Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ASPM	259266	broad.mit.edu	37	1	197071366	197071366	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197071366T>G	uc001gtu.2	-	18	7272	c.7015A>C	c.(7015-7017)ACT>CCT	p.T2339P	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Missense_Mutation_p.T187P	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2339	IQ 22.|IQ 23.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TGGATGAAAGTAGCAGCCCTG	0.408																0.12069	11.288113	19.465328	7	51	KEEP	---	---	---	---	5	2	23	33	-1	capture	Missense_Mutation	SNP	197071366	197071366	ASPM	1	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	1047	133
RRP15	51018	broad.mit.edu	37	1	218478415	218478415	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:218478415G>A	uc001hlj.2	+	3	481	c.451G>A	c.(451-453)GAT>AAT	p.D151N		NM_016052	NP_057136	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog	151						mitochondrion|nucleolus	protein binding				0				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		AGTAAAGCCAGATGTTGTCCA	0.363																0.037383	-16.997021	7.801438	4	103	KEEP	---	---	---	---	0	4	54	75	-1	capture	Missense_Mutation	SNP	218478415	218478415	RRP15	1	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	13579	133
PTEN	5728	broad.mit.edu	37	10	89711891	89711891	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711891G>A	uc001kfb.2	+	7	1540	c.509G>A	c.(508-510)AGT>AAT	p.S170N		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	170	Phosphatase tensin-type.		S -> N (loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|S -> R (in BZS; severely reduced protein phosphatase activity; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.S170N(3)|p.S170I(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.V166fs*10(1)|p.G165_K342del(1)|p.G165_*404del(1)|p.S170fs*13(1)|p.S170G(1)|p.S170fs*8(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ACTATTCCCAGTCAGAGGCGC	0.353			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.146667	20.317653	29.280058	11	64	KEEP	---	---	---	---	3	10	39	34	-1	capture	Missense_Mutation	SNP	89711891	89711891	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	12633	133
SLC22A10	387775	broad.mit.edu	37	11	63069908	63069908	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63069908G>A	uc009yor.2	+	7	1386	c.1178G>A	c.(1177-1179)CGA>CAA	p.R393Q	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_Intron|SLC22A10_uc010rmp.1_Intron	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	393	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						CTCATAGTTCGATGTCTTGCT	0.438																0.126761	10.941983	20.579803	9	62	KEEP	---	---	---	---	3	6	30	37	-1	capture	Missense_Mutation	SNP	63069908	63069908	SLC22A10	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14334	133
NAALADL1	10004	broad.mit.edu	37	11	64821985	64821985	+	Missense_Mutation	SNP	C	T	T	rs138766443		TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64821985C>T	uc001ocn.2	-	5	845	c.829G>A	c.(829-831)GGA>AGA	p.G277R	NAALADL1_uc010rnw.1_5'UTR	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	277	NAALADase.|Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						GGGGGAAATCCGGAGACATTG	0.597																0.189655	22.384598	27.621759	11	47	KEEP	---	---	---	---	7	5	19	34	-1	capture	Missense_Mutation	SNP	64821985	64821985	NAALADL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10039	133
UNC93B1	81622	broad.mit.edu	37	11	67765220	67765220	+	Silent	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67765220C>T	uc001omw.1	-	7	911	c.831G>A	c.(829-831)CGG>CGA	p.R277R		NM_030930	NP_112192	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1	277					innate immune response|intracellular protein transport|response to virus|toll-like receptor 3 signaling pathway|toll-like receptor 7 signaling pathway|toll-like receptor 9 signaling pathway	early phagosome|endoplasmic reticulum membrane|endosome|integral to membrane|lysosome					0						GCGGGAGCGTCCGCAGAACCG	0.652																0.069767	-1.810052	6.409078	3	40	KEEP	---	---	---	---	1	2	13	32	-1	capture	Silent	SNP	67765220	67765220	UNC93B1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	16879	133
MMP10	4319	broad.mit.edu	37	11	102646042	102646042	+	Nonsense_Mutation	SNP	G	A	A	rs150825082	byFrequency	TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102646042G>A	uc001phg.1	-	7	965	c.943C>T	c.(943-945)CGA>TGA	p.R315*		NM_002425	NP_002416	P09238	MMP10_HUMAN	matrix metalloproteinase 10 preproprotein	315	Hemopexin-like 1.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)		TGGGATCTTCGCCAAAAATAT	0.333																0.166667	5.713242	7.609899	3	15	KEEP	---	---	---	---	3	0	7	9	-1	capture	Nonsense_Mutation	SNP	102646042	102646042	MMP10	11	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	9561	133
KCNA1	3736	broad.mit.edu	37	12	5020794	5020794	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5020794C>T	uc001qnh.2	+	2	1355	c.250C>T	c.(250-252)CGC>TGC	p.R84C		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	84					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTTCTTCGACCGCAACCGGCC	0.627																0.07874	0.520648	23.479025	10	117	KEEP	---	---	---	---	3	8	54	70	-1	capture	Missense_Mutation	SNP	5020794	5020794	KCNA1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7923	133
C12orf63	374467	broad.mit.edu	37	12	97085019	97085019	+	Silent	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97085019C>T	uc001tet.1	+	11	1548	c.1470C>T	c.(1468-1470)GAC>GAT	p.D490D		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	490										skin(6)|ovary(1)	7						ACAGGGCTGACATTTGCTCTG	0.358																0.136364	4.408686	7.226816	3	19	KEEP	---	---	---	---	3	0	7	13	-1	capture	Silent	SNP	97085019	97085019	C12orf63	12	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	1692	133
PCDH20	64881	broad.mit.edu	37	13	61986212	61986212	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:61986212C>G	uc001vid.3	-	2	2384	c.2020G>C	c.(2020-2022)GTC>CTC	p.V674L	PCDH20_uc010thj.1_Missense_Mutation_p.V674L	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	647	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GAGAGGGCGACCCATCCATTT	0.458																0.123596	15.04356	27.457117	11	78	KEEP	---	---	---	---	9	3	41	40	-1	capture	Missense_Mutation	SNP	61986212	61986212	PCDH20	13	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	11418	133
LRFN5	145581	broad.mit.edu	37	14	42355895	42355895	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42355895C>T	uc001wvm.2	+	3	1265	c.67C>T	c.(67-69)CGT>TGT	p.R23C	LRFN5_uc010ana.2_Missense_Mutation_p.R23C	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	23	Extracellular (Potential).|LRRNT.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTGTCCAAAGCGTTGTGTCTG	0.398													HNSCC(30;0.082)			0.176471	11.533312	14.884292	6	28	KEEP	---	---	---	---	6	0	11	20	-1	capture	Missense_Mutation	SNP	42355895	42355895	LRFN5	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8857	133
GPR65	8477	broad.mit.edu	37	14	88478097	88478097	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88478097G>A	uc001xvv.2	+	2	1436	c.906G>A	c.(904-906)TGG>TGA	p.W302*		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	302	Cytoplasmic (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						ATGATATGTGGAATATATTAA	0.343																0.242424	20.082343	22.079621	8	25	KEEP	---	---	---	---	4	5	14	14	-1	capture	Nonsense_Mutation	SNP	88478097	88478097	GPR65	14	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	6639	133
IGF1R	3480	broad.mit.edu	37	15	99454571	99454571	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99454571C>G	uc002bul.2	+	7	1540	c.1490C>G	c.(1489-1491)TCC>TGC	p.S497C	IGF1R_uc010urq.1_Missense_Mutation_p.S497C|IGF1R_uc010bon.2_Missense_Mutation_p.S497C|IGF1R_uc010urr.1_5'UTR	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	497	Fibronectin type-III 1.				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CATTTCACCTCCACCACCACG	0.522					471											0.147541	18.733737	26.011006	9	52	KEEP	---	---	---	---	4	6	29	25	-1	capture	Missense_Mutation	SNP	99454571	99454571	IGF1R	15	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	7496	133
LRRK1	79705	broad.mit.edu	37	15	101595206	101595206	+	Silent	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101595206C>T	uc002bwr.2	+	27	4429	c.4110C>T	c.(4108-4110)ATC>ATT	p.I1370I	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1370	Protein kinase.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCTACCAGATCGCCTCGGGCC	0.438					1100											0.142857	28.97723	44.45533	18	108	KEEP	---	---	---	---	11	10	49	77	-1	capture	Silent	SNP	101595206	101595206	LRRK1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	8947	133
JMJD5	79831	broad.mit.edu	37	16	27225037	27225037	+	Silent	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27225037C>T	uc002doh.2	+	3	812	c.630C>T	c.(628-630)GGC>GGT	p.G210G	JMJD5_uc010vcn.1_Silent_p.G248G|JMJD5_uc010bxw.2_Intron|JMJD5_uc010bxx.2_5'Flank	NM_024773	NP_079049	Q8N371	KDM8_HUMAN	jumonji domain containing 5 isoform 2	210					G2/M transition of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|histone demethylase activity (H3-K36 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(2)|upper_aerodigestive_tract(1)	3						TCCTGAAAGGCGTGGCTGACC	0.582																0.095238	3.359301	17.157882	8	76	KEEP	---	---	---	---	7	2	37	49	-1	capture	Silent	SNP	27225037	27225037	JMJD5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7875	133
CHST5	23563	broad.mit.edu	37	16	75564022	75564022	+	Silent	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75564022G>A	uc002fei.2	-	3	1656	c.261C>T	c.(259-261)GAC>GAT	p.D87D	CHST5_uc002fej.1_Silent_p.D93D	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	87	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GGTAGAAGACGTCGGGGTGCT	0.672																0.076923	-1.439895	8.089757	4	48	KEEP	---	---	---	---	0	4	16	37	-1	capture	Silent	SNP	75564022	75564022	CHST5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3372	133
KRTAP4-7	100132476	broad.mit.edu	37	17	39240819	39240819	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240819C>G	uc010wfn.1	+	1	361	c.361C>G	c.(361-363)CTG>GTG	p.L121V		NM_033061	NP_149050			keratin associated protein 4-7												0						ctgctgctgcCTGCGTCCAGT	0.313																0.333333	8.021548	8.24318	3	6	KEEP	---	---	---	---	4	1	3	3	-1	capture	Missense_Mutation	SNP	39240819	39240819	KRTAP4-7	17	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	8475	133
MED13	9969	broad.mit.edu	37	17	60107352	60107352	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60107352C>G	uc002izo.2	-	7	1109	c.1032G>C	c.(1030-1032)AAG>AAC	p.K344N	MED13_uc002izp.2_5'UTR	NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	344					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						ATTTGACCCACTTCTGGACAG	0.363																0.183333	26.701514	32.338841	11	49	KEEP	---	---	---	---	4	7	25	27	-1	capture	Missense_Mutation	SNP	60107352	60107352	MED13	17	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	9343	133
LAMA1	284217	broad.mit.edu	37	18	7011417	7011417	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7011417G>A	uc002knm.2	-	25	3663	c.3569C>T	c.(3568-3570)ACG>ATG	p.T1190M	LAMA1_uc010wzj.1_Missense_Mutation_p.T666M	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1190	Laminin IV type A 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCCCTCGGTCGTGCCCCTCAA	0.597					1597											0.26087	14.640891	15.83055	6	17	KEEP	---	---	---	---	3	3	10	10	-1	capture	Missense_Mutation	SNP	7011417	7011417	LAMA1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8525	133
MUC16	94025	broad.mit.edu	37	19	9088981	9088981	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9088981G>A	uc002mkp.2	-	1	3038	c.2834C>T	c.(2833-2835)ACG>ATG	p.T945M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	945	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATTGTTGCCGTCCCAGTGAG	0.478																0.134078	32.270337	55.528188	24	155	KEEP	---	---	---	---	8	16	70	88	-1	capture	Missense_Mutation	SNP	9088981	9088981	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9883	133
FCGBP	8857	broad.mit.edu	37	19	40376645	40376645	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40376645T>G	uc002omp.3	-	24	11785	c.11777A>C	c.(11776-11778)AAT>ACT	p.N3926T		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3926						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GAAAGTTTCATTCCTCCAGGG	0.627																0.038961	-31.117765	21.884237	9	222	KEEP	---	---	---	---	4	5	113	171	-1	capture	Missense_Mutation	SNP	40376645	40376645	FCGBP	19	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	5724	133
APOB	338	broad.mit.edu	37	2	21238335	21238335	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21238335C>T	uc002red.2	-	22	3543	c.3415G>A	c.(3415-3417)GCC>ACC	p.A1139T		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1139					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GACCAGTGGGCGAGGATCTCA	0.463																0.073529	-1.550542	11.134715	5	63	KEEP	---	---	---	---	2	3	41	28	-1	capture	Missense_Mutation	SNP	21238335	21238335	APOB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	778	133
SDPR	8436	broad.mit.edu	37	2	192711670	192711670	+	Translation_Start_Site	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192711670G>A	uc002utb.2	-	1	312	c.-18C>T	c.(-20--16)AACGT>AATGT			NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein							caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)	AGGTGGGAACGTTCTTTCTCT	0.617																0.070423	-3.380723	10.137434	5	66	KEEP	---	---	---	---	4	1	42	34	-1	capture	Translation_Start_Site	SNP	192711670	192711670	SDPR	2	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	13863	133
PFKL	5211	broad.mit.edu	37	21	45732952	45732952	+	Silent	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45732952C>T	uc002zel.2	+	5	578	c.519C>T	c.(517-519)GAC>GAT	p.D173D	PFKL_uc002zek.2_Silent_p.D220D|PFKL_uc011afd.1_Silent_p.D220D	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	173					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		GCGGCACCGACATGACCATCG	0.632																0.055901	-18.792743	14.838805	9	152	KEEP	---	---	---	---	4	6	77	94	-1	capture	Silent	SNP	45732952	45732952	PFKL	21	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	11667	133
PARVB	29780	broad.mit.edu	37	22	44536022	44536022	+	Silent	SNP	C	T	T	rs149571024		TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44536022C>T	uc003ben.2	+	8	763	c.711C>T	c.(709-711)TTC>TTT	p.F237F	PARVB_uc003bem.2_Silent_p.F270F|PARVB_uc010gzn.2_Silent_p.F185F|PARVB_uc003beo.2_Silent_p.F200F	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b	237					cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				TGGGCCGGTTCGGTAAGTAAC	0.532																0.146497	38.435323	57.279812	23	134	KEEP	---	---	---	---	15	10	74	81	-1	capture	Silent	SNP	44536022	44536022	PARVB	22	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	11372	133
UNC5C	8633	broad.mit.edu	37	4	96127874	96127874	+	Missense_Mutation	SNP	G	A	A	rs139568380	byFrequency	TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96127874G>A	uc003htp.1	-	11	1961	c.1807C>T	c.(1807-1809)CGC>TGC	p.R603C	UNC5C_uc010ilc.1_Missense_Mutation_p.R622C	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	603	Cytoplasmic (Potential).|ZU5.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ACGACTGGGCGGGTGAGCAGA	0.582																0.1375	20.368938	30.539108	11	69	KEEP	---	---	---	---	3	9	29	44	-1	capture	Missense_Mutation	SNP	96127874	96127874	UNC5C	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16875	133
AHRR	57491	broad.mit.edu	37	5	422882	422882	+	Silent	SNP	C	T	T	rs2671894	byFrequency;by1000genomes	TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:422882C>T	uc003jav.2	+	6	536	c.492C>T	c.(490-492)CAC>CAT	p.H164H	AHRR_uc003jaw.2_Silent_p.H160H|AHRR_uc010isy.2_Silent_p.H10H|AHRR_uc010isz.2_Silent_p.H160H|AHRR_uc003jax.2_Translation_Start_Site|AHRR_uc003jay.2_Silent_p.H20H	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	164	PAS.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			ACTACATCCACGTGGACGACC	0.547																0.057471	-7.491671	10.381346	5	82	KEEP	---	---	---	---	3	3	38	50	-1	capture	Silent	SNP	422882	422882	AHRR	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	417	133
HCN1	348980	broad.mit.edu	37	5	45262241	45262241	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262241C>T	uc003jok.2	-	8	2480	c.2455G>A	c.(2455-2457)GTG>ATG	p.V819M		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	819	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACCGCCGTCACGGGTTGAGGG	0.677																0.140845	13.900453	22.747763	10	61	KEEP	---	---	---	---	8	6	28	36	-1	capture	Missense_Mutation	SNP	45262241	45262241	HCN1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6922	133
DMGDH	29958	broad.mit.edu	37	5	78326739	78326739	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:78326739G>T	uc003kfs.2	-	10	1606	c.1600C>A	c.(1600-1602)CTA>ATA	p.L534I	DMGDH_uc011cte.1_Missense_Mutation_p.L384I|DMGDH_uc011ctf.1_Missense_Mutation_p.L333I|DMGDH_uc011ctg.1_Missense_Mutation_p.L154I	NM_013391	NP_037523	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase precursor	534					choline metabolic process|glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|dimethylglycine dehydrogenase activity|electron carrier activity			ovary(2)|liver(1)|skin(1)	4		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AATGGTGATAGGTCAGTTACC	0.433																0.148148	12.962012	19.382418	8	46	KEEP	---	---	---	---	4	4	23	24	0.5	capture	Missense_Mutation	SNP	78326739	78326739	DMGDH	5	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	4539	133
LAMA2	3908	broad.mit.edu	37	6	129823804	129823804	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129823804G>A	uc003qbn.2	+	58	8350	c.8245G>A	c.(8245-8247)GGT>AGT	p.G2749S	LAMA2_uc003qbo.2_Missense_Mutation_p.G2745S|uc003qbq.2_RNA	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2749					cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TATTTTACAGGGTCCTTGTGC	0.388																0.078947	-0.107013	6.77532	3	35	KEEP	---	---	---	---	1	2	24	15	-1	capture	Missense_Mutation	SNP	129823804	129823804	LAMA2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	8526	133
PHACTR2	9749	broad.mit.edu	37	6	144086812	144086812	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:144086812T>C	uc003qjq.3	+	6	1206	c.1076T>C	c.(1075-1077)GTT>GCT	p.V359A	PHACTR2_uc010khh.2_Missense_Mutation_p.V279A|PHACTR2_uc010khi.2_Missense_Mutation_p.V370A|PHACTR2_uc003qjr.3_Missense_Mutation_p.V290A	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	359							actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		CTCGTCAGCGTTGGAGCTGAC	0.582	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)															0.134615	26.079748	39.541268	14	90	KEEP	---	---	---	---	5	9	48	47	-1	capture	Missense_Mutation	SNP	144086812	144086812	PHACTR2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	11713	133
SERAC1	84947	broad.mit.edu	37	6	158579375	158579375	+	Silent	SNP	G	A	A	rs139301835	byFrequency	TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158579375G>A	uc003qrc.2	-	2	163	c.21C>T	c.(19-21)TGC>TGT	p.C7C	SERAC1_uc003qrb.2_5'UTR	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1	7					GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		AACAGATGACGCAATAAGCAG	0.358																0.147059	8.450711	12.521035	5	29	KEEP	---	---	---	---	5	2	19	14	-1	capture	Silent	SNP	158579375	158579375	SERAC1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13967	133
PCLO	27445	broad.mit.edu	37	7	82579939	82579939	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82579939G>T	uc003uhx.2	-	6	10254	c.9965C>A	c.(9964-9966)CCT>CAT	p.P3322H	PCLO_uc003uhv.2_Missense_Mutation_p.P3322H|PCLO_uc010lec.2_Missense_Mutation_p.P287H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3253					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGTTCCAGAAGGGTCATAGTT	0.478																0.078571	-3.77318	21.649204	11	129	KEEP	---	---	---	---	5	6	70	73	0.454545454545	capture	Missense_Mutation	SNP	82579939	82579939	PCLO	7	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	11486	133
EPHB4	2050	broad.mit.edu	37	7	100411279	100411279	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100411279C>T	uc003uwn.1	-	10	2242	c.1751G>A	c.(1750-1752)GGA>GAA	p.G584E	EPHB4_uc003uwm.1_Missense_Mutation_p.G491E|EPHB4_uc010lhj.1_Missense_Mutation_p.G584E	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	584	Cytoplasmic (Potential).				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCACCATGTCCGATGAGATA	0.343	GBM(200;2113 3072 25865 52728)				223											0.085106	21.218326	152.516802	64	688	KEEP	---	---	---	---	35	42	341	465	-1	capture	Missense_Mutation	SNP	100411279	100411279	EPHB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5132	133
CADPS2	93664	broad.mit.edu	37	7	121960313	121960313	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121960313C>T	uc010lkp.2	-	29	3960	c.3797G>A	c.(3796-3798)CGT>CAT	p.R1266H	CADPS2_uc011knx.1_Missense_Mutation_p.R641H|CADPS2_uc003vkg.3_Missense_Mutation_p.R920H|CADPS2_uc010lkq.2_Missense_Mutation_p.R1225H	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	1266					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TACTGTTAAACGTCTGTGCAC	0.433																0.145631	23.553609	35.996006	15	88	KEEP	---	---	---	---	4	12	36	58	-1	capture	Missense_Mutation	SNP	121960313	121960313	CADPS2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2547	133
FREM1	158326	broad.mit.edu	37	9	14824887	14824887	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14824887G>C	uc003zlm.2	-	11	2575	c.1985C>G	c.(1984-1986)ACT>AGT	p.T662S	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	662	CSPG 4.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		CTGTTTCTTAGTTATATAGGC	0.428																0.294118	16.268176	16.91306	5	12	KEEP	---	---	---	---	1	4	4	9	-1	capture	Missense_Mutation	SNP	14824887	14824887	FREM1	9	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	5987	133
CRB2	286204	broad.mit.edu	37	9	126136965	126136965	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:126136965C>T	uc004bnx.1	+	11	3589	c.3497C>T	c.(3496-3498)GCT>GTT	p.A1166V		NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN	crumbs homolog 2 precursor	1166	Extracellular (Potential).|EGF-like 14.					extracellular region|integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GAGGGTCTTGCTGGCCAGAGG	0.657																0.046875	-7.132222	6.874508	3	61	KEEP	---	---	---	---	0	4	29	35	-1	capture	Missense_Mutation	SNP	126136965	126136965	CRB2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	3814	133
GATA1	2623	broad.mit.edu	37	X	48650419	48650419	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48650419C>A	uc004dkq.3	+	3	480	c.389C>A	c.(388-390)ACC>AAC	p.T130N		NM_002049	NP_002040	P15976	GATA1_HUMAN	GATA binding protein 1	130					basophil differentiation|eosinophil differentiation|erythrocyte development|megakaryocyte differentiation|platelet aggregation|platelet formation|positive regulation of anti-apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|regulation of glycoprotein biosynthetic process|transcription from RNA polymerase II promoter	nuclear membrane|nucleolus|nucleoplasm	C2H2 zinc finger domain binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.?(2)|p.V74_C199del(1)		haematopoietic_and_lymphoid_tissue(246)|lung(2)	248						AAAGGCAGCACCAGCTTCCTG	0.602	Pancreas(9;429 505 11287 29617)				37	Mis|F		megakaryoblastic leukemia of Downs Syndrome								0.163934	19.714104	26.25526	10	51	KEEP	---	---	---	---	6	5	23	33	0.454545454545	capture	Missense_Mutation	SNP	48650419	48650419	GATA1	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	6193	133
ACTRT1	139741	broad.mit.edu	37	X	127185485	127185485	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:127185485C>T	uc004eum.2	-	1	898	c.701G>A	c.(700-702)CGG>CAG	p.R234Q		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	234						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						GACCTCTCCCCGGCTCTTGCG	0.507																0.288288	86.65686	91.116545	32	79	KEEP	---	---	---	---	16	19	35	55	-1	capture	Missense_Mutation	SNP	127185485	127185485	ACTRT1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	218	133
ALS2CR11	151254	broad.mit.edu	37	2	202483659	202483659	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202483659delG	uc002uye.2	-	1	243	c.195delC	c.(193-195)AACfs	p.N65fs	ALS2CR11_uc002uyf.2_Frame_Shift_Del_p.N65fs|ALS2CR11_uc010fti.2_Frame_Shift_Del_p.N65fs	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	65										large_intestine(1)|ovary(1)|skin(1)	3						CCTGGTTCTTGTTCTTAGGCA	0.657																0.16			18	98		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	202483659	202483659	ALS2CR11	2	G	-	-	-	1	0	1	0	1	0	0	0	0	620	48	5	5	552	133
CARD6	84674	broad.mit.edu	37	5	40853877	40853877	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40853877delT	uc003jmg.2	+	3	2518	c.2443delT	c.(2443-2445)TTTfs	p.F815fs		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	815					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						GAATGGAACATTTGGGAGACT	0.453																0.12			83	592		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	40853877	40853877	CARD6	5	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	2626	133
GCNT2	2651	broad.mit.edu	37	6	10529185	10529186	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-14-0781-01	TCGA-14-0781-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:10529185_10529186delTT	uc010joo.2	+	3	592_593	c.41_42delTT	c.(40-42)CTTfs	p.L14fs	GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Frame_Shift_Del_p.L13fs|GCNT2_uc010jon.2_Frame_Shift_Del_p.L13fs	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,	14	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AGCGCGTCTCTTATCTCTGCCC	0.401					312											0.13			23	158		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	10529185	10529186	GCNT2	6	TT	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	6241	133
