Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0562	9731	broad.mit.edu	37	1	3756341	3756341	+	Splice_Site	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3756341C>T	uc001aky.2	-	7	926	c.567_splice	c.e7-1	p.R189_splice	KIAA0562_uc010nzm.1_Splice_Site|KIAA0562_uc001akz.2_Splice_Site_p.R189_splice	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,							centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		GTCAGATTTCCTAAAGGGAAG	0.423																0.020725	-42.286425	7.365691	4	189	KEEP	---	---	---	---	1	3	86	123	-1	capture	Splice_Site	SNP	3756341	3756341	KIAA0562	1	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	8106	88
LRRC40	55631	broad.mit.edu	37	1	70611582	70611582	+	Silent	SNP	T	C	C			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70611582T>C	uc001der.1	-	15	1762	c.1710A>G	c.(1708-1710)TTA>TTG	p.L570L		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	570	LRR 20.									ovary(1)	1						CATCCAGTAGTAATGTTCTAA	0.313																0.552632	168.262854	168.446689	42	34	KEEP	---	---	---	---	24	18	18	17	-1	capture	Silent	SNP	70611582	70611582	LRRC40	1	T	C	C	C	1	0	0	0	0	0	0	0	1	738	57	3	3	8913	88
IQGAP3	128239	broad.mit.edu	37	1	156497822	156497822	+	Silent	SNP	C	T	T	rs144640189	byFrequency	TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156497822C>T	uc001fpf.2	-	37	4779	c.4704G>A	c.(4702-4704)CCG>CCA	p.P1568P		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1568					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTCATCTCCCGGCGTGATGT	0.512																0.346154	113.772507	115.944035	36	68	KEEP	---	---	---	---	18	25	31	44	-1	capture	Silent	SNP	156497822	156497822	IQGAP3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7739	88
SELP	6403	broad.mit.edu	37	1	169562878	169562878	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169562878A>G	uc001ggi.3	-	14	2437	c.2372T>C	c.(2371-2373)CTC>CCC	p.L791P	SELP_uc001ggh.2_Intron|SELP_uc009wvr.2_Missense_Mutation_p.L790P	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	791	Helical; (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	CAAAGCCAGGAGCGTCCCACC	0.413																0.030303	-16.942699	6.995791	3	96	KEEP	---	---	---	---	1	2	51	52	-1	capture	Missense_Mutation	SNP	169562878	169562878	SELP	1	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	13912	88
CRB1	23418	broad.mit.edu	37	1	197407699	197407699	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197407699G>A	uc001gtz.2	+	10	3907	c.3772G>A	c.(3772-3774)GTC>ATC	p.V1258I	CRB1_uc010poz.1_Missense_Mutation_p.V1234I|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.V1146I|CRB1_uc010ppb.1_Missense_Mutation_p.V722I|CRB1_uc010ppd.1_Missense_Mutation_p.V739I|CRB1_uc001gub.1_Missense_Mutation_p.V907I	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	1258	Extracellular (Potential).|EGF-like 18.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						ACCCTCAACAGTCTGTGGGAA	0.413																0.031646	-28.270099	9.660299	5	153	KEEP	---	---	---	---	1	4	79	85	-1	capture	Missense_Mutation	SNP	197407699	197407699	CRB1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	3813	88
CACNA1S	779	broad.mit.edu	37	1	201028369	201028369	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201028369G>A	uc001gvv.2	-	27	3700	c.3473C>T	c.(3472-3474)ACT>ATT	p.T1158I		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1158	IV.|Helical; Name=S2 of repeat IV; (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GAAGATGATAGTGAAGGCCAC	0.597																0.4	101.881103	102.581684	32	48	KEEP	---	---	---	---	19	17	25	30	-1	capture	Missense_Mutation	SNP	201028369	201028369	CACNA1S	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	2523	88
OBSCN	84033	broad.mit.edu	37	1	228473808	228473808	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228473808G>A	uc009xez.1	+	34	9078	c.9034G>A	c.(9034-9036)GAG>AAG	p.E3012K	OBSCN_uc001hsn.2_Missense_Mutation_p.E3012K|OBSCN_uc001hsq.1_Missense_Mutation_p.E268K	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3012	Ig-like 30.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CGAGGACCTGGAGGATGTGGA	0.647					4006											0.214286	7.517653	8.572643	3	11	KEEP	---	---	---	---	1	2	8	5	-1	capture	Missense_Mutation	SNP	228473808	228473808	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10717	88
TRIM58	25893	broad.mit.edu	37	1	248028031	248028031	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248028031C>T	uc001ido.2	+	3	589	c.541C>T	c.(541-543)CGC>TGC	p.R181C		NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	181						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCAGAGGCAGCGCTTCAGATT	0.592																0.345455	52.61659	53.772629	19	36	KEEP	---	---	---	---	10	12	21	21	-1	capture	Missense_Mutation	SNP	248028031	248028031	TRIM58	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16414	88
BMI1	648	broad.mit.edu	37	10	22617609	22617609	+	Silent	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:22617609C>T	uc001irh.2	+	8	1191	c.552C>T	c.(550-552)GAC>GAT	p.D184D	BMI1_uc009xkg.2_Silent_p.D327D	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	184	Interaction with E4F1.				hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						GTAAAATGGACATACCTAATA	0.299					116											0.78481	201.280504	207.188706	62	17	KEEP	---	---	---	---	38	29	8	9	-1	capture	Silent	SNP	22617609	22617609	BMI1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	1443	88
PTCHD3	374308	broad.mit.edu	37	10	27702648	27702648	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27702648C>T	uc001itu.2	-	1	650	c.532G>A	c.(532-534)GCC>ACC	p.A178T		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	178					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						TCCGCCTTGGCCGGGCTCCCC	0.632																0.029412	-34.685878	6.725212	5	165	KEEP	---	---	---	---	4	1	94	98	-1	capture	Missense_Mutation	SNP	27702648	27702648	PTCHD3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12629	88
DNA2	1763	broad.mit.edu	37	10	70196997	70196997	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70196997C>T	uc001jof.2	-	10	1675	c.1675G>A	c.(1675-1677)GAG>AAG	p.E559K	DNA2_uc001jog.1_Missense_Mutation_p.E473K|DNA2_uc001joh.1_RNA	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog	473					base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						CCACTCTTCTCCCTATGAAAA	0.343																0.722222	88.063006	89.661229	26	10	KEEP	---	---	---	---	24	32	8	7	-1	capture	Missense_Mutation	SNP	70196997	70196997	DNA2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4554	88
PTEN	5728	broad.mit.edu	37	10	89692818	89692818	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692818T>C	uc001kfb.2	+	6	1333	c.302T>C	c.(301-303)ATC>ACC	p.I101T		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	101	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.I101T(7)|p.R55fs*1(4)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.H93fs*5(1)|p.I101M(1)|p.I101del(1)|p.I101N(1)|p.I101I(1)|p.I101fs*10(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTAGAACTTATCAAACCCTTT	0.368			31	p.I101T(GMS10-Tumor)|p.I101T(8MGBA-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.170732	35.405967	43.807773	14	68	KEEP	---	---	---	---	8	9	41	44	-1	capture	Missense_Mutation	SNP	89692818	89692818	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	12633	88
FAM178A	55719	broad.mit.edu	37	10	102697209	102697209	+	Silent	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102697209A>G	uc001krt.3	+	10	3029	c.2487A>G	c.(2485-2487)ACA>ACG	p.T829T	FAM178A_uc001krs.2_Silent_p.T829T	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	829											0						TTTTAAGTACATTGATGGAAA	0.308																0.803279	361.885818	372.327754	98	24	KEEP	---	---	---	---	55	50	5	19	-1	capture	Silent	SNP	102697209	102697209	FAM178A	10	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	5456	88
OR56A3	390083	broad.mit.edu	37	11	5969282	5969282	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5969282G>A	uc010qzt.1	+	1	706	c.706G>A	c.(706-708)GGT>AGT	p.G236S		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAAGGCAGAGGGTGCCGTGGC	0.522																0.038348	-50.846495	27.176169	13	326	KEEP	---	---	---	---	8	7	179	185	-1	capture	Missense_Mutation	SNP	5969282	5969282	OR56A3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11038	88
NUMA1	4926	broad.mit.edu	37	11	71729889	71729889	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71729889C>T	uc001orl.1	-	10	894	c.722G>A	c.(721-723)CGC>CAC	p.R241H	NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Missense_Mutation_p.R241H|NUMA1_uc001orm.1_Missense_Mutation_p.R241H|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Missense_Mutation_p.R241H|NUMA1_uc001oro.1_Missense_Mutation_p.R241H|NUMA1_uc009ysy.1_Missense_Mutation_p.R241H|NUMA1_uc001orp.2_Missense_Mutation_p.R241H|NUMA1_uc001orq.2_Missense_Mutation_p.R241H	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	241	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GAGGAGCTTGCGGTTCTCAGC	0.562					525	T	RARA	APL								0.019802	-44.772524	7.484184	4	198	KEEP	---	---	---	---	0	4	101	110	-1	capture	Missense_Mutation	SNP	71729889	71729889	NUMA1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10657	88
MLL	4297	broad.mit.edu	37	11	118376191	118376191	+	Missense_Mutation	SNP	C	T	T	rs147412214		TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118376191C>T	uc001pta.2	+	27	9598	c.9575C>T	c.(9574-9576)CCG>CTG	p.P3192L	MLL_uc001ptb.2_Missense_Mutation_p.P3195L	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3192					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CAGCCTCCTCCGGATCCCCAA	0.507					723	T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								0.033149	-30.091331	12.930656	6	175	KEEP	---	---	---	---	1	5	88	92	-1	capture	Missense_Mutation	SNP	118376191	118376191	MLL	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9532	88
CD163L1	283316	broad.mit.edu	37	12	7531814	7531814	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7531814C>T	uc001qsy.2	-	9	2157	c.2131G>A	c.(2131-2133)GTG>ATG	p.V711M	CD163L1_uc010sge.1_Missense_Mutation_p.V721M	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	711	SRCR 7.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AGAATTCCCACGGCACCCTGG	0.502																0.465347	146.522476	146.627103	47	54	KEEP	---	---	---	---	34	31	39	40	-1	capture	Missense_Mutation	SNP	7531814	7531814	CD163L1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2939	88
NCKAP1L	3071	broad.mit.edu	37	12	54914540	54914540	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54914540G>A	uc001sgc.3	+	17	1767	c.1688G>A	c.(1687-1689)CGT>CAT	p.R563H	NCKAP1L_uc010sox.1_Missense_Mutation_p.R105H|NCKAP1L_uc010soy.1_Missense_Mutation_p.R513H	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	563					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						GCCATGTTGCGTTATGCCATT	0.458																0.042836	-89.999549	61.773272	29	648	KEEP	---	---	---	---	13	18	376	323	-1	capture	Missense_Mutation	SNP	54914540	54914540	NCKAP1L	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10129	88
CCT2	10576	broad.mit.edu	37	12	69987309	69987309	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69987309C>T	uc001svb.1	+	10	992	c.898C>T	c.(898-900)CCT>TCT	p.P300S	CCT2_uc009zrm.1_RNA|CCT2_uc009zrn.1_Missense_Mutation_p.P300S|CCT2_uc010stl.1_Missense_Mutation_p.P253S	NM_006431	NP_006422	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2	300					'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TTATAATTATCCTGAACAGCT	0.264																0.044444	-17.370095	12.60982	6	129	KEEP	---	---	---	---	3	3	87	55	-1	capture	Missense_Mutation	SNP	69987309	69987309	CCT2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2924	88
UHRF1BP1L	23074	broad.mit.edu	37	12	100478382	100478382	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100478382C>G	uc001tgq.2	-	10	1389	c.1160G>C	c.(1159-1161)GGA>GCA	p.G387A	UHRF1BP1L_uc001tgr.2_Missense_Mutation_p.G387A|UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.G37A	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	387										ovary(2)	2						ATTGGCCCATCCATTTTTTGT	0.353																0.371728	245.57641	248.337426	71	120	KEEP	---	---	---	---	42	35	63	63	-1	capture	Missense_Mutation	SNP	100478382	100478382	UHRF1BP1L	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	16851	88
NOS1	4842	broad.mit.edu	37	12	117655934	117655934	+	Silent	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117655934G>A	uc001twm.1	-	28	4892	c.4206C>T	c.(4204-4206)GTC>GTT	p.V1402V		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1402					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	TTCGCAGGGTGACTCCAAAAA	0.483	Esophageal Squamous(162;1748 2599 51982 52956)															0.411009	670.453674	674.23309	224	321	KEEP	---	---	---	---	123	127	167	182	-1	capture	Silent	SNP	117655934	117655934	NOS1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	10448	88
SOCS4	122809	broad.mit.edu	37	14	55510054	55510054	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:55510054G>A	uc001xbo.2	+	3	860	c.295G>A	c.(295-297)GTG>ATG	p.V99M	SOCS4_uc001xbp.2_Missense_Mutation_p.V99M	NM_199421	NP_955453	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	99					intracellular signal transduction|negative regulation of signal transduction|regulation of growth					ovary(1)|kidney(1)	2						GCAAGATGCCGTGGGGCAGTG	0.423																0.019417	-46.521761	6.856191	4	202	KEEP	---	---	---	---	0	4	105	105	-1	capture	Missense_Mutation	SNP	55510054	55510054	SOCS4	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14808	88
DACT1	51339	broad.mit.edu	37	14	59113060	59113060	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:59113060C>A	uc001xdw.2	+	4	1883	c.1719C>A	c.(1717-1719)CAC>CAA	p.H573Q	DACT1_uc010trv.1_Missense_Mutation_p.H292Q|DACT1_uc001xdx.2_Missense_Mutation_p.H536Q|DACT1_uc010trw.1_Missense_Mutation_p.H292Q	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	573					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						ACCGGGGCCACAGGAACATGG	0.657																0.06383	-2.314823	6.987957	3	44	KEEP	---	---	---	---	2	1	23	27	0.333333333333	capture	Missense_Mutation	SNP	59113060	59113060	DACT1	14	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	4182	88
ZFYVE26	23503	broad.mit.edu	37	14	68274397	68274397	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:68274397G>A	uc001xka.2	-	5	743	c.604C>T	c.(604-606)CGG>TGG	p.R202W	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.R202W|ZFYVE26_uc010tta.1_Missense_Mutation_p.R202W	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	202					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TGCAAAGCCCGCAATGCCTTT	0.612																0.019417	-46.351769	7.052853	4	202	KEEP	---	---	---	---	2	2	108	103	-1	capture	Missense_Mutation	SNP	68274397	68274397	ZFYVE26	14	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	17548	88
CKB	1152	broad.mit.edu	37	14	103986328	103986328	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103986328T>G	uc001ynf.1	-	8	1099	c.1019A>C	c.(1018-1020)GAC>GCC	p.D340A	CKB_uc001yne.1_Missense_Mutation_p.D162A|CKB_uc010awr.1_Missense_Mutation_p.D271A	NM_001823	NP_001814	P12277	KCRB_HUMAN	brain creatine kinase	340	Phosphagen kinase C-terminal.			D->E: No change in activity.	creatine metabolic process	cytosol	ATP binding|creatine kinase activity				0		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	GCCCAGGCGGTCAGCGTTGGA	0.662	Esophageal Squamous(186;2492 2823 49929 50127)															0.4	50.090567	50.44073	16	24	KEEP	---	---	---	---	8	9	15	13	-1	capture	Missense_Mutation	SNP	103986328	103986328	CKB	14	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	3411	88
GJD2	57369	broad.mit.edu	37	15	35044812	35044812	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35044812C>T	uc001zis.1	-	2	833	c.833G>A	c.(832-834)CGC>CAC	p.R278H	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	278	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		CTTGATCTTGCGCCATCCCAG	0.512																0.02139	-41.011435	6.824542	4	183	KEEP	---	---	---	---	1	4	110	102	-1	capture	Missense_Mutation	SNP	35044812	35044812	GJD2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6354	88
THSD4	79875	broad.mit.edu	37	15	71535188	71535188	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:71535188G>A	uc002atb.1	+	4	744	c.665G>A	c.(664-666)GGG>GAG	p.G222E	THSD4_uc002atd.1_5'UTR	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	222	TSP type-1 1.					proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						CCCCAACATGGGCCTTTGTAC	0.597																0.457143	205.392944	205.615385	64	76	KEEP	---	---	---	---	28	40	41	40	-1	capture	Missense_Mutation	SNP	71535188	71535188	THSD4	15	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15763	88
KRT27	342574	broad.mit.edu	37	17	38938701	38938701	+	Silent	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38938701G>A	uc002hvg.2	-	1	86	c.45C>T	c.(43-45)TGC>TGT	p.C15C		NM_181537	NP_853515	Q7Z3Y8	K1C27_HUMAN	keratin 27	15	Head.|Gly-rich.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.000812)				CAGTGCCCCCGCAAGAGCCAA	0.582																0.166667	5.712725	7.609882	3	15	KEEP	---	---	---	---	1	2	8	11	-1	capture	Silent	SNP	38938701	38938701	KRT27	17	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8384	88
MYO5B	4645	broad.mit.edu	37	18	47352977	47352977	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47352977C>T	uc002leb.2	-	40	5699	c.5411G>A	c.(5410-5412)CGG>CAG	p.R1804Q	MYO5B_uc002ldz.2_Missense_Mutation_p.R374Q|MYO5B_uc002lea.2_Missense_Mutation_p.R919Q	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	1804					protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AGGGTCATTCCGCTCTTGTAG	0.408																0.022222	-49.436915	7.985752	5	220	KEEP	---	---	---	---	1	4	128	121	-1	capture	Missense_Mutation	SNP	47352977	47352977	MYO5B	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9989	88
ZNF407	55628	broad.mit.edu	37	18	72345779	72345779	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72345779C>T	uc002llw.2	+	1	2861	c.2804C>T	c.(2803-2805)GCT>GTT	p.A935V	ZNF407_uc010xfc.1_Missense_Mutation_p.A935V|ZNF407_uc010dqu.1_Missense_Mutation_p.A935V|ZNF407_uc002llu.2_Missense_Mutation_p.A934V	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	935					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AAAAAGAATGCTGGCTCAGCA	0.453																0.026549	-21.468899	6.521472	3	110	KEEP	---	---	---	---	0	4	57	63	-1	capture	Missense_Mutation	SNP	72345779	72345779	ZNF407	18	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	17767	88
TCF3	6929	broad.mit.edu	37	19	1623996	1623996	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1623996G>A	uc002ltr.2	-	8	570	c.503C>T	c.(502-504)ACG>ATG	p.T168M	TCF3_uc002lto.2_5'Flank|TCF3_uc002ltt.3_Missense_Mutation_p.T168M|TCF3_uc002ltq.2_Missense_Mutation_p.T117M|TCF3_uc002lts.1_Missense_Mutation_p.T84M	NM_003200	NP_003191	P15923	TFE2_HUMAN	transcription factor 3 isoform E12	168					B cell lineage commitment|B cell lineage commitment|G1 phase of mitotic cell cycle|immunoglobulin V(D)J recombination|muscle cell differentiation|positive regulation of B cell proliferation|positive regulation of cell cycle|positive regulation of muscle cell differentiation|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus|protein complex|transcription factor complex	bHLH transcription factor binding|DNA binding|E-box binding|identical protein binding|mitogen-activated protein kinase kinase kinase binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|vitamin D response element binding			lung(2)|breast(2)|ovary(1)|large_intestine(1)|skin(1)	7		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGGGCTGCGTGTCTGTTAG	0.612					128	T	PBX1|HLF|TFPT	pre B-ALL								0.181818	25.899053	33.236763	14	63	KEEP	---	---	---	---	4	11	33	38	-1	capture	Missense_Mutation	SNP	1623996	1623996	TCF3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15579	88
ZNF506	440515	broad.mit.edu	37	19	19905675	19905675	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19905675A>G	uc010eci.2	-	4	1169	c.1021T>C	c.(1021-1023)TAC>CAC	p.Y341H	ZNF506_uc002nog.2_Intron|ZNF506_uc002noh.3_Missense_Mutation_p.Y309H	NM_001099269	NP_001092739	Q5JVG8	ZN506_HUMAN	zinc finger protein 506 isoform 1	341	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding				0						TCACATTTGTAGGGTACATCT	0.408																0.015625	-59.526525	8.565115	4	252	KEEP	---	---	---	---	2	2	119	140	-1	capture	Missense_Mutation	SNP	19905675	19905675	ZNF506	19	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	17831	88
CEACAM20	125931	broad.mit.edu	37	19	45015149	45015149	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45015149G>T	uc010ejn.1	-	12	1692	c.1676C>A	c.(1675-1677)CCT>CAT	p.P559H	CEACAM20_uc010ejo.1_Missense_Mutation_p.P547H|CEACAM20_uc010ejp.1_Missense_Mutation_p.P466H|CEACAM20_uc010ejq.1_Missense_Mutation_p.P454H	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	559	Cytoplasmic (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				GGGCATCAGAGGTTTGGGTGG	0.507																0.320312	116.624124	120.298923	41	87	KEEP	---	---	---	---	29	21	45	61	0.58	capture	Missense_Mutation	SNP	45015149	45015149	CEACAM20	19	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	3160	88
TFPT	29844	broad.mit.edu	37	19	54617886	54617886	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54617886C>T	uc010yej.1	-	2	624	c.218G>A	c.(217-219)CGC>CAC	p.R73H	TFPT_uc010erd.2_Missense_Mutation_p.R73H|PRPF31_uc002qdh.2_5'Flank|PRPF31_uc010yek.1_5'Flank	NM_013342	NP_037474	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner	73					apoptosis|DNA recombination|DNA repair|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex	DNA binding|protein binding				0	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					TTCCCGCTGGCGCCGCCGCCG	0.652					208	T	TCF3	pre-B ALL								0.297561	151.992341	159.506513	61	144	KEEP	---	---	---	---	30	39	69	95	-1	capture	Missense_Mutation	SNP	54617886	54617886	TFPT	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15695	88
GALNT14	79623	broad.mit.edu	37	2	31178570	31178570	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31178570C>T	uc002rnr.2	-	6	1187	c.568G>A	c.(568-570)GCC>ACC	p.A190T	GALNT14_uc002rnq.2_Missense_Mutation_p.A170T|GALNT14_uc002rns.2_Missense_Mutation_p.A195T|GALNT14_uc010ymr.1_Missense_Mutation_p.A155T|GALNT14_uc010ezo.1_Missense_Mutation_p.A157T|GALNT14_uc010ezp.1_Missense_Mutation_p.A161T	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14	190	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GTGCCCTGGGCGATGTCAGCG	0.597																0.416667	108.713933	109.222158	35	49	KEEP	---	---	---	---	20	16	27	26	-1	capture	Missense_Mutation	SNP	31178570	31178570	GALNT14	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6152	88
LTBP1	4052	broad.mit.edu	37	2	33482448	33482448	+	Silent	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:33482448A>G	uc002ros.2	+	12	2265	c.2265A>G	c.(2263-2265)GTA>GTG	p.V755V	LTBP1_uc002rot.2_Silent_p.V429V|LTBP1_uc002rou.2_Silent_p.V429V|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Silent_p.V429V|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	755					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGGACCTGTATTTGTCAAGC	0.502																0.047945	-15.667618	16.07339	7	139	KEEP	---	---	---	---	5	2	76	71	-1	capture	Silent	SNP	33482448	33482448	LTBP1	2	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	8988	88
ZAP70	7535	broad.mit.edu	37	2	98351132	98351132	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:98351132G>A	uc002syd.1	+	9	1246	c.1039G>A	c.(1039-1041)GGC>AGC	p.G347S	ZAP70_uc010yvf.1_3'UTR|ZAP70_uc002sye.1_Missense_Mutation_p.G237S|ZAP70_uc002syf.1_Missense_Mutation_p.G40S	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	347	Protein kinase.|ATP (By similarity).				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						ACTTGGCTGCGGCAACTTTGG	0.622					138											0.542484	277.932477	278.172902	83	70	KEEP	---	---	---	---	34	59	44	41	-1	capture	Missense_Mutation	SNP	98351132	98351132	ZAP70	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17395	88
GCC2	9648	broad.mit.edu	37	2	109092033	109092033	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109092033A>G	uc002tec.2	+	8	3057	c.2903A>G	c.(2902-2904)AAT>AGT	p.N968S	GCC2_uc002ted.2_Missense_Mutation_p.N867S	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	968	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						GAGAAAATAAATAAGATAAAA	0.299																0.387097	43.493466	43.839619	12	19	KEEP	---	---	---	---	11	5	10	11	-1	capture	Missense_Mutation	SNP	109092033	109092033	GCC2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	6226	88
KIF5C	3800	broad.mit.edu	37	2	149866823	149866823	+	Silent	SNP	C	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149866823C>A	uc010zbu.1	+	24	3093	c.2725C>A	c.(2725-2727)CGG>AGG	p.R909R	KIF5C_uc002tws.1_RNA|KIF5C_uc002twu.1_Silent_p.R191R	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	909	|Globular.				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		GGAGGCCGTGCGGGCCAAGAA	0.632																0.666667	11.764107	11.901673	4	2	KEEP	---	---	---	---	3	1	0	3	0.25	capture	Silent	SNP	149866823	149866823	KIF5C	2	C	A	A	A	1	0	0	0	0	0	0	0	1	347	27	4	4	8229	88
DNTTIP1	116092	broad.mit.edu	37	20	44431987	44431987	+	Silent	SNP	C	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44431987C>A	uc002xpk.2	+	8	641	c.573C>A	c.(571-573)TCC>TCA	p.S191S		NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting	191						nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				AACCAAAATCCTGTGAACCAA	0.493																0.269231	78.551277	83.550549	28	76	KEEP	---	---	---	---	12	19	39	50	0.612903225806	capture	Silent	SNP	44431987	44431987	DNTTIP1	20	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	4637	88
UMODL1	89766	broad.mit.edu	37	21	43539379	43539379	+	Silent	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43539379C>T	uc002zaf.1	+	15	2634	c.2634C>T	c.(2632-2634)ACC>ACT	p.T878T	UMODL1_uc002zad.1_Silent_p.T806T|UMODL1_uc002zae.1_Silent_p.T934T|UMODL1_uc002zag.1_Silent_p.T1006T|UMODL1_uc002zal.1_5'Flank	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	878	Extracellular (Potential).|SEA 2.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CATTTCTCACCGCCTTCCAGA	0.567	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)															0.255499	408.778789	440.803498	151	440	KEEP	---	---	---	---	73	89	241	254	-1	capture	Silent	SNP	43539379	43539379	UMODL1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16862	88
DNMT3L	29947	broad.mit.edu	37	21	45679526	45679526	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45679526C>T	uc002zeg.1	-	4	704	c.220G>A	c.(220-222)GCC>ACC	p.A74T	DNMT3L_uc002zeh.1_Missense_Mutation_p.A74T	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein	74	GATA-type; atypical.|ADD.				DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		TTACATGGGGCGCAGATCCCT	0.507																0.241758	55.412097	60.94302	22	69	KEEP	---	---	---	---	13	11	41	35	-1	capture	Missense_Mutation	SNP	45679526	45679526	DNMT3L	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4634	88
INPP5J	27124	broad.mit.edu	37	22	31523358	31523358	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31523358G>A	uc003aju.3	+	6	1719	c.1627G>A	c.(1627-1629)GTG>ATG	p.V543M	INPP5J_uc003ajv.3_Missense_Mutation_p.V176M|INPP5J_uc003ajs.3_Missense_Mutation_p.V176M|INPP5J_uc011alk.1_Missense_Mutation_p.V476M|INPP5J_uc010gwg.2_Missense_Mutation_p.V108M|INPP5J_uc003ajw.2_Translation_Start_Site|INPP5J_uc003ajt.3_Missense_Mutation_p.V175M|INPP5J_uc003ajx.2_5'Flank|INPP5J_uc003ajy.2_5'Flank|INPP5J_uc003ajz.2_5'Flank	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	543	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						CAAGGGTGGCGTGAGCGTGCG	0.632																0.434783	30.551008	30.635251	10	13	KEEP	---	---	---	---	3	7	3	11	-1	capture	Missense_Mutation	SNP	31523358	31523358	INPP5J	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7682	88
SFI1	9814	broad.mit.edu	37	22	31957290	31957290	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31957290C>T	uc003ale.2	+	8	1070	c.677C>T	c.(676-678)ACG>ATG	p.T226M	SFI1_uc003ald.1_Missense_Mutation_p.T202M|SFI1_uc003alf.2_Missense_Mutation_p.T226M|SFI1_uc003alg.2_Missense_Mutation_p.T144M|SFI1_uc011alp.1_Missense_Mutation_p.T144M|SFI1_uc011alq.1_Missense_Mutation_p.T202M|SFI1_uc003alh.2_RNA	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	226					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TGGTGGAGCACGTGGAGGCAG	0.572														OREG0026480	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.388889	60.858786	61.443442	21	33	KEEP	---	---	---	---	15	11	27	17	-1	capture	Missense_Mutation	SNP	31957290	31957290	SFI1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14049	88
GTSE1	51512	broad.mit.edu	37	22	46725343	46725343	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46725343T>C	uc011aqy.1	+	11	2227	c.2015T>C	c.(2014-2016)TTC>TCC	p.F672S	GTSE1_uc011aqz.1_Missense_Mutation_p.F519S|GTSE1_uc003bhn.2_RNA|uc011ara.1_5'Flank|uc003bho.3_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	653					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CTCATCGACTTCTGCGATACC	0.498	GBM(153;542 1915 12487 29016 50495)				471											0.459144	425.835236	426.207415	118	139	KEEP	---	---	---	---	73	76	75	98	-1	capture	Missense_Mutation	SNP	46725343	46725343	GTSE1	22	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	6814	88
ZNF860	344787	broad.mit.edu	37	3	32030908	32030908	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32030908G>C	uc011axg.1	+	2	886	c.337G>C	c.(337-339)GAG>CAG	p.E113Q		NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	113					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TCATGACTTTGAGTTTCAATG	0.388																0.34375	116.046992	118.116804	33	63	KEEP	---	---	---	---	13	20	35	29	-1	capture	Missense_Mutation	SNP	32030908	32030908	ZNF860	3	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	18070	88
SCN5A	6331	broad.mit.edu	37	3	38639416	38639416	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38639416C>T	uc003cio.2	-	14	2260	c.2066G>A	c.(2065-2067)CGT>CAT	p.R689H	SCN5A_uc003cin.2_Missense_Mutation_p.R689H|SCN5A_uc003cil.3_Missense_Mutation_p.R689H|SCN5A_uc010hhi.2_Missense_Mutation_p.R689H|SCN5A_uc010hhk.2_Missense_Mutation_p.R689H|SCN5A_uc011ayr.1_Missense_Mutation_p.R689H|SCN5A_uc010hhj.1_Missense_Mutation_p.R300H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	689					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CTGGGCGAGACGGTTCCAGCA	0.537																0.425532	188.079178	188.760411	60	81	KEEP	---	---	---	---	34	36	45	54	-1	capture	Missense_Mutation	SNP	38639416	38639416	SCN5A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13815	88
GPR27	2850	broad.mit.edu	37	3	71804047	71804047	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:71804047T>G	uc011bge.1	+	1	847	c.847T>G	c.(847-849)TGC>GGC	p.C283G	EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	283	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		GAAGAGGCTGTGCAAGATGTT	0.552																0.232558	5.852638	8.877644	10	33	KEEP	---	---	---	---	8	10	16	26	-1	capture	Missense_Mutation	SNP	71804047	71804047	GPR27	3	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	6619	88
CD96	10225	broad.mit.edu	37	3	111356989	111356989	+	Missense_Mutation	SNP	C	T	T	rs140955483		TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111356989C>T	uc003dxw.2	+	13	1669	c.1499C>T	c.(1498-1500)ACG>ATG	p.T500M	CD96_uc003dxx.2_Missense_Mutation_p.T484M|CD96_uc010hpy.1_Missense_Mutation_p.T483M	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	500	Extracellular (Potential).|Pro/Ser/Thr-rich.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						AATGGATCTACGAAAACTAAT	0.338												Opitz_Trigonocephaly_syndrome				0.45679	243.04123	243.303584	74	88	KEEP	---	---	---	---	42	58	59	55	-1	capture	Missense_Mutation	SNP	111356989	111356989	CD96	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3019	88
PKD2	5311	broad.mit.edu	37	4	88987002	88987002	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88987002C>T	uc003hre.2	+	12	2395	c.2329C>T	c.(2329-2331)CAG>TAG	p.Q777*	PKD2_uc011cdf.1_Nonsense_Mutation_p.Q195*|PKD2_uc011cdg.1_Nonsense_Mutation_p.Q103*|PKD2_uc011cdh.1_5'UTR	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	777	EF-hand.|EF-hand domain.|Cytoplasmic (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGAACATCAGCAGATGAGAGA	0.443																0.487342	233.660661	233.682992	77	81	KEEP	---	---	---	---	34	47	31	52	-1	capture	Nonsense_Mutation	SNP	88987002	88987002	PKD2	4	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	11869	88
TERT	7015	broad.mit.edu	37	5	1279521	1279521	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1279521C>T	uc003jcb.1	-	5	2073	c.2015G>A	c.(2014-2016)CGC>CAC	p.R672H	TERT_uc003jbz.1_5'UTR|TERT_uc003jca.1_Missense_Mutation_p.R672H|TERT_uc003jcc.1_Missense_Mutation_p.R672H|TERT_uc003jcd.1_RNA|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	672	Reverse transcriptase.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity	p.R672H(1)		lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GAGGCCGGGGCGCCGCGCCCG	0.697					563							TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				0.5	6.45073	6.450716	2	2	KEEP	---	---	---	---	1	1	2	1	-1	capture	Missense_Mutation	SNP	1279521	1279521	TERT	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15649	88
ADAMTS16	170690	broad.mit.edu	37	5	5222920	5222920	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5222920T>G	uc003jdl.2	+	11	1762	c.1624T>G	c.(1624-1626)TGG>GGG	p.W542G	ADAMTS16_uc003jdk.1_Missense_Mutation_p.W542G|ADAMTS16_uc003jdj.1_Missense_Mutation_p.W542G	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	542	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TAAAGCCCTGTGGTGCCATCG	0.358																0.357143	136.678737	138.687677	40	72	KEEP	---	---	---	---	25	17	33	46	-1	capture	Missense_Mutation	SNP	5222920	5222920	ADAMTS16	5	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	261	88
BASP1	10409	broad.mit.edu	37	5	17275820	17275820	+	Silent	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:17275820C>T	uc003jfx.2	+	2	674	c.495C>T	c.(493-495)GAC>GAT	p.D165D		NM_006317	NP_006308	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein	165					glomerular visceral epithelial cell differentiation|negative regulation of transcription, DNA-dependent	cytoplasm|cytoskeleton|growth cone|nuclear speck|plasma membrane	protein domain specific binding|transcription corepressor activity|transcription regulatory region DNA binding				0						CCAAAAGTGACGGGGCCCCAG	0.582																0.375	16.8456	17.065235	6	10	KEEP	---	---	---	---	3	4	6	9	-1	capture	Silent	SNP	17275820	17275820	BASP1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1306	88
FBN2	2201	broad.mit.edu	37	5	127728882	127728882	+	Missense_Mutation	SNP	C	T	T	rs138046782		TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127728882C>T	uc003kuu.2	-	10	1850	c.1411G>A	c.(1411-1413)GTT>ATT	p.V471I	FBN2_uc003kuv.2_Missense_Mutation_p.V438I	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	471					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCTCCCCCAACGCCAGGAGAA	0.577				p.V471I(HCC1569-Tumor)	1552											0.363636	193.622415	196.868911	72	126	KEEP	---	---	---	---	35	42	66	75	-1	capture	Missense_Mutation	SNP	127728882	127728882	FBN2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5649	88
PCDHGA1	56114	broad.mit.edu	37	5	140711985	140711985	+	Silent	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140711985G>A	uc003lji.1	+	1	1734	c.1734G>A	c.(1732-1734)GCG>GCA	p.A578A	PCDHGA1_uc011dan.1_Silent_p.A578A	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	578	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGCTGGCGCCCCTCTCCG	0.657																0.434555	226.430105	227.1316	83	108	KEEP	---	---	---	---	46	47	60	57	-1	capture	Silent	SNP	140711985	140711985	PCDHGA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11453	88
SPINK6	404203	broad.mit.edu	37	5	147585617	147585617	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147585617G>A	uc003lpa.2	+	2	333	c.77G>A	c.(76-78)GGA>GAA	p.G26E		NM_205841	NP_995313	Q6UWN8	ISK6_HUMAN	serine protease inhibitor, Kazal type 6	26	Kazal-like.					extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCAGGGAGGACAGGTCAGT	0.383																0.02071	-76.481993	10.50463	7	331	KEEP	---	---	---	---	4	4	201	173	-1	capture	Missense_Mutation	SNP	147585617	147585617	SPINK6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	14955	88
GPR116	221395	broad.mit.edu	37	6	46826170	46826170	+	Missense_Mutation	SNP	G	A	A	rs141322343	byFrequency	TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46826170G>A	uc003oyo.3	-	17	3759	c.3470C>T	c.(3469-3471)ACG>ATG	p.T1157M	GPR116_uc011dwj.1_Missense_Mutation_p.T712M|GPR116_uc011dwk.1_Missense_Mutation_p.T586M|GPR116_uc003oyp.3_Missense_Mutation_p.T1015M|GPR116_uc003oyq.3_Missense_Mutation_p.T1157M|GPR116_uc010jzi.1_Missense_Mutation_p.T829M	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	1157	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			ATTCTTCCTCGTATAGACTTC	0.557	NSCLC(59;410 1274 8751 36715 50546)															0.391892	87.15463	87.913046	29	45	KEEP	---	---	---	---	15	18	25	22	-1	capture	Missense_Mutation	SNP	46826170	46826170	GPR116	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6567	88
EGFR	1956	broad.mit.edu	37	7	55211080	55211080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55211080G>A	uc003tqk.2	+	3	569	c.323G>A	c.(322-324)AGA>AAA	p.R108K	EGFR_uc003tqh.2_Missense_Mutation_p.R108K|EGFR_uc003tqi.2_Missense_Mutation_p.R108K|EGFR_uc003tqj.2_Missense_Mutation_p.R108K|EGFR_uc010kzg.1_Missense_Mutation_p.R108K|EGFR_uc011kco.1_Missense_Mutation_p.R55K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	108	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.R108K(7)|p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGATCATCAGAGGAAATATG	0.423			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.952965	3451.924738	3572.925646	932	46	KEEP	---	---	---	---	468	475	33	23	-1	capture	Missense_Mutation	SNP	55211080	55211080	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4922	88
EGFR	1956	broad.mit.edu	37	7	55240690	55240690	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55240690C>G	uc003tqk.2	+	17	2180	c.1934C>G	c.(1933-1935)TCC>TGC	p.S645C	EGFR_uc010kzg.1_Missense_Mutation_p.S600C|EGFR_uc011kco.1_Missense_Mutation_p.S592C	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	645	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAGATCCCGTCCATCGCCACT	0.612			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.028377	-170.268381	45.92009	25	856	KEEP	---	---	---	---	18	14	479	488	-1	capture	Missense_Mutation	SNP	55240690	55240690	EGFR	7	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	4922	88
TYW1	55253	broad.mit.edu	37	7	66482862	66482862	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66482862G>A	uc003tvn.2	+	6	742	c.593G>A	c.(592-594)TGG>TAG	p.W198*	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	198	FMN (By similarity).|Flavodoxin-like.				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				GTTGACAAGTGGCTCTGGATG	0.512					1											0.5	183.570853	183.570853	57	57	KEEP	---	---	---	---	33	36	37	33	-1	capture	Nonsense_Mutation	SNP	66482862	66482862	TYW1	7	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	16700	88
CD36	948	broad.mit.edu	37	7	80290463	80290463	+	Silent	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80290463C>T	uc003uhc.2	+	8	1050	c.366C>T	c.(364-366)TTC>TTT	p.F122F	CD36_uc003uhd.3_Silent_p.F122F|CD36_uc011kgv.1_Silent_p.F46F|CD36_uc003uhe.3_Silent_p.F122F|CD36_uc003uhf.3_Silent_p.F122F|CD36_uc003uhg.3_Silent_p.F122F|CD36_uc003uhh.3_Silent_p.F122F	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	122	Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						GTGCCATCTTCGAACCTTCAC	0.428																0.386207	169.868976	171.513505	56	89	KEEP	---	---	---	---	39	24	45	55	-1	capture	Silent	SNP	80290463	80290463	CD36	7	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	2978	88
ANK1	286	broad.mit.edu	37	8	41521227	41521227	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41521227C>T	uc003xok.2	-	40	5512	c.5428G>A	c.(5428-5430)GTG>ATG	p.V1810M	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.V964M|ANK1_uc003xoi.2_Missense_Mutation_p.V1810M|ANK1_uc003xoj.2_Missense_Mutation_p.V1810M|ANK1_uc003xol.2_Missense_Mutation_p.V1648M|ANK1_uc003xom.2_Missense_Mutation_p.V1851M|ANK1_uc011lcl.1_Missense_Mutation_p.V85M|ANK1_uc003xod.2_Missense_Mutation_p.V85M|ANK1_uc003xoc.2_Missense_Mutation_p.V85M|ANK1_uc003xof.2_Missense_Mutation_p.V85M	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1810	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TCCTCTGTCACCTGCTCCCCT	0.537																0.424837	203.552328	204.305905	65	88	KEEP	---	---	---	---	33	42	40	55	-1	capture	Missense_Mutation	SNP	41521227	41521227	ANK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	617	88
RP1	6101	broad.mit.edu	37	8	55537454	55537454	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55537454C>T	uc003xsd.1	+	4	1160	c.1012C>T	c.(1012-1014)CGA>TGA	p.R338*	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	338					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GATGAAAGTTCGATTCAGAAT	0.328	Colon(91;1014 1389 7634 14542 40420)															0.058824	-8.332739	12.471159	6	96	KEEP	---	---	---	---	4	2	51	51	-1	capture	Nonsense_Mutation	SNP	55537454	55537454	RP1	8	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	13424	88
SLCO5A1	81796	broad.mit.edu	37	8	70650427	70650427	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70650427G>T	uc003xyl.2	-	5	1978	c.1271C>A	c.(1270-1272)GCA>GAA	p.A424E	SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Missense_Mutation_p.A424E|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	424	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CCTGACAGCTGCTCTTGGTAG	0.348																0.44	175.217028	175.607432	55	70	KEEP	---	---	---	---	28	31	34	45	0.474576271186	capture	Missense_Mutation	SNP	70650427	70650427	SLCO5A1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	14623	88
KLF10	7071	broad.mit.edu	37	8	103662460	103662460	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:103662460G>A	uc011lhk.1	-	4	1497	c.1343C>T	c.(1342-1344)GCC>GTC	p.A448V	KLF10_uc011lhj.1_Missense_Mutation_p.A437V	NM_005655	NP_005646	Q13118	KLF10_HUMAN	Kruppel-like factor 10 isoform a	448	C2H2-type 3.				cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			ATGGCGCCGGGCATGCTTGGT	0.542	Esophageal Squamous(16;495 519 2144 16528 44005)															0.421965	201.726878	202.648018	73	100	KEEP	---	---	---	---	43	44	57	54	-1	capture	Missense_Mutation	SNP	103662460	103662460	KLF10	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8259	88
HEMGN	55363	broad.mit.edu	37	9	100698486	100698486	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100698486A>G	uc004axy.2	-	2	248	c.140T>C	c.(139-141)GTG>GCG	p.V47A	HEMGN_uc004axz.2_Missense_Mutation_p.V47A	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	47	Necessary for nuclear localization.				cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CTTTTCATGCACTTCAGCTTT	0.299																0.024	-50.571145	12.380438	6	244	KEEP	---	---	---	---	2	5	141	141	-1	capture	Missense_Mutation	SNP	100698486	100698486	HEMGN	9	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	6976	88
SMC1A	8243	broad.mit.edu	37	X	53430549	53430549	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53430549C>T	uc004dsg.2	-	15	2438	c.2369G>A	c.(2368-2370)CGG>CAG	p.R790Q	SMC1A_uc011moe.1_Missense_Mutation_p.R768Q	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	790	Potential.		R -> Q (in CDLS2).		cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CTCAAACTCCCGGATGTTGCG	0.517																0.421053	24.490068	24.594678	8	11	KEEP	---	---	---	---	2	6	4	8	-1	capture	Missense_Mutation	SNP	53430549	53430549	SMC1A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14673	88
SMC1A	8243	broad.mit.edu	37	X	53438785	53438785	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53438785C>T	uc004dsg.2	-	7	1249	c.1180G>A	c.(1180-1182)GAG>AAG	p.E394K	SMC1A_uc011moe.1_Missense_Mutation_p.E372K|SMC1A_uc011mof.1_Missense_Mutation_p.E160K	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	394	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						TTGAATTTCTCCAGCTCCTGG	0.498																0.03125	-23.554632	7.190785	4	124	KEEP	---	---	---	---	1	3	66	71	-1	capture	Missense_Mutation	SNP	53438785	53438785	SMC1A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	14673	88
FRMD7	90167	broad.mit.edu	37	X	131212246	131212246	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131212246C>T	uc004ewn.2	-	12	1977	c.1799G>A	c.(1798-1800)CGT>CAT	p.R600H	FRMD7_uc011muy.1_Missense_Mutation_p.R585H	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	600					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AAAAGGAAAACGAATAGTTTT	0.428																0.864662	400.915522	418.056285	115	18	KEEP	---	---	---	---	68	59	13	8	-1	capture	Missense_Mutation	SNP	131212246	131212246	FRMD7	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5998	88
MAP7D3	79649	broad.mit.edu	37	X	135301831	135301831	+	Splice_Site	SNP	C	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135301831C>T	uc004ezt.2	-	17	2578	c.2487_splice	c.e17-1	p.R829_splice	MAP7D3_uc004ezs.2_Splice_Site_p.R793_splice|MAP7D3_uc011mwc.1_Splice_Site_p.R811_splice|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					GGAAGATGGTCTGGAAAGAGA	0.418																0.923077	405.198502	426.636475	108	9	KEEP	---	---	---	---	67	48	6	3	-1	capture	Splice_Site	SNP	135301831	135301831	MAP7D3	23	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	9182	88
AFF2	2334	broad.mit.edu	37	X	148038125	148038125	+	Silent	SNP	G	A	A			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148038125G>A	uc004fcp.2	+	11	3029	c.2550G>A	c.(2548-2550)AAG>AAA	p.K850K	AFF2_uc004fcq.2_Silent_p.K840K|AFF2_uc004fcr.2_Silent_p.K811K|AFF2_uc011mxb.1_Silent_p.K815K|AFF2_uc004fcs.2_Silent_p.K817K|AFF2_uc011mxc.1_Silent_p.K491K	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	850					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCCCCTAAGGGCAAACGTA	0.517																0.078947	1.292992	8.174059	3	35	KEEP	---	---	---	---	2	1	21	36	-1	capture	Silent	SNP	148038125	148038125	AFF2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	357	88
RNF152	220441	broad.mit.edu	37	18	59483671	59483672	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:59483671_59483672delAG	uc002lih.1	-	2	437_438	c.25_26delCT	c.(25-27)CTGfs	p.L9fs		NM_173557	NP_775828	Q8N8N0	RN152_HUMAN	ring finger protein 152	9					apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)				ACATTCCAGCAGAGAGTCCTGG	0.594																0.24			51	160		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	59483671	59483672	RNF152	18	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	13345	88
TNK2	10188	broad.mit.edu	37	3	195599202	195599203	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195599202_195599203delCT	uc003fvu.1	-	10	1938_1939	c.1395_1396delAG	c.(1393-1398)ACAGGGfs	p.T465fs	TNK2_uc003fvq.1_5'Flank|TNK2_uc003fvr.1_5'UTR|TNK2_uc003fvs.1_Frame_Shift_Del_p.T497fs|TNK2_uc003fvt.1_Frame_Shift_Del_p.T528fs|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_Frame_Shift_Del_p.T295fs	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	465_466	CRIB.			Missing (in Ref. 4; AAH08884).	positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	TCGCCATGCCCTGTGTGGATGA	0.673					288											0.69			25	11		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	195599202	195599203	TNK2	3	CT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	16201	88
SEMA3E	9723	broad.mit.edu	37	7	83034830	83034830	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:83034830delC	uc003uhy.1	-	9	1400	c.934delG	c.(934-936)GTTfs	p.V312fs		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	312	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				AGCAAAAAAACGTCCTCTGAA	0.313																0.41			41	58		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	83034830	83034830	SEMA3E	7	C	-	-	-	1	0	1	0	1	0	0	0	0	247	19	5	5	13921	88
CNKSR2	22866	broad.mit.edu	37	X	21450738	21450739	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-2565-01	TCGA-06-2565-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21450738_21450739insT	uc004czx.1	+	3	273_274	c.237_238insT	c.(235-240)GGCTTGfs	p.G79fs	CNKSR2_uc004czw.2_Frame_Shift_Ins_p.G79fs|CNKSR2_uc011mjn.1_Frame_Shift_Ins_p.G79fs|CNKSR2_uc011mjo.1_Frame_Shift_Ins_p.G79fs	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	79_80					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						AGAATTATGGCTTGGAAACAGA	0.243																0.05			7	122		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	21450738	21450739	CNKSR2	23	-	T	T	T	1	0	1	1	0	0	0	0	0	353	28	5	5	3572	88
