Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AGRN	375790	broad.mit.edu	37	1	985841	985841	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:985841C>T	uc001ack.1	+	29	5061	c.5011C>T	c.(5011-5013)CGA>TGA	p.R1671*		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	1671	Laminin G-like 2.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GTTCCTGGCACGAGGCCCCAG	0.677																0.55	64.549887	64.63652	22	18	KEEP	---	---	---	---	7	15	15	7	-1	capture	Nonsense_Mutation	SNP	985841	985841	AGRN	1	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	397	108
PRAMEF11	440560	broad.mit.edu	37	1	12885289	12885289	+	Silent	SNP	G	T	T	rs148273194	by1000genomes	TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12885289G>T	uc001auk.2	-	4	1018	c.822C>A	c.(820-822)CTC>CTA	p.L274L		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	274	LRR 3.										0						GGCACTGGGAGAGATGCTTCA	0.458																0.111111	3.654704	10.374445	5	40	KEEP	---	---	---	---	3	3	25	25	0.5	capture	Silent	SNP	12885289	12885289	PRAMEF11	1	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	12328	108
ARHGEF11	9826	broad.mit.edu	37	1	156917716	156917716	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156917716G>A	uc001fqo.2	-	24	3106	c.2066C>T	c.(2065-2067)ACA>ATA	p.T689I	ARHGEF11_uc010phu.1_Missense_Mutation_p.T105I|ARHGEF11_uc001fqn.2_Missense_Mutation_p.T729I	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	689					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GAGGGTATCTGTGCAGAACCC	0.562																0.375	32.189812	32.629581	12	20	KEEP	---	---	---	---	4	10	10	14	-1	capture	Missense_Mutation	SNP	156917716	156917716	ARHGEF11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	889	108
OBSCN	84033	broad.mit.edu	37	1	228494214	228494214	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228494214G>A	uc009xez.1	+	44	11845	c.11801G>A	c.(11800-11802)CGC>CAC	p.R3934H	OBSCN_uc001hsn.2_Missense_Mutation_p.R3934H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3934	Ig-like 40.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCCAATGGGCGCCGGGAGCCA	0.652					4006											0.160714	14.54018	20.676458	9	47	KEEP	---	---	---	---	5	5	26	33	-1	capture	Missense_Mutation	SNP	228494214	228494214	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10717	108
DIP2C	22982	broad.mit.edu	37	10	395316	395316	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:395316C>T	uc001ifp.2	-	25	3154	c.3064G>A	c.(3064-3066)GGC>AGC	p.G1022S	DIP2C_uc009xhi.1_Missense_Mutation_p.G408S	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	1022						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGAAGGTGGCCCCTCTCCATC	0.652					1018											0.7	92.839837	94.301142	28	12	KEEP	---	---	---	---	15	15	7	6	-1	capture	Missense_Mutation	SNP	395316	395316	DIP2C	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4487	108
CALY	50632	broad.mit.edu	37	10	135142374	135142374	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135142374C>T	uc001lmo.2	-	2	278	c.120G>A	c.(118-120)CCG>CCA	p.P40P		NM_015722	NP_056537	Q9NYX4	CALY_HUMAN	dopamine receptor D1 interacting protein	40	Extracellular (Potential).				clathrin coat assembly|dopamine receptor signaling pathway|endocytosis|positive regulation of endocytosis	cytoplasmic vesicle membrane|integral to plasma membrane	clathrin light chain binding|dopamine receptor binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Flupenthixol(DB00875)|Trifluoperazine(DB00831)	CAGGGAGTGGCGGCTGGAGCT	0.637																1	10.748101	10.630221	3	0	KEEP	---	---	---	---	2	2	0	0	-1	capture	Silent	SNP	135142374	135142374	CALY	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2571	108
ANO9	338440	broad.mit.edu	37	11	419726	419726	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:419726G>T	uc001lpi.2	-	20	1875	c.1790C>A	c.(1789-1791)ACC>AAC	p.T597N	SIGIRR_uc001lpf.2_5'Flank|SIGIRR_uc001lpe.1_5'Flank|ANO9_uc001lph.2_Missense_Mutation_p.T290N|ANO9_uc010qvv.1_Missense_Mutation_p.T453N	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	597	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CTGCAGCCAGGTCCCTGCACC	0.637																0.470588	100.894899	100.946078	32	36	KEEP	---	---	---	---	20	20	19	23	0.5	capture	Missense_Mutation	SNP	419726	419726	ANO9	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	698	108
CHRNA10	57053	broad.mit.edu	37	11	3688571	3688571	+	Silent	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3688571G>A	uc001lyf.2	-	4	858	c.786C>T	c.(784-786)GCC>GCT	p.A262A	CHRNA10_uc010qxt.1_Silent_p.A56A|CHRNA10_uc010qxu.1_Silent_p.A56A	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	262					elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	CGCCTGAGTCGGCAGGCAGGT	0.706	Melanoma(153;17 1869 2949 7120 36888)															0.5	34.224742	34.224742	11	11	KEEP	---	---	---	---	5	7	9	3	-1	capture	Silent	SNP	3688571	3688571	CHRNA10	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3347	108
OR52E4	390081	broad.mit.edu	37	11	5906315	5906315	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5906315T>A	uc010qzs.1	+	1	793	c.793T>A	c.(793-795)TTT>ATT	p.F265I	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACACATCGTTTTGGCCAAAA	0.423																0.405556	196.819266	198.227259	73	107	KEEP	---	---	---	---	36	49	60	55	-1	capture	Missense_Mutation	SNP	5906315	5906315	OR52E4	11	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	11020	108
OR5L1	219437	broad.mit.edu	37	11	55579782	55579782	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55579782C>T	uc001nhw.1	+	1	840	c.840C>T	c.(838-840)GTC>GTT	p.V280V		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				TCTACACAGTCGTGATTCCTA	0.453																0.484375	92.021458	92.035036	31	33	KEEP	---	---	---	---	16	19	21	15	-1	capture	Silent	SNP	55579782	55579782	OR5L1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11074	108
PACS1	55690	broad.mit.edu	37	11	65977846	65977846	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65977846T>C	uc001oha.1	+	3	592	c.458T>C	c.(457-459)ATT>ACT	p.I153T	PACS1_uc001ogz.1_Missense_Mutation_p.I153T	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	153					interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						TCAAAAAGAATTCTTCGCTCC	0.318																0.527473	171.008574	171.068581	48	43	KEEP	---	---	---	---	29	25	23	32	-1	capture	Missense_Mutation	SNP	65977846	65977846	PACS1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11276	108
KIAA1377	57562	broad.mit.edu	37	11	101818772	101818772	+	Silent	SNP	A	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101818772A>G	uc001pgm.2	+	4	675	c.405A>G	c.(403-405)AAA>AAG	p.K135K	KIAA1377_uc001pgn.2_Silent_p.K91K|KIAA1377_uc009yxa.1_5'UTR	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	135							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TTTCCCGAAAACCAGTTCCTC	0.343																0.392857	76.439344	77.001808	22	34	KEEP	---	---	---	---	16	9	19	18	-1	capture	Silent	SNP	101818772	101818772	KIAA1377	11	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	8149	108
OR6M1	390261	broad.mit.edu	37	11	123676994	123676994	+	Nonsense_Mutation	SNP	G	A	A	rs150135307		TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123676994G>A	uc010rzz.1	-	1	64	c.64C>T	c.(64-66)CGA>TGA	p.R22*		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		AGAGATATTCGAATCTCCAGG	0.458																0.347222	68.951197	70.435617	25	47	KEEP	---	---	---	---	10	20	31	26	-1	capture	Nonsense_Mutation	SNP	123676994	123676994	OR6M1	11	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	11109	108
PPP1R12A	4659	broad.mit.edu	37	12	80191152	80191152	+	Silent	SNP	T	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:80191152T>C	uc001syz.2	-	16	2382	c.2115A>G	c.(2113-2115)CAA>CAG	p.Q705Q	PPP1R12A_uc010suc.1_Silent_p.Q618Q|PPP1R12A_uc001sza.2_Silent_p.Q649Q|PPP1R12A_uc010sud.1_Silent_p.Q705Q|PPP1R12A_uc001szb.2_Silent_p.Q705Q|PPP1R12A_uc001szc.2_Silent_p.Q646Q	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	705	Interaction with ROCK2.					contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						TCTCAGCTTCTTGAAGATCAG	0.244																0.421053	28.997675	29.100861	8	11	KEEP	---	---	---	---	4	6	4	8	-1	capture	Silent	SNP	80191152	80191152	PPP1R12A	12	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	12255	108
GPR109A	338442	broad.mit.edu	37	12	123187006	123187006	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123187006C>T	uc001ucx.1	-	1	899	c.825G>A	c.(823-825)GCG>GCA	p.A275A	GPR81_uc001ucw.1_Intron	NM_177551	NP_808219	Q8TDS4	HCAR2_HUMAN	G protein-coupled receptor 109A	275	Helical; Name=7; (Potential).				negative regulation of lipid catabolic process|neutrophil apoptosis|positive regulation of adiponectin secretion|positive regulation of neutrophil apoptosis	integral to membrane|plasma membrane	nicotinic acid receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	TGATAAAGAACGCCAGGTCCA	0.542																0.272727	35.212397	37.766425	15	40	KEEP	---	---	---	---	8	11	24	35	-1	capture	Silent	SNP	123187006	123187006	GPR109A	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6559	108
CLEC14A	161198	broad.mit.edu	37	14	38724093	38724093	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38724093T>A	uc001wum.1	-	1	1482	c.1135A>T	c.(1135-1137)AAG>TAG	p.K379*		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	379	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GAATTAAACTTGGAAATCACG	0.502																0.514706	102.622164	102.634864	35	33	KEEP	---	---	---	---	19	18	15	20	-1	capture	Nonsense_Mutation	SNP	38724093	38724093	CLEC14A	14	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	3464	108
CLEC14A	161198	broad.mit.edu	37	14	38724649	38724649	+	Silent	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38724649G>A	uc001wum.1	-	1	926	c.579C>T	c.(577-579)CGC>CGT	p.R193R		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	193	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GGAAGGGCGCGCGATAGCTCA	0.542																0.413462	116.738069	117.408516	43	61	KEEP	---	---	---	---	23	21	24	42	-1	capture	Silent	SNP	38724649	38724649	CLEC14A	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3464	108
NIN	51199	broad.mit.edu	37	14	51227078	51227078	+	Splice_Site	SNP	C	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51227078C>G	uc001wym.2	-	17	2088	c.1897_splice	c.e17-1	p.V633_splice	NIN_uc001wyi.2_Splice_Site_p.V633_splice|NIN_uc001wyj.2_Splice_Site|NIN_uc001wyk.2_Splice_Site_p.V633_splice|NIN_uc010tqp.1_Splice_Site_p.V639_splice|NIN_uc001wyo.2_Splice_Site_p.V633_splice	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5						centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					AATGGCGCACCTGAAGGCACA	0.453					745	T	PDGFRB	MPD								0.384615	60.473696	61.084978	20	32	KEEP	---	---	---	---	11	13	15	21	-1	capture	Splice_Site	SNP	51227078	51227078	NIN	14	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	10324	108
SIX4	51804	broad.mit.edu	37	14	61180418	61180418	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:61180418G>C	uc001xfc.2	-	3	2053	c.2053C>G	c.(2053-2055)CTT>GTT	p.L685V		NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	685						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		ATTTCCCCAAGGGCAGCCTGA	0.473					127											0.454545	77.567505	77.666671	25	30	KEEP	---	---	---	---	13	14	16	16	-1	capture	Missense_Mutation	SNP	61180418	61180418	SIX4	14	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	14242	108
YY1	7528	broad.mit.edu	37	14	100705804	100705804	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100705804C>G	uc001ygy.1	+	1	703	c.223C>G	c.(223-225)CAT>GAT	p.H75D		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	75	Poly-His.				cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				ccaccaccaccatcaccacca	0.313																0.375	7.321675	7.431879	3	5	KEEP	---	---	---	---	0	3	4	2	-1	capture	Missense_Mutation	SNP	100705804	100705804	YY1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	17388	108
BAHD1	22893	broad.mit.edu	37	15	40751318	40751318	+	Missense_Mutation	SNP	C	T	T	rs143744499		TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40751318C>T	uc001zlu.2	+	2	726	c.655C>T	c.(655-657)CGG>TGG	p.R219W	BAHD1_uc001zlt.2_Missense_Mutation_p.R219W|BAHD1_uc010bbp.1_Missense_Mutation_p.R219W|BAHD1_uc001zlv.2_Missense_Mutation_p.R219W	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	219					heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		GAGCCAGGAGCGGGAGCTACC	0.642																0.346154	22.463751	23.008484	9	17	KEEP	---	---	---	---	1	8	9	8	-1	capture	Missense_Mutation	SNP	40751318	40751318	BAHD1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	1286	108
VPS13C	54832	broad.mit.edu	37	15	62300907	62300907	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:62300907C>T	uc002agz.2	-	14	1139	c.1065G>A	c.(1063-1065)GCG>GCA	p.A355A	VPS13C_uc002aha.2_Silent_p.A312A|VPS13C_uc002ahb.1_Silent_p.A355A|VPS13C_uc002ahc.1_Silent_p.A312A	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	355					protein localization					ovary(2)	2						TCCTATAAGGCGCATTCCTAA	0.274																0.425926	65.214933	65.473462	23	31	KEEP	---	---	---	---	14	13	18	23	-1	capture	Silent	SNP	62300907	62300907	VPS13C	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17073	108
THSD4	79875	broad.mit.edu	37	15	72037463	72037463	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72037463T>C	uc002atb.1	+	11	2004	c.1925T>C	c.(1924-1926)TTC>TCC	p.F642S	THSD4_uc002ate.2_Missense_Mutation_p.F282S	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	642						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TACCCTATTTTCCGCTGTGTG	0.547																0.437642	682.190371	683.667802	193	248	KEEP	---	---	---	---	104	120	141	145	-1	capture	Missense_Mutation	SNP	72037463	72037463	THSD4	15	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	15763	108
LRRK1	79705	broad.mit.edu	37	15	101569415	101569415	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101569415G>A	uc002bwr.2	+	20	3260	c.2941G>A	c.(2941-2943)GCC>ACC	p.A981T	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	981					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTTTGAGATCGCCCTGCCCGT	0.592				p.A981T(SW1573-Tumor)	1100											0.344828	27.464288	28.070133	10	19	KEEP	---	---	---	---	6	5	8	13	-1	capture	Missense_Mutation	SNP	101569415	101569415	LRRK1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8947	108
SRL	6345	broad.mit.edu	37	16	4245578	4245578	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4245578C>T	uc002cvz.3	-	5	599	c.586G>A	c.(586-588)GAG>AAG	p.E196K	SRL_uc002cvy.3_RNA	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin	655						sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5						TTGCGGTTCTCGATGATGCCT	0.378																0.445205	190.147429	190.530116	65	81	KEEP	---	---	---	---	36	45	51	48	-1	capture	Missense_Mutation	SNP	4245578	4245578	SRL	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15042	108
CETP	1071	broad.mit.edu	37	16	57016107	57016107	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57016107C>T	uc002eki.2	+	14	1336	c.1279C>T	c.(1279-1281)CAG>TAG	p.Q427*	CETP_uc002ekj.2_Nonsense_Mutation_p.Q367*	NM_000078	NP_000069	P11597	CETP_HUMAN	cholesteryl ester transfer protein, plasma	427					cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|lipoprotein metabolic process|low-density lipoprotein particle remodeling|phosphatidylcholine metabolic process|phospholipid homeostasis|receptor-mediated endocytosis|regulation of cholesterol efflux|triglyceride homeostasis|triglyceride metabolic process|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle|vesicle	cholesterol binding|cholesterol transporter activity|phosphatidylcholine binding|phospholipid transporter activity|triglyceride binding			central_nervous_system(1)|skin(1)	2						GAGCTTCCTGCAGTCAATGAT	0.582																0.0625	-6.193829	9.770956	5	75	KEEP	---	---	---	---	1	4	45	44	-1	capture	Nonsense_Mutation	SNP	57016107	57016107	CETP	16	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	3245	108
GALNS	2588	broad.mit.edu	37	16	88891241	88891241	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88891241C>T	uc002fly.3	-	11	1265	c.1176G>A	c.(1174-1176)GCG>GCA	p.A392A	GALNS_uc002flx.2_5'Flank|GALNS_uc010cid.2_Silent_p.A398A|GALNS_uc002flz.3_Silent_p.A75A	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	392			A -> V (in MPS4A).			lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	CGAGGGTGGCCGCCATCAGCG	0.627	GBM(129;1929 2344 25209 33204)															0.53125	105.551676	105.605982	34	30	KEEP	---	---	---	---	19	23	17	17	-1	capture	Silent	SNP	88891241	88891241	GALNS	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6146	108
CRLF3	51379	broad.mit.edu	37	17	29119557	29119557	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29119557C>G	uc002hfr.3	-	6	969	c.860G>C	c.(859-861)AGC>ACC	p.S287T	CRLF3_uc010wbr.1_Missense_Mutation_p.S171T	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	287					negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				TCTTCGACTGCTCAGACTGTA	0.423	Pancreas(30;346 881 29244 33464 41299)															0.40367	151.080137	151.964189	44	65	KEEP	---	---	---	---	34	16	37	40	-1	capture	Missense_Mutation	SNP	29119557	29119557	CRLF3	17	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	3853	108
TMEM106A	113277	broad.mit.edu	37	17	41365143	41365143	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41365143G>A	uc002idn.1	+	3	320	c.83G>A	c.(82-84)AGC>AAC	p.S28N	TMEM106A_uc010why.1_Intron|TMEM106A_uc010cze.1_Missense_Mutation_p.S28N|TMEM106A_uc010whz.1_Missense_Mutation_p.S28N	NM_145041	NP_659478	Q96A25	T106A_HUMAN	transmembrane protein 106A	28						integral to membrane					0		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		GCCATTGGCAGCAAGGCTGTC	0.547																0.02381	-34.756175	7.606764	4	164	KEEP	---	---	---	---	2	2	83	94	-1	capture	Missense_Mutation	SNP	41365143	41365143	TMEM106A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	15905	108
CSH2	1443	broad.mit.edu	37	17	61949661	61949661	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61949661C>T	uc002jch.2	-	5	594	c.479G>A	c.(478-480)CGG>CAG	p.R160Q	CSH2_uc002jcg.2_Missense_Mutation_p.R65Q|CSH2_uc002jci.2_3'UTR|GH2_uc002jcj.2_Missense_Mutation_p.G159R|CSH2_uc002jck.2_Missense_Mutation_p.R160Q	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1	160					female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						CTGCCCAGTCCGGCGGCTGCC	0.547																0.84507	194.937621	203.014697	60	11	KEEP	---	---	---	---	37	38	12	14	-1	capture	Missense_Mutation	SNP	61949661	61949661	CSH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3906	108
TXNDC2	84203	broad.mit.edu	37	18	9887074	9887074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9887074G>A	uc002koi.3	+	2	1047	c.598G>A	c.(598-600)GAA>AAA	p.E200K	TXNDC2_uc010wzq.1_Intron|TXNDC2_uc002koh.3_Missense_Mutation_p.E133K	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	200	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.|6.				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						GTCCTCAGAAGAAGCCATCCA	0.577																0.020202	-44.484743	6.624643	4	194	KEEP	---	---	---	---	1	4	96	120	-1	capture	Missense_Mutation	SNP	9887074	9887074	TXNDC2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16679	108
FAM129C	199786	broad.mit.edu	37	19	17653014	17653014	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17653014A>G	uc010xpr.1	+	11	1471	c.1333A>G	c.(1333-1335)AGC>GGC	p.S445G	FAM129C_uc010xpq.1_Missense_Mutation_p.S445G|FAM129C_uc002ngy.3_Missense_Mutation_p.S171G|FAM129C_uc010xpu.1_Missense_Mutation_p.S171G|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Missense_Mutation_p.S171G|FAM129C_uc002nhb.2_Missense_Mutation_p.S44G	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	445											0						GGCCGAGCGGAGCCGGGGGCG	0.612																0.398467	344.121183	346.450214	104	157	KEEP	---	---	---	---	48	71	85	98	-1	capture	Missense_Mutation	SNP	17653014	17653014	FAM129C	19	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5392	108
ZNF208	7757	broad.mit.edu	37	19	22155056	22155056	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155056C>T	uc002nqp.2	-	5	2629	c.2480G>A	c.(2479-2481)AGC>AAC	p.S827N	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGACAACCAGCTGAAGGCTTT	0.393																0.492537	98.464856	98.468252	33	34	KEEP	---	---	---	---	19	18	21	19	-1	capture	Missense_Mutation	SNP	22155056	22155056	ZNF208	19	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	17646	108
ZNF180	7733	broad.mit.edu	37	19	44981361	44981361	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44981361A>C	uc002ozf.3	-	5	1619	c.1337T>G	c.(1336-1338)TTC>TGC	p.F446C	ZNF180_uc002ozh.3_Missense_Mutation_p.F103C|ZNF180_uc002ozi.3_Missense_Mutation_p.F419C|ZNF180_uc002ozg.3_Missense_Mutation_p.F445C|ZNF180_uc010ejm.2_Missense_Mutation_p.F421C	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	446	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				GCTCTGCCTGAATGACTTTCC	0.393	Esophageal Squamous(180;1353 2003 32862 46574 49854)															0.490909	198.953721	198.96148	54	56	KEEP	---	---	---	---	28	31	34	29	-1	capture	Missense_Mutation	SNP	44981361	44981361	ZNF180	19	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	17628	108
SH3RF3	344558	broad.mit.edu	37	2	110015136	110015136	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:110015136G>A	uc010ywt.1	+	4	1036	c.1036G>A	c.(1036-1038)GGC>AGC	p.G346S		NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	346							zinc ion binding			ovary(1)	1						CTCTGACTCCGGCGCTGTGGC	0.602																0.333333	14.170298	14.539158	5	10	KEEP	---	---	---	---	5	1	3	10	-1	capture	Missense_Mutation	SNP	110015136	110015136	SH3RF3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14153	108
TMEM163	81615	broad.mit.edu	37	2	135470799	135470799	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135470799A>G	uc002ttx.2	-	2	359	c.293T>C	c.(292-294)GTC>GCC	p.V98A	TMEM163_uc002tty.2_RNA	NM_030923	NP_112185	Q8TC26	TM163_HUMAN	transmembrane protein 163	98	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)		GGCCAGGGTGACAATGATGGA	0.517																0.018987	-34.404393	6.679695	3	155	KEEP	---	---	---	---	1	3	80	89	-1	capture	Missense_Mutation	SNP	135470799	135470799	TMEM163	2	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	15961	108
TMC2	117532	broad.mit.edu	37	20	2616589	2616589	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2616589T>A	uc002wgf.1	+	18	2339	c.2324T>A	c.(2323-2325)CTG>CAG	p.L775Q	TMC2_uc002wgg.1_Missense_Mutation_p.L759Q	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	775	Cytoplasmic (Potential).					integral to membrane				ovary(3)	3						ATTTACTACCTGAACTCAGTT	0.502																0.532468	127.575559	127.645891	41	36	KEEP	---	---	---	---	24	25	25	18	-1	capture	Missense_Mutation	SNP	2616589	2616589	TMC2	20	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	15870	108
PLTP	5360	broad.mit.edu	37	20	44528299	44528299	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44528299T>C	uc002xqn.1	-	14	1324	c.1244A>G	c.(1243-1245)AAG>AGG	p.K415R	PLTP_uc002xql.1_Missense_Mutation_p.K327R|PLTP_uc002xqm.1_Missense_Mutation_p.K435R|PLTP_uc002xqo.1_Missense_Mutation_p.K363R|PLTP_uc002xqp.1_Missense_Mutation_p.K410R|PLTP_uc002xqq.1_Missense_Mutation_p.K384R|PLTP_uc010zxj.1_Missense_Mutation_p.K320R|PLTP_uc010ghj.1_Intron	NM_006227	NP_006218	P55058	PLTP_HUMAN	phospholipid transfer protein isoform a	415					cellular lipid metabolic process|lipid transport	extracellular region	lipid binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CAGCATGGTCTTCAGAGGGGC	0.602																0.534247	139.450975	139.528346	39	34	KEEP	---	---	---	---	20	24	21	20	-1	capture	Missense_Mutation	SNP	44528299	44528299	PLTP	20	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	12017	108
ZGPAT	84619	broad.mit.edu	37	20	62367145	62367145	+	Silent	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62367145G>A	uc002ygk.2	+	7	1648	c.1470G>A	c.(1468-1470)GCG>GCA	p.A490A	ZGPAT_uc002ygi.2_Silent_p.A470A|ZGPAT_uc002ygj.2_Silent_p.A470A|ZGPAT_uc010gkk.1_Silent_p.A47A|ZGPAT_uc010gkl.1_Silent_p.A470A|ZGPAT_uc002ygm.2_Silent_p.A461A|ZGPAT_uc002ygn.3_RNA|LIME1_uc011abi.1_5'UTR|LIME1_uc002ygp.3_5'Flank	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	490					negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					ATAGCGTGGCGTCAGCCCAGC	0.692																0.375	16.446815	16.665955	6	10	KEEP	---	---	---	---	5	1	5	5	-1	capture	Silent	SNP	62367145	62367145	ZGPAT	20	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17554	108
UMODL1	89766	broad.mit.edu	37	21	43524008	43524008	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43524008G>C	uc002zaf.1	+	9	1330	c.1330G>C	c.(1330-1332)GAC>CAC	p.D444H	UMODL1_uc002zad.1_Missense_Mutation_p.D372H|UMODL1_uc002zae.1_Missense_Mutation_p.D372H|UMODL1_uc002zag.1_Missense_Mutation_p.D444H|UMODL1_uc010gow.1_Missense_Mutation_p.D236H|UMODL1_uc002zai.1_Missense_Mutation_p.D95H|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Missense_Mutation_p.D95H|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.D189H|C21orf128_uc002zak.2_Silent_p.V75V	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	444	Extracellular (Potential).|SEA 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						AGTGGTGTCTGACTTGTACCG	0.567	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)															0.060976	-4.389898	12.110809	5	77	KEEP	---	---	---	---	3	2	55	35	-1	capture	Missense_Mutation	SNP	43524008	43524008	UMODL1	21	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	16862	108
UMODL1	89766	broad.mit.edu	37	21	43524114	43524114	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43524114G>C	uc002zaf.1	+	9	1436	c.1436G>C	c.(1435-1437)GGC>GCC	p.G479A	UMODL1_uc002zad.1_Missense_Mutation_p.G407A|UMODL1_uc002zae.1_Missense_Mutation_p.G407A|UMODL1_uc002zag.1_Missense_Mutation_p.G479A|UMODL1_uc010gow.1_Missense_Mutation_p.G271A|UMODL1_uc002zai.1_Missense_Mutation_p.G130A|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Missense_Mutation_p.G130A|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.G224A|C21orf128_uc002zak.2_Missense_Mutation_p.A40G	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	479	Extracellular (Potential).|SEA 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						TTTCCCATGGGCATCTCCACG	0.622	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)															0.058824	-4.591529	12.729582	5	80	KEEP	---	---	---	---	2	4	49	44	-1	capture	Missense_Mutation	SNP	43524114	43524114	UMODL1	21	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	16862	108
TRPM2	7226	broad.mit.edu	37	21	45817635	45817635	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45817635G>C	uc002zet.1	+	14	2151	c.1938G>C	c.(1936-1938)CAG>CAC	p.Q646H	TRPM2_uc002zeu.1_Missense_Mutation_p.Q646H|TRPM2_uc002zew.1_Missense_Mutation_p.Q646H|TRPM2_uc010gpt.1_Missense_Mutation_p.Q646H|TRPM2_uc002zex.1_Missense_Mutation_p.Q432H|TRPM2_uc002zey.1_Missense_Mutation_p.Q159H	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	646	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CCCAGAGCCAGGACTGCATCG	0.627																0.130435	4.707837	7.764393	3	20	KEEP	---	---	---	---	3	0	12	14	-1	capture	Missense_Mutation	SNP	45817635	45817635	TRPM2	21	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	16469	108
PROS1	5627	broad.mit.edu	37	3	93646100	93646100	+	Silent	SNP	C	T	T	rs6121	by1000genomes	TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:93646100C>T	uc003drb.3	-	2	569	c.228G>A	c.(226-228)CCG>CCA	p.P76P	PROS1_uc010hoo.2_5'UTR|PROS1_uc003dqz.3_5'UTR	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	76	Gla.		P -> L.		leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TTACCGTTTCCGGGTCATTTT	0.388																0.446602	144.119848	144.377796	46	57	KEEP	---	---	---	---	27	26	37	28	-1	capture	Silent	SNP	93646100	93646100	PROS1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12454	108
TNIK	23043	broad.mit.edu	37	3	170819385	170819385	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:170819385C>T	uc003fhh.2	-	22	2789	c.2444G>A	c.(2443-2445)CGG>CAG	p.R815Q	TNIK_uc003fhi.2_Missense_Mutation_p.R760Q|TNIK_uc003fhj.2_Missense_Mutation_p.R786Q|TNIK_uc003fhk.2_Missense_Mutation_p.R807Q|TNIK_uc003fhl.2_Missense_Mutation_p.R731Q|TNIK_uc003fhm.2_Missense_Mutation_p.R752Q|TNIK_uc003fhn.2_Missense_Mutation_p.R778Q|TNIK_uc003fho.2_Missense_Mutation_p.R723Q|TNIK_uc003fhg.2_5'UTR	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	815	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTCTTCAATCCGGAGTTCTCT	0.453					743											0.033784	-26.837791	8.212964	5	143	KEEP	---	---	---	---	2	3	71	83	-1	capture	Missense_Mutation	SNP	170819385	170819385	TNIK	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16196	108
ARAP2	116984	broad.mit.edu	37	4	36085016	36085016	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:36085016C>T	uc003gsq.1	-	29	4820	c.4482G>A	c.(4480-4482)GTG>GTA	p.V1494V		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1494	PH 5.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TTTTCTTTTTCACTCCACGAT	0.313																0.457143	45.390281	45.446866	16	19	KEEP	---	---	---	---	7	10	12	8	-1	capture	Silent	SNP	36085016	36085016	ARAP2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	832	108
FRAS1	80144	broad.mit.edu	37	4	79204019	79204019	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79204019C>T	uc003hlb.2	+	12	1593	c.1153C>T	c.(1153-1155)CGA>TGA	p.R385*	FRAS1_uc003hkw.2_Nonsense_Mutation_p.R385*|FRAS1_uc003hky.1_Nonsense_Mutation_p.R89*|FRAS1_uc003hkz.2_Nonsense_Mutation_p.R89*	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	385	VWFC 6.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GTGTGAGTGCCGAGGGGCTCA	0.537																0.862069	162.184565	169.536504	50	8	KEEP	---	---	---	---	28	28	7	3	-1	capture	Nonsense_Mutation	SNP	79204019	79204019	FRAS1	4	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	5986	108
HPGD	3248	broad.mit.edu	37	4	175439163	175439163	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175439163T>A	uc003itu.2	-	3	473	c.283A>T	c.(283-285)AAT>TAT	p.N95Y	HPGD_uc003itv.2_Missense_Mutation_p.N95Y|HPGD_uc011ckf.1_Intron|HPGD_uc010irp.2_5'UTR|HPGD_uc010irq.2_Missense_Mutation_p.N95Y|HPGD_uc011ckg.1_Intron|HPGD_uc011ckh.1_5'UTR|HPGD_uc003itw.2_Missense_Mutation_p.N95Y|HPGD_uc003itx.2_Missense_Mutation_p.N95Y	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	95					female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	TTCTCATTATTCACTCCAGCA	0.279																0.348837	39.110781	39.978393	15	28	KEEP	---	---	---	---	2	14	19	18	-1	capture	Missense_Mutation	SNP	175439163	175439163	HPGD	4	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	7259	108
PLCXD3	345557	broad.mit.edu	37	5	41382349	41382349	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41382349A>G	uc003jmm.1	-	2	493	c.391T>C	c.(391-393)TTC>CTC	p.F131L		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	131	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						TCTGTGAGGAATGCATTGATC	0.433																0.352381	125.050668	127.065492	37	68	KEEP	---	---	---	---	21	20	35	40	-1	capture	Missense_Mutation	SNP	41382349	41382349	PLCXD3	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11946	108
ATXN1	6310	broad.mit.edu	37	6	16327903	16327903	+	Missense_Mutation	SNP	C	A	A	rs3817753		TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16327903C>A	uc003nbt.2	-	8	1610	c.639G>T	c.(637-639)CAG>CAT	p.Q213H	ATXN1_uc010jpi.2_Missense_Mutation_p.Q213H|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	213	Poly-Gln.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgatgct	0.378																0.333333	16.444015	16.886819	6	12	KEEP	---	---	---	---	4	3	8	6	0.428571428571	capture	Missense_Mutation	SNP	16327903	16327903	ATXN1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	1200	108
RSPO3	84870	broad.mit.edu	37	6	127469958	127469958	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:127469958G>A	uc003qar.2	+	2	553	c.263G>A	c.(262-264)CGA>CAA	p.R88Q	RSPO3_uc003qas.1_Missense_Mutation_p.R88Q	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor	88						extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		TATGGAACTCGATATCCAGAT	0.363																0.410526	112.212901	112.875375	39	56	KEEP	---	---	---	---	20	24	32	31	-1	capture	Missense_Mutation	SNP	127469958	127469958	RSPO3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13603	108
ZBTB2	57621	broad.mit.edu	37	6	151687542	151687542	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151687542G>T	uc003qoh.2	-	3	794	c.659C>A	c.(658-660)ACC>AAC	p.T220N		NM_020861	NP_065912	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		TTCCAGATTGGTCTCCTCCCC	0.552																0.402439	96.858287	97.54059	33	49	KEEP	---	---	---	---	16	19	23	29	0.457142857143	capture	Missense_Mutation	SNP	151687542	151687542	ZBTB2	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	17408	108
MACC1	346389	broad.mit.edu	37	7	20180649	20180649	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20180649C>A	uc003sus.3	-	7	2788	c.2479G>T	c.(2479-2481)GAA>TAA	p.E827*	MACC1_uc010kug.2_Nonsense_Mutation_p.E827*	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	827					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						CCAGTTAATTCTCTCCAGTGT	0.383																0.507692	188.437336	188.443793	66	64	KEEP	---	---	---	---	30	39	31	40	0.565217391304	capture	Nonsense_Mutation	SNP	20180649	20180649	MACC1	7	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	9058	108
EGFR	1956	broad.mit.edu	37	7	55221763	55221763	+	Silent	SNP	C	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221763C>G	uc003tqk.2	+	7	1053	c.807C>G	c.(805-807)CTC>CTG	p.L269L	EGFR_uc003tqh.2_Silent_p.L269L|EGFR_uc003tqi.2_Silent_p.L269L|EGFR_uc003tqj.2_Silent_p.L269L|EGFR_uc010kzg.1_Silent_p.L224L|EGFR_uc011kco.1_Silent_p.L216L|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	269	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CACTCATGCTCTACAACCCCA	0.577			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.084599	34.43763	196.270522	78	844	KEEP	---	---	---	---	34	41	433	489	-1	capture	Silent	SNP	55221763	55221763	EGFR	7	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	4922	108
EPHA1	2041	broad.mit.edu	37	7	143097029	143097029	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143097029C>T	uc003wcz.2	-	4	637	c.550G>A	c.(550-552)GCT>ACT	p.A184T		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	184	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TTGTGGAAAGCGAGGTAGAGG	0.617					379											0.380952	21.093446	21.354982	8	13	KEEP	---	---	---	---	6	5	16	5	-1	capture	Missense_Mutation	SNP	143097029	143097029	EPHA1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5120	108
BNC2	54796	broad.mit.edu	37	9	16437497	16437497	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16437497C>T	uc003zml.2	-	6	835	c.695G>A	c.(694-696)CGC>CAC	p.R232H	BNC2_uc011lmw.1_Missense_Mutation_p.R137H|BNC2_uc003zmm.2_Missense_Mutation_p.R190H|BNC2_uc003zmq.1_Missense_Mutation_p.R246H|BNC2_uc003zmr.1_Missense_Mutation_p.R269H|BNC2_uc003zmp.1_Missense_Mutation_p.R260H|BNC2_uc010mij.1_Missense_Mutation_p.R154H|BNC2_uc011lmv.1_Missense_Mutation_p.R58H|BNC2_uc003zmo.1_Missense_Mutation_p.R154H|BNC2_uc003zmj.2_5'UTR|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_5'UTR|BNC2_uc003zmn.1_5'UTR	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	232					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		GATGGCCCAGCGGTCCAGCAC	0.448																0.928571	85.034475	89.468229	26	2	KEEP	---	---	---	---	14	14	3	0	-1	capture	Missense_Mutation	SNP	16437497	16437497	BNC2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1463	108
NOL8	55035	broad.mit.edu	37	9	95078415	95078415	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95078415G>C	uc004arv.2	-	7	829	c.492C>G	c.(490-492)ATC>ATG	p.I164M	NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Intron|NOL8_uc011ltw.1_Missense_Mutation_p.I96M	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN	nucleolar protein 8	164					DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding			ovary(1)	1						GATCATATTTGATGATGTTAC	0.338																0.5	107.376115	107.376115	29	29	KEEP	---	---	---	---	18	15	20	13	-1	capture	Missense_Mutation	SNP	95078415	95078415	NOL8	9	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	10434	108
KIAA0368	23392	broad.mit.edu	37	9	114145511	114145511	+	Silent	SNP	C	T	T			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114145511C>T	uc004bfe.1	-	36	4317	c.4317G>A	c.(4315-4317)GTG>GTA	p.V1439V		NM_001080398	NP_001073867			KIAA0368 protein												0						GAACTTCCGTCACGGTGCTCA	0.483																0.277778	24.832466	26.433441	10	26	KEEP	---	---	---	---	9	3	14	16	-1	capture	Silent	SNP	114145511	114145511	KIAA0368	9	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	8093	108
PHEX	5251	broad.mit.edu	37	X	22132590	22132590	+	Silent	SNP	C	G	G			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:22132590C>G	uc004dah.2	+	11	1391	c.1188C>G	c.(1186-1188)ACC>ACG	p.T396T	PHEX_uc011mjr.1_Silent_p.T396T|PHEX_uc011mjs.1_Silent_p.T299T	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	396	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						TCCAGGGGACCACAACTTTGC	0.398																0.333333	101.347618	104.012845	36	72	KEEP	---	---	---	---	22	18	38	46	-1	capture	Silent	SNP	22132590	22132590	PHEX	23	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	11722	108
DCAF8L1	139425	broad.mit.edu	37	X	27999308	27999308	+	Silent	SNP	G	A	A	rs147579544	byFrequency	TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27999308G>A	uc004dbx.1	-	1	259	c.144C>T	c.(142-144)ACC>ACT	p.T48T		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	48										ovary(3)|skin(1)	4						CACCATCTCCGGTCGATGGCT	0.532																0.432432	99.690507	99.984734	32	42	KEEP	---	---	---	---	18	18	19	27	-1	capture	Silent	SNP	27999308	27999308	DCAF8L1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4236	108
MAGEB16	139604	broad.mit.edu	37	X	35821053	35821053	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35821053G>A	uc010ngt.1	+	2	1019	c.740G>A	c.(739-741)AGA>AAA	p.R247K		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	247	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7						GGAGAGCCCAGAATGCTCATC	0.493					43											0.096154	2.333723	10.842224	5	47	KEEP	---	---	---	---	12	14	25	27	-1	capture	Missense_Mutation	SNP	35821053	35821053	MAGEB16	23	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	9088	108
GPR82	27197	broad.mit.edu	37	X	41587247	41587247	+	Missense_Mutation	SNP	T	G	G	rs144887525		TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41587247T>G	uc004dfs.1	+	3	1208	c.968T>G	c.(967-969)CTC>CGC	p.L323R	CASK_uc004dfl.3_Intron|CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron|GPR82_uc004dft.2_Missense_Mutation_p.L323R|GPR82_uc004dfu.1_RNA	NM_080817	NP_543007	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	323	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2						CTATATAATCTCTTTACAAAG	0.333																0.375	48.31531	48.863952	15	25	KEEP	---	---	---	---	7	9	20	8	-1	capture	Missense_Mutation	SNP	41587247	41587247	GPR82	23	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	6645	108
MAGIX	79917	broad.mit.edu	37	X	49021421	49021421	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49021421G>A	uc010nin.1	+	4	547	c.500G>A	c.(499-501)CGT>CAT	p.R167H	MAGIX_uc010nio.1_Intron|MAGIX_uc004dmt.2_Intron|MAGIX_uc004dmu.2_Missense_Mutation_p.R108H|MAGIX_uc004dmw.2_Missense_Mutation_p.R100H	NM_024859	NP_079135	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked isoform a	167	PDZ.										0						CGCTGTGGTCGTTTGGAGGTG	0.622																0.490196	71.869444	71.873785	25	26	KEEP	---	---	---	---	19	10	16	14	-1	capture	Missense_Mutation	SNP	49021421	49021421	MAGIX	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9107	108
R3HDM2	22864	broad.mit.edu	37	12	57674205	57674207	+	In_Frame_Del	DEL	TGC	-	-			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57674205_57674207delTGC	uc009zpm.1	-	12	1271_1273	c.1236_1238delGCA	c.(1234-1239)CAGCAA>CAA	p.412_413QQ>Q	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_In_Frame_Del_p.73_74QQ>Q|R3HDM2_uc001snr.2_In_Frame_Del_p.139_140QQ>Q|R3HDM2_uc001sns.2_In_Frame_Del_p.412_413QQ>Q|R3HDM2_uc001snt.2_In_Frame_Del_p.426_427QQ>Q|R3HDM2_uc009zpn.1_In_Frame_Del_p.35_36QQ>Q	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	412_413	Gln-rich.					nucleus	nucleic acid binding			ovary(2)	2						AGCAGGAAGTtgctgctgctgct	0.488																0.07			9	113		---	---	---	---						capture_indel	In_Frame_Del	DEL	57674205	57674207	R3HDM2	12	TGC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	12783	108
DNAH2	146754	broad.mit.edu	37	17	7644166	7644166	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7644166delC	uc002giu.1	+	10	1559	c.1545delC	c.(1543-1545)CTCfs	p.L515fs	DNAH2_uc002git.2_Frame_Shift_Del_p.L597fs|DNAH2_uc010vuk.1_Frame_Shift_Del_p.L515fs	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	515	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGGTGGATCTCTACATGCTGT	0.587																0.42			82	113		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7644166	7644166	DNAH2	17	C	-	-	-	1	0	1	0	1	0	0	0	0	405	32	5	5	4559	108
PDE4A	5141	broad.mit.edu	37	19	10561526	10561526	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10561526delC	uc002moj.2	+	6	800	c.692delC	c.(691-693)GCCfs	p.A231fs	PDE4A_uc002mok.2_Frame_Shift_Del_p.A205fs|PDE4A_uc002mol.2_Frame_Shift_Del_p.A170fs|PDE4A_uc002mom.2_5'Flank|PDE4A_uc002mon.2_5'Flank	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	231					signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	CAGCAGTTGGCCCGGGAGACT	0.612																0.52			13	12		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	10561526	10561526	PDE4A	19	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	11542	108
PHC3	80012	broad.mit.edu	37	3	169896635	169896637	+	In_Frame_Del	DEL	TGG	-	-			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169896635_169896637delTGG	uc010hws.1	-	2	132_134	c.68_70delCCA	c.(67-72)ACCATC>ATC	p.T23del	PHC3_uc003fgl.2_In_Frame_Del_p.T35del|PHC3_uc011bpq.1_In_Frame_Del_p.T35del|PHC3_uc011bpr.1_In_Frame_Del_p.T35del|PHC3_uc003fgm.2_In_Frame_Del_p.T35del|PHC3_uc003fgo.1_In_Frame_Del_p.T23del|PHC3_uc003fgp.3_In_Frame_Del_p.T35del|PHC3_uc003fgq.3_In_Frame_Del_p.T35del|PHC3_uc003fgr.1_RNA	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	23	Poly-Thr.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GAAgtggtgatggtggtggtggt	0.424																0.02			8	437		---	---	---	---						capture_indel	In_Frame_Del	DEL	169896635	169896637	PHC3	3	TGG	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	11721	108
LGI2	55203	broad.mit.edu	37	4	25032262	25032264	+	In_Frame_Del	DEL	CAG	-	-			TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25032262_25032264delCAG	uc003grf.2	-	1	151_153	c.52_54delCTG	c.(52-54)CTGdel	p.L18del		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	18						extracellular region					0		Breast(46;0.173)				ACGCGGCGCCCAGCAGCAGCAGC	0.547																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	25032262	25032264	LGI2	4	CAG	-	-	-	1	0	1	0	1	0	0	0	0	262	21	5	5	8672	108
MYC	4609	broad.mit.edu	37	8	128750605	128750607	+	In_Frame_Del	DEL	CAG	-	-	rs61752959	byFrequency;by1000genomes	TCGA-06-6693-01	TCGA-06-6693-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:128750605_128750607delCAG	uc003ysh.1	+	3	610_612	c.97_99delCAG	c.(97-99)CAGdel	p.Q37del	MYC_uc003ysi.2_In_Frame_Del_p.Q52del	NM_002467	NP_002458	P01106	MYC_HUMAN	myc proto-oncogene protein	37	Poly-Gln.				branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)		GAACTTCTACCAGCAGCAGCAGC	0.611			3	p.Q48Q(HCC1438-Tumor)|p.Q48Q(NCIH2172-Tumor)|p.Q48Q(A704-Tumor)|p.Q48Q(HCC1359-Tumor)|p.Q48Q(NCIH2110-Tumor)	133	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.01			11	1150		---	---	---	---						capture_indel	In_Frame_Del	DEL	128750605	128750607	MYC	8	CAG	-	-	-	1	0	1	0	1	0	0	0	0	273	21	5	5	9926	108
