V336M		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	336	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TCATGGACCACGAGGGACTGA	0.537																0.268908	340.11704	363.050321	128	348	KEEP	---	---	---	---	70	62	185	173	-1	capture	Missense_Mutation	SNP	142650962	142650962	KEL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8064	23
TRPA1	8989	broad.mit.edu	37	8	72938268	72938268	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72938268C>A	uc003xza.2	-	25	3153	c.2978G>T	c.(2977-2979)TGG>TTG	p.W993L	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	993	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GCGTAGAAACCAAAGTGGCAG	0.363																0.383721	97.350718	98.371634	33	53	KEEP	---	---	---	---	24	17	39	26	0.414634146341	capture	Missense_Mutation	SNP	72938268	72938268	TRPA1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	16460	23
DOCK8	81704	broad.mit.edu	37	9	286581	286581	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:286581G>A	uc003zgf.2	+	3	389	c.277G>A	c.(277-279)GTG>ATG	p.V93M	DOCK8_uc011lls.1_Missense_Mutation_p.V93M|DOCK8_uc010mgu.2_Translation_Start_Site|DOCK8_uc010mgv.2_Missense_Mutation_p.V25M|DOCK8_uc010mgt.2_Missense_Mutation_p.V25M|DOCK8_uc003zgg.2_Missense_Mutation_p.V25M|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	93					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	p.V25M(1)		ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CGACTTGGACGTGGTGTTCAC	0.498																0.619048	127.238247	128.021381	39	24	KEEP	---	---	---	---	20	23	15	11	-1	capture	Missense_Mutation	SNP	286581	286581	DOCK8	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4649	23
GLIS3	169792	broad.mit.edu	37	9	4286000	4286000	+	Silent	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:4286000G>A	uc003zii.1	-	2	1139	c.426C>T	c.(424-426)AAC>AAT	p.N142N	GLIS3_uc003zhx.1_Intron|GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron			Q8NEA6	GLIS3_HUMAN	SubName: Full=GLIS family zinc finger 3 transcript variant TS2; SubName: Full=GLIS family zinc finger 3 transcript variant TS3; SubName: Full=GLIS family zinc finger 3 transcript variant TS4; SubName: Full=GLIS family zinc finger 3 transcript variant TS5; Flags: Fragment;	Error:Variant_position_missing_in_Q8NEA6_after_alignment					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GAAAAAAATCGTTTCCATTTT	0.393																0.731343	164.802974	168.040352	49	18	KEEP	---	---	---	---	29	24	7	12	-1	capture	Silent	SNP	4286000	4286000	GLIS3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	508	40	1	1	6383	23
SCML2	10389	broad.mit.edu	37	X	18260650	18260650	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18260650G>T	uc004cyl.2	-	14	2040	c.1883C>A	c.(1882-1884)CCT>CAT	p.P628H	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Intron|SCML2_uc011miz.1_Intron|SCML2_uc010nfc.2_Intron	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	628					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					CCAGGTTGAAGGGTCCTTAGA	0.453	Esophageal Squamous(100;1252 1965 19021 35517)															0.378378	124.327181	125.766305	42	69	KEEP	---	---	---	---	16	28	45	29	0.363636363636	capture	Missense_Mutation	SNP	18260650	18260650	SCML2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	13803	23
CNKSR2	22866	broad.mit.edu	37	X	21670464	21670464	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21670464A>G	uc004czx.1	+	22	2966	c.2930A>G	c.(2929-2931)GAC>GGC	p.D977G	CNKSR2_uc011mjo.1_Missense_Mutation_p.D947G	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	977					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AAAGTCCTAGACAATCCAGAC	0.378																0.357143	171.334181	173.840676	50	90	KEEP	---	---	---	---	34	23	51	51	-1	capture	Missense_Mutation	SNP	21670464	21670464	CNKSR2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3572	23
DMD	1756	broad.mit.edu	37	X	31986588	31986588	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:31986588G>A	uc004dda.1	-	45	6726	c.6482C>T	c.(6481-6483)ACA>ATA	p.T2161I	DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Missense_Mutation_p.T817I|DMD_uc004dcx.2_Missense_Mutation_p.T820I|DMD_uc004dcz.2_Missense_Mutation_p.T2038I|DMD_uc004dcy.1_Missense_Mutation_p.T2157I|DMD_uc004ddb.1_Missense_Mutation_p.T2153I|DMD_uc010ngo.1_Missense_Mutation_p.T70I|DMD_uc010ngn.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2161	Spectrin 15.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGCATTCAATGTTCTGACAAC	0.428																0.463235	185.701135	185.862194	63	73	KEEP	---	---	---	---	43	29	49	27	-1	capture	Missense_Mutation	SNP	31986588	31986588	DMD	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4538	23
PIM2	11040	broad.mit.edu	37	X	48771498	48771498	+	Silent	SNP	C	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48771498C>A	uc004dls.2	-	6	1148	c.846G>T	c.(844-846)CTG>CTT	p.L282L	SLC35A2_uc004dlo.1_5'Flank|SLC35A2_uc011mml.1_5'Flank|SLC35A2_uc004dlp.1_5'Flank|SLC35A2_uc011mmm.1_5'Flank|SLC35A2_uc011mmn.1_5'Flank|SLC35A2_uc004dlq.2_5'Flank|SLC35A2_uc011mmo.1_5'Flank	NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	282	Protein kinase.				anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4						TCCAGGGGTCCAGCAGGATCT	0.577					33											0.428571	26.571433	26.664923	9	12	KEEP	---	---	---	---	4	5	8	4	0.555555555556	capture	Silent	SNP	48771498	48771498	PIM2	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	11831	23
P2RY4	5030	broad.mit.edu	37	X	69478786	69478786	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69478786G>T	uc004dxz.1	-	1	869	c.689C>A	c.(688-690)CCC>CAC	p.P230H		NM_002565	NP_002556	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y4	230	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1						GCCTGGCAAGGGCTGATACAG	0.582																0.393939	34.163112	34.489417	13	20	KEEP	---	---	---	---	10	3	13	7	0.769230769231	capture	Missense_Mutation	SNP	69478786	69478786	P2RY4	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11257	23
KIF4A	24137	broad.mit.edu	37	X	69626855	69626855	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69626855A>G	uc004dyg.2	+	28	3312	c.3185A>G	c.(3184-3186)GAT>GGT	p.D1062G	KIF4A_uc010nkw.2_Missense_Mutation_p.D1062G	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	1062	Globular.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						gatggtgatgatgatgagggg	0.303																0.4	68.294708	68.730549	20	30	KEEP	---	---	---	---	7	14	18	12	-1	capture	Missense_Mutation	SNP	69626855	69626855	KIF4A	23	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8225	23
MED12	9968	broad.mit.edu	37	X	70351950	70351950	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70351950G>A	uc004dyy.2	+	30	4346	c.4147G>A	c.(4147-4149)GCC>ACC	p.A1383T	MED12_uc011mpq.1_Missense_Mutation_p.A1383T|MED12_uc004dyz.2_Missense_Mutation_p.A1383T|MED12_uc004dza.2_Missense_Mutation_p.A1230T|MED12_uc010nla.2_Missense_Mutation_p.A9T	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1383					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GGAGAACATCGCCAAGGCCAC	0.507																0.415584	95.885427	96.364609	32	45	KEEP	---	---	---	---	20	19	25	21	-1	capture	Missense_Mutation	SNP	70351950	70351950	MED12	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9341	23
DIAPH2	1730	broad.mit.edu	37	X	96171460	96171460	+	Silent	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96171460A>G	uc004efu.3	+	8	1152	c.756A>G	c.(754-756)GGA>GGG	p.G252G	DIAPH2_uc004eft.3_Silent_p.G252G|DIAPH2_uc004efs.2_Silent_p.G259G	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	252	GBD/FH3.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						GGATTCTAGGAGATGAAAGAA	0.299																0.375	51.317409	51.865277	15	25	KEEP	---	---	---	---	8	7	17	8	-1	capture	Silent	SNP	96171460	96171460	DIAPH2	23	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	4477	23
RGAG1	57529	broad.mit.edu	37	X	109694565	109694565	+	Silent	SNP	A	G	G			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109694565A>G	uc004eor.1	+	3	966	c.720A>G	c.(718-720)GAA>GAG	p.E240E	RGAG1_uc011msr.1_Silent_p.E240E	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	240										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						AAGACACCGAAGCAATGTCCA	0.468																0.431472	297.549991	298.355779	85	112	KEEP	---	---	---	---	40	47	54	60	-1	capture	Silent	SNP	109694565	109694565	RGAG1	23	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	13169	23
ODZ1	10178	broad.mit.edu	37	X	123637433	123637433	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123637433T>C	uc004euj.2	-	19	3486	c.3422A>G	c.(3421-3423)CAT>CGT	p.H1141R	ODZ1_uc011muj.1_Missense_Mutation_p.H1140R|ODZ1_uc010nqy.2_Missense_Mutation_p.H1141R	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1141	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CAAAATGTGATGCTTATTCAA	0.358					623											0.408088	371.274685	373.281976	111	161	KEEP	---	---	---	---	63	61	85	100	-1	capture	Missense_Mutation	SNP	123637433	123637433	ODZ1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	10739	23
GABRE	2564	broad.mit.edu	37	X	151129839	151129839	+	Splice_Site	SNP	T	A	A			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151129839T>A	uc004ffi.2	-	5	618	c.564_splice	c.e5-1	p.R188_splice	GABRE_uc011myd.1_Splice_Site|GABRE_uc011mye.1_Intron|MIR224_hsa-mir-224|MI0000301_5'Flank|MIR452_hsa-mir-452|MI0001733_5'Flank	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ATGGTCATCCTGGAAGGGAGA	0.493																0.375	81.629605	82.608383	27	45	KEEP	---	---	---	---	19	9	24	21	-1	capture	Splice_Site	SNP	151129839	151129839	GABRE	23	T	A	A	A	1	0	0	0	0	0	0	1	0	715	55	5	4	6112	23
ATP2B3	492	broad.mit.edu	37	X	152801876	152801876	+	Silent	SNP	C	T	T			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152801876C>T	uc004fht.1	+	1	297	c.171C>T	c.(169-171)AGC>AGT	p.S57S	ATP2B3_uc004fhs.1_Silent_p.S57S	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	57	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGATGTCAGCGGGCTCTGCC	0.667																0.5	19.050264	19.050264	6	6	KEEP	---	---	---	---	2	5	1	6	-1	capture	Silent	SNP	152801876	152801876	ATP2B3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	1132	23
ZNF234	10780	broad.mit.edu	37	19	44661986	44661986	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44661986delG	uc002oym.2	+	6	2124	c.1817delG	c.(1816-1818)AGTfs	p.S606fs	ZNF234_uc002oyl.3_Frame_Shift_Del_p.S606fs	NM_006630	NP_006621	Q14588	ZN234_HUMAN	zinc finger protein 234	606	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				AAGCACTTCAGTCAGGCCTCA	0.468																0.25			52	153		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	44661986	44661986	ZNF234	19	G	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	17667	23
GPR143	4935	broad.mit.edu	37	X	9711643	9711643	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0145-01	TCGA-06-0145-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:9711643delC	uc004cst.1	-	6	789	c.789delG	c.(787-789)AAGfs	p.K263fs		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	243	Cytoplasmic (Potential).				calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				AAAATCGGATCTTGATCACGG	0.393																0.38			83	135		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	9711643	9711643	GPR143	23	C	-	-	-	1	0	1	0	1	0	0	0	0	415	32	5	5	6585	23
