Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TDRD10	126668	broad.mit.edu	37	1	154516509	154516509	+	Missense_Mutation	SNP	G	A	A	rs143192137	byFrequency	TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154516509G>A	uc009wow.2	+	9	1412	c.574G>A	c.(574-576)GTC>ATC	p.V192I	TDRD10_uc001ffd.2_Missense_Mutation_p.V192I|TDRD10_uc001ffe.2_Missense_Mutation_p.V113I	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a	192							nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CATCCATAGCGTCCGTGGGGA	0.612																0.3125	128.688241	133.697988	50	110	KEEP	---	---	---	---	30	28	74	62	-1	capture	Missense_Mutation	SNP	154516509	154516509	TDRD10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15616	142
CACNA1S	779	broad.mit.edu	37	1	201009210	201009210	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201009210C>T	uc001gvv.2	-	44	5598	c.5371G>A	c.(5371-5373)GCT>ACT	p.A1791T		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1791	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CGAACCAGAGCCTGCAGGGAG	0.617																0.390625	67.448119	68.122273	25	39	KEEP	---	---	---	---	15	11	17	23	-1	capture	Missense_Mutation	SNP	201009210	201009210	CACNA1S	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2523	142
EDARADD	128178	broad.mit.edu	37	1	236590728	236590728	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236590728G>A	uc001hxu.1	+	4	262	c.197G>A	c.(196-198)CGA>CAA	p.R66Q	EDARADD_uc001hxv.1_Missense_Mutation_p.R56Q	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A	66					cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AACTGCCCACGAAATTCAGAT	0.249																0.411765	86.592954	87.053808	28	40	KEEP	---	---	---	---	17	15	22	24	-1	capture	Missense_Mutation	SNP	236590728	236590728	EDARADD	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4861	142
PTEN	5728	broad.mit.edu	37	10	89692841	89692841	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692841G>A	uc001kfb.2	+	6	1356	c.325G>A	c.(325-327)GAC>AAC	p.D109N		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	109	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y27_N212>Y(2)|p.?(2)|p.Y27fs*1(2)|p.L108_D109del(2)|p.D109fs*6(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAAGATCTTGACCAATGGCT	0.383			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.422414	140.2485	140.859299	49	67	KEEP	---	---	---	---	31	28	43	44	-1	capture	Missense_Mutation	SNP	89692841	89692841	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	12633	142
SCGB1C1	147199	broad.mit.edu	37	11	193135	193135	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:193135C>T	uc001loa.1	+	1	56	c.36C>T	c.(34-36)CTC>CTT	p.L12L		NM_145651	NP_663626	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1 precursor	12						extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGGTGGCCCTCACCCTGTTCT	0.612																0.153846	11.878886	17.829142	8	44	KEEP	---	---	---	---	1	10	29	23	-1	capture	Silent	SNP	193135	193135	SCGB1C1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	13787	142
CKAP5	9793	broad.mit.edu	37	11	46792527	46792527	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46792527C>T	uc001ndi.1	-	25	3107	c.2997G>A	c.(2995-2997)CTG>CTA	p.L999L	CKAP5_uc009ylg.1_Silent_p.L885L|CKAP5_uc001ndj.1_Silent_p.L999L|CKAP5_uc001ndh.1_5'Flank	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	999					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						CCAGCCAGCCCAGAAGCTGCC	0.428	Ovarian(4;85 273 2202 4844 13323)															0.220339	25.816202	30.10127	13	46	KEEP	---	---	---	---	13	23	35	34	-1	capture	Silent	SNP	46792527	46792527	CKAP5	11	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3410	142
NOX4	50507	broad.mit.edu	37	11	89073317	89073317	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89073317G>A	uc001pct.2	-	15	1599	c.1360C>T	c.(1360-1362)CTT>TTT	p.L454F	NOX4_uc009yvr.2_Missense_Mutation_p.L429F|NOX4_uc001pcu.2_Missense_Mutation_p.L380F|NOX4_uc001pcw.2_Missense_Mutation_p.L147F|NOX4_uc001pcx.2_Missense_Mutation_p.L107F|NOX4_uc001pcv.2_Missense_Mutation_p.L414F|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Missense_Mutation_p.L288F|NOX4_uc009yvp.2_Missense_Mutation_p.L218F|NOX4_uc010rtv.1_Missense_Mutation_p.L390F|NOX4_uc009yvq.2_Missense_Mutation_p.L430F	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	454	Cytoplasmic (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGTCTTCTAAGCTTGTATGGT	0.323																0.312169	160.16876	166.098602	59	130	KEEP	---	---	---	---	39	26	49	95	-1	capture	Missense_Mutation	SNP	89073317	89073317	NOX4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10465	142
PPP2R1B	5519	broad.mit.edu	37	11	111613292	111613292	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111613292T>C	uc001plx.1	-	13	1736	c.1652A>G	c.(1651-1653)AAT>AGT	p.N551S	PPP2R1B_uc001plw.1_Missense_Mutation_p.N551S|PPP2R1B_uc010rwi.1_Missense_Mutation_p.N487S|PPP2R1B_uc010rwj.1_Missense_Mutation_p.N390S|PPP2R1B_uc010rwk.1_Missense_Mutation_p.N506S|PPP2R1B_uc010rwl.1_Missense_Mutation_p.N424S	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	551	HEAT 14.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TTTGGCCACATTGAAGCGAAC	0.368																0.283951	69.891696	73.286004	23	58	KEEP	---	---	---	---	17	8	24	36	-1	capture	Missense_Mutation	SNP	111613292	111613292	PPP2R1B	11	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	12284	142
GALNT8	26290	broad.mit.edu	37	12	4854615	4854615	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4854615G>A	uc001qne.1	+	5	973	c.881G>A	c.(880-882)CGG>CAG	p.R294Q		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	294	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						ATCTTGGCTCGGATTCAGGAG	0.478	Colon(108;631 1558 7270 20097 39846)															0.401961	130.465968	131.319718	41	61	KEEP	---	---	---	---	30	18	40	47	-1	capture	Missense_Mutation	SNP	4854615	4854615	GALNT8	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6159	142
CD163	9332	broad.mit.edu	37	12	7639557	7639557	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7639557C>T	uc001qsz.3	-	9	2204	c.2076G>A	c.(2074-2076)TCG>TCA	p.S692S	CD163_uc001qta.3_Silent_p.S692S|CD163_uc009zfw.2_Silent_p.S725S	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	692	Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						ATGAATTGCACGAGGACAGTG	0.438																0.300752	111.261861	115.970493	40	93	KEEP	---	---	---	---	21	23	46	58	-1	capture	Silent	SNP	7639557	7639557	CD163	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2938	142
SRGAP1	57522	broad.mit.edu	37	12	64509616	64509616	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:64509616G>A	uc010ssp.1	+	18	2223	c.2167G>A	c.(2167-2169)GGT>AGT	p.G723S	SRGAP1_uc001srv.2_Missense_Mutation_p.G660S	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	723					axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CAGTGAGCACGGTACATTGGA	0.343																0.264706	23.659078	25.360945	9	25	KEEP	---	---	---	---	4	6	15	13	-1	capture	Missense_Mutation	SNP	64509616	64509616	SRGAP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15037	142
ATP7B	540	broad.mit.edu	37	13	52516659	52516659	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52516659G>A	uc001vfw.2	-	15	3432	c.3275C>T	c.(3274-3276)ACG>ATG	p.T1092M	ATP7B_uc010adv.2_Missense_Mutation_p.T662M|ATP7B_uc001vfx.2_Missense_Mutation_p.T885M|ATP7B_uc001vfy.2_Missense_Mutation_p.T981M|ATP7B_uc010tgt.1_Missense_Mutation_p.T1027M|ATP7B_uc010tgu.1_Missense_Mutation_p.T1044M|ATP7B_uc010tgv.1_Missense_Mutation_p.T1014M|ATP7B_uc001vfv.2_Missense_Mutation_p.T364M|ATP7B_uc010tgs.1_Missense_Mutation_p.T303M	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1092	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)		CTGGAAGTCCGTGCAGTATCC	0.572												Wilson_disease				0.074627	-0.87963	11.564988	5	62	KEEP	---	---	---	---	4	4	39	30	-1	capture	Missense_Mutation	SNP	52516659	52516659	ATP7B	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1182	142
LMO7	4008	broad.mit.edu	37	13	76381854	76381854	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:76381854C>T	uc001vjv.2	+	7	1496	c.736C>T	c.(736-738)CGA>TGA	p.R246*	LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Nonsense_Mutation_p.R152*	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	531						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATATGTTCTCCGAGCTTTTGA	0.413																0.55914	171.808862	172.092297	52	41	KEEP	---	---	---	---	26	27	21	22	-1	capture	Nonsense_Mutation	SNP	76381854	76381854	LMO7	13	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8775	142
SLITRK6	84189	broad.mit.edu	37	13	86370546	86370546	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:86370546G>C	uc001vll.1	-	2	557	c.98C>G	c.(97-99)TCT>TGT	p.S33C	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	33	LRRNT 1.|Extracellular (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		ATTGCAAAGAGAATCACAAGA	0.403																0.530435	222.184619	222.27732	61	54	KEEP	---	---	---	---	27	39	26	33	-1	capture	Missense_Mutation	SNP	86370546	86370546	SLITRK6	13	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14639	142
SYT16	83851	broad.mit.edu	37	14	62550997	62550997	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62550997G>A	uc001xfu.1	+	5	1715	c.1518G>A	c.(1516-1518)GCG>GCA	p.A506A	SYT16_uc010tse.1_Silent_p.A64A	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	506										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		ATGGAGGGGCGCCAGAGCTGT	0.552																0.328467	118.714151	122.295665	45	92	KEEP	---	---	---	---	27	24	43	58	-1	capture	Silent	SNP	62550997	62550997	SYT16	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15360	142
AHNAK2	113146	broad.mit.edu	37	14	105409667	105409667	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105409667C>T	uc010axc.1	-	7	12241	c.12121G>A	c.(12121-12123)GTG>ATG	p.V4041M	AHNAK2_uc001ypx.2_Missense_Mutation_p.V3941M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4041						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCTCGGGCACGGGGCCCTCT	0.627																0.305164	164.609515	171.707295	65	148	KEEP	---	---	---	---	36	32	81	82	-1	capture	Missense_Mutation	SNP	105409667	105409667	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	415	142
TEKT5	146279	broad.mit.edu	37	16	10788509	10788509	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10788509C>T	uc002czz.1	-	1	294	c.222G>A	c.(220-222)CCG>CCA	p.P74P		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	74					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						GGATGGTGGGCGGCCGCAGGG	0.642																0.343137	85.578519	87.802634	35	67	KEEP	---	---	---	---	17	21	33	41	-1	capture	Silent	SNP	10788509	10788509	TEKT5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15641	142
TMCO7	79613	broad.mit.edu	37	16	68893945	68893945	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68893945C>A	uc002ewi.3	+	2	265	c.253C>A	c.(253-255)CAA>AAA	p.Q85K	TMCO7_uc002ewh.2_Missense_Mutation_p.Q85K	NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	85						integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		AGAATGGCCACAAAACTCTGT	0.428																0.048077	-16.083566	6.507222	5	99	KEEP	---	---	---	---	4	3	50	61	0.428571428571	capture	Missense_Mutation	SNP	68893945	68893945	TMCO7	16	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	15886	142
PLCG2	5336	broad.mit.edu	37	16	81953214	81953214	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81953214G>A	uc002fgt.2	+	20	2332	c.2180G>A	c.(2179-2181)CGA>CAA	p.R727Q	PLCG2_uc010chg.1_Missense_Mutation_p.R727Q	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	727	SH2 2.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCACTCTACCGAAAGATGAGA	0.557				p.R727Q(SNU81-Tumor)	1880											0.240741	65.195643	71.819978	26	82	KEEP	---	---	---	---	14	15	42	49	-1	capture	Missense_Mutation	SNP	81953214	81953214	PLCG2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11939	142
NECAB2	54550	broad.mit.edu	37	16	84035467	84035467	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84035467G>A	uc002fhd.2	+	12	1095	c.1078G>A	c.(1078-1080)GTC>ATC	p.V360I	NECAB2_uc002fhe.2_Missense_Mutation_p.V277I	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2	360	ABM.				antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						GTTCCGGCACGTCAAGGTGGA	0.647																0.363636	67.116677	68.181869	24	42	KEEP	---	---	---	---	11	15	28	21	-1	capture	Missense_Mutation	SNP	84035467	84035467	NECAB2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10212	142
KIAA1609	57707	broad.mit.edu	37	16	84529371	84529371	+	Missense_Mutation	SNP	C	T	T	rs146039021		TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84529371C>T	uc002fib.2	-	3	409	c.302G>A	c.(301-303)GGA>GAA	p.G101E	KIAA1609_uc010vod.1_Missense_Mutation_p.G74E|KIAA1609_uc002fic.2_RNA	NM_020947	NP_065998	Q6P9B6	K1609_HUMAN	hypothetical protein LOC57707	101							protein binding			ovary(2)	2						CTCGGAGTTTCCTTTCAACAG	0.542																0.274648	103.069365	109.561114	39	103	KEEP	---	---	---	---	32	11	60	51	-1	capture	Missense_Mutation	SNP	84529371	84529371	KIAA1609	16	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8169	142
GSG2	83903	broad.mit.edu	37	17	3628349	3628349	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3628349C>T	uc002fwp.2	+	1	1153	c.1120C>T	c.(1120-1122)CCT>TCT	p.P374S	ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin	374					cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						GGACCTGACTCCTTTACAGAA	0.478					41											0.323308	118.232582	121.944657	43	90	KEEP	---	---	---	---	17	27	39	57	-1	capture	Missense_Mutation	SNP	3628349	3628349	GSG2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6754	142
TP53	7157	broad.mit.edu	37	17	7579374	7579374	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7579374C>G	uc002gim.2	-	4	507	c.313G>C	c.(313-315)GGC>CGC	p.G105R	TP53_uc002gig.1_Missense_Mutation_p.G105R|TP53_uc002gih.2_Missense_Mutation_p.G105R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.G105R|TP53_uc010cni.1_Missense_Mutation_p.G105R|TP53_uc002gij.2_Missense_Mutation_p.G105R|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.G66R|TP53_uc010cnk.1_Missense_Mutation_p.G120R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	105	Interaction with HIPK1 (By similarity).||Interaction with WWOX.		G -> D (in sporadic cancers; somatic mutation).|G -> S (in a sporadic cancer; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.G105C(5)|p.G105fs*18(3)|p.G59fs*23(3)|p.G105R(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G105A(1)|p.G105S(1)|p.G105V(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.G105G(1)|p.G105D(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCGTAGCTGCCCTGGTAGGTT	0.627	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.45098	73.61933	73.725897	23	28	KEEP	---	---	---	---	12	11	12	17	-1	capture	Missense_Mutation	SNP	7579374	7579374	TP53	17	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	16264	142
HNF1B	6928	broad.mit.edu	37	17	36065013	36065013	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36065013G>A	uc002hok.3	-	6	1471	c.1250C>T	c.(1249-1251)ACG>ATG	p.T417M	HNF1B_uc010wdi.1_Missense_Mutation_p.T391M	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1	417					endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GTGGATATTCGTCAAGGTGCT	0.478	Colon(71;102 1179 9001 27917 43397)				411							Hereditary_Prostate_Cancer				0.302326	70.519092	73.518173	26	60	KEEP	---	---	---	---	11	16	21	40	-1	capture	Missense_Mutation	SNP	36065013	36065013	HNF1B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7177	142
EPX	8288	broad.mit.edu	37	17	56280591	56280591	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56280591G>A	uc002ivq.2	+	11	1944	c.1858G>A	c.(1858-1860)GCT>ACT	p.A620T		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	620					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						TGGGGCCATCGCTGAGCCTCT	0.547																0.304636	121.023655	126.149202	46	105	KEEP	---	---	---	---	21	31	57	58	-1	capture	Missense_Mutation	SNP	56280591	56280591	EPX	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5155	142
SETBP1	26040	broad.mit.edu	37	18	42643234	42643234	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:42643234C>T	uc010dni.2	+	6	4658	c.4362C>T	c.(4360-4362)CGC>CGT	p.R1454R		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	1454	A.T hook 3.					nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AGAAGAGGCGCGGGCGTCCCA	0.552												Schinzel-Giedion_syndrome				0.5	29.077957	29.077957	9	9	KEEP	---	---	---	---	3	6	5	5	-1	capture	Silent	SNP	42643234	42643234	SETBP1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14022	142
ST8SIA3	51046	broad.mit.edu	37	18	55024414	55024414	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55024414C>T	uc002lgn.2	+	3	930	c.573C>T	c.(571-573)TTC>TTT	p.F191F		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	191	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GTTGCAATTTCGCCCCTACGG	0.403																0.285714	141.638659	149.129869	52	130	KEEP	---	---	---	---	29	31	56	86	-1	capture	Silent	SNP	55024414	55024414	ST8SIA3	18	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	15123	142
CNN2	1265	broad.mit.edu	37	19	1032680	1032680	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1032680C>T	uc002lqu.2	+	4	738	c.375C>T	c.(373-375)CTC>CTT	p.L125L	CNN2_uc002lqt.1_Silent_p.L125L|CNN2_uc010drz.1_Intron|CNN2_uc002lqv.2_Silent_p.L125L|CNN2_uc010xgb.1_Intron|CNN2_uc010xgc.1_Silent_p.L125L	NM_004368	NP_004359	Q99439	CNN2_HUMAN	calponin 2 isoform a	125	CH.				actomyosin structure organization|cellular response to mechanical stimulus|regulation of actin filament-based process	cell-cell junction|stress fiber	actin binding|calmodulin binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tgtctcttctcgccctggcgg	0.284																0.309524	35.461395	36.818002	13	29	KEEP	---	---	---	---	5	10	14	17	-1	capture	Silent	SNP	1032680	1032680	CNN2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	3575	142
HMHA1	23526	broad.mit.edu	37	19	1080274	1080274	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1080274G>A	uc002lqz.1	+	14	1955	c.1724G>A	c.(1723-1725)CGG>CAG	p.R575Q	HMHA1_uc010xgd.1_Missense_Mutation_p.R591Q|HMHA1_uc010xge.1_Missense_Mutation_p.R415Q|HMHA1_uc002lra.1_Missense_Mutation_p.R415Q|HMHA1_uc002lrb.1_Missense_Mutation_p.R458Q|HMHA1_uc002lrc.1_Missense_Mutation_p.R210Q|HMHA1_uc002lrd.1_5'Flank|HMHA1_uc010dsd.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	575					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCGTGCCCGGAAGAGCAGC	0.642																0.24537	140.817656	153.538624	53	163	KEEP	---	---	---	---	24	41	74	109	-1	capture	Missense_Mutation	SNP	1080274	1080274	HMHA1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7165	142
TLE2	7089	broad.mit.edu	37	19	3005947	3005947	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3005947C>T	uc002lww.2	-	16	1783	c.1520G>A	c.(1519-1521)CGT>CAT	p.R507H	TLE2_uc010xhb.1_Missense_Mutation_p.R174H|TLE2_uc010dth.2_Missense_Mutation_p.R508H|TLE2_uc010xhc.1_Missense_Mutation_p.R385H|TLE2_uc010dti.2_Missense_Mutation_p.R521H	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1	507	WD 2.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGCAGGAACGAATGTAGTT	0.632																0.197368	31.782169	38.265532	15	61	KEEP	---	---	---	---	10	7	36	40	-1	capture	Missense_Mutation	SNP	3005947	3005947	TLE2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15824	142
EMR3	84658	broad.mit.edu	37	19	14758015	14758015	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14758015G>A	uc002mzi.3	-	8	1008	c.860C>T	c.(859-861)ACG>ATG	p.T287M	EMR3_uc010dzp.2_Missense_Mutation_p.T235M|EMR3_uc010xnv.1_Missense_Mutation_p.T161M	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor	287	Extracellular (Potential).				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						GAAAGTCAGCGTCACAGACTT	0.483																0.253927	246.499407	267.489885	97	285	KEEP	---	---	---	---	33	82	141	173	-1	capture	Missense_Mutation	SNP	14758015	14758015	EMR3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5061	142
ZNF676	163223	broad.mit.edu	37	19	22364158	22364158	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22364158C>T	uc002nqs.1	-	3	679	c.361G>A	c.(361-363)GTC>ATC	p.V121I		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TTATGAAAGACGTTTGCATAT	0.333																0.230241	160.376628	179.786116	67	224	KEEP	---	---	---	---	32	40	116	117	-1	capture	Missense_Mutation	SNP	22364158	22364158	ZNF676	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17961	142
KIRREL2	84063	broad.mit.edu	37	19	36351505	36351505	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36351505C>T	uc002ocb.3	+	7	1076	c.864C>T	c.(862-864)CCC>CCT	p.P288P	KIRREL2_uc002obz.3_Silent_p.P288P|KIRREL2_uc002oca.3_Silent_p.P238P|KIRREL2_uc002occ.3_Silent_p.P235P|KIRREL2_uc002ocd.3_Silent_p.P285P	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	288	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGACTGAGCCCGTGTCCTGCG	0.662																0.216216	55.957196	64.199686	24	87	KEEP	---	---	---	---	16	13	46	52	-1	capture	Silent	SNP	36351505	36351505	KIRREL2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8247	142
ZNF780B	163131	broad.mit.edu	37	19	40541725	40541725	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40541725C>G	uc002omu.2	-	5	1106	c.1041G>C	c.(1039-1041)AAG>AAC	p.K347N	ZNF780B_uc002omv.2_Missense_Mutation_p.K199N	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	347	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GTCGAACAAGCTTTGTCAGAA	0.423																0.345324	151.653546	154.592219	48	91	KEEP	---	---	---	---	30	19	44	48	-1	capture	Missense_Mutation	SNP	40541725	40541725	ZNF780B	19	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	18029	142
NLRP7	199713	broad.mit.edu	37	19	55449589	55449589	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55449589G>A	uc002qih.3	-	5	2028	c.1952C>T	c.(1951-1953)CCG>CTG	p.P651L	NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Missense_Mutation_p.P651L|NLRP7_uc010esk.2_Missense_Mutation_p.P651L|NLRP7_uc010esl.2_Missense_Mutation_p.P679L	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	651			P -> S (in HYDM).				ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		AGCCCAGTTCGGAATGGTTAG	0.453																0.238095	110.01534	120.540769	40	128	KEEP	---	---	---	---	25	24	61	85	-1	capture	Missense_Mutation	SNP	55449589	55449589	NLRP7	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10389	142
B3GNT2	10678	broad.mit.edu	37	2	62450208	62450208	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:62450208A>G	uc002sbs.2	+	2	1091	c.853A>G	c.(853-855)AAG>GAG	p.K285E		NM_006577	NP_006568	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal	285	Lumenal (Potential).					Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			TCATCGGGATAAGAAGCTGAA	0.502																0.297753	171.014567	177.517912	53	125	KEEP	---	---	---	---	30	24	62	73	-1	capture	Missense_Mutation	SNP	62450208	62450208	B3GNT2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	1246	142
PSD4	23550	broad.mit.edu	37	2	113950118	113950118	+	Missense_Mutation	SNP	G	A	A	rs140435814	byFrequency	TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113950118G>A	uc002tjc.2	+	6	1973	c.1790G>A	c.(1789-1791)CGC>CAC	p.R597H	PSD4_uc002tjd.2_Missense_Mutation_p.R218H|PSD4_uc002tje.2_Missense_Mutation_p.R568H|PSD4_uc002tjf.2_Missense_Mutation_p.R218H	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	597	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CGCCTCTATCGCCTGGAGGGC	0.597																0.255639	76.595711	83.796713	34	99	KEEP	---	---	---	---	15	23	53	68	-1	capture	Missense_Mutation	SNP	113950118	113950118	PSD4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12544	142
TTN	7273	broad.mit.edu	37	2	179474032	179474032	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179474032G>A	uc010zfg.1	-	222	44525	c.44301C>T	c.(44299-44301)CGC>CGT	p.R14767R	uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R8462R|TTN_uc010zfi.1_Silent_p.R8395R|TTN_uc010zfj.1_Silent_p.R8270R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15694							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCTCGGACGCGTAGCTGAG	0.458					8722											0.333333	63.605209	65.301049	23	46	KEEP	---	---	---	---	14	11	33	18	-1	capture	Silent	SNP	179474032	179474032	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16617	142
ASXL1	171023	broad.mit.edu	37	20	31022345	31022345	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31022345C>T	uc002wxs.2	+	12	2256	c.1830C>T	c.(1828-1830)GGC>GGT	p.G610G	ASXL1_uc010geb.2_Silent_p.G501G	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	610					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	p.Q592fs*5(1)|p.G610G(1)		haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						GTTGGACTGGCGCCAGGACCC	0.632						F|N|Mis		MDS|CMML								0.368421	79.623863	80.762392	28	48	KEEP	---	---	---	---	17	13	29	27	-1	capture	Silent	SNP	31022345	31022345	ASXL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1057	142
KRTAP10-10	353333	broad.mit.edu	37	21	46057496	46057496	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46057496G>A	uc002zfq.2	+	1	224	c.162G>A	c.(160-162)CAG>CAA	p.Q54Q	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181688	NP_859016	P60014	KR10A_HUMAN	keratin associated protein 10-10	54	3.|15 X 5 AA repeats of C-C-X(3).					keratin filament					0						CCTGCTGCCAGACGGCCTGTG	0.657																0.54	178.940862	179.078587	54	46	KEEP	---	---	---	---	27	37	24	27	-1	capture	Silent	SNP	46057496	46057496	KRTAP10-10	21	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	8426	142
COL18A1	80781	broad.mit.edu	37	21	46911174	46911174	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46911174C>T	uc011afs.1	+	21	3369	c.3348C>T	c.(3346-3348)GGC>GGT	p.G1116G	COL18A1_uc002zhg.2_Silent_p.G701G|COL18A1_uc002zhi.2_Silent_p.G881G	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	1116	Triple-helical region 4 (COL4).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGCAGCCGGGCCTCCCTGGCC	0.682					1836											0.409091	47.619938	47.941609	18	26	KEEP	---	---	---	---	5	19	14	19	-1	capture	Silent	SNP	46911174	46911174	COL18A1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3640	142
COL6A2	1292	broad.mit.edu	37	21	47538549	47538549	+	Missense_Mutation	SNP	C	T	T	rs142880107		TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47538549C>T	uc002zia.1	+	13	1220	c.1138C>T	c.(1138-1140)CGC>TGC	p.R380C	COL6A2_uc002zhy.1_Missense_Mutation_p.R380C|COL6A2_uc002zhz.1_Missense_Mutation_p.R380C|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	380	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCCCAGGACGCAGAGGGCC	0.682																0.282051	25.942779	27.587387	11	28	KEEP	---	---	---	---	5	6	12	23	-1	capture	Missense_Mutation	SNP	47538549	47538549	COL6A2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3665	142
ZNF445	353274	broad.mit.edu	37	3	44488333	44488333	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:44488333G>C	uc003cnf.2	-	8	3178	c.2830C>G	c.(2830-2832)CTA>GTA	p.L944V	ZNF445_uc011azv.1_Missense_Mutation_p.L932V|ZNF445_uc011azw.1_Missense_Mutation_p.L944V	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	944					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CTTGGTTTTAGCTTCTGTAAT	0.522																0.265193	145.418498	154.436314	48	133	KEEP	---	---	---	---	27	21	62	78	-1	capture	Missense_Mutation	SNP	44488333	44488333	ZNF445	3	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	17797	142
DNAH1	25981	broad.mit.edu	37	3	52417479	52417479	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52417479C>T	uc011bef.1	+	51	8280	c.8019C>T	c.(8017-8019)GAC>GAT	p.D2673D	DNAH1_uc003ddv.2_5'Flank	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2673	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATACTGCGGACGAGCAGGACC	0.557																0.395349	48.9627	49.375658	17	26	KEEP	---	---	---	---	3	14	11	17	-1	capture	Silent	SNP	52417479	52417479	DNAH1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4555	142
OR5K4	403278	broad.mit.edu	37	3	98072705	98072705	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98072705G>T	uc011bgv.1	+	1	8	c.8G>T	c.(7-9)AGG>ATG	p.R3M		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	3	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						GGAATGGCTAGGGAAAATCAC	0.393																0.338028	127.070251	130.357881	48	94	KEEP	---	---	---	---	27	23	52	51	0.54	capture	Missense_Mutation	SNP	98072705	98072705	OR5K4	3	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	11073	142
LRRC31	79782	broad.mit.edu	37	3	169579511	169579511	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169579511T>C	uc003fgc.1	-	2	343	c.266A>G	c.(265-267)AAG>AGG	p.K89R	LRRC31_uc010hwp.1_Missense_Mutation_p.K89R	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	89										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			ATCTAGACACTTGTTGACAGC	0.428																0.350711	500.079939	508.3742	148	274	KEEP	---	---	---	---	79	79	149	154	-1	capture	Missense_Mutation	SNP	169579511	169579511	LRRC31	3	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	8902	142
TLL1	7092	broad.mit.edu	37	4	166963247	166963247	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166963247C>T	uc003irh.1	+	11	1977	c.1330C>T	c.(1330-1332)CGT>TGT	p.R444C	TLL1_uc011cjn.1_Missense_Mutation_p.R444C|TLL1_uc011cjo.1_Missense_Mutation_p.R268C	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	444	CUB 1.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GATTGAGTTTCGTAGCAGCAG	0.368																0.349057	216.589577	220.850355	74	138	KEEP	---	---	---	---	38	41	72	77	-1	capture	Missense_Mutation	SNP	166963247	166963247	TLL1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15830	142
SLC9A3	6550	broad.mit.edu	37	5	492029	492029	+	Silent	SNP	G	A	A	rs144657077		TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:492029G>A	uc003jbe.2	-	2	481	c.369C>T	c.(367-369)ATC>ATT	p.I123I	SLC9A3_uc011clx.1_Silent_p.I123I	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	123	Helical; Name=D/M4; (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGTCCAGCACGATGGGGGGCA	0.652																0.357143	13.673974	13.924317	5	9	KEEP	---	---	---	---	2	3	5	5	-1	capture	Silent	SNP	492029	492029	SLC9A3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	14605	142
CMBL	134147	broad.mit.edu	37	5	10290849	10290849	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10290849G>A	uc003jes.2	-	2	477	c.26C>T	c.(25-27)CCG>CTG	p.P9L		NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase	9						cytosol	hydrolase activity|protein binding			skin(1)	1						AATGTCACACGGACAAGGATA	0.468																0.349593	127.197938	129.64849	43	80	KEEP	---	---	---	---	34	20	47	55	-1	capture	Missense_Mutation	SNP	10290849	10290849	CMBL	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3541	142
PRDM9	56979	broad.mit.edu	37	5	23523456	23523456	+	Silent	SNP	C	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23523456C>A	uc003jgo.2	+	9	1121	c.939C>A	c.(937-939)GCC>GCA	p.A313A		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	313	SET.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AATCCTGGGCCAACTGGATGA	0.438													HNSCC(3;0.000094)			0.267442	58.078475	62.284723	23	63	KEEP	---	---	---	---	7	21	29	42	0.75	capture	Silent	SNP	23523456	23523456	PRDM9	5	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	12359	142
HCN1	348980	broad.mit.edu	37	5	45262901	45262901	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262901A>G	uc003jok.2	-	8	1820	c.1795T>C	c.(1795-1797)TCA>CCA	p.S599P		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	599	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AGAAGAATTGAATTTTTCTTT	0.413																0.301887	103.963219	107.675523	32	74	KEEP	---	---	---	---	23	13	42	38	-1	capture	Missense_Mutation	SNP	45262901	45262901	HCN1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	6922	142
TRPC7	57113	broad.mit.edu	37	5	135692836	135692836	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135692836G>A	uc003lbn.1	-	1	240	c.237C>T	c.(235-237)AAC>AAT	p.N79N	TRPC7_uc010jef.1_Silent_p.N71N|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.N71N|TRPC7_uc010jei.1_Silent_p.N71N|TRPC7_uc010jej.1_Translation_Start_Site	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	80	Cytoplasmic (Potential).|ANK 2.				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGCAGAGCGTTCTGCCCCA	0.607																0.294521	112.040151	117.514999	43	103	KEEP	---	---	---	---	10	37	52	59	-1	capture	Silent	SNP	135692836	135692836	TRPC7	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16467	142
PPARGC1B	133522	broad.mit.edu	37	5	149212575	149212575	+	Silent	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149212575C>T	uc003lrc.2	+	5	981	c.939C>T	c.(937-939)CCC>CCT	p.P313P	PPARGC1B_uc003lrb.1_Silent_p.P313P|PPARGC1B_uc003lrd.2_Silent_p.P274P|PPARGC1B_uc003lrf.2_Silent_p.P292P|PPARGC1B_uc003lre.1_Silent_p.P292P	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	313					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			AGCCACTCCCCAAGGCCTGCA	0.627																0.298969	73.819812	77.334965	29	68	KEEP	---	---	---	---	21	19	37	44	-1	capture	Silent	SNP	149212575	149212575	PPARGC1B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	12202	142
FAT2	2196	broad.mit.edu	37	5	150901466	150901466	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150901466G>A	uc003lue.3	-	18	10701	c.10688C>T	c.(10687-10689)ACG>ATG	p.T3563M	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.T256M	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3563	Cadherin 32.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATAGGTCAGCGTGTCCTGGGG	0.602																0.376812	74.832799	75.751804	26	43	KEEP	---	---	---	---	11	16	25	23	-1	capture	Missense_Mutation	SNP	150901466	150901466	FAT2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5636	142
F13A1	2162	broad.mit.edu	37	6	6267040	6267040	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:6267040G>A	uc003mwv.2	-	4	445	c.322C>T	c.(322-324)CGC>TGC	p.R108C	F13A1_uc011dib.1_Missense_Mutation_p.R45C	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	108					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TGTGGGTAGCGACCTATGAGA	0.448																0.284519	177.304694	187.265321	68	171	KEEP	---	---	---	---	34	41	91	98	-1	capture	Missense_Mutation	SNP	6267040	6267040	F13A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5294	142
HIST1H2BA	255626	broad.mit.edu	37	6	25727485	25727485	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25727485A>G	uc003nfd.2	+	1	349	c.349A>G	c.(349-351)ACC>GCC	p.T117A	HIST1H2AA_uc003nfc.2_5'Flank	NM_170610	NP_733759	Q96A08	H2B1A_HUMAN	histone cluster 1, H2ba	117					nucleosome assembly	nucleosome|nucleus	DNA binding			kidney(1)	1						GTCTGAGGGCACCAAGGCTGT	0.488																0.216667	28.594568	33.102509	13	47	KEEP	---	---	---	---	5	9	22	34	-1	capture	Missense_Mutation	SNP	25727485	25727485	HIST1H2BA	6	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	7065	142
SCAND3	114821	broad.mit.edu	37	6	28539828	28539828	+	Missense_Mutation	SNP	C	T	T	rs140560647		TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28539828C>T	uc003nlo.2	-	4	4456	c.3838G>A	c.(3838-3840)GGA>AGA	p.G1280R		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	1280					DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						gtagagaatccggtctcacag	0.000																0.416058	181.55504	182.396817	57	80	KEEP	---	---	---	---	27	32	43	45	-1	capture	Missense_Mutation	SNP	28539828	28539828	SCAND3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13768	142
VARS	7407	broad.mit.edu	37	6	31749730	31749730	+	Splice_Site	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31749730C>T	uc003nxe.2	-	19	2665	c.2242_splice	c.e19-1	p.D748_splice	VARS_uc003nxf.1_5'Flank|VARS_uc011doi.1_Splice_Site	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase						translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)	CATCAGGGTCCTGCCACAGGT	0.632																0.1	6.670188	17.859514	7	63	KEEP	---	---	---	---	4	3	98	97	-1	capture	Splice_Site	SNP	31749730	31749730	VARS	6	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	17005	142
C6orf165	154313	broad.mit.edu	37	6	88140868	88140868	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:88140868C>T	uc003plv.2	+	10	1369	c.1277C>T	c.(1276-1278)GCA>GTA	p.A426V	C6orf165_uc003plw.2_Missense_Mutation_p.A238V|C6orf165_uc010kbv.1_RNA|C6orf165_uc003plu.1_Missense_Mutation_p.A426V	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	426										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		ACGTTTGCTGCAACAGATGGT	0.378																0.275	106.882614	114.215737	44	116	KEEP	---	---	---	---	21	25	75	59	-1	capture	Missense_Mutation	SNP	88140868	88140868	C6orf165	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2318	142
USP45	85015	broad.mit.edu	37	6	99930669	99930669	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:99930669G>A	uc003ppx.2	-	8	1338	c.805C>T	c.(805-807)CCA>TCA	p.P269S	USP45_uc003ppw.2_Intron|USP45_uc003ppy.2_RNA|USP45_uc010kcq.1_Missense_Mutation_p.P269S|USP45_uc003ppz.2_Missense_Mutation_p.P269S|USP45_uc003pqa.2_Missense_Mutation_p.P269S	NM_001080481	NP_001073950	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	269					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|breast(1)	2		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		GGAGAAAGTGGTCCTTTTTCA	0.378																0.319018	142.435748	147.184017	52	111	KEEP	---	---	---	---	24	30	73	46	-1	capture	Missense_Mutation	SNP	99930669	99930669	USP45	6	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16958	142
PTPRK	5796	broad.mit.edu	37	6	128304041	128304041	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:128304041C>T	uc003qbk.2	-	24	3836	c.3469G>A	c.(3469-3471)GCA>ACA	p.A1157T	PTPRK_uc003qbj.2_Missense_Mutation_p.A1158T|PTPRK_uc010kfc.2_Missense_Mutation_p.A1164T|PTPRK_uc011ebu.1_Missense_Mutation_p.A1180T	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1157	Cytoplasmic (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TCAAAATATGCAGCTTTAAAT	0.338																0.022831	-48.134692	7.456796	5	214	KEEP	---	---	---	---	1	4	116	127	-1	capture	Missense_Mutation	SNP	128304041	128304041	PTPRK	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	12700	142
TAAR5	9038	broad.mit.edu	37	6	132910519	132910519	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:132910519C>T	uc003qdk.2	-	1	359	c.307G>A	c.(307-309)GGG>AGG	p.G103R		NM_003967	NP_003958	O14804	TAAR5_HUMAN	trace amine associated receptor 5	103	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGGAAGTCCCCGAAGAACCAG	0.582																0.050314	-17.554205	16.460157	8	151	KEEP	---	---	---	---	4	5	71	97	-1	capture	Missense_Mutation	SNP	132910519	132910519	TAAR5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15379	142
DNAH11	8701	broad.mit.edu	37	7	21640705	21640705	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21640705G>A	uc003svc.2	+	17	3364	c.3333G>A	c.(3331-3333)GTG>GTA	p.V1111V		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1111	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGTTCAAGGTGGACATGAAGC	0.353												Kartagener_syndrome				0.283465	98.942448	104.292707	36	91	KEEP	---	---	---	---	15	23	46	47	-1	capture	Silent	SNP	21640705	21640705	DNAH11	7	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4557	142
GPNMB	10457	broad.mit.edu	37	7	23286464	23286464	+	Translation_Start_Site	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23286464G>A	uc003swc.2	+	1	149	c.-12G>A	c.(-14--10)CCGTG>CCATG		GPNMB_uc003swa.2_Translation_Start_Site|GPNMB_uc003swb.2_Translation_Start_Site|GPNMB_uc011jyy.1_Translation_Start_Site|GPNMB_uc011jyz.1_Translation_Start_Site	NM_001005340	NP_001005340	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb isoform a						negative regulation of cell proliferation	melanosome				ovary(3)|breast(2)	5			GBM - Glioblastoma multiforme(13;0.154)			GCCTGCGTCCGTGAGAATTCA	0.488																0.287671	114.742334	120.614758	42	104	KEEP	---	---	---	---	23	23	57	51	-1	capture	Translation_Start_Site	SNP	23286464	23286464	GPNMB	7	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	6554	142
AVL9	23080	broad.mit.edu	37	7	32620473	32620473	+	Missense_Mutation	SNP	G	C	C	rs150772071	byFrequency	TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:32620473G>C	uc003tcv.1	+	15	1948	c.1802G>C	c.(1801-1803)CGG>CCG	p.R601P	AVL9_uc011kai.1_Intron|AVL9_uc010kwj.1_Missense_Mutation_p.G385R	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	601						integral to membrane					0						ACAACTAGCCGGAATGTTGTA	0.353																0.206349	29.035927	34.078355	13	50	KEEP	---	---	---	---	6	8	24	32	-1	capture	Missense_Mutation	SNP	32620473	32620473	AVL9	7	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	1218	142
EGFR	1956	broad.mit.edu	37	7	55210077	55210077	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55210077G>A	uc003tqk.2	+	2	433	c.187G>A	c.(187-189)GGG>AGG	p.G63R	EGFR_uc003tqh.2_Missense_Mutation_p.G63R|EGFR_uc003tqi.2_Missense_Mutation_p.G63R|EGFR_uc003tqj.2_Missense_Mutation_p.G63R|EGFR_uc010kzg.1_Missense_Mutation_p.G63R|EGFR_uc011kco.1_Missense_Mutation_p.G10R	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	63	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.G63R(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGTGGTCCTTGGGAATTTGGA	0.398			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.174545	100.620337	128.112206	48	227	KEEP	---	---	---	---	26	26	127	120	-1	capture	Missense_Mutation	SNP	55210077	55210077	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4922	142
GRM8	2918	broad.mit.edu	37	7	126173853	126173853	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126173853G>A	uc003vlr.2	-	8	1894	c.1583C>T	c.(1582-1584)ACG>ATG	p.T528M	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.T528M|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	528	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CCCTTTCACCGTTTTCTTCCT	0.542													HNSCC(24;0.065)			0.258216	132.392003	143.707253	55	158	KEEP	---	---	---	---	26	33	98	81	-1	capture	Missense_Mutation	SNP	126173853	126173853	GRM8	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6736	142
TAS2R41	259287	broad.mit.edu	37	7	143175209	143175209	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143175209C>T	uc003wdc.1	+	1	244	c.244C>T	c.(244-246)CGA>TGA	p.R82*	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	82	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					GGGTCTCGGCCGACAGTTCTT	0.542																0.286486	151.177365	158.697388	53	132	KEEP	---	---	---	---	27	31	69	72	-1	capture	Nonsense_Mutation	SNP	143175209	143175209	TAS2R41	7	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	15467	142
ZNF862	643641	broad.mit.edu	37	7	149557807	149557807	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149557807G>T	uc010lpn.2	+	7	1750	c.1558G>T	c.(1558-1560)GAA>TAA	p.E520*	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	520	TTF-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						AAAATACCATGAAGTCAGCAA	0.488																0.226415	83.110099	94.042854	36	123	KEEP	---	---	---	---	15	21	58	68	0.416666666667	capture	Nonsense_Mutation	SNP	149557807	149557807	ZNF862	7	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	18071	142
SFTPC	6440	broad.mit.edu	37	8	22020147	22020147	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22020147C>T	uc003xax.3	+	2	261	c.103C>T	c.(103-105)CGC>TGC	p.R35C	SFTPC_uc003xaw.3_Missense_Mutation_p.R84C|SFTPC_uc011kza.1_Missense_Mutation_p.R35C|SFTPC_uc003xaz.2_Missense_Mutation_p.R35C|SFTPC_uc003xay.3_Missense_Mutation_p.R35C|BMP1_uc011kzb.1_5'Flank|BMP1_uc003xba.2_5'Flank|BMP1_uc003xbb.2_5'Flank|BMP1_uc003xbe.2_5'Flank|BMP1_uc003xbc.2_5'Flank|BMP1_uc003xbd.2_5'Flank|BMP1_uc003xbf.2_5'Flank|BMP1_uc003xbg.2_5'Flank|BMP1_uc011kzc.1_5'Flank|BMP1_uc003xbh.2_5'Flank|BMP1_uc003xbi.2_5'Flank	NM_003018	NP_003009	P11686	PSPC_HUMAN	surfactant protein C precursor	35					respiratory gaseous exchange	extracellular space					0				Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GCACCTGAAACGCCTTCTTAT	0.602																0.4	181.819026	183.174159	62	93	KEEP	---	---	---	---	41	28	65	42	-1	capture	Missense_Mutation	SNP	22020147	22020147	SFTPC	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14085	142
ADAM28	10863	broad.mit.edu	37	8	24199174	24199174	+	Silent	SNP	G	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24199174G>T	uc003xdy.2	+	16	1817	c.1734G>T	c.(1732-1734)CGG>CGT	p.R578R	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Silent_p.R265R	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	578	Extracellular (Potential).|Cys-rich.				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding	p.R578R(1)		skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GGAAAGGACGGATAGTGACTT	0.423	NSCLC(193;488 2149 22258 34798 40734)				410											0.353234	191.202717	195.003532	71	130	KEEP	---	---	---	---	36	45	67	73	0.444444444444	capture	Silent	SNP	24199174	24199174	ADAM28	8	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	246	142
UBE2W	55284	broad.mit.edu	37	8	74722708	74722709	+	Splice_Site	DNP	CC	AA	AA			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74722708_74722709CC>AA	uc003xzv.2	-	4	419	c.366_splice	c.e4+1	p.K122_splice	UBE2W_uc003xzt.2_Splice_Site_p.K122_splice|UBE2W_uc003xzu.2_Splice_Site_p.K133_splice|UBE2W_uc003xzw.2_Splice_Site	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			AAAAGTCTTACCTTTTCCTTGC	0.327	Pancreas(14;490 592 20090 21022 23311)															0.142857	29.021529	42.789938	16	96	KEEP	---	---	---	---	0	0	0	0	-1	capture	Splice_Site	DNP	74722708	74722709	UBE2W	8	CC	AA	AA	AA	1	0	0	0	0	0	0	1	0	234	18	5	4	16759	142
SLC26A7	115111	broad.mit.edu	37	8	92407320	92407320	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:92407320G>A	uc003yex.2	+	20	2244	c.1966G>A	c.(1966-1968)GTC>ATC	p.V656I	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yfa.2_Missense_Mutation_p.V656I	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	656	Cytoplasmic (Potential).|Membrane targeting.					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CCACAGTGAAGTCTGAGACCC	0.393																0.06	-20.673685	40.035113	18	282	KEEP	---	---	---	---	12	10	173	154	-1	capture	Missense_Mutation	SNP	92407320	92407320	SLC26A7	8	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	14414	142
TG	7038	broad.mit.edu	37	8	133880390	133880390	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133880390C>T	uc003ytw.2	+	2	139	c.98C>T	c.(97-99)CCC>CTC	p.P33L		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	33	Thyroglobulin type-1 1.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCCTTCGTCCCTGTGAGCTG	0.552					1778											0.32	71.274487	73.432953	24	51	KEEP	---	---	---	---	14	14	27	31	-1	capture	Missense_Mutation	SNP	133880390	133880390	TG	8	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15698	142
CYC1	1537	broad.mit.edu	37	8	145151572	145151572	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145151572T>A	uc003zaz.3	+	5	740	c.697T>A	c.(697-699)TTC>ATC	p.F233I	CYC1_uc003zay.2_Missense_Mutation_p.F174I	NM_001916	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	233					respiratory electron transport chain|transport	cell junction|integral to membrane|mitochondrial inner membrane|respiratory chain	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity|heme binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGGTCTCTACTTCAACCCCTA	0.582																0.417391	139.970689	140.657601	48	67	KEEP	---	---	---	---	32	25	41	35	-1	capture	Missense_Mutation	SNP	145151572	145151572	CYC1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	4095	142
APBA1	320	broad.mit.edu	37	9	72131360	72131360	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:72131360G>A	uc004ahh.2	-	2	1043	c.767C>T	c.(766-768)GCG>GTG	p.A256V		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	256	Munc-18-1 binding.				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						CGGGTAGGGCGCGAACTCGGC	0.682																0.25	27.222031	29.709806	11	33	KEEP	---	---	---	---	7	8	15	27	-1	capture	Missense_Mutation	SNP	72131360	72131360	APBA1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	749	142
DENND1A	57706	broad.mit.edu	37	9	126219637	126219637	+	Silent	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:126219637G>A	uc004bnz.1	-	15	1409	c.1176C>T	c.(1174-1176)GGC>GGT	p.G392G	DENND1A_uc011lzl.1_Silent_p.G167G|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Silent_p.G360G|DENND1A_uc004boa.1_Silent_p.G392G|DENND1A_uc004bob.1_Silent_p.G362G|DENND1A_uc004boc.2_Silent_p.G360G	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	392						cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						CAGCGTACTCGCCCATGTTGA	0.438																0.357692	263.902243	268.539385	93	167	KEEP	---	---	---	---	49	56	93	103	-1	capture	Silent	SNP	126219637	126219637	DENND1A	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4384	142
ARSD	414	broad.mit.edu	37	X	2840042	2840042	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2840042G>C	uc004cqy.2	-	3	294	c.218C>G	c.(217-219)GCA>GGA	p.A73G	ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Missense_Mutation_p.A73G|ARSD_uc004crb.3_Missense_Mutation_p.A73G	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	73						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACCTTCCTCTGCAAGCTGGTC	0.547																0.345455	60.76008	61.942368	19	36	KEEP	---	---	---	---	14	8	23	16	-1	capture	Missense_Mutation	SNP	2840042	2840042	ARSD	23	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	982	142
PPEF1	5475	broad.mit.edu	37	X	18845405	18845405	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18845405G>A	uc004cyq.2	+	19	2243	c.1762G>A	c.(1762-1764)GTG>ATG	p.V588M	PPEF1_uc004cyp.2_Missense_Mutation_p.V560M|PPEF1_uc004cyr.2_Missense_Mutation_p.V526M|PPEF1_uc004cys.2_Missense_Mutation_p.V588M|PPEF1_uc011mja.1_Missense_Mutation_p.V523M|PPEF1_uc011mjb.1_Missense_Mutation_p.V532M	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	588	EF-hand 2.|1 (Potential).				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					CCTGATCTCCGTGGAAGAATT	0.418																0.353774	218.073047	222.064726	75	137	KEEP	---	---	---	---	42	42	75	75	-1	capture	Missense_Mutation	SNP	18845405	18845405	PPEF1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12208	142
CCDC22	28952	broad.mit.edu	37	X	49093699	49093699	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49093699G>A	uc004dnd.1	+	2	353	c.197G>A	c.(196-198)CGC>CAC	p.R66H	CCDC22_uc011mna.1_Missense_Mutation_p.R66H|CCDC22_uc004dnc.1_RNA	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22	66										central_nervous_system(1)	1						GCCCGGTTCCGCCTGGCCATG	0.587																0.346939	91.549604	93.562799	34	64	KEEP	---	---	---	---	19	17	27	49	-1	capture	Missense_Mutation	SNP	49093699	49093699	CCDC22	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2771	142
GPR174	84636	broad.mit.edu	37	X	78427086	78427086	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78427086T>A	uc004edg.1	+	1	618	c.582T>A	c.(580-582)TTT>TTA	p.F194L		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	194	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TGATTGGGTTTGTAACTCCGC	0.453													HNSCC(63;0.18)			0.318627	180.499251	186.465731	65	139	KEEP	---	---	---	---	29	44	78	69	-1	capture	Missense_Mutation	SNP	78427086	78427086	GPR174	23	T	A	A	A	1	0	0	0	0	1	0	0	0	816	63	4	4	6606	142
SYTL4	94121	broad.mit.edu	37	X	99956599	99956599	+	Missense_Mutation	SNP	G	A	A	rs151147513		TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99956599G>A	uc004egd.3	-	5	537	c.181C>T	c.(181-183)CGG>TGG	p.R61W	SYTL4_uc010nnc.2_Missense_Mutation_p.R61W|SYTL4_uc004ege.3_Missense_Mutation_p.R61W|SYTL4_uc004egf.3_Missense_Mutation_p.R61W|SYTL4_uc004egg.3_Missense_Mutation_p.R61W	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	61	RabBD.				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GCACAGGTCCGATCACTGTAG	0.537																0.192547	65.831587	80.043512	31	130	KEEP	---	---	---	---	19	17	73	79	-1	capture	Missense_Mutation	SNP	99956599	99956599	SYTL4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	15373	142
ZCCHC12	170261	broad.mit.edu	37	X	117959260	117959260	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117959260T>G	uc004equ.2	+	4	526	c.53T>G	c.(52-54)TTG>TGG	p.L18W		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	18					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						AATGCACCCTTGCCGCCTTGG	0.473																0.345455	123.142806	125.497576	38	72	KEEP	---	---	---	---	22	20	36	46	-1	capture	Missense_Mutation	SNP	117959260	117959260	ZCCHC12	23	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	17461	142
KIAA1210	57481	broad.mit.edu	37	X	118250604	118250604	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118250604C>A	uc004era.3	-	4	505	c.505G>T	c.(505-507)GCC>TCC	p.A169S		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	169										ovary(4)|skin(1)	5						CTCTTAAGGGCTTTAAATTTG	0.398																0.325581	39.133946	40.295226	14	29	KEEP	---	---	---	---	7	8	14	17	0.533333333333	capture	Missense_Mutation	SNP	118250604	118250604	KIAA1210	23	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	8136	142
GPR112	139378	broad.mit.edu	37	X	135455198	135455198	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135455198C>A	uc004ezu.1	+	15	8042	c.7751C>A	c.(7750-7752)TCC>TAC	p.S2584Y	GPR112_uc010nsb.1_Missense_Mutation_p.S2379Y	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2584	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AGCATTCACTCCTATGAAGAA	0.537					487											0.315217	379.409714	393.382441	145	315	KEEP	---	---	---	---	73	81	190	157	0.525974025974	capture	Missense_Mutation	SNP	135455198	135455198	GPR112	23	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	6563	142
KCNC4	3749	broad.mit.edu	37	1	110754401	110754403	+	In_Frame_Del	DEL	TTC	-	-			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110754401_110754403delTTC	uc001dzh.2	+	1	337_339	c.280_282delTTC	c.(280-282)TTCdel	p.F96del	KCNC4_uc001dzf.2_In_Frame_Del_p.F96del|KCNC4_uc009wfr.2_In_Frame_Del_p.F96del|KCNC4_uc001dzg.2_In_Frame_Del_p.F96del|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	96	Cytoplasmic (Potential).				synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		gggctgcgAGTTCTTCTTCGACA	0.537																0.37			10	17		---	---	---	---						capture_indel	In_Frame_Del	DEL	110754401	110754403	KCNC4	1	TTC	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	7939	142
TOP3A	7156	broad.mit.edu	37	17	18210245	18210246	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18210245_18210246delTC	uc002gsx.1	-	4	578_579	c.349_350delGA	c.(349-351)GAAfs	p.E117fs	TOP3A_uc002gsw.1_5'UTR|TOP3A_uc010vxs.1_Frame_Shift_Del_p.E15fs|TOP3A_uc010cqa.1_RNA	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	117	Toprim.				DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						CTTTTCAATTTCTGCTTCAAAG	0.426																0.32			29	61		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	18210245	18210246	TOP3A	17	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	16250	142
NF1	4763	broad.mit.edu	37	17	29685497	29685497	+	Splice_Site	DEL	G	-	-			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29685497delG	uc002hgg.2	+	55	8304	c.7971_splice	c.e55-1	p.V2657_splice	NF1_uc002hgh.2_Splice_Site_p.V2636_splice|NF1_uc010cso.2_Splice_Site_p.V845_splice|NF1_uc010wbt.1_Splice_Site_p.V135_splice|NF1_uc010wbu.1_Splice_Site	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTTCTTTTAGGCATAATTTG	0.333					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.51			28	27		---	---	---	---						capture_indel	Splice_Site	DEL	29685497	29685497	NF1	17	G	-	-	-	1	0	1	0	1	0	0	1	0	455	35	5	5	10263	142
KRT23	25984	broad.mit.edu	37	17	39087633	39087633	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39087633delG	uc002hvm.1	-	3	1060	c.471delC	c.(469-471)TTCfs	p.F157fs	KRT23_uc010wfl.1_Frame_Shift_Del_p.F20fs|KRT23_uc010cxf.1_5'UTR|KRT23_uc010cxg.2_Frame_Shift_Del_p.F157fs|KRT23_uc002hvn.1_Frame_Shift_Del_p.F157fs	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23	157	Rod.|Coil 1B.					intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)				ACTTGAGGTTGAAGTCATCCA	0.338																0.31			37	84		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39087633	39087633	KRT23	17	G	-	-	-	1	0	1	0	1	0	0	0	0	581	45	5	5	8380	142
HOOK3	84376	broad.mit.edu	37	8	42841865	42841866	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-1034-01	TCGA-14-1034-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42841865_42841866insA	uc003xpr.2	+	15	1701_1702	c.1459_1460insA	c.(1459-1461)GAAfs	p.E487fs	HOOK3_uc010lxq.1_Frame_Shift_Ins_p.E487fs	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	golgi-associated microtubule-binding protein	487	Potential.				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			TTCGGACAATGAAAAAATAGCC	0.361						T	RET	papillary thyroid								0.35			56	105		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	42841865	42841866	HOOK3	8	-	A	A	A	1	0	1	1	0	0	0	0	0	585	45	5	5	7209	142
