Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MASP2	10747	broad.mit.edu	37	1	11107017	11107017	+	Silent	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11107017G>A	uc001aru.2	-	2	186	c.165C>T	c.(163-165)TAC>TAT	p.Y55Y	MASP2_uc001arv.2_Silent_p.Y55Y|MASP2_uc001arw.2_Silent_p.Y55Y|MASP2_uc001arx.1_Silent_p.Y55Y	NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform	55	CUB 1.				complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		GGCGCAGGCGGTAGCCGGGGG	0.657	GBM(35;611 746 20780 22741 36496)															0.5	20.223933	20.223933	7	7	KEEP	---	---	---	---	4	3	7	2	-1	capture	Silent	SNP	11107017	11107017	MASP2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	9236	138
ZNF362	149076	broad.mit.edu	37	1	33745906	33745906	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33745906G>C	uc001bxc.1	+	5	701	c.531G>C	c.(529-531)AAG>AAC	p.K177N		NM_152493	NP_689706	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	177					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACTCCATCAAGACAATCCAGG	0.667	Pancreas(162;1431 2676 35353 38425)															0.297297	106.73294	110.809655	33	78	KEEP	---	---	---	---	10	27	37	49	-1	capture	Missense_Mutation	SNP	33745906	33745906	ZNF362	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	17748	138
KLF17	128209	broad.mit.edu	37	1	44595485	44595485	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44595485G>A	uc001clp.2	+	2	600	c.542G>A	c.(541-543)GGC>GAC	p.G181D	KLF17_uc009vxf.1_Missense_Mutation_p.G144D	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	181					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					CCTTACCCTGGCCTCTCGACA	0.597																0.375	101.07032	102.388913	36	60	KEEP	---	---	---	---	20	20	32	37	-1	capture	Missense_Mutation	SNP	44595485	44595485	KLF17	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8266	138
LRRC7	57554	broad.mit.edu	37	1	70489054	70489054	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70489054A>T	uc001dep.2	+	15	1707	c.1677A>T	c.(1675-1677)AGA>AGT	p.R559S	LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	559						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TAAGTGGCAGACAGGTAGGCC	0.507					783											0.356643	143.180456	145.771015	51	92	KEEP	---	---	---	---	24	36	60	47	-1	capture	Missense_Mutation	SNP	70489054	70489054	LRRC7	1	A	T	T	T	1	0	0	0	0	1	0	0	0	128	10	4	4	8935	138
NEGR1	257194	broad.mit.edu	37	1	72400892	72400892	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:72400892A>C	uc001dfw.2	-	2	379	c.279T>G	c.(277-279)ATT>ATG	p.I93M	NEGR1_uc001dfv.2_Translation_Start_Site|NEGR1_uc010oqs.1_Missense_Mutation_p.I93M	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	93	Ig-like C2-type 1.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TCAATGTTGAAATTGAAACTC	0.443																0.320312	129.432496	133.102643	41	87	KEEP	---	---	---	---	26	21	53	44	-1	capture	Missense_Mutation	SNP	72400892	72400892	NEGR1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	8	1	4	4	10224	138
MOV10	4343	broad.mit.edu	37	1	113232671	113232671	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:113232671G>A	uc001eck.2	+	5	1057	c.787G>A	c.(787-789)GGA>AGA	p.G263R	MOV10_uc001ecl.2_Missense_Mutation_p.G263R|MOV10_uc001ecn.2_Missense_Mutation_p.G263R|MOV10_uc001ecm.2_Missense_Mutation_p.G203R|MOV10_uc009wgj.1_Missense_Mutation_p.G203R	NM_001130079	NP_001123551	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	263					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CCGGATCACCGGAAACCCTGT	0.602																0.028902	-31.774778	10.456825	5	168	KEEP	---	---	---	---	2	4	98	95	-1	capture	Missense_Mutation	SNP	113232671	113232671	MOV10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9630	138
INSRR	3645	broad.mit.edu	37	1	156816384	156816384	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156816384C>T	uc010pht.1	-	8	1991	c.1737G>A	c.(1735-1737)ACG>ACA	p.T579T	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	579	Fibronectin type-III 1.				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGTGGTTAGCGTGATGGCCC	0.607					299											0.189873	30.080925	37.188085	15	64	KEEP	---	---	---	---	10	9	40	26	-1	capture	Silent	SNP	156816384	156816384	INSRR	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7697	138
OR10Z1	128368	broad.mit.edu	37	1	158576316	158576316	+	Silent	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158576316T>C	uc010pio.1	+	1	88	c.88T>C	c.(88-90)TTG>CTG	p.L30L		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	30	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					TCTCTTTGCCTTGTTCCTCTC	0.502																0.045833	-25.880287	26.963049	11	229	KEEP	---	---	---	---	7	4	157	89	-1	capture	Silent	SNP	158576316	158576316	OR10Z1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	10827	138
ATF6	22926	broad.mit.edu	37	1	161816315	161816315	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161816315T>C	uc001gbr.2	+	10	1331	c.1264T>C	c.(1264-1266)TCT>CCT	p.S422P	ATF6_uc001gbq.1_Missense_Mutation_p.S422P	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6	422	Lumenal (Potential).				positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			TCTAGGATTTTCTGCTAAAGA	0.403																0.021127	-29.996263	6.420845	3	139	KEEP	---	---	---	---	1	3	75	73	-1	capture	Missense_Mutation	SNP	161816315	161816315	ATF6	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	1075	138
GORAB	92344	broad.mit.edu	37	1	170511696	170511696	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170511696C>T	uc001gha.2	+	3	586	c.559C>T	c.(559-561)CGT>TGT	p.R187C	GORAB_uc001ggz.3_Missense_Mutation_p.R187C|GORAB_uc009wvx.2_Missense_Mutation_p.R7C|GORAB_uc001ghb.2_Missense_Mutation_p.R7C|GORAB_uc001ghc.2_Missense_Mutation_p.R7C|GORAB_uc001ghd.2_5'Flank	NM_152281	NP_689494	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting isoform a	187	Potential.					Golgi apparatus|nucleus					0						GAAAAATAAACGTAAAAAAGC	0.398																0.303738	162.909924	170.260551	65	149	KEEP	---	---	---	---	44	27	95	66	-1	capture	Missense_Mutation	SNP	170511696	170511696	GORAB	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6508	138
PAPPA2	60676	broad.mit.edu	37	1	176526282	176526282	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:176526282G>A	uc001gkz.2	+	2	1988	c.824G>A	c.(823-825)CGT>CAT	p.R275H	PAPPA2_uc001gky.1_Missense_Mutation_p.R275H|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	275					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTGCTGCTGCGTCCAGAAGTG	0.577																0.134328	12.425442	21.117787	9	58	KEEP	---	---	---	---	5	8	36	37	-1	capture	Missense_Mutation	SNP	176526282	176526282	PAPPA2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11337	138
HMCN1	83872	broad.mit.edu	37	1	186062774	186062774	+	Missense_Mutation	SNP	G	A	A	rs143555094		TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186062774G>A	uc001grq.1	+	66	10398	c.10169G>A	c.(10168-10170)CGG>CAG	p.R3390Q		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3390	Ig-like C2-type 32.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TCCCATATCCGGTTACTGGCA	0.428																0.25	93.714607	101.420589	34	102	KEEP	---	---	---	---	25	16	66	59	-1	capture	Missense_Mutation	SNP	186062774	186062774	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7145	138
AVPR1B	553	broad.mit.edu	37	1	206224826	206224826	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:206224826C>T	uc001hds.2	+	1	544	c.386C>T	c.(385-387)ACG>ATG	p.T129M		NM_000707	NP_000698	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	129	Helical; Name=3; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity	p.T129M(1)		ovary(2)|large_intestine(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CTGGCCATGACGCTGGACCGC	0.657																0.465409	214.429728	214.595433	74	85	KEEP	---	---	---	---	35	46	44	47	-1	capture	Missense_Mutation	SNP	206224826	206224826	AVPR1B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1222	138
CD55	1604	broad.mit.edu	37	1	207500170	207500170	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207500170C>T	uc001hfq.3	+	5	946	c.652C>T	c.(652-654)CCA>TCA	p.P218S	CD55_uc001hfp.3_Missense_Mutation_p.P218S|CD55_uc001hfr.3_Missense_Mutation_p.P218S|CD55_uc010psf.1_RNA|CD55_uc009xcf.2_Missense_Mutation_p.P154S|CD55_uc009xce.2_Missense_Mutation_p.P218S|CD55_uc009xcg.2_5'UTR	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform	218	Sushi 3.				complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	TGACCCGTTGCCAGAGTGCAG	0.403																0.486486	399.438693	399.479907	126	133	KEEP	---	---	---	---	75	59	79	62	-1	capture	Missense_Mutation	SNP	207500170	207500170	CD55	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2995	138
SIPA1L2	57568	broad.mit.edu	37	1	232581433	232581433	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232581433C>T	uc001hvg.2	-	9	3353	c.3195G>A	c.(3193-3195)ACG>ACA	p.T1065T	SIPA1L2_uc001hvf.2_Silent_p.T139T	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1065					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCCGGTGCCACGTGGTGTTCC	0.642																0.521127	325.8874	325.976186	111	102	KEEP	---	---	---	---	80	40	63	45	-1	capture	Silent	SNP	232581433	232581433	SIPA1L2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	14223	138
OR2L13	284521	broad.mit.edu	37	1	248262881	248262881	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248262881G>T	uc001ids.2	+	3	541	c.204G>T	c.(202-204)ATG>ATT	p.M68I		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TCTCCCTTATGGACCTGATGT	0.547					85											0.304348	305.131476	317.718768	112	256	KEEP	---	---	---	---	68	52	152	126	0.566666666667	capture	Missense_Mutation	SNP	248262881	248262881	OR2L13	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	10910	138
OR2T4	127074	broad.mit.edu	37	1	248525679	248525679	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248525679G>A	uc001ieh.1	+	1	797	c.797G>A	c.(796-798)CGG>CAG	p.R266Q		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	266	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCAGAGGGCCGGAAAAAGGCC	0.547																0.268156	253.75244	271.116909	96	262	KEEP	---	---	---	---	40	59	151	145	-1	capture	Missense_Mutation	SNP	248525679	248525679	OR2T4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10931	138
GDF2	2658	broad.mit.edu	37	10	48413956	48413956	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48413956C>T	uc001jfa.1	-	2	1075	c.912G>A	c.(910-912)ACG>ACA	p.T304T		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	304					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						CGTGGCCATCCGTGTCCTCCT	0.607																0.688889	103.339256	104.768976	31	14	KEEP	---	---	---	---	20	18	13	11	-1	capture	Silent	SNP	48413956	48413956	GDF2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6254	138
A1CF	29974	broad.mit.edu	37	10	52566580	52566580	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:52566580G>T	uc001jjj.2	-	13	1882	c.1694C>A	c.(1693-1695)ACC>AAC	p.T565N	A1CF_uc010qhn.1_Missense_Mutation_p.T565N|A1CF_uc001jji.2_Missense_Mutation_p.T557N|A1CF_uc001jjh.2_Missense_Mutation_p.T565N|A1CF_uc010qho.1_Missense_Mutation_p.T573N|A1CF_uc009xov.2_Missense_Mutation_p.T557N	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	565					cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						TTGTCCAAGGGTTACCGCTTG	0.493																0.102041	9.174631	24.65037	10	88	KEEP	---	---	---	---	5	6	59	41	0.454545454545	capture	Missense_Mutation	SNP	52566580	52566580	A1CF	10	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	2	138
PTEN	5728	broad.mit.edu	37	10	89692883	89692883	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692883C>T	uc001kfb.2	+	6	1398	c.367C>T	c.(367-369)CAC>TAC	p.H123Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	123	Phosphatase tensin-type.		H -> R (in CD).|H -> Y (in endometrial cancer; loss of protein phosphatase activity).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.H123Y(4)|p.R55fs*1(4)|p.I122fs*2(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.A121_F145del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGCAGCAATTCACTGTAAAGC	0.398			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.496063	193.817533	193.819307	63	64	KEEP	---	---	---	---	41	34	37	38	-1	capture	Missense_Mutation	SNP	89692883	89692883	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12633	138
FAM178A	55719	broad.mit.edu	37	10	102676871	102676871	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102676871C>T	uc001krt.3	+	3	1271	c.729C>T	c.(727-729)TAC>TAT	p.Y243Y	FAM178A_uc001krr.1_Silent_p.Y243Y|FAM178A_uc001krs.2_Silent_p.Y243Y|FAM178A_uc001kru.1_Silent_p.Y179Y	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	243											0						TAGCTTCTTACTGCAGAGAAC	0.473																0.545455	113.295563	113.413224	36	30	KEEP	---	---	---	---	18	23	15	17	-1	capture	Silent	SNP	102676871	102676871	FAM178A	10	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	5456	138
PCGF6	84108	broad.mit.edu	37	10	105108477	105108477	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105108477T>C	uc001kwt.2	-	3	621	c.553A>G	c.(553-555)ATA>GTA	p.I185V	PCGF6_uc001kwu.2_Missense_Mutation_p.I185V|PCGF6_uc009xxk.2_RNA|PCGF6_uc009xxl.2_RNA|PCGF6_uc009xxm.2_RNA	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a	185					negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		TCTTACCTTATGTTATAAAGA	0.284																0.560606	130.684077	130.895482	37	29	KEEP	---	---	---	---	21	19	17	16	-1	capture	Missense_Mutation	SNP	105108477	105108477	PCGF6	10	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	11481	138
OR56B4	196335	broad.mit.edu	37	11	6129052	6129052	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6129052T>A	uc010qzx.1	+	1	44	c.44T>A	c.(43-45)ATT>AAT	p.I15N		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCCTCCAGATTTCCCAGTTC	0.493																0.333333	74.655258	76.49768	25	50	KEEP	---	---	---	---	16	13	33	29	-1	capture	Missense_Mutation	SNP	6129052	6129052	OR56B4	11	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	11042	138
QSER1	79832	broad.mit.edu	37	11	32954286	32954286	+	Silent	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32954286G>A	uc001mty.2	+	4	1362	c.1095G>A	c.(1093-1095)AAG>AAA	p.K365K	QSER1_uc001mtz.1_Intron|QSER1_uc001mua.2_5'Flank	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	365	Ser-rich.									ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					GGTCCAGCAAGGTTGAGAAAT	0.383																0.068	-6.341999	41.945399	17	233	KEEP	---	---	---	---	7	10	138	117	-1	capture	Silent	SNP	32954286	32954286	QSER1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	12777	138
OR5AR1	219493	broad.mit.edu	37	11	56431526	56431526	+	Missense_Mutation	SNP	G	A	A	rs143043362		TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431526G>A	uc010rjm.1	+	1	365	c.365G>A	c.(364-366)CGT>CAT	p.R122H		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCCTATGGTCGTTTTGTGGCC	0.512																0.395904	320.244425	322.982107	116	177	KEEP	---	---	---	---	76	48	135	70	-1	capture	Missense_Mutation	SNP	56431526	56431526	OR5AR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11049	138
PLAC1L	219990	broad.mit.edu	37	11	59807826	59807826	+	Translation_Start_Site	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59807826C>T	uc001nol.2	+	1	79	c.-106C>T	c.(-108--104)AACGA>AATGA			NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor							extracellular region				ovary(2)|skin(1)	3						AGGAGGAAAACGAACGCAGCT	0.463																0.428571	94.958933	95.302285	33	44	KEEP	---	---	---	---	16	17	24	23	-1	capture	Translation_Start_Site	SNP	59807826	59807826	PLAC1L	11	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	11916	138
MS4A14	84689	broad.mit.edu	37	11	60183888	60183888	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60183888T>A	uc001npj.2	+	5	2012	c.1447T>A	c.(1447-1449)TCA>ACA	p.S483T	MS4A14_uc001npi.2_Missense_Mutation_p.S371T|MS4A14_uc001npn.2_Missense_Mutation_p.S221T|MS4A14_uc001npk.2_Missense_Mutation_p.S466T|MS4A14_uc001npl.2_Missense_Mutation_p.S221T|MS4A14_uc001npm.2_Missense_Mutation_p.S221T	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	483	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						AAGAAAATCCTCAAGACGGCA	0.398																0.04908	-19.541349	15.670286	8	155	KEEP	---	---	---	---	4	5	63	100	-1	capture	Missense_Mutation	SNP	60183888	60183888	MS4A14	11	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	9768	138
AHNAK	79026	broad.mit.edu	37	11	62285625	62285625	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62285625C>T	uc001ntl.2	-	5	16564	c.16264G>A	c.(16264-16266)GTC>ATC	p.V5422I	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5422					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TTGGCATTGACGTGCAAGTCG	0.532																0.27381	120.978459	128.721454	46	122	KEEP	---	---	---	---	29	21	72	59	-1	capture	Missense_Mutation	SNP	62285625	62285625	AHNAK	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	414	138
DHH	50846	broad.mit.edu	37	12	49483743	49483743	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49483743G>A	uc001rtf.2	-	3	1397	c.1090C>T	c.(1090-1092)CAC>TAC	p.H364Y		NM_021044	NP_066382	O43323	DHH_HUMAN	desert hedgehog preproprotein	364					cell-cell signaling|proteolysis	extracellular space|plasma membrane	calcium ion binding|peptidase activity|zinc ion binding			lung(1)|breast(1)	2						CCTAGCGCGTGCAGCAGTCTC	0.667																0.466667	20.122502	20.137115	7	8	KEEP	---	---	---	---	2	5	3	6	-1	capture	Missense_Mutation	SNP	49483743	49483743	DHH	12	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4441	138
ACVRL1	94	broad.mit.edu	37	12	52312886	52312887	+	Missense_Mutation	DNP	TG	GT	GT			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52312886_52312887TG>GT	uc001rzj.2	+	9	1647_1648	c.1364_1365TG>GT	c.(1363-1365)CTG>CGT	p.L455R	ACVRL1_uc001rzk.2_Missense_Mutation_p.L455R|ACVRL1_uc010snm.1_Missense_Mutation_p.L281R	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	455	Cytoplasmic (Potential).|Protein kinase.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CCTAACCGGCTGGCTGCAGACC	0.599					321							Hereditary_Hemorrhagic_Telangiectasia				0.28169	53.759949	56.808452	20	51	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	52312886	52312887	ACVRL1	12	TG	GT	GT	GT	1	0	0	0	0	1	0	0	0	715	55	4	4	225	138
TPCN1	53373	broad.mit.edu	37	12	113730818	113730818	+	Silent	SNP	G	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113730818G>C	uc001tuw.2	+	26	2490	c.2193G>C	c.(2191-2193)CGG>CGC	p.R731R	TPCN1_uc001tux.2_Silent_p.R803R|TPCN1_uc010syu.1_5'Flank	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	731	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						GGGAGGCACGGGGGGCCTCCT	0.617																0.32	88.461008	91.341708	32	68	KEEP	---	---	---	---	16	19	36	36	-1	capture	Silent	SNP	113730818	113730818	TPCN1	12	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	16278	138
ORAI1	84876	broad.mit.edu	37	12	122079191	122079191	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122079191G>A	uc010szz.1	+	3	741	c.548G>A	c.(547-549)GGC>GAC	p.G183D		NM_032790	NP_116179	Q96D31	CRCM1_HUMAN	calcium release-activated calcium channel	183	Helical; (Potential).				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		ACCGTCATCGGCACGCTGCTC	0.637																0.040404	-14.883162	7.640565	4	95	KEEP	---	---	---	---	2	2	63	52	-1	capture	Missense_Mutation	SNP	122079191	122079191	ORAI1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11161	138
ENOX1	55068	broad.mit.edu	37	13	43935415	43935415	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:43935415T>C	uc001uza.3	-	6	682	c.382A>G	c.(382-384)AAT>GAT	p.N128D	ENOX1_uc001uzb.3_Missense_Mutation_p.N128D|ENOX1_uc001uzc.3_Missense_Mutation_p.N128D|ENOX1_uc010tfm.1_5'Flank	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	128	Pro-rich.				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		CGTTACTTACTTGGATTTTGA	0.378																0.071795	2.587093	39.411931	14	181	KEEP	---	---	---	---	14	0	120	75	-1	capture	Missense_Mutation	SNP	43935415	43935415	ENOX1	13	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	5081	138
PRKD1	5587	broad.mit.edu	37	14	30068325	30068325	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:30068325C>T	uc001wqh.2	-	15	2255	c.2074G>A	c.(2074-2076)GTG>ATG	p.V692M		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	692	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CGCAAAGCCACGAGTATCTGT	0.368					428											0.276923	48.828327	51.735519	18	47	KEEP	---	---	---	---	7	11	32	17	-1	capture	Missense_Mutation	SNP	30068325	30068325	PRKD1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12414	138
MKRN3	7681	broad.mit.edu	37	15	23811197	23811197	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23811197C>T	uc001ywh.3	+	1	744	c.268C>T	c.(268-270)CGA>TGA	p.R90*	MKRN3_uc001ywi.2_Nonsense_Mutation_p.R90*|MKRN3_uc010ayi.1_Nonsense_Mutation_p.R90*	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	90						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GTTGCCAAGCCGAAGCAGCGG	0.607					79											0.409091	143.263953	144.055445	45	65	KEEP	---	---	---	---	35	27	49	42	-1	capture	Nonsense_Mutation	SNP	23811197	23811197	MKRN3	15	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	9520	138
FBN1	2200	broad.mit.edu	37	15	48744871	48744871	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48744871C>A	uc001zwx.1	-	45	5761	c.5433G>T	c.(5431-5433)GAG>GAT	p.E1811D	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1811	EGF-like 30; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CGTTCTGACACTCGTCAATAT	0.488					2933											0.308411	92.131608	95.634003	33	74	KEEP	---	---	---	---	23	13	32	46	0.361111111111	capture	Missense_Mutation	SNP	48744871	48744871	FBN1	15	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	5648	138
VPS13C	54832	broad.mit.edu	37	15	62292774	62292774	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:62292774C>A	uc002agz.2	-	16	1416	c.1342G>T	c.(1342-1344)GCA>TCA	p.A448S	VPS13C_uc002aha.2_Missense_Mutation_p.A405S|VPS13C_uc002ahb.1_Missense_Mutation_p.A448S|VPS13C_uc002ahc.1_Missense_Mutation_p.A405S	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	448					protein localization					ovary(2)	2						TCAACTTGTGCTTGTTGCCTT	0.308																0.178571	10.356508	13.080624	5	23	KEEP	---	---	---	---	4	1	18	7	0.2	capture	Missense_Mutation	SNP	62292774	62292774	VPS13C	15	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	17073	138
TLN2	83660	broad.mit.edu	37	15	63058560	63058560	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63058560G>A	uc002alb.3	+	38	5135	c.5135G>A	c.(5134-5136)GGA>GAA	p.G1712E	TLN2_uc002alc.3_Missense_Mutation_p.G105E|TLN2_uc002ald.2_Missense_Mutation_p.G105E	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1712					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						CAGGAAATCGGACACCTTATC	0.572																0.26506	56.503735	60.587179	22	61	KEEP	---	---	---	---	14	16	37	45	-1	capture	Missense_Mutation	SNP	63058560	63058560	TLN2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	15833	138
SH3GL3	6457	broad.mit.edu	37	15	84245409	84245409	+	Silent	SNP	C	T	T	rs138675150	byFrequency	TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84245409C>T	uc002bjw.2	+	6	735	c.540C>T	c.(538-540)GAC>GAT	p.D180D	SH3GL3_uc010uot.1_Silent_p.D180D|SH3GL3_uc002bjx.2_Silent_p.D111D|SH3GL3_uc002bju.2_Silent_p.D188D|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	180	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						AGATACCAGACGAAGAAGTCA	0.383																0.272727	39.199788	41.761041	15	40	KEEP	---	---	---	---	5	11	34	13	-1	capture	Silent	SNP	84245409	84245409	SH3GL3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14145	138
CHD2	1106	broad.mit.edu	37	15	93563361	93563361	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:93563361G>A	uc002bsp.2	+	38	5601	c.5026G>A	c.(5026-5028)GGG>AGG	p.G1676R	CHD2_uc002bso.1_Missense_Mutation_p.G1676R	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1676					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CCACCATTATGGGGACCGGCG	0.527																0.189394	54.390628	66.308108	25	107	KEEP	---	---	---	---	16	15	55	65	-1	capture	Missense_Mutation	SNP	93563361	93563361	CHD2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	3291	138
IL4R	3566	broad.mit.edu	37	16	27363945	27363945	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27363945C>T	uc002don.2	+	7	840	c.598C>T	c.(598-600)CGG>TGG	p.R200W	IL4R_uc002dom.2_Missense_Mutation_p.R200W|IL4R_uc002dop.3_Missense_Mutation_p.R185W|IL4R_uc010bxy.2_Missense_Mutation_p.R200W|IL4R_uc002doo.2_Missense_Mutation_p.R40W	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	200	Extracellular (Potential).|Fibronectin type-III.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CTACAGGGCACGGGTGAGGGC	0.552																0.506849	226.44909	226.455064	74	72	KEEP	---	---	---	---	36	45	34	47	-1	capture	Missense_Mutation	SNP	27363945	27363945	IL4R	16	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	7621	138
PLCG2	5336	broad.mit.edu	37	16	81954828	81954828	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81954828A>C	uc002fgt.2	+	21	2413	c.2261A>C	c.(2260-2262)GAC>GCC	p.D754A	PLCG2_uc010chg.1_Missense_Mutation_p.D754A	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	754					intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCCCTCTACGACGTCAGCAGA	0.428					1880											0.481481	91.946481	91.962609	26	28	KEEP	---	---	---	---	17	14	19	13	-1	capture	Missense_Mutation	SNP	81954828	81954828	PLCG2	16	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	11939	138
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557	Pancreas(47;798 1329 9957 10801)		111	p.R282G(NCIH510-Tumor)|p.R282W(HUPT3-Tumor)|p.V274fs(SCC9-Tumor)|p.R282W(CAL29-Tumor)|p.R282W(EFE184-Tumor)|p.R282W(OVKATE-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.337349	83.272846	85.21571	28	55	KEEP	---	---	---	---	25	8	35	23	-1	capture	Missense_Mutation	SNP	7577094	7577094	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	138
TRIM16	10626	broad.mit.edu	37	17	15517208	15517208	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:15517208C>T	uc002gor.1	-	9	2077	c.1740G>A	c.(1738-1740)GGG>GGA	p.G580G	CDRT1_uc002gov.3_Silent_p.G270G			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;	Error:Variant_position_missing_in_O95361_after_alignment					histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		ATTTGCTGAACCCAGAAGACA	0.488																0.526718	209.470742	209.551714	69	62	KEEP	---	---	---	---	51	51	106	104	-1	capture	Silent	SNP	15517208	15517208	TRIM16	17	C	T	T	T	1	0	0	0	0	0	0	0	1	223	18	2	2	16374	138
RBBP8	5932	broad.mit.edu	37	18	20573449	20573449	+	Silent	SNP	C	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20573449C>G	uc002ktw.2	+	11	1990	c.1659C>G	c.(1657-1659)CCC>CCG	p.P553P	RBBP8_uc002kty.2_Silent_p.P553P|RBBP8_uc002ktz.2_Silent_p.P553P|RBBP8_uc002kua.2_Silent_p.P553P|RBBP8_uc010xap.1_5'Flank|RBBP8_uc002ktx.1_Silent_p.P553P	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	553					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			CAGGGGAGCCCTGTTCACAGG	0.438					470						Direct_reversal_of_damage|Homologous_recombination					0.352	126.656176	129.073679	44	81	KEEP	---	---	---	---	23	22	36	51	-1	capture	Silent	SNP	20573449	20573449	RBBP8	18	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	13000	138
PSMA8	143471	broad.mit.edu	37	18	23738210	23738210	+	Splice_Site	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:23738210T>A	uc002kvq.2	+	4	609	c.495_splice	c.e4+2	p.K165_splice	PSMA8_uc002kvo.2_Splice_Site_p.K121_splice|PSMA8_uc002kvp.2_Splice_Site_p.K159_splice|PSMA8_uc002kvr.2_Splice_Site_p.K133_splice	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			GCTTGGAAGGTGAGTCATGAA	0.299																0.377863	313.672748	317.09841	99	163	KEEP	---	---	---	---	63	41	91	94	-1	capture	Splice_Site	SNP	23738210	23738210	PSMA8	18	T	A	A	A	1	0	0	0	0	0	0	1	0	767	59	5	4	12568	138
SERPINB3	6317	broad.mit.edu	37	18	61323223	61323223	+	Missense_Mutation	SNP	C	T	T	rs143634391		TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61323223C>T	uc002lji.2	-	8	985	c.841G>A	c.(841-843)GAT>AAT	p.D281N	SERPINB4_uc002ljg.2_Intron|SERPINB3_uc010dqa.2_Missense_Mutation_p.D229N	NM_006919	NP_008850	P29508	SPB3_HUMAN	serine (or cysteine) proteinase inhibitor, clade	281					regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						AAGTGTAAATCGACACGTGTC	0.418																0.241611	89.761376	98.811269	36	113	KEEP	---	---	---	---	27	13	71	49	-1	capture	Missense_Mutation	SNP	61323223	61323223	SERPINB3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13995	138
FARSA	2193	broad.mit.edu	37	19	13041262	13041262	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13041262C>T	uc002mvs.2	-	3	413	c.365G>A	c.(364-366)GGG>GAG	p.G122E	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Missense_Mutation_p.G122E|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	122					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	CACCCGGGGCCCGTCAGCCGC	0.637																0.25641	102.419822	110.758311	40	116	KEEP	---	---	---	---	22	28	72	66	-1	capture	Missense_Mutation	SNP	13041262	13041262	FARSA	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5625	138
ZNF681	148213	broad.mit.edu	37	19	23927229	23927229	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23927229A>C	uc002nrk.3	-	4	1265	c.1123T>G	c.(1123-1125)TTT>GTT	p.F375V	ZNF681_uc002nrl.3_Missense_Mutation_p.F306V|ZNF681_uc002nrj.3_Missense_Mutation_p.F306V	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	375	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GACTGCCTAAAGGCTTTGCCA	0.413																0.311881	186.164562	192.522115	63	139	KEEP	---	---	---	---	41	28	86	59	-1	capture	Missense_Mutation	SNP	23927229	23927229	ZNF681	19	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	17966	138
ZNF569	148266	broad.mit.edu	37	19	37905163	37905163	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37905163T>C	uc002ogi.2	-	6	955	c.397A>G	c.(397-399)AGA>GGA	p.R133G	ZNF569_uc002ogh.2_5'UTR|ZNF569_uc002ogj.2_Missense_Mutation_p.R157G	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	133					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGATTGTGTCTGGAAGGGAAA	0.323																0.454545	183.413358	183.63093	55	66	KEEP	---	---	---	---	30	30	37	37	-1	capture	Missense_Mutation	SNP	37905163	37905163	ZNF569	19	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	17879	138
PRX	57716	broad.mit.edu	37	19	40903183	40903183	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40903183C>T	uc002onr.2	-	7	1345	c.1076G>A	c.(1075-1077)CGC>CAC	p.R359H	PRX_uc002onq.2_Missense_Mutation_p.R220H|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	359					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAAACTAAGGCGGGGCATCTT	0.637																0.373016	131.671789	133.463074	47	79	KEEP	---	---	---	---	23	27	37	51	-1	capture	Missense_Mutation	SNP	40903183	40903183	PRX	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12537	138
SIGLEC8	27181	broad.mit.edu	37	19	51960834	51960834	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51960834C>T	uc002pwt.2	-	2	681	c.614G>A	c.(613-615)CGC>CAC	p.R205H	SIGLEC8_uc010yda.1_Intron|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Intron	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	205	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CACTGAGGAGCGGGCAGTAGT	0.652																0.396396	120.367941	121.412544	44	67	KEEP	---	---	---	---	25	24	44	31	-1	capture	Missense_Mutation	SNP	51960834	51960834	SIGLEC8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14207	138
NLRP7	199713	broad.mit.edu	37	19	55451643	55451643	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55451643C>T	uc002qih.3	-	4	620	c.544G>A	c.(544-546)GTG>ATG	p.V182M	NLRP7_uc002qig.3_Missense_Mutation_p.V182M|NLRP7_uc002qii.3_Missense_Mutation_p.V182M|NLRP7_uc010esk.2_Missense_Mutation_p.V182M|NLRP7_uc010esl.2_Missense_Mutation_p.V210M	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	182	NACHT.|ATP (Potential).						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		GTTTTCCCCACGCCTGCGGGG	0.562																0.33617	209.136857	214.724527	79	156	KEEP	---	---	---	---	52	29	94	65	-1	capture	Missense_Mutation	SNP	55451643	55451643	NLRP7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10389	138
USP29	57663	broad.mit.edu	37	19	57641754	57641754	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57641754T>A	uc002qny.2	+	4	2067	c.1711T>A	c.(1711-1713)TCT>ACT	p.S571T		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	571					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGAGATGATTTCTGAGATCAA	0.468																0.263158	134.924799	145.532051	55	154	KEEP	---	---	---	---	28	30	80	80	-1	capture	Missense_Mutation	SNP	57641754	57641754	USP29	19	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	16941	138
NBAS	51594	broad.mit.edu	37	2	15417158	15417158	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:15417158G>T	uc002rcc.1	-	43	5232	c.5206C>A	c.(5206-5208)CCA>ACA	p.P1736T	NBAS_uc010exl.1_Missense_Mutation_p.P808T|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1736										ovary(2)|liver(1)|skin(1)	4						AAGGCTTCTGGATCAGTCTTC	0.398																0.271429	46.09135	49.391999	19	51	KEEP	---	---	---	---	12	9	27	26	0.571428571429	capture	Missense_Mutation	SNP	15417158	15417158	NBAS	2	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	10093	138
ASXL2	55252	broad.mit.edu	37	2	25965918	25965918	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25965918C>T	uc002rgs.2	-	12	3509	c.3288G>A	c.(3286-3288)CAG>CAA	p.Q1096Q	ASXL2_uc002rgt.1_Silent_p.Q579Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1096					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTCTTCCAGCTGGAAACCTG	0.493																0.3	172.341971	179.47806	60	140	KEEP	---	---	---	---	37	24	96	55	-1	capture	Silent	SNP	25965918	25965918	ASXL2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	1058	138
IL18R1	8809	broad.mit.edu	37	2	102984390	102984390	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102984390G>T	uc002tbw.3	+	3	314	c.164G>T	c.(163-165)AGC>ATC	p.S55I	IL18R1_uc010ywb.1_Missense_Mutation_p.S55I|IL18R1_uc010ywc.1_Missense_Mutation_p.S55I|IL18R1_uc010ywd.1_Intron|IL18R1_uc010fiy.2_Missense_Mutation_p.S55I	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor	55	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						ACCACCAAAAGCTGGTACAAA	0.448																0.396226	123.524075	124.5242	42	64	KEEP	---	---	---	---	31	11	36	30	0.738095238095	capture	Missense_Mutation	SNP	102984390	102984390	IL18R1	2	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	7570	138
SCN7A	6332	broad.mit.edu	37	2	167263066	167263066	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167263066C>T	uc002udu.1	-	25	4200	c.4073G>A	c.(4072-4074)CGT>CAT	p.R1358H		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1358	Helical; Voltage-sensor; Name=S4 of repeat IV; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TTTTCCAAGACGCAGCATGTG	0.468																0.376712	159.286493	161.235226	55	91	KEEP	---	---	---	---	34	26	58	39	-1	capture	Missense_Mutation	SNP	167263066	167263066	SCN7A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13816	138
ITGA6	3655	broad.mit.edu	37	2	173338970	173338970	+	Silent	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:173338970G>A	uc002uhp.1	+	6	1166	c.963G>A	c.(961-963)GCG>GCA	p.A321A	ITGA6_uc010fqk.1_Silent_p.A207A|ITGA6_uc010zdy.1_Silent_p.A202A|ITGA6_uc002uho.1_Silent_p.A321A|ITGA6_uc010fqm.1_5'Flank	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	360	FG-GAP 5.|Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			ATGATGTGGCGGTGGTGGACC	0.483																0.367647	79.159462	80.205782	25	43	KEEP	---	---	---	---	16	10	30	21	-1	capture	Silent	SNP	173338970	173338970	ITGA6	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7803	138
TTN	7273	broad.mit.edu	37	2	179528769	179528769	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179528769T>G	uc010zfk.1	-	14	1323	c.775A>C	c.(775-777)AAA>CAA	p.K259Q	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	11471							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R256_K260>K(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGCTTTTTAGGAGGCACC	0.388					8722											0.093458	7.715211	25.49904	10	97	KEEP	---	---	---	---	9	3	56	51	-1	capture	Missense_Mutation	SNP	179528769	179528769	TTN	2	T	G	G	G	1	0	0	0	0	1	0	0	0	781	61	4	4	16617	138
ALPP	250	broad.mit.edu	37	2	233246043	233246043	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233246043C>T	uc002vsq.2	+	10	1440	c.1275C>T	c.(1273-1275)GAC>GAT	p.D425D	ALPP_uc002vsr.2_RNA	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	425						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TGCTCAAGGACGGCGCCCGGC	0.697																0.086957	2.374771	22.225318	10	105	KEEP	---	---	---	---	8	11	68	69	-1	capture	Silent	SNP	233246043	233246043	ALPP	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	548	138
COL6A3	1293	broad.mit.edu	37	2	238275874	238275874	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238275874C>T	uc002vwl.2	-	11	5241	c.4956G>A	c.(4954-4956)AGG>AGA	p.R1652R	COL6A3_uc002vwo.2_Silent_p.R1446R|COL6A3_uc010znj.1_Silent_p.R1045R	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1652	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGAAACTGTCCCTCCTGAAGT	0.433																0.033708	-14.516058	6.53833	3	86	KEEP	---	---	---	---	2	1	36	55	-1	capture	Silent	SNP	238275874	238275874	COL6A3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	3666	138
OR6B2	389090	broad.mit.edu	37	2	240969715	240969715	+	Silent	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:240969715G>T	uc002vyr.2	-	2	178	c.132C>A	c.(130-132)GCC>GCA	p.A44A	OR6B2_uc010zoc.1_Silent_p.A44A	NM_001005853	NP_001005853	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		TGAGGATGATGGCCAGGTTCT	0.577																0.211382	119.458133	138.412436	52	194	KEEP	---	---	---	---	31	28	132	101	0.525423728814	capture	Silent	SNP	240969715	240969715	OR6B2	2	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	11092	138
SIRPB1	10326	broad.mit.edu	37	20	1600544	1600544	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1600544A>G	uc010gai.2	-	1	146	c.47T>C	c.(46-48)CTG>CCG	p.L16P	SIRPB1_uc002wfk.3_Missense_Mutation_p.L16P|SIRPB1_uc002wfl.3_Missense_Mutation_p.L16P	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	16					cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						TAGCGTCATCAGCAGGAAAGG	0.572																0.060606	-5.735293	14.23824	6	93	KEEP	---	---	---	---	7	2	66	49	-1	capture	Missense_Mutation	SNP	1600544	1600544	SIRPB1	20	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	14226	138
NINL	22981	broad.mit.edu	37	20	25457045	25457045	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25457045G>A	uc002wux.1	-	17	2956	c.2882C>T	c.(2881-2883)CCC>CTC	p.P961L	NINL_uc010gdn.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	961					G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CGGCCTCAGGGGTGGCTCCCA	0.692																0.259259	16.716141	18.131406	7	20	KEEP	---	---	---	---	10	10	27	22	-1	capture	Missense_Mutation	SNP	25457045	25457045	NINL	20	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10327	138
PPP1R16B	26051	broad.mit.edu	37	20	37547256	37547256	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37547256G>A	uc002xje.2	+	11	1840	c.1651G>A	c.(1651-1653)GCC>ACC	p.A551T	PPP1R16B_uc010ggc.2_Missense_Mutation_p.A509T	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	551	ANK 5.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AAAGTTCAAGGCCCCCATAGA	0.577																0.375	75.930859	76.909058	27	45	KEEP	---	---	---	---	25	6	26	21	-1	capture	Missense_Mutation	SNP	37547256	37547256	PPP1R16B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12267	138
BMP7	655	broad.mit.edu	37	20	55777537	55777537	+	Silent	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55777537G>A	uc010gip.1	-	3	1283	c.754C>T	c.(754-756)CTG>TTG	p.L252L	BMP7_uc010giq.1_Silent_p.L252L|BMP7_uc002xyc.2_Silent_p.L252L	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor	252					BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			TCACCATCCAGCGTCTCCACC	0.607																0.571429	51.202168	51.326369	16	12	KEEP	---	---	---	---	10	10	12	10	-1	capture	Silent	SNP	55777537	55777537	BMP7	20	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	1453	138
CACNG2	10369	broad.mit.edu	37	22	36983511	36983511	+	Splice_Site	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:36983511C>T	uc003aps.1	-	2	577	c.295_splice	c.e2+1	p.R99_splice		NM_006078	NP_006069	Q9Y698	CCG2_HUMAN	voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0						TGTGCACTCACGGAGGAAATA	0.507																0.340541	172.261512	176.422578	63	122	KEEP	---	---	---	---	41	26	77	55	-1	capture	Splice_Site	SNP	36983511	36983511	CACNG2	22	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	2533	138
CHL1	10752	broad.mit.edu	37	3	424158	424158	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:424158G>T	uc003bou.2	+	17	2203	c.1932G>T	c.(1930-1932)GAG>GAT	p.E644D	CHL1_uc003bot.2_Missense_Mutation_p.E660D|CHL1_uc003bow.1_Missense_Mutation_p.E644D|CHL1_uc011asi.1_Missense_Mutation_p.E660D|uc003box.1_Intron	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	644	Fibronectin type-III 1.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TACTACCAGAGTATATTGTTG	0.338				p.E660D(DKMG-Tumor)	659											0.271357	141.144953	150.538909	54	145	KEEP	---	---	---	---	28	30	85	78	0.48275862069	capture	Missense_Mutation	SNP	424158	424158	CHL1	3	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	3314	138
POLQ	10721	broad.mit.edu	37	3	121206922	121206922	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121206922T>G	uc003eee.3	-	16	4985	c.4856A>C	c.(4855-4857)AAA>ACA	p.K1619T	POLQ_uc003eed.2_Missense_Mutation_p.K791T	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1619					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CCCAGTTAATTTTGATTTTTC	0.408	Pancreas(152;907 1925 26081 31236 36904)										DNA_polymerases_(catalytic_subunits)					0.389362	641.82066	646.860273	183	287	KEEP	---	---	---	---	125	83	177	149	-1	capture	Missense_Mutation	SNP	121206922	121206922	POLQ	3	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	12111	138
PRR23C	389152	broad.mit.edu	37	3	138762733	138762733	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138762733G>A	uc011bmt.1	-	1	1002	c.730C>T	c.(730-732)CGC>TGC	p.R244C		NM_001134657	NP_001128129	Q6ZRP0	PR23C_HUMAN	proline rich 23C	244	Pro-rich.									skin(1)	1						AGCTCCGGGCGCGCGTGGGGA	0.642																0.307692	10.695865	11.124043	4	9	KEEP	---	---	---	---	3	3	8	3	-1	capture	Missense_Mutation	SNP	138762733	138762733	PRR23C	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12491	138
NMNAT3	349565	broad.mit.edu	37	3	139297857	139297857	+	Silent	SNP	G	A	A	rs79043406	byFrequency;by1000genomes	TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:139297857G>A	uc003etj.2	-	2	190	c.150C>T	c.(148-150)AAC>AAT	p.N50N	NMNAT3_uc003etk.2_Silent_p.N13N|NMNAT3_uc003etl.2_RNA|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471	Q96T66	NMNA3_HUMAN	nicotinamide mononucleotide adenylyltransferase	50					water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0						CATAGGTGTCGTTGACAGGAG	0.572																0.527778	116.950302	116.998446	38	34	KEEP	---	---	---	---	25	14	20	16	-1	capture	Silent	SNP	139297857	139297857	NMNAT3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10407	138
MCF2L2	23101	broad.mit.edu	37	3	182897228	182897228	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182897228C>T	uc003fli.1	-	30	3375	c.3285G>A	c.(3283-3285)GGG>GGA	p.G1095G		NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	1095					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CAGCCGTCGCCCCCGCAGGAG	0.741																0.263158	14.166003	15.130047	5	14	KEEP	---	---	---	---	4	1	12	7	-1	capture	Silent	SNP	182897228	182897228	MCF2L2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	9293	138
DRD5	1816	broad.mit.edu	37	4	9784506	9784506	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784506C>T	uc003gmb.3	+	1	1249	c.853C>T	c.(853-855)CGC>TGC	p.R285C		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	285	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	CACCAGCCTGCGCGCTTCCAT	0.627																0.324324	129.059554	133.107848	48	100	KEEP	---	---	---	---	25	35	75	54	-1	capture	Missense_Mutation	SNP	9784506	9784506	DRD5	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4715	138
PCDH7	5099	broad.mit.edu	37	4	30724196	30724196	+	Silent	SNP	G	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30724196G>T	uc003gsk.1	+	1	2160	c.1152G>T	c.(1150-1152)ACG>ACT	p.T384T	PCDH7_uc011bxw.1_Silent_p.T337T|PCDH7_uc011bxx.1_Silent_p.T384T	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	384	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						TGCGCTTCACGGTCATGGCCC	0.652																0.328947	70.254581	72.223197	25	51	KEEP	---	---	---	---	19	14	29	27	0.575757575758	capture	Silent	SNP	30724196	30724196	PCDH7	4	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	11419	138
OCIAD1	54940	broad.mit.edu	37	4	48852092	48852092	+	Missense_Mutation	SNP	C	T	T	rs150423557		TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48852092C>T	uc003gyo.2	+	6	627	c.370C>T	c.(370-372)CCA>TCA	p.P124S	OCIAD1_uc011bzk.1_RNA|OCIAD1_uc003gyr.2_Missense_Mutation_p.P124S|OCIAD1_uc003gyp.2_Missense_Mutation_p.P124S|OCIAD1_uc003gys.2_Missense_Mutation_p.P124S|OCIAD1_uc003gyq.2_Missense_Mutation_p.P124S|OCIAD1_uc010igk.2_Missense_Mutation_p.P129S	NM_017830	NP_060300	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1 isoform 1	124						endosome	protein binding				0						ACGATCTTCACCACCTGGGTA	0.373																0.072368	-4.288011	24.316923	11	141	KEEP	---	---	---	---	6	8	88	70	-1	capture	Missense_Mutation	SNP	48852092	48852092	OCIAD1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10722	138
MOBKL1A	92597	broad.mit.edu	37	4	71847741	71847741	+	Silent	SNP	A	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71847741A>G	uc003hfw.2	+	6	808	c.618A>G	c.(616-618)GAA>GAG	p.E206E	MOBKL1A_uc011cba.1_Silent_p.E211E	NM_173468	NP_775739	Q7L9L4	MOL1A_HUMAN	MOB1, Mps One Binder kinase activator-like 1A	206					hippo signaling cascade|protein autophosphorylation	cytoplasm|nucleus	kinase activator activity|kinase binding|metal ion binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			CACTCCAAGAACTGATTGAAA	0.353																0.393443	83.690078	84.295511	24	37	KEEP	---	---	---	---	16	11	18	24	-1	capture	Silent	SNP	71847741	71847741	MOBKL1A	4	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	9594	138
SLC39A8	64116	broad.mit.edu	37	4	103184237	103184237	+	Silent	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:103184237G>A	uc003hwb.1	-	8	1876	c.1347C>T	c.(1345-1347)CTC>CTT	p.L449L	SLC39A8_uc011ceo.1_Intron|SLC39A8_uc003hwa.1_Silent_p.L382L|SLC39A8_uc003hwc.2_Silent_p.L449L	NM_022154	NP_071437	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter),	449	Helical; (Potential).					integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		ACAAGGTAATGAGTAGAATGG	0.348																0.22293	80.833407	91.923862	35	122	KEEP	---	---	---	---	24	15	80	58	-1	capture	Silent	SNP	103184237	103184237	SLC39A8	4	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	14516	138
TET2	54790	broad.mit.edu	37	4	106158045	106158045	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106158045G>C	uc003hxk.2	+	3	3332	c.2946G>C	c.(2944-2946)AAG>AAC	p.K982N	TET2_uc011cez.1_Missense_Mutation_p.K1003N|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.K982N|TET2_uc003hxi.1_Missense_Mutation_p.K982N	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	982					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGCCAATTAAGGTGGAACCTG	0.473					111	Mis N|F		MDS								0.052632	-7.767375	8.308226	4	72	KEEP	---	---	---	---	2	2	34	48	-1	capture	Missense_Mutation	SNP	106158045	106158045	TET2	4	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	15655	138
EGF	1950	broad.mit.edu	37	4	110880565	110880565	+	Silent	SNP	C	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110880565C>A	uc003hzy.3	+	6	1490	c.1038C>A	c.(1036-1038)GCC>GCA	p.A346A	EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Silent_p.A346A	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	346	EGF-like 1.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	AGGGATACGCCCTAAGTCGAG	0.502					724											0.301471	111.719359	116.508095	41	95	KEEP	---	---	---	---	19	24	60	44	0.558139534884	capture	Silent	SNP	110880565	110880565	EGF	4	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	4917	138
TBC1D9	23158	broad.mit.edu	37	4	141578365	141578365	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:141578365C>T	uc010ioj.2	-	13	2495	c.2223G>A	c.(2221-2223)GTG>GTA	p.V741V		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	741						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CTTTATTGGTCACACTGTCTA	0.438																0.37963	113.742785	115.117716	41	67	KEEP	---	---	---	---	26	21	45	26	-1	capture	Silent	SNP	141578365	141578365	TBC1D9	4	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	15514	138
PCDHB5	26167	broad.mit.edu	37	5	140517019	140517019	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140517019C>T	uc003liq.2	+	1	2220	c.2003C>T	c.(2002-2004)CCC>CTC	p.P668L		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	668	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCTCCCAGCCCTACCTGCCG	0.701																0.396825	150.399636	151.579634	50	76	KEEP	---	---	---	---	39	36	83	75	-1	capture	Missense_Mutation	SNP	140517019	140517019	PCDHB5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11448	138
C5orf25	375484	broad.mit.edu	37	5	175717198	175717198	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175717198G>A	uc003mds.3	+	4	1021	c.614G>A	c.(613-615)CGA>CAA	p.R205Q	C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Missense_Mutation_p.R224Q|uc003mdu.1_Missense_Mutation_p.R116Q			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	205	Pro-rich.										0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		TGCCCCCTGCGACCTTTGCCA	0.512																0.413043	54.229103	54.529063	19	27	KEEP	---	---	---	---	9	11	11	16	-1	capture	Missense_Mutation	SNP	175717198	175717198	C5orf25	5	G	A	A	A	1	0	0	0	0	1	0	0	0	469	37	1	1	2266	138
HK3	3101	broad.mit.edu	37	5	176311062	176311062	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176311062C>T	uc003mfa.2	-	14	2023	c.1931G>A	c.(1930-1932)CGG>CAG	p.R644Q	HK3_uc003mez.2_Missense_Mutation_p.R200Q	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	644	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	p.R644W(1)		ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GATGGCTTCCCGCAACAGACT	0.587																0.317647	146.136891	151.138106	54	116	KEEP	---	---	---	---	29	30	63	63	-1	capture	Missense_Mutation	SNP	176311062	176311062	HK3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7117	138
DSP	1832	broad.mit.edu	37	6	7585169	7585169	+	Silent	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7585169T>A	uc003mxp.1	+	24	7953	c.7674T>A	c.(7672-7674)GCT>GCA	p.A2558A	DSP_uc003mxq.1_Silent_p.A1959A	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2558	Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTCAATTTGCTGACATGATCT	0.478																0.066667	-6.901235	16.465929	8	112	KEEP	---	---	---	---	5	3	77	48	-1	capture	Silent	SNP	7585169	7585169	DSP	6	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	4736	138
TULP1	7287	broad.mit.edu	37	6	35480607	35480607	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35480607T>C	uc003okv.3	-	1	41	c.29A>G	c.(28-30)GAG>GGG	p.E10G	TULP1_uc003okw.3_Missense_Mutation_p.E10G	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1	10					dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3						GGCCCACACCTCTCGGAGGGT	0.522	GBM(55;1027 1091 11115 23439)															0.080808	4.933244	22.64973	8	91	KEEP	---	---	---	---	4	5	43	63	-1	capture	Missense_Mutation	SNP	35480607	35480607	TULP1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16655	138
TCTE1	202500	broad.mit.edu	37	6	44255398	44255398	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44255398C>T	uc003oxi.2	-	2	321	c.165G>A	c.(163-165)AGG>AGA	p.R55R	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_182539	NP_872345	Q5JU00	TCTE1_HUMAN	t-complex-associated testis expressed 1	55										ovary(2)|skin(2)	4	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGATATTGGCCCTGGGATGTG	0.547																0.362903	138.071035	140.109301	45	79	KEEP	---	---	---	---	25	22	58	30	-1	capture	Silent	SNP	44255398	44255398	TCTE1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	15602	138
C6orf138	442213	broad.mit.edu	37	6	47846160	47846160	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47846160A>G	uc011dwm.1	-	3	2454	c.2369T>C	c.(2368-2370)CTA>CCA	p.L790P	C6orf138_uc011dwn.1_Missense_Mutation_p.L554P	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	807	Helical; (Potential).					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						GAAAAACGTTAGGAACACAGG	0.443																0.331551	205.99145	210.690452	62	125	KEEP	---	---	---	---	32	30	78	51	-1	capture	Missense_Mutation	SNP	47846160	47846160	C6orf138	6	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	2309	138
C6orf142	90523	broad.mit.edu	37	6	53986287	53986287	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:53986287T>A	uc003pcg.3	+	2	219	c.106T>A	c.(106-108)TTT>ATT	p.F36I	C6orf142_uc003pcf.2_Missense_Mutation_p.F36I|C6orf142_uc003pch.3_Intron|C6orf142_uc011dwz.1_Intron|C6orf142_uc011dxa.1_Missense_Mutation_p.F47I	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	36	Interaction with LMNA.					nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					GATCTTCACATTTGTCCCCAC	0.413																0.044304	-20.513944	14.603425	7	151	KEEP	---	---	---	---	4	3	99	72	-1	capture	Missense_Mutation	SNP	53986287	53986287	C6orf142	6	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	2310	138
LMBRD1	55788	broad.mit.edu	37	6	70411373	70411373	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70411373T>A	uc003pfa.2	-	11	1160	c.1045A>T	c.(1045-1047)AGT>TGT	p.S349C	LMBRD1_uc003pey.2_Missense_Mutation_p.S145C|LMBRD1_uc003pez.2_Missense_Mutation_p.S276C|LMBRD1_uc010kal.2_Missense_Mutation_p.S276C|LMBRD1_uc003pfb.2_RNA	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein	349	Extracellular (Potential).				interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						AGTGGATTACTCAGGTTAGCT	0.294																0.254545	35.722756	38.730297	14	41	KEEP	---	---	---	---	6	8	29	15	-1	capture	Missense_Mutation	SNP	70411373	70411373	LMBRD1	6	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	8762	138
SIM1	6492	broad.mit.edu	37	6	100838922	100838922	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100838922G>C	uc003pqj.3	-	11	1823	c.1616C>G	c.(1615-1617)CCT>CGT	p.P539R	SIM1_uc010kcu.2_Missense_Mutation_p.P539R	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	539	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GGCCGACCCAGGGTCTGGAGA	0.433																0.2875	121.475027	127.961099	46	114	KEEP	---	---	---	---	21	28	64	61	-1	capture	Missense_Mutation	SNP	100838922	100838922	SIM1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	14216	138
AIM1	202	broad.mit.edu	37	6	106968654	106968654	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:106968654C>T	uc003prh.2	+	2	2834	c.2347C>T	c.(2347-2349)CGT>TGT	p.R783C		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	783							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GAGACCCAAACGTGCATCTGC	0.468				p.R783C(JHH7-Tumor)|p.R783C(PC14-Tumor)|p.R783C(SNU475-Tumor)	659											0.35	97.591918	99.578265	35	65	KEEP	---	---	---	---	18	18	24	44	-1	capture	Missense_Mutation	SNP	106968654	106968654	AIM1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	430	138
HOXA9	3205	broad.mit.edu	37	7	27204781	27204781	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27204781G>A	uc003syt.2	-	1	369	c.296C>T	c.(295-297)GCG>GTG	p.A99V		NM_152739	NP_689952	P31269	HXA9_HUMAN	homeobox A9	99							protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)	2						CGCCGCCGCCGCCACGGGCGC	0.721					22	T	NUP98|MSI2	AML*								0.222222	13.035815	14.952965	6	21	KEEP	---	---	---	---	7	7	29	15	-1	capture	Missense_Mutation	SNP	27204781	27204781	HOXA9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7223	138
OGDH	4967	broad.mit.edu	37	7	44714133	44714133	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44714133C>T	uc003tln.2	+	7	1021	c.912C>T	c.(910-912)TAC>TAT	p.Y304Y	OGDH_uc003tlm.2_Silent_p.Y304Y|OGDH_uc011kbx.1_Silent_p.Y300Y|OGDH_uc011kby.1_Silent_p.Y154Y|OGDH_uc003tlp.2_Silent_p.Y315Y|OGDH_uc011kbz.1_Silent_p.Y99Y|OGDH_uc003tlo.1_Silent_p.Y137Y	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	304					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	GCGTGGACTACGTGATCATGG	0.562																0.026596	-38.389406	8.187143	5	183	KEEP	---	---	---	---	0	5	108	98	-1	capture	Silent	SNP	44714133	44714133	OGDH	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10744	138
EGFR	1956	broad.mit.edu	37	7	55233037	55233037	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233037C>T	uc003tqk.2	+	15	2033	c.1787C>T	c.(1786-1788)CCG>CTG	p.P596L	EGFR_uc003tqi.2_Missense_Mutation_p.P596L|EGFR_uc003tqj.2_Missense_Mutation_p.P596L|EGFR_uc010kzg.1_Missense_Mutation_p.P551L|EGFR_uc011kco.1_Missense_Mutation_p.P543L|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	596	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.P596L(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAGACCTGCCCGGCAGGAGTC	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.019455	-58.838097	7.802986	5	252	KEEP	---	---	---	---	5	1	141	144	-1	capture	Missense_Mutation	SNP	55233037	55233037	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4922	138
NPTX2	4885	broad.mit.edu	37	7	98254345	98254345	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254345T>A	uc003upl.2	+	3	932	c.755T>A	c.(754-756)ATC>AAC	p.I252N		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	252	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GCCTTCACCATCTGCCTGTGG	0.592																0.019126	-83.83558	11.137153	7	359	KEEP	---	---	---	---	7	4	200	237	-1	capture	Missense_Mutation	SNP	98254345	98254345	NPTX2	7	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	10510	138
LAMB4	22798	broad.mit.edu	37	7	107706294	107706294	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107706294G>A	uc010ljo.1	-	21	2833	c.2749C>T	c.(2749-2751)CCC>TCC	p.P917S	LAMB4_uc003vey.2_Missense_Mutation_p.P917S|LAMB4_uc010ljp.1_5'Flank	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	917	Laminin EGF-like 9.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TTGCTTGAGGGATCATCTGGA	0.428																0.081633	-1.211537	42.532407	20	225	KEEP	---	---	---	---	12	11	132	113	-1	capture	Missense_Mutation	SNP	107706294	107706294	LAMB4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	8533	138
MET	4233	broad.mit.edu	37	7	116398608	116398608	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116398608C>A	uc003vij.2	+	9	2385	c.2198C>A	c.(2197-2199)ACA>AAA	p.T733K	MET_uc010lkh.2_Missense_Mutation_p.T733K|MET_uc011kng.1_Missense_Mutation_p.T733K|MET_uc011knh.1_Missense_Mutation_p.T733K|MET_uc011kni.1_Missense_Mutation_p.T733K|MET_uc011knj.1_Missense_Mutation_p.T303K	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	733	Extracellular (Potential).|IPT/TIG 2.				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AACCGAGAGACAAGCATCTTC	0.368					299	Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				0.256757	98.776728	106.71813	38	110	KEEP	---	---	---	---	18	21	60	61	0.538461538462	capture	Missense_Mutation	SNP	116398608	116398608	MET	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	9397	138
MSR1	4481	broad.mit.edu	37	8	16021738	16021738	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:16021738C>T	uc003wwz.2	-	5	851	c.653G>A	c.(652-654)CGT>CAT	p.R218H	MSR1_uc010lsu.2_Missense_Mutation_p.R236H|MSR1_uc003wxa.2_Missense_Mutation_p.R218H|MSR1_uc003wxb.2_Missense_Mutation_p.R218H|MSR1_uc011kxz.1_Translation_Start_Site	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	218	Potential.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		ATTGTAAACACGCTCCTCTAA	0.338																0.458333	66.54662	66.618898	22	26	KEEP	---	---	---	---	16	8	17	11	-1	capture	Missense_Mutation	SNP	16021738	16021738	MSR1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9796	138
ZNF395	55893	broad.mit.edu	37	8	28210755	28210755	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:28210755C>T	uc003xgq.2	-	5	842	c.754G>A	c.(754-756)GAT>AAT	p.D252N	ZNF395_uc003xgt.2_Missense_Mutation_p.D252N|ZNF395_uc003xgr.2_Missense_Mutation_p.D252N|ZNF395_uc003xgs.2_Missense_Mutation_p.D252N	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	252					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		AAGCCATGATCAGTTTGGGGA	0.592																0.409836	70.759964	71.194086	25	36	KEEP	---	---	---	---	11	19	22	22	-1	capture	Missense_Mutation	SNP	28210755	28210755	ZNF395	8	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17761	138
FER1L6	654463	broad.mit.edu	37	8	125110059	125110059	+	Silent	SNP	A	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125110059A>G	uc003yqw.2	+	37	5024	c.4818A>G	c.(4816-4818)GAA>GAG	p.E1606E	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1606	C2 6.|Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GGAACACTGAAGATGTCATTT	0.423																0.035294	-12.752093	7.198306	3	82	KEEP	---	---	---	---	3	0	49	55	-1	capture	Silent	SNP	125110059	125110059	FER1L6	8	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	5761	138
NFIB	4781	broad.mit.edu	37	9	14155894	14155894	+	Splice_Site	SNP	T	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14155894T>A	uc003zle.2	-	4	1052	c.617_splice	c.e4-1	p.G206_splice	NFIB_uc003zld.2_Splice_Site|NFIB_uc003zlf.2_Splice_Site_p.G206_splice|NFIB_uc011lmo.1_Splice_Site_p.G206_splice	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		CAAGGTAACCTGAAAATAAAT	0.274	Esophageal Squamous(132;921 1730 14828 40753 46471)					T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								0.709677	79.163587	80.385309	22	9	KEEP	---	---	---	---	15	9	5	5	-1	capture	Splice_Site	SNP	14155894	14155894	NFIB	9	T	A	A	A	1	0	0	0	0	0	0	1	0	715	55	5	4	10278	138
ADAMTSL1	92949	broad.mit.edu	37	9	18777209	18777209	+	Silent	SNP	C	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:18777209C>G	uc003zne.3	+	19	3109	c.2982C>G	c.(2980-2982)ACC>ACG	p.T994T		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	994						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CCCTGCAGACCCACAAACACC	0.687																0.625	68.405363	68.843707	20	12	KEEP	---	---	---	---	10	13	4	10	-1	capture	Silent	SNP	18777209	18777209	ADAMTSL1	9	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	274	138
FAM108B1	51104	broad.mit.edu	37	9	74485080	74485080	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:74485080A>G	uc004aim.1	-	3	1168	c.566T>C	c.(565-567)ATT>ACT	p.I189T	FAM108B1_uc004ail.2_Missense_Mutation_p.I189T	NM_001025780	NP_001020951	Q5VST6	F108B_HUMAN	family with sequence similarity 108, member B1	189						extracellular region	hydrolase activity				0						AGAATGAAGAATAACAGCAGC	0.423																0.369668	264.901363	268.049057	78	133	KEEP	---	---	---	---	38	49	78	63	-1	capture	Missense_Mutation	SNP	74485080	74485080	FAM108B1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	5346	138
TMC1	117531	broad.mit.edu	37	9	75406910	75406910	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75406910C>T	uc004aiz.1	+	16	1873	c.1333C>T	c.(1333-1335)CGC>TGC	p.R445C	TMC1_uc010moz.1_Missense_Mutation_p.R403C|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.R299C|TMC1_uc010mpa.1_Missense_Mutation_p.R299C	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	445	Helical; (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						GCTACTGGGACGCATTTTTGC	0.393	Pancreas(75;173 1345 14232 34245 43413)															0.345714	340.27872	347.583871	121	229	KEEP	---	---	---	---	78	46	148	94	-1	capture	Missense_Mutation	SNP	75406910	75406910	TMC1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15869	138
GRIN3A	116443	broad.mit.edu	37	9	104432454	104432454	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:104432454T>G	uc004bbp.1	-	3	2841	c.2240A>C	c.(2239-2241)AAC>ACC	p.N747T	GRIN3A_uc004bbq.1_Missense_Mutation_p.N747T	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	747	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	GGCCCAAAGGTTCATTAGAAA	0.433					27											0.027397	-26.725022	9.250036	4	142	KEEP	---	---	---	---	4	1	72	73	-1	capture	Missense_Mutation	SNP	104432454	104432454	GRIN3A	9	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	6716	138
MUSK	4593	broad.mit.edu	37	9	113445003	113445003	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113445003A>T	uc004bey.2	+	2	227	c.129A>T	c.(127-129)GAA>GAT	p.E43D	MUSK_uc004bex.2_Missense_Mutation_p.E43D	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	43	Ig-like 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						TAGTTGAAGAAGTGGCTACTT	0.378					297											0.056769	-21.423839	25.842107	13	216	KEEP	---	---	---	---	12	3	138	91	-1	capture	Missense_Mutation	SNP	113445003	113445003	MUSK	9	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	9899	138
COL4A5	1287	broad.mit.edu	37	X	107827754	107827754	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107827754T>C	uc004enz.1	+	18	1233	c.1031T>C	c.(1030-1032)CTT>CCT	p.L344P	COL4A5_uc011mso.1_Missense_Mutation_p.L344P|COL4A5_uc004eob.1_5'UTR	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	344	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						CCTCCTGGACTTGTAAGTTTT	0.343												Alport_syndrome_with_Diffuse_Leiomyomatosis				0.084746	3.029296	13.351089	5	54	KEEP	---	---	---	---	4	1	32	27	-1	capture	Missense_Mutation	SNP	107827754	107827754	COL4A5	23	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3659	138
AFF2	2334	broad.mit.edu	37	X	147743983	147743983	+	Silent	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:147743983C>T	uc004fcp.2	+	3	1214	c.735C>T	c.(733-735)GCC>GCT	p.A245A	AFF2_uc004fco.2_Silent_p.A241A|AFF2_uc004fcq.2_Silent_p.A241A|AFF2_uc004fcr.2_Silent_p.A241A|AFF2_uc011mxb.1_Silent_p.A245A|AFF2_uc004fcs.2_Silent_p.A241A	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	245					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAATTCGCCGTGCAAGCGC	0.458																0.147679	64.495654	92.722059	35	202	KEEP	---	---	---	---	22	15	125	97	-1	capture	Silent	SNP	147743983	147743983	AFF2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	357	138
MAGEA12	4111	broad.mit.edu	37	X	151900520	151900520	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151900520C>A	uc010ntp.2	-	3	635	c.281G>T	c.(280-282)GGG>GTG	p.G94V	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.G94V|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	94										skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGCTTGGCCCTTCCTGTTC	0.547																0.738806	312.977999	319.906355	99	35	KEEP	---	---	---	---	61	46	21	17	0.429906542056	capture	Missense_Mutation	SNP	151900520	151900520	MAGEA12	23	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9080	138
ARHGAP4	393	broad.mit.edu	37	X	153184317	153184317	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153184317C>T	uc004fjk.1	-	7	1043	c.1001G>A	c.(1000-1002)CGC>CAC	p.R334H	ARHGAP4_uc011mzf.1_Missense_Mutation_p.R311H|ARHGAP4_uc004fjl.1_Missense_Mutation_p.R374H|ARHGAP4_uc010nup.1_RNA	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2	334					apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTAGTCAAAGCGCAGCGGGGG	0.617																0.627119	228.00389	229.699125	74	44	KEEP	---	---	---	---	41	43	26	26	-1	capture	Missense_Mutation	SNP	153184317	153184317	ARHGAP4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	878	138
OR2T2	401992	broad.mit.edu	37	1	248616705	248616711	+	Frame_Shift_Del	DEL	TGCTGCG	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248616705_248616711delTGCTGCG	uc001iek.1	+	1	607_613	c.607_613delTGCTGCG	c.(607-615)TGCTGCGTGfs	p.C203fs		NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,	203_205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGCCTGCTGCGTGCTGATGCT	0.527																0.06			10	156		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	248616705	248616711	OR2T2	1	TGCTGCG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	10924	138
RBM4	5936	broad.mit.edu	37	11	66411364	66411384	+	In_Frame_Del	DEL	GCTGCTGCTGCAGCAGCAGCC	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66411364_66411384delGCTGCTGCTGCAGCAGCAGCC	uc009yrj.2	+	3	1344_1364	c.856_876delGCTGCTGCTGCAGCAGCAGCC	c.(856-876)GCTGCTGCTGCAGCAGCAGCCdel	p.AAAAAAA286del	RBM4_uc009yrk.2_In_Frame_Del_p.AAAAAAA261del|RBM4_uc001oiw.1_In_Frame_Del_p.AAAAAAA286del|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_In_Frame_Del_p.AAAAAAA286del|RBM4_uc001oiz.1_In_Frame_Del_p.AAAAAAA286del	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	286_292	Interaction with TNPO3.|Poly-Ala.				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		tgctgccacagctgctgctgcagcagcagccgctgctgctg	0.457																0.09			9	93		---	---	---	---						capture_indel	In_Frame_Del	DEL	66411364	66411384	RBM4	11	GCTGCTGCTGCAGCAGCAGCC	-	-	-	1	0	1	0	1	0	0	0	0	442	34	5	5	13029	138
TP53	7157	broad.mit.edu	37	17	7578211	7578214	+	Frame_Shift_Del	DEL	CGAA	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578211_7578214delCGAA	uc002gim.2	-	6	829_832	c.635_638delTTCG	c.(634-639)TTTCGAfs	p.F212fs	TP53_uc002gig.1_Frame_Shift_Del_p.F212fs|TP53_uc002gih.2_Frame_Shift_Del_p.F212fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.F80fs|TP53_uc010cng.1_Frame_Shift_Del_p.F80fs|TP53_uc002gii.1_Frame_Shift_Del_p.F80fs|TP53_uc010cnh.1_Frame_Shift_Del_p.F212fs|TP53_uc010cni.1_Frame_Shift_Del_p.F212fs|TP53_uc002gij.2_Frame_Shift_Del_p.F212fs|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Frame_Shift_Del_p.F119fs|TP53_uc002gio.2_Frame_Shift_Del_p.F80fs|TP53_uc010vug.1_Frame_Shift_Del_p.F173fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	212_213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.F212fs*3(7)|p.0?(7)|p.R213P(5)|p.F212L(3)|p.R213fs*34(3)|p.F212I(2)|p.R81*(2)|p.F212S(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.T211_F212insX(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.D208fs*1(1)|p.F212fs*4(1)|p.R213>L(1)|p.F212Y(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACACTATGTCGAAAAGTGTTTCT	0.534	Pancreas(47;798 1329 9957 10801)		111	p.R213L(HT55-Tumor)|p.R213Q(AN3CA-Tumor)|p.R213*(DMS114-Tumor)|p.R213*(MOLT13-Tumor)|p.R213*(SUPT11-Tumor)|p.R213Q(RAJI-Tumor)|p.R213Q(U138MG-Tumor)|p.R213*(HEC251-Tumor)|p.R213*(TC71-Tumor)|p.R213*(SNU81-Tumor)|p.R213*(IPC298-Tumor)|p.R213*(RERFGC1B-Tumor)|p.R213*(TE14-Tumor)|p.R213*(HT115-Tumor)|p.R213*(ESS1-Tumor)|p.R213*(JHOM1-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.27			25	68		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7578211	7578214	TP53	17	CGAA	-	-	-	1	0	1	0	1	0	0	0	0	403	31	5	5	16264	138
KPNB1	3837	broad.mit.edu	37	17	45734349	45734349	+	Frame_Shift_Del	DEL	A	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45734349delA	uc002ilt.1	+	4	742	c.406delA	c.(406-408)AATfs	p.N136fs	KPNB1_uc010wkw.1_5'UTR|KPNB1_uc010wkx.1_5'UTR	NM_002265	NP_002256	Q14974	IMB1_HUMAN	karyopherin beta 1	136	HEAT 1.				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						GCTGGTGGCCAATGTCACAAA	0.483																0.29			28	69		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	45734349	45734349	KPNB1	17	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	8355	138
AKD1	221264	broad.mit.edu	37	6	109993127	109993127	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109993127delT	uc003ptn.2	-	5	403	c.326delA	c.(325-327)CACfs	p.H109fs	AKD1_uc003ptr.3_Frame_Shift_Del_p.H109fs|AKD1_uc003pts.1_RNA	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	109					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						CATACCAAAGTGACAGACTTC	0.383																0.39			42	65		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	109993127	109993127	AKD1	6	T	-	-	-	1	0	1	0	1	0	0	0	0	767	59	5	5	460	138
RFX6	222546	broad.mit.edu	37	6	117203548	117203548	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0813-01	TCGA-14-0813-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117203548delC	uc003pxm.2	+	4	586	c.523delC	c.(523-525)CCCfs	p.P175fs		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	175	RFX-type winged-helix.				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						CCAGAAGTTTCCCCTCCTAAC	0.413																0.31			29	66		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	117203548	117203548	RFX6	6	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	13162	138
