Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1888126	1888126	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1888126G>A	uc001aim.1	-	17	2105	c.1949C>T	c.(1948-1950)ACG>ATG	p.T650M	KIAA1751_uc009vkz.1_Missense_Mutation_p.T650M	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	650										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CTTGAAAGTCGTGCCCAAGCC	0.582																0.309091	45.65956	47.443067	17	38	KEEP	---	---	---	---	13	5	19	22	-1	capture	Missense_Mutation	SNP	1888126	1888126	KIAA1751	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8178	59
TAS1R2	80834	broad.mit.edu	37	1	19166593	19166593	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19166593G>A	uc001bba.1	-	6	2021	c.2020C>T	c.(2020-2022)CGC>TGC	p.R674C		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	674	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CCCTGGTAGCGGACCCAGTAG	0.572																0.32197	248.117726	255.529937	85	179	KEEP	---	---	---	---	59	51	112	133	-1	capture	Missense_Mutation	SNP	19166593	19166593	TAS1R2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15451	59
GRHL3	57822	broad.mit.edu	37	1	24657929	24657929	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24657929C>T	uc001biy.2	+	2	92	c.46C>T	c.(46-48)CGG>TGG	p.R16W	GRHL3_uc001bix.2_Missense_Mutation_p.R11W|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	11					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CAGGTCTGTGCGGCTGCTAAA	0.512																0.287671	57.761626	60.70325	21	52	KEEP	---	---	---	---	17	15	27	35	-1	capture	Missense_Mutation	SNP	24657929	24657929	GRHL3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	6698	59
KPRP	448834	broad.mit.edu	37	1	152732729	152732729	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152732729G>A	uc001fal.1	+	2	723	c.665G>A	c.(664-666)CGG>CAG	p.R222Q		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	222						cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCAGTATCGGTCCCGGACT	0.582																0.364929	236.586168	239.943769	77	134	KEEP	---	---	---	---	48	46	76	76	-1	capture	Missense_Mutation	SNP	152732729	152732729	KPRP	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8356	59
OR2L8	391190	broad.mit.edu	37	1	248112496	248112496	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248112496C>A	uc001idt.1	+	1	337	c.337C>A	c.(337-339)CTT>ATT	p.L113I	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	113	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			AGAAGCACTACTTTTGGCATC	0.443																0.341463	325.79278	333.081462	112	216	KEEP	---	---	---	---	72	51	134	103	0.414634146341	capture	Missense_Mutation	SNP	248112496	248112496	OR2L8	1	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	10913	59
SMC3	9126	broad.mit.edu	37	10	112328741	112328741	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112328741G>C	uc001kze.2	+	2	187	c.61G>C	c.(61-63)GAT>CAT	p.D21H		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	21					cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AACAATTGTAGATCCCTTCAG	0.308																0.159574	35.661407	46.037965	15	79	KEEP	---	---	---	---	10	11	45	44	-1	capture	Missense_Mutation	SNP	112328741	112328741	SMC3	10	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14676	59
SMC3	9126	broad.mit.edu	37	10	112341821	112341821	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112341821C>G	uc001kze.2	+	9	814	c.688C>G	c.(688-690)CAG>GAG	p.Q230E		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	230	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CATTTACAATCAGGAACTTAA	0.343																0.233577	92.126378	101.027958	32	105	KEEP	---	---	---	---	22	15	66	54	-1	capture	Missense_Mutation	SNP	112341821	112341821	SMC3	10	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	14676	59
NHLRC2	374354	broad.mit.edu	37	10	115668096	115668096	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115668096G>A	uc001lax.1	+	11	2194	c.1982G>A	c.(1981-1983)AGT>AAT	p.S661N	NHLRC2_uc001lay.1_RNA	NM_198514	NP_940916	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	661					cell redox homeostasis					ovary(1)	1				Epithelial(162;0.017)|all cancers(201;0.0187)		AACATTTCCAGTCAACCAACA	0.348																0.5	115.366857	115.366857	37	37	KEEP	---	---	---	---	19	23	26	14	-1	capture	Missense_Mutation	SNP	115668096	115668096	NHLRC2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10313	59
DAGLA	747	broad.mit.edu	37	11	61490356	61490356	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61490356C>T	uc001nsa.2	+	4	444	c.333C>T	c.(331-333)TAC>TAT	p.Y111Y		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	111	Helical; (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		AGTTCATCTACGCCATCGTGG	0.607																0.03876	-20.524908	9.110985	5	124	KEEP	---	---	---	---	1	4	95	49	-1	capture	Silent	SNP	61490356	61490356	DAGLA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4185	59
CPT1A	1374	broad.mit.edu	37	11	68579934	68579934	+	Silent	SNP	A	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68579934A>G	uc001oog.3	-	3	422	c.252T>C	c.(250-252)ATT>ATC	p.I84I	CPT1A_uc001oof.3_Silent_p.I84I|CPT1A_uc009ysj.2_Silent_p.I84I	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform	84	Mitochondrial intermembrane (Potential).				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	TGATTTTTGCAATTATTCCTA	0.473																0.027397	-29.027941	6.960626	4	142	KEEP	---	---	---	---	2	3	80	81	-1	capture	Silent	SNP	68579934	68579934	CPT1A	11	A	G	G	G	1	0	0	0	0	0	0	0	1	60	5	3	3	3796	59
P2RY2	5029	broad.mit.edu	37	11	72945705	72945705	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72945705C>T	uc001otj.2	+	3	834	c.501C>T	c.(499-501)CCC>CCT	p.P167P	P2RY2_uc001otk.2_Silent_p.P167P|P2RY2_uc001otl.2_Silent_p.P167P	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	167	Helical; Name=4; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	GCCAGGCCCCCGTGCTCTACT	0.721																0.342857	35.395268	36.156017	12	23	KEEP	---	---	---	---	8	6	17	10	-1	capture	Silent	SNP	72945705	72945705	P2RY2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11256	59
ST14	6768	broad.mit.edu	37	11	130069961	130069961	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130069961C>T	uc001qfw.2	+	16	2116	c.1923C>T	c.(1921-1923)TGC>TGT	p.C641C		NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	641	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GCCACATCTGCGGTGCTTCCC	0.627																0.047059	-10.041852	8.509327	4	81	KEEP	---	---	---	---	2	3	43	50	-1	capture	Silent	SNP	130069961	130069961	ST14	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	15101	59
SLC38A2	54407	broad.mit.edu	37	12	46757576	46757576	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46757576C>T	uc001rpg.2	-	12	1427	c.987G>A	c.(985-987)AAG>AAA	p.K329K	SLC38A2_uc010sli.1_Silent_p.K167K|SLC38A2_uc001rph.2_Silent_p.K229K	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	329	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		AAAATGAAATCTTGGACACAT	0.343	Ovarian(9;448 492 8335 28722 40361)															0.057692	-3.320459	7.351681	3	49	KEEP	---	---	---	---	3	1	30	26	-1	capture	Silent	SNP	46757576	46757576	SLC38A2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	14496	59
BAZ2A	11176	broad.mit.edu	37	12	57005685	57005685	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57005685G>A	uc001slq.1	-	6	1681	c.1487C>T	c.(1486-1488)TCT>TTT	p.S496F	BAZ2A_uc001slp.1_Missense_Mutation_p.S494F|BAZ2A_uc009zow.1_Missense_Mutation_p.S464F	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	496					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						AGTTACGGGAGAGGCTTTTGG	0.542																0.434783	29.845517	29.930991	10	13	KEEP	---	---	---	---	4	6	7	8	-1	capture	Missense_Mutation	SNP	57005685	57005685	BAZ2A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	1320	59
ALDH1L2	160428	broad.mit.edu	37	12	105455479	105455479	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:105455479G>T	uc001tlc.2	-	8	1100	c.973C>A	c.(973-975)CAG>AAG	p.Q325K	ALDH1L2_uc009zuo.2_5'UTR|ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	325					10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						GAAAAGTACTGAGAGGCAGGG	0.408																0.290909	83.150061	87.461905	32	78	KEEP	---	---	---	---	22	17	46	40	0.564102564103	capture	Missense_Mutation	SNP	105455479	105455479	ALDH1L2	12	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	495	59
TRPV4	59341	broad.mit.edu	37	12	110230485	110230485	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110230485G>A	uc001tpj.1	-	10	1891	c.1796C>T	c.(1795-1797)ACG>ATG	p.T599M	TRPV4_uc001tpg.1_Missense_Mutation_p.T565M|TRPV4_uc001tph.1_Missense_Mutation_p.T552M|TRPV4_uc001tpi.1_Missense_Mutation_p.T492M|TRPV4_uc001tpk.1_Missense_Mutation_p.T599M|TRPV4_uc001tpl.1_Missense_Mutation_p.T539M	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	599	Cytoplasmic (Potential).				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						ATAGGTCCCCGTCAGCTTCAG	0.582																0.25641	50.065829	54.260982	20	58	KEEP	---	---	---	---	8	13	34	26	-1	capture	Missense_Mutation	SNP	110230485	110230485	TRPV4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16481	59
DNAH10	196385	broad.mit.edu	37	12	124330629	124330629	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124330629C>T	uc001uft.3	+	31	5413	c.5388C>T	c.(5386-5388)TAC>TAT	p.Y1796Y		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1796	AAA 1 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCTACGGCTACGAGTACATGG	0.587																0.291139	64.209871	67.28719	23	56	KEEP	---	---	---	---	20	14	49	34	-1	capture	Silent	SNP	124330629	124330629	DNAH10	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4556	59
NYNRIN	57523	broad.mit.edu	37	14	24878300	24878300	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24878300C>A	uc001wpf.3	+	4	1618	c.1300C>A	c.(1300-1302)CCA>ACA	p.P434T		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	434					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						AGCTGGTAGACCAGATGGGGG	0.552					473											0.46875	48.023207	48.050341	15	17	KEEP	---	---	---	---	5	13	5	14	0.722222222222	capture	Missense_Mutation	SNP	24878300	24878300	NYNRIN	14	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	10701	59
PLEK2	26499	broad.mit.edu	37	14	67864439	67864439	+	Silent	SNP	G	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:67864439G>T	uc001xjh.1	-	2	199	c.147C>A	c.(145-147)GGC>GGA	p.G49G		NM_016445	NP_057529	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	49	PH 1.				actin cytoskeleton organization|intracellular signal transduction	cytoplasm|cytoskeleton|lamellipodium membrane				ovary(1)|pancreas(1)	2				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		GGAGGATCCGGCCCTTGGGAG	0.592																0.3	33.617962	35.028428	12	28	KEEP	---	---	---	---	8	6	16	14	0.571428571429	capture	Silent	SNP	67864439	67864439	PLEK2	14	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	11957	59
SGK269	79834	broad.mit.edu	37	15	77473255	77473255	+	Silent	SNP	T	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:77473255T>C	uc002bcm.2	-	3	1322	c.1014A>G	c.(1012-1014)TCA>TCG	p.S338S	SGK269_uc002bcn.2_Silent_p.S338S	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	338	Ser-rich.				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TGGAGTCAGATGACACCATGC	0.423					217											0.357143	134.139937	136.404827	45	81	KEEP	---	---	---	---	26	19	45	42	-1	capture	Silent	SNP	77473255	77473255	SGK269	15	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	14104	59
CHRNB4	1143	broad.mit.edu	37	15	78921872	78921872	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78921872C>T	uc002bed.1	-	5	887	c.775G>A	c.(775-777)GAC>AAC	p.D259N	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.D77N	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	259	Cytoplasmic (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						TCGCCGCAGTCGGATGGCAGG	0.557					152											0.405172	143.603987	144.515291	47	69	KEEP	---	---	---	---	29	22	35	42	-1	capture	Missense_Mutation	SNP	78921872	78921872	CHRNB4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3358	59
RASGRF1	5923	broad.mit.edu	37	15	79292172	79292172	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79292172C>T	uc002beq.2	-	18	3082	c.2707G>A	c.(2707-2709)GCC>ACC	p.A903T	RASGRF1_uc002bep.2_Missense_Mutation_p.A887T|RASGRF1_uc010blm.1_Missense_Mutation_p.A812T|RASGRF1_uc002ber.3_Missense_Mutation_p.A887T|RASGRF1_uc010unh.1_Missense_Mutation_p.A298T|RASGRF1_uc002beo.2_Missense_Mutation_p.A119T	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	905					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						AAGGCAGAGGCGGCCGACAAG	0.562				p.A903T(JHH2-Tumor)	694											0.035398	-19.083357	7.408296	4	109	KEEP	---	---	---	---	3	2	75	82	-1	capture	Missense_Mutation	SNP	79292172	79292172	RASGRF1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12967	59
NTRK3	4916	broad.mit.edu	37	15	88576210	88576210	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:88576210A>G	uc002bme.1	-	13	1625	c.1463T>C	c.(1462-1464)ATC>ACC	p.I488T	NTRK3_uc002bmh.2_Missense_Mutation_p.I480T|NTRK3_uc002bmf.1_Missense_Mutation_p.I488T|NTRK3_uc010upl.1_Missense_Mutation_p.I390T|NTRK3_uc010bnh.1_Missense_Mutation_p.I480T|NTRK3_uc002bmg.2_Missense_Mutation_p.I488T|NTRK3_uc010bni.2_RNA	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	488	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	p.I488I(1)|p.I488T(1)	ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGGCGTGGTGATGCCGTGGTT	0.607					506	T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			0.222222	16.13645	18.052125	6	21	KEEP	---	---	---	---	3	4	12	13	-1	capture	Missense_Mutation	SNP	88576210	88576210	NTRK3	15	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	10615	59
SEPT12	124404	broad.mit.edu	37	16	4834042	4834042	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4834042G>A	uc002cxq.2	-	5	543	c.402C>T	c.(400-402)AAC>AAT	p.N134N	SEPT12_uc002cxr.2_Intron|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	134					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CGTATTGCTCGTTGATGTAGC	0.627																0.064865	-10.432889	25.944445	12	173	KEEP	---	---	---	---	10	4	95	111	-1	capture	Silent	SNP	4834042	4834042	SEPT12	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13955	59
IQCK	124152	broad.mit.edu	37	16	19729642	19729642	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19729642G>C	uc002dgr.2	+	2	713	c.14G>C	c.(13-15)CGG>CCG	p.R5P	IQCK_uc002dgs.2_RNA|IQCK_uc010vat.1_Missense_Mutation_p.R5P|IQCK_uc010bwc.2_RNA|IQCK_uc010vau.1_5'UTR|C16orf88_uc002dgq.2_5'Flank	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K	5										skin(1)	1						GCGGCACCGCGGCAAATCCCC	0.692																0.25	6.04778	6.501119	2	6	KEEP	---	---	---	---	2	2	6	3	-1	capture	Missense_Mutation	SNP	19729642	19729642	IQCK	16	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	7736	59
ODF4	146852	broad.mit.edu	37	17	8243550	8243550	+	Missense_Mutation	SNP	C	T	T	rs147153349		TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8243550C>T	uc002gle.1	+	1	363	c.181C>T	c.(181-183)CGC>TGC	p.R61C		NM_153007	NP_694552	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	61					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)	1						CTTGGGCCAGCGCCAGAACTC	0.592																0.52381	69.451393	69.472094	22	20	KEEP	---	---	---	---	17	11	11	11	-1	capture	Missense_Mutation	SNP	8243550	8243550	ODF4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10738	59
RHBDL3	162494	broad.mit.edu	37	17	30632431	30632431	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30632431G>A	uc002hhe.1	+	7	867	c.853G>A	c.(853-855)GTC>ATC	p.V285I	RHBDL3_uc010csw.1_Missense_Mutation_p.V277I|RHBDL3_uc010csx.1_Intron|RHBDL3_uc010csy.1_Missense_Mutation_p.V187I|RHBDL3_uc002hhf.1_Missense_Mutation_p.V187I	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3	285	Helical; (Potential).				proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				GTATGCTCTCGTCTCTGCCCA	0.542																0.379518	172.780562	174.895507	63	103	KEEP	---	---	---	---	31	39	55	58	-1	capture	Missense_Mutation	SNP	30632431	30632431	RHBDL3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13215	59
POLRMT	5442	broad.mit.edu	37	19	622950	622950	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:622950C>A	uc002lpf.1	-	7	1382	c.1326G>T	c.(1324-1326)GAG>GAT	p.E442D		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	442					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGTGCTTTCTCCCATTGGT	0.672																0.071429	-2.347859	8.254879	4	52	KEEP	---	---	---	---	3	2	29	37	0.4	capture	Missense_Mutation	SNP	622950	622950	POLRMT	19	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	12140	59
PODNL1	79883	broad.mit.edu	37	19	14046600	14046600	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14046600G>A	uc002mxr.2	-	5	723	c.449C>T	c.(448-450)GCG>GTG	p.A150V	PODNL1_uc010xni.1_Missense_Mutation_p.A68V|PODNL1_uc010xnj.1_Missense_Mutation_p.A148V|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101	Q6PEZ8	PONL1_HUMAN	podocan-like 1 isoform 1	150	Leu-rich.|LRR 4.					proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			AGCCAGATCCGCGACACGGAG	0.667																0.235294	19.582009	21.761384	8	26	KEEP	---	---	---	---	1	8	15	16	-1	capture	Missense_Mutation	SNP	14046600	14046600	PODNL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12082	59
EMR2	30817	broad.mit.edu	37	19	14857101	14857101	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14857101A>C	uc002mzp.1	-	18	2582	c.2126T>G	c.(2125-2127)ATT>AGT	p.I709S	EMR2_uc010dzs.1_Missense_Mutation_p.I168S|EMR2_uc010xnw.1_Missense_Mutation_p.I651S|EMR2_uc002mzo.1_Missense_Mutation_p.I698S|EMR2_uc002mzq.1_Missense_Mutation_p.I649S|EMR2_uc002mzr.1_Missense_Mutation_p.I660S|EMR2_uc002mzs.1_Missense_Mutation_p.I567S|EMR2_uc002mzt.1_Missense_Mutation_p.I605S|EMR2_uc002mzu.1_Missense_Mutation_p.I616S|EMR2_uc010xnx.1_RNA	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	709	Cytoplasmic (Potential).				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						GTTTTTCAAAATCCAGAGAGT	0.388																0.253676	208.452287	223.426709	69	203	KEEP	---	---	---	---	47	34	117	128	-1	capture	Missense_Mutation	SNP	14857101	14857101	EMR2	19	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	5060	59
CPAMD8	27151	broad.mit.edu	37	19	17086872	17086872	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17086872G>A	uc002nfb.2	-	16	2021	c.1989C>T	c.(1987-1989)GTC>GTT	p.V663V		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	616						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CAACTGCGGCGACGCACACAC	0.597				p.V663V(SNU869-Tumor)	1067											0.220779	39.538431	45.061749	17	60	KEEP	---	---	---	---	9	12	30	42	-1	capture	Silent	SNP	17086872	17086872	CPAMD8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	3760	59
ZFP30	22835	broad.mit.edu	37	19	38126468	38126468	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38126468G>A	uc002ogv.1	-	6	1490	c.974C>T	c.(973-975)CCC>CTC	p.P325L	ZFP30_uc002ogw.1_Missense_Mutation_p.P325L|ZFP30_uc002ogx.1_Missense_Mutation_p.P325L|ZFP30_uc010xtt.1_Missense_Mutation_p.P324L	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	325					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACATTCATAGGGTTTTTCTCC	0.438																0.210191	80.785103	92.987123	33	124	KEEP	---	---	---	---	18	19	69	61	-1	capture	Missense_Mutation	SNP	38126468	38126468	ZFP30	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	17524	59
MAP4K1	11184	broad.mit.edu	37	19	39086283	39086283	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39086283C>T	uc002oix.1	-	28	2374	c.2266G>A	c.(2266-2268)GTG>ATG	p.V756M	MAP4K1_uc002oiw.1_Missense_Mutation_p.V343M|MAP4K1_uc002oiy.1_Missense_Mutation_p.V756M	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	756	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CACAGACCCACGGCCTCCACC	0.622					518											0.186047	48.832501	60.746607	24	105	KEEP	---	---	---	---	14	12	61	62	-1	capture	Missense_Mutation	SNP	39086283	39086283	MAP4K1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9173	59
LILRA1	11024	broad.mit.edu	37	19	55107682	55107682	+	Silent	SNP	G	A	A	rs138767008		TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55107682G>A	uc002qgh.1	+	7	1169	c.987G>A	c.(985-987)TCG>TCA	p.S329S	LILRA2_uc010yfg.1_Silent_p.S327S|LILRA1_uc010yfh.1_Silent_p.S329S	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	329	Ig-like C2-type 4.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		CCTTCATCTCGGTGCATCCGG	0.612																0.22973	43.962271	48.899722	17	57	KEEP	---	---	---	---	9	11	28	35	-1	capture	Silent	SNP	55107682	55107682	LILRA1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8704	59
NLRP8	126205	broad.mit.edu	37	19	56466478	56466478	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56466478G>A	uc002qmh.2	+	3	1125	c.1054G>A	c.(1054-1056)GTA>ATA	p.V352I	NLRP8_uc010etg.2_Missense_Mutation_p.V352I	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	352	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCCCTCTCTCGTAACCCTTCC	0.458																0.260638	128.388411	138.139259	49	139	KEEP	---	---	---	---	32	25	70	85	-1	capture	Missense_Mutation	SNP	56466478	56466478	NLRP8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10390	59
EHD3	30845	broad.mit.edu	37	2	31483602	31483602	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31483602C>T	uc002rnu.2	+	4	1337	c.729C>T	c.(727-729)ATC>ATT	p.I243I	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	243					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					TGGGGAAGATCGTGAACACCC	0.592																0.052632	-9.906057	10.185456	5	90	KEEP	---	---	---	---	3	3	47	50	-1	capture	Silent	SNP	31483602	31483602	EHD3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4934	59
SLC35F5	80255	broad.mit.edu	37	2	114489225	114489225	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:114489225G>T	uc002tku.1	-	10	1345	c.921C>A	c.(919-921)AGC>AGA	p.S307R	SLC35F5_uc002tkt.2_RNA	NM_025181	NP_079457	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	307	DUF6.|Helical; (Potential).				transport	integral to membrane					0						CGCCTCCAATGCTATGAGAAT	0.373																0.291925	130.256813	136.501544	47	114	KEEP	---	---	---	---	34	20	62	64	0.62962962963	capture	Missense_Mutation	SNP	114489225	114489225	SLC35F5	2	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	14484	59
GCA	25801	broad.mit.edu	37	2	163204201	163204201	+	Silent	SNP	T	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163204201T>C	uc002ucg.2	+	2	317	c.141T>C	c.(139-141)TAT>TAC	p.Y47Y	GCA_uc010zcu.1_Silent_p.Y28Y	NM_012198	NP_036330	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	47					cellular membrane fusion	cytoplasm|plasma membrane	calcium ion binding|protein homodimerization activity				0						CAGACACTTATTCCTCAGCTG	0.443																0.310811	75.600155	77.957711	23	51	KEEP	---	---	---	---	12	13	23	31	-1	capture	Silent	SNP	163204201	163204201	GCA	2	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	6223	59
ITGA4	3676	broad.mit.edu	37	2	182374515	182374515	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182374515A>C	uc002unu.2	+	16	2589	c.1826A>C	c.(1825-1827)AAA>ACA	p.K609T	ITGA4_uc010frj.1_Missense_Mutation_p.K91T	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	609	SG1.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AAGAAAGAAAAAGACATAATG	0.333																0.279412	61.197694	64.171721	19	49	KEEP	---	---	---	---	12	13	27	31	-1	capture	Missense_Mutation	SNP	182374515	182374515	ITGA4	2	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	7801	59
COL4A4	1286	broad.mit.edu	37	2	227924195	227924195	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227924195G>A	uc010zlt.1	-	28	2963	c.2309C>T	c.(2308-2310)CCG>CTG	p.P770L		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	770	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTCTTTCCCGGGGGTCCCAG	0.612																0.354582	273.136372	277.799588	89	162	KEEP	---	---	---	---	45	52	90	85	-1	capture	Missense_Mutation	SNP	227924195	227924195	COL4A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3658	59
CASS4	57091	broad.mit.edu	37	20	55027872	55027872	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55027872T>C	uc002xxp.2	+	6	1865	c.1640T>C	c.(1639-1641)CTT>CCT	p.L547P	CASS4_uc002xxq.3_Missense_Mutation_p.L547P|CASS4_uc002xxr.2_Missense_Mutation_p.L547P|CASS4_uc010zze.1_Missense_Mutation_p.L493P|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	547					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						CTGGAAGTTCTTGTGACTGAC	0.493																0.448276	185.389873	185.659806	52	64	KEEP	---	---	---	---	31	31	39	30	-1	capture	Missense_Mutation	SNP	55027872	55027872	CASS4	20	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	2659	59
TMPRSS15	5651	broad.mit.edu	37	21	19744570	19744570	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19744570A>T	uc002ykw.2	-	6	635	c.604T>A	c.(604-606)TTA>ATA	p.L202I		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	202	Extracellular (Potential).|LDL-receptor class A 1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TCACAAAATAAATCAGCTTTT	0.383																0.233333	48.725698	54.586879	21	69	KEEP	---	---	---	---	10	14	44	35	-1	capture	Missense_Mutation	SNP	19744570	19744570	TMPRSS15	21	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	16129	59
ICOSLG	23308	broad.mit.edu	37	21	45655287	45655287	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45655287C>T	uc002zee.2	-	4	699	c.565G>A	c.(565-567)GTC>ATC	p.V189I	ICOSLG_uc011afc.1_Missense_Mutation_p.V99I|ICOSLG_uc002zef.2_Missense_Mutation_p.V72I|ICOSLG_uc010gpp.1_Missense_Mutation_p.V189I	NM_015259	NP_056074	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand precursor	189	Extracellular (Potential).|Ig-like C2-type.				B cell activation|defense response|hyperosmotic response|positive regulation of activated T cell proliferation|signal transduction|T cell activation|T cell costimulation		receptor binding				0				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TTCAAGAAGACGGTGTCATTC	0.552																0.162162	10.925707	14.942034	6	31	KEEP	---	---	---	---	3	3	13	20	-1	capture	Missense_Mutation	SNP	45655287	45655287	ICOSLG	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7412	59
LTF	4057	broad.mit.edu	37	3	46490484	46490484	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46490484C>T	uc003cpq.2	-	9	1120	c.1082G>A	c.(1081-1083)CGT>CAT	p.R361H	LTF_uc003fzr.2_Missense_Mutation_p.R317H|LTF_uc010hjh.2_Missense_Mutation_p.R361H|LTF_uc003cpr.2_Missense_Mutation_p.R348H	NM_002343	NP_002334	P02788	TRFL_HUMAN	lactotransferrin precursor	361					cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity			central_nervous_system(2)|ovary(1)|lung(1)	4				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	Pefloxacin(DB00487)	GACCCGCGCACGCCGGGCAGC	0.667																0.107143	2.804671	7.092399	3	25	KEEP	---	---	---	---	2	2	17	16	-1	capture	Missense_Mutation	SNP	46490484	46490484	LTF	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8994	59
DHX30	22907	broad.mit.edu	37	3	47890010	47890010	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47890010G>A	uc003cru.2	+	16	2971	c.2545G>A	c.(2545-2547)GAC>AAC	p.D849N	DHX30_uc003crt.2_Missense_Mutation_p.D810N|MIR1226_hsa-mir-1226|MI0006313_5'Flank	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	849						mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAAGGCAGTGGACGAGGCTGT	0.527																0.346405	149.120758	152.311048	53	100	KEEP	---	---	---	---	37	24	70	52	-1	capture	Missense_Mutation	SNP	47890010	47890010	DHX30	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4462	59
IFRD2	7866	broad.mit.edu	37	3	50327467	50327467	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50327467C>G	uc011bdp.1	-	5	760	c.631G>C	c.(631-633)GTG>CTG	p.V211L	IFRD2_uc003czb.2_Missense_Mutation_p.V313L	NM_006764	NP_006755	Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	211							binding			lung(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCCAGCTGCACGCAGAGCAGG	0.637																0.382353	44.68054	45.088186	13	21	KEEP	---	---	---	---	9	5	12	9	-1	capture	Missense_Mutation	SNP	50327467	50327467	IFRD2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	7479	59
GPR15	2838	broad.mit.edu	37	3	98251667	98251667	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98251667G>A	uc011bgy.1	+	1	790	c.790G>A	c.(790-792)GCC>ACC	p.A264T		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	264	Extracellular (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		CAAGTTCCTGGCCATTGTCTC	0.453																0.272727	68.683452	73.291542	27	72	KEEP	---	---	---	---	14	16	40	40	-1	capture	Missense_Mutation	SNP	98251667	98251667	GPR15	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6589	59
TRPC1	7220	broad.mit.edu	37	3	142524983	142524983	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142524983A>G	uc003evc.2	+	13	2424	c.2288A>G	c.(2287-2289)GAA>GGA	p.E763G	TRPC1_uc003evb.2_Missense_Mutation_p.E729G	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	763					axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						AATCTAAACGAACTGCGCCAA	0.373																0.030928	-16.06208	7.321673	3	94	KEEP	---	---	---	---	2	1	51	55	-1	capture	Missense_Mutation	SNP	142524983	142524983	TRPC1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	16461	59
CPZ	8532	broad.mit.edu	37	4	8605806	8605806	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8605806G>A	uc003glm.2	+	4	726	c.600G>A	c.(598-600)ACG>ACA	p.T200T	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.T63T|CPZ_uc003glo.2_Silent_p.T189T|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	200				T -> M (in Ref. 4; BC006393).	proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						TGAGGCGGACGGCCTCCCGCT	0.701																0.166667	8.185307	10.713169	4	20	KEEP	---	---	---	---	4	5	14	16	-1	capture	Silent	SNP	8605806	8605806	CPZ	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3804	59
FRAS1	80144	broad.mit.edu	37	4	79366682	79366682	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79366682G>A	uc003hlb.2	+	42	6112	c.5672G>A	c.(5671-5673)CGT>CAT	p.R1891H	FRAS1_uc003hkw.2_Missense_Mutation_p.R1891H|FRAS1_uc010ijj.1_Missense_Mutation_p.R311H	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1890	CSPG 7.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GCAGGTGATCGTTTTGGCCCT	0.393																0.318182	56.55741	58.493791	21	45	KEEP	---	---	---	---	12	11	29	20	-1	capture	Missense_Mutation	SNP	79366682	79366682	FRAS1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5986	59
ALPK1	80216	broad.mit.edu	37	4	113351620	113351620	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113351620G>T	uc003iap.3	+	11	1196	c.917G>T	c.(916-918)TGT>TTT	p.C306F	ALPK1_uc003ian.3_Missense_Mutation_p.C306F|ALPK1_uc011cfx.1_Missense_Mutation_p.C228F|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.C134F	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	306							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CGTGGCACGTGTTTATTGTCC	0.398					252											0.209877	41.628305	47.938546	17	64	KEEP	---	---	---	---	10	12	41	32	0.454545454545	capture	Missense_Mutation	SNP	113351620	113351620	ALPK1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	544	59
PRSS48	345062	broad.mit.edu	37	4	152203364	152203364	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:152203364C>T	uc011cif.1	+	3	280	c.280C>T	c.(280-282)CGT>TGT	p.R94C	PRSS48_uc011cig.1_Intron	NM_183375	NP_899231	Q7RTY5	PRS48_HUMAN	epidermis-specific serine protease-like protein	94	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			large_intestine(1)	1						CTCAAGGAAACGTGTGAAGTA	0.473																0.250883	180.889346	196.852071	71	212	KEEP	---	---	---	---	42	37	124	106	-1	capture	Missense_Mutation	SNP	152203364	152203364	PRSS48	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12525	59
CDH18	1016	broad.mit.edu	37	5	19520782	19520782	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19520782T>A	uc003jgc.2	-	9	1873	c.1496A>T	c.(1495-1497)AAT>ATT	p.N499I	CDH18_uc003jgd.2_Missense_Mutation_p.N499I|CDH18_uc011cnm.1_Missense_Mutation_p.N499I	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	499	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGGCTTAGAATTTTCACATAC	0.393																0.052083	-8.70471	11.658725	5	91	KEEP	---	---	---	---	0	6	48	48	-1	capture	Missense_Mutation	SNP	19520782	19520782	CDH18	5	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	3074	59
PLCXD3	345557	broad.mit.edu	37	5	41382221	41382221	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41382221C>T	uc003jmm.1	-	2	621	c.519G>A	c.(517-519)GCG>GCA	p.A173A		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	173	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						GGGCAAAAATCGCTGGGCACA	0.428																0.167315	86.164054	113.12195	43	214	KEEP	---	---	---	---	24	20	149	112	-1	capture	Silent	SNP	41382221	41382221	PLCXD3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11946	59
FGF18	8817	broad.mit.edu	37	5	170883763	170883763	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170883763C>T	uc003mbk.2	+	5	1115	c.578C>T	c.(577-579)ACG>ATG	p.T193M		NM_003862	NP_003853	O76093	FGF18_HUMAN	fibroblast growth factor 18 precursor	193					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AAGTACACGACGGTGACCAAG	0.657																0.19802	43.750948	52.320615	20	81	KEEP	---	---	---	---	14	10	46	47	-1	capture	Missense_Mutation	SNP	170883763	170883763	FGF18	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5792	59
BCLAF1	9774	broad.mit.edu	37	6	136600997	136600997	+	Missense_Mutation	SNP	C	T	T	rs148729378	byFrequency	TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136600997C>T	uc003qgx.1	-	3	261	c.8G>A	c.(7-9)CGC>CAC	p.R3H	BCLAF1_uc003qgw.1_Missense_Mutation_p.R3H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R3H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R3H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	3					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AGAATTGGAGCGACCCATTTC	0.308	Colon(142;1534 1789 5427 7063 28491)															0.068493	-2.777594	11.272866	5	68	KEEP	---	---	---	---	4	1	45	35	-1	capture	Missense_Mutation	SNP	136600997	136600997	BCLAF1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1372	59
ESR1	2099	broad.mit.edu	37	6	152265483	152265483	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152265483C>T	uc003qom.3	+	6	1306	c.936C>T	c.(934-936)GCC>GCT	p.A312A	ESR1_uc010kin.2_Silent_p.A312A|ESR1_uc010kio.2_Silent_p.A314A|ESR1_uc010kip.2_Silent_p.A311A|ESR1_uc003qon.3_Silent_p.A312A|ESR1_uc003qoo.3_Silent_p.A312A|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Silent_p.A93A|ESR1_uc010kit.1_Silent_p.A49A|ESR1_uc011eey.1_Silent_p.A49A	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	312	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding	p.A312A(1)		central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	CCCTGACGGCCGACCAGATGG	0.547					249											0.291045	112.28316	117.517079	39	95	KEEP	---	---	---	---	19	25	47	59	-1	capture	Silent	SNP	152265483	152265483	ESR1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5211	59
SYNE1	23345	broad.mit.edu	37	6	152461284	152461284	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152461284C>T	uc010kiw.2	-	140	25861	c.25259G>A	c.(25258-25260)CGA>CAA	p.R8420Q	SYNE1_uc010kiv.2_Missense_Mutation_p.R2944Q|SYNE1_uc003qos.3_Missense_Mutation_p.R2944Q|SYNE1_uc003qot.3_Missense_Mutation_p.R8372Q|SYNE1_uc003qou.3_Missense_Mutation_p.R8420Q|SYNE1_uc003qop.3_Missense_Mutation_p.R605Q|SYNE1_uc011eez.1_Missense_Mutation_p.R622Q|SYNE1_uc003qoq.3_Missense_Mutation_p.R622Q|SYNE1_uc003qor.3_Missense_Mutation_p.R1343Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8420	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAGCTCCCATCGGTCAATCAC	0.458													HNSCC(10;0.0054)			0.045455	-16.659395	12.47073	6	126	KEEP	---	---	---	---	1	6	66	80	-1	capture	Missense_Mutation	SNP	152461284	152461284	SYNE1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15333	59
ADAM22	53616	broad.mit.edu	37	7	87795154	87795154	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87795154G>A	uc003ujn.2	+	24	2163	c.2084G>A	c.(2083-2085)AGT>AAT	p.S695N	ADAM22_uc003ujk.1_Missense_Mutation_p.S695N|ADAM22_uc003ujl.1_Missense_Mutation_p.S695N|ADAM22_uc003ujm.2_Missense_Mutation_p.S695N|ADAM22_uc003ujo.2_Missense_Mutation_p.S695N|ADAM22_uc003ujp.1_Missense_Mutation_p.S747N	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	695	EGF-like.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			CAGGTTTGCAGTAATGAGCTG	0.368					704											0.162963	46.258584	60.83606	22	113	KEEP	---	---	---	---	11	15	72	61	-1	capture	Missense_Mutation	SNP	87795154	87795154	ADAM22	7	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	244	59
ZNF3	7551	broad.mit.edu	37	7	99672770	99672770	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99672770C>G	uc003usq.2	-	5	566	c.259G>C	c.(259-261)GTG>CTG	p.V87L	ZNF3_uc003usp.2_Missense_Mutation_p.V87L|ZNF3_uc003usr.2_Missense_Mutation_p.V87L|ZNF3_uc010lgj.2_Missense_Mutation_p.V51L|ZNF3_uc003uss.2_Missense_Mutation_p.V94L|ZNF3_uc003ust.3_Missense_Mutation_p.V87L	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2	87	KRAB.				cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			AGTGAGAACACATTCCCGTAA	0.458																0.179211	123.666342	150.6942	50	229	KEEP	---	---	---	---	29	25	136	127	-1	capture	Missense_Mutation	SNP	99672770	99672770	ZNF3	7	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	17709	59
MUC17	140453	broad.mit.edu	37	7	100674888	100674888	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100674888C>T	uc003uxp.1	+	3	244	c.191C>T	c.(190-192)GCG>GTG	p.A64V	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	64	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAGGTTCTGCGGCAAACACC	0.418																0.127273	15.865173	30.78004	14	96	KEEP	---	---	---	---	9	6	46	53	-1	capture	Missense_Mutation	SNP	100674888	100674888	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9884	59
TAS2R41	259287	broad.mit.edu	37	7	143174982	143174982	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143174982C>T	uc003wdc.1	+	1	17	c.17C>T	c.(16-18)ACG>ATG	p.T6M	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	6	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					GCAGCACTGACGGCCTTCTTC	0.572																0.201087	81.863312	97.157525	37	147	KEEP	---	---	---	---	22	18	91	69	-1	capture	Missense_Mutation	SNP	143174982	143174982	TAS2R41	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15467	59
TAS2R41	259287	broad.mit.edu	37	7	143175836	143175836	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143175836C>T	uc003wdc.1	+	1	871	c.871C>T	c.(871-873)CGA>TGA	p.R291*	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	291	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					CCTCAAGCTTCGAAGCGTGTT	0.502																0.188679	43.843909	53.453932	20	86	KEEP	---	---	---	---	8	14	48	47	-1	capture	Nonsense_Mutation	SNP	143175836	143175836	TAS2R41	7	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	15467	59
KCNB2	9312	broad.mit.edu	37	8	73849053	73849053	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73849053C>T	uc003xzb.2	+	3	2051	c.1463C>T	c.(1462-1464)TCG>TTG	p.S488L		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	488	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			AATCACCTGTCGCCAAGCCGG	0.527																0.313433	117.816843	121.959643	42	92	KEEP	---	---	---	---	25	29	65	58	-1	capture	Missense_Mutation	SNP	73849053	73849053	KCNB2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7935	59
KIAA1429	25962	broad.mit.edu	37	8	95547143	95547143	+	Silent	SNP	T	C	C			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95547143T>C	uc003ygo.1	-	5	421	c.408A>G	c.(406-408)AGA>AGG	p.R136R	KIAA1429_uc003ygp.2_Silent_p.R136R	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	136					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			gtggAGAGTCTCTGTCATGAC	0.343																0.298246	44.647641	46.724979	17	40	KEEP	---	---	---	---	9	10	28	20	-1	capture	Silent	SNP	95547143	95547143	KIAA1429	8	T	C	C	C	1	0	0	0	0	0	0	0	1	699	54	3	3	8153	59
PKHD1L1	93035	broad.mit.edu	37	8	110476724	110476724	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110476724G>A	uc003yne.2	+	49	7767	c.7663G>A	c.(7663-7665)GAT>AAT	p.D2555N		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2555	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTTCTGAATGATGATGTGAC	0.443													HNSCC(38;0.096)			0.279412	49.688632	52.669578	19	49	KEEP	---	---	---	---	11	11	27	29	-1	capture	Missense_Mutation	SNP	110476724	110476724	PKHD1L1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11875	59
SLC45A4	57210	broad.mit.edu	37	8	142229845	142229845	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142229845C>T	uc003ywd.1	-	3	669	c.361G>A	c.(361-363)GCC>ACC	p.A121T	SLC45A4_uc003ywc.1_Missense_Mutation_p.A121T|SLC45A4_uc010meq.1_Missense_Mutation_p.A119T	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	172	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GTGGCATCGGCGCTGAAGTCC	0.657																0.26087	14.943373	16.131506	6	17	KEEP	---	---	---	---	3	3	10	9	-1	capture	Missense_Mutation	SNP	142229845	142229845	SLC45A4	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14535	59
CYLC2	1539	broad.mit.edu	37	9	105767804	105767804	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:105767804G>A	uc004bbs.2	+	5	961	c.891G>A	c.(889-891)ACG>ACA	p.T297T		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	297	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				aggacgccacgaaagatgcca	0.164																0.24	15.337046	16.879811	6	19	KEEP	---	---	---	---	4	2	7	12	-1	capture	Silent	SNP	105767804	105767804	CYLC2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	4102	59
MAGEB6	158809	broad.mit.edu	37	X	26212572	26212572	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26212572G>A	uc004dbr.2	+	2	758	c.609G>A	c.(607-609)GCG>GCA	p.A203A	MAGEB6_uc010ngc.1_5'UTR	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	203	MAGE.									ovary(3)	3						GCACGTTGGCGCAATTCCTGC	0.478																0.404255	115.83194	116.584279	38	56	KEEP	---	---	---	---	21	22	36	36	-1	capture	Silent	SNP	26212572	26212572	MAGEB6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9093	59
FAM70A	55026	broad.mit.edu	37	X	119410833	119410833	+	Silent	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119410833G>A	uc004eso.3	-	8	881	c.654C>T	c.(652-654)CTC>CTT	p.L218L	FAM70A_uc004esp.3_Silent_p.L194L|FAM70A_uc010nqo.2_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	218						integral to membrane				lung(1)|breast(1)	2						GCAGGTGGTAGAGGTGGATGA	0.542																0.29	155.96333	163.871008	58	142	KEEP	---	---	---	---	31	30	86	81	-1	capture	Silent	SNP	119410833	119410833	FAM70A	23	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	5553	59
SAGE1	55511	broad.mit.edu	37	X	134986679	134986679	+	Silent	SNP	C	T	T			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134986679C>T	uc004ezh.2	+	4	431	c.264C>T	c.(262-264)AAC>AAT	p.N88N	SAGE1_uc010nry.1_Intron|SAGE1_uc011mvv.1_Silent_p.N88N	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	88										ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GGATAAATAACGGCCAACCAG	0.443																0.274194	126.431793	134.987561	51	135	KEEP	---	---	---	---	21	33	80	80	-1	capture	Silent	SNP	134986679	134986679	SAGE1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13701	59
GPR112	139378	broad.mit.edu	37	X	135430793	135430793	+	Missense_Mutation	SNP	C	T	T	rs146283448		TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135430793C>T	uc004ezu.1	+	6	5219	c.4928C>T	c.(4927-4929)ACG>ATG	p.T1643M	GPR112_uc010nsb.1_Missense_Mutation_p.T1438M|GPR112_uc010nsc.1_Missense_Mutation_p.T1410M	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1643	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					ATCACACCTACGACCTTTCTC	0.468					487											0.34139	321.175931	328.533752	113	218	KEEP	---	---	---	---	61	60	122	121	-1	capture	Missense_Mutation	SNP	135430793	135430793	GPR112	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6563	59
DNASE1L1	1774	broad.mit.edu	37	X	153633852	153633852	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153633852G>A	uc004fks.1	-	2	249	c.58C>T	c.(58-60)CGC>TGC	p.R20C	DNASE1L1_uc004fkt.1_Missense_Mutation_p.R20C|DNASE1L1_uc004fku.1_Missense_Mutation_p.R20C|DNASE1L1_uc004fkv.1_Missense_Mutation_p.R20C|DNASE1L1_uc004fkw.1_Missense_Mutation_p.R20C	NM_006730	NP_006721	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1 precursor	20					DNA catabolic process	endoplasmic reticulum	DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCGCAGATGCGAAAGGCCTGG	0.607																0.3	32.482889	33.913296	12	28	KEEP	---	---	---	---	7	5	14	18	-1	capture	Missense_Mutation	SNP	153633852	153633852	DNASE1L1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4617	59
FFAR2	2867	broad.mit.edu	37	19	35940788	35940790	+	In_Frame_Del	DEL	CTG	-	-			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35940788_35940790delCTG	uc002nzg.2	+	2	252_254	c.172_174delCTG	c.(172-174)CTGdel	p.L62del	FFAR2_uc010eea.2_In_Frame_Del_p.L62del	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	62	Helical; Name=2; (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CGACCTCCTCCTGCTGCTGCTGC	0.645	GBM(40;139 809 9833 23358 48736)				34											0.08			8	90		---	---	---	---						capture_indel	In_Frame_Del	DEL	35940788	35940790	FFAR2	19	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	5774	59
CCDC136	64753	broad.mit.edu	37	7	128434467	128434469	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-0645-01	TCGA-06-0645-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128434467_128434469delGAA	uc003vnv.1	+	2	449_451	c.82_84delGAA	c.(82-84)GAAdel	p.E32del	CCDC136_uc003vnu.1_In_Frame_Del_p.E82del|CCDC136_uc003vnw.1_In_Frame_Del_p.E32del	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	32	Glu-rich.					integral to membrane	protein binding			ovary(2)	2						agaagaggtggaagaagaagaag	0.414																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	128434467	128434469	CCDC136	7	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	2744	59
