Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
C8A	731	broad.mit.edu	37	1	57333307	57333307	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57333307G>A	uc001cyo.2	+	2	235	c.103G>A	c.(103-105)GCA>ACA	p.A35T		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	35					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						AGCTACACCCGCAGCAGTTAC	0.448																0.171429	20.376869	27.506789	12	58	KEEP	---	---	---	---	10	5	33	34	-1	capture	Missense_Mutation	SNP	57333307	57333307	C8A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2393	145
PRCC	5546	broad.mit.edu	37	1	156764463	156764463	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156764463C>T	uc001fqa.2	+	5	1476	c.1186C>T	c.(1186-1188)CGG>TGG	p.R396W	PRCC_uc001fqb.2_Missense_Mutation_p.R364W	NM_005973	NP_005964	Q92733	PRCC_HUMAN	papillary renal cell carcinoma	396					cell cycle|mitotic cell cycle checkpoint	nucleus	protein binding		PRCC/TFE3(25)	kidney(25)|central_nervous_system(2)	27	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCAGTTTAAGCGGCTGCAGGG	0.478				p.R396W(SNU1040-Tumor)	110	T	TFE3	papillary renal 								0.373134	65.459559	66.40574	25	42	KEEP	---	---	---	---	14	17	26	20	-1	capture	Missense_Mutation	SNP	156764463	156764463	PRCC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12343	145
CACNA1E	777	broad.mit.edu	37	1	181689358	181689358	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181689358C>T	uc001gow.2	+	14	1933	c.1768C>T	c.(1768-1770)CGG>TGG	p.R590W	CACNA1E_uc009wxs.2_Missense_Mutation_p.R497W	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	590	Cytoplasmic (Potential).|II.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GGCTTCCCTACGGAATTTGGT	0.478																0.291667	51.375905	54.157843	21	51	KEEP	---	---	---	---	17	8	28	32	-1	capture	Missense_Mutation	SNP	181689358	181689358	CACNA1E	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	2518	145
PROX1	5629	broad.mit.edu	37	1	214170642	214170642	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214170642A>G	uc001hkh.2	+	2	1036	c.764A>G	c.(763-765)GAA>GGA	p.E255G	PROX1_uc001hkg.1_Missense_Mutation_p.E255G	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	255					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAGCTGCAGGAAAAGTTCTAC	0.532																0.307692	62.928768	65.042534	20	45	KEEP	---	---	---	---	11	10	19	31	-1	capture	Missense_Mutation	SNP	214170642	214170642	PROX1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	12456	145
SH2D4B	387694	broad.mit.edu	37	10	82330026	82330026	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:82330026G>T	uc001kck.1	+	2	731	c.301G>T	c.(301-303)GCA>TCA	p.A101S	SH2D4B_uc001kcl.1_Missense_Mutation_p.A52S	NM_207372	NP_997255	Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B isoform 1	100	Glu-rich.										0			Colorectal(32;0.229)			GGAGCTGATTGCAGAGAGGGC	0.602																0.520548	114.446615	114.473117	38	35	KEEP	---	---	---	---	19	25	22	16	0.431818181818	capture	Missense_Mutation	SNP	82330026	82330026	SH2D4B	10	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	14129	145
FAM178A	55719	broad.mit.edu	37	10	102710503	102710503	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102710503G>A	uc001krt.3	+	17	3865	c.3323G>A	c.(3322-3324)GGA>GAA	p.G1108E	FAM178A_uc001krs.2_Missense_Mutation_p.G1108E	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	1108											0						TTTTCTTCTGGACAACGGGTA	0.338																0.485714	50.473401	50.479594	17	18	KEEP	---	---	---	---	9	9	9	11	-1	capture	Missense_Mutation	SNP	102710503	102710503	FAM178A	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5456	145
TRIM8	81603	broad.mit.edu	37	10	104404874	104404874	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104404874G>A	uc001kvz.2	+	1	623	c.500G>A	c.(499-501)TGC>TAC	p.C167Y		NM_030912	NP_112174	Q9BZR9	TRIM8_HUMAN	tripartite motif-containing 8	167	B box-type 2.					cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TGCCAGTACTGCTGCTACTAC	0.652																0.458333	28.116955	28.153714	11	13	KEEP	---	---	---	---	4	8	9	6	-1	capture	Missense_Mutation	SNP	104404874	104404874	TRIM8	10	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	16431	145
NRAP	4892	broad.mit.edu	37	10	115388695	115388695	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115388695G>A	uc001laj.2	-	20	2290	c.2126C>T	c.(2125-2127)GCT>GTT	p.A709V	NRAP_uc009xyb.2_Missense_Mutation_p.A20V|NRAP_uc001lak.2_Missense_Mutation_p.A674V|NRAP_uc001lal.3_Missense_Mutation_p.A709V	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	709	Nebulin 17.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CAGCTGTCCAGCCTTCTTGGC	0.547																0.214286	25.062757	29.292135	12	44	KEEP	---	---	---	---	7	6	26	28	-1	capture	Missense_Mutation	SNP	115388695	115388695	NRAP	10	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10545	145
GFRA1	2674	broad.mit.edu	37	10	117884937	117884937	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:117884937G>A	uc001lcj.2	-	6	1263	c.565C>T	c.(565-567)CGC>TGC	p.R189C	GFRA1_uc001lci.2_Missense_Mutation_p.R184C|GFRA1_uc009xyr.2_Missense_Mutation_p.R184C	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a	189	2.				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)		CACTTGCGGCGGTTGCAGACA	0.607	Ovarian(128;329 1725 45498 46808 50759)															0.52381	33.024421	33.034692	11	10	KEEP	---	---	---	---	7	5	4	7	-1	capture	Missense_Mutation	SNP	117884937	117884937	GFRA1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6287	145
MKI67	4288	broad.mit.edu	37	10	129905312	129905312	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129905312G>A	uc001lke.2	-	13	4987	c.4792C>T	c.(4792-4794)CGA>TGA	p.R1598*	MKI67_uc001lkf.2_Nonsense_Mutation_p.R1238*|MKI67_uc009yav.1_Nonsense_Mutation_p.R1173*|MKI67_uc009yaw.1_Nonsense_Mutation_p.R748*	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1598	5.|16 X 122 AA approximate repeats.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GTGTGACCTCGTGTCTGGAAG	0.488																0.465686	262.705758	262.91331	95	109	KEEP	---	---	---	---	59	48	58	60	-1	capture	Nonsense_Mutation	SNP	129905312	129905312	MKI67	10	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9510	145
MRGPRX4	117196	broad.mit.edu	37	11	18195645	18195645	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18195645G>A	uc001mnv.1	+	1	1262	c.842G>A	c.(841-843)CGT>CAT	p.R281H		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	281	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						TTTAGGCAGCGTCAAAATAGG	0.498																0.303448	106.73532	111.740982	44	101	KEEP	---	---	---	---	25	25	68	62	-1	capture	Missense_Mutation	SNP	18195645	18195645	MRGPRX4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9679	145
OR5D18	219438	broad.mit.edu	37	11	55587380	55587380	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587380C>A	uc010rin.1	+	1	275	c.275C>A	c.(274-276)ACC>AAC	p.T92N		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	92	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				AAAGACAGAACCATTTCATTT	0.418																0.232323	157.506763	177.010368	69	228	KEEP	---	---	---	---	33	42	145	123	0.56	capture	Missense_Mutation	SNP	55587380	55587380	OR5D18	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11061	145
LRRC55	219527	broad.mit.edu	37	11	56949947	56949947	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56949947C>T	uc001njl.1	+	1	727	c.580C>T	c.(580-582)CGG>TGG	p.R194W		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	164	LRR 4.					integral to membrane					0						CCCCTGGCTGCGGAGGGTGCA	0.617																0.311475	45.345171	47.253437	19	42	KEEP	---	---	---	---	13	11	27	22	-1	capture	Missense_Mutation	SNP	56949947	56949947	LRRC55	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	8926	145
GLYATL2	219970	broad.mit.edu	37	11	58605817	58605817	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58605817T>C	uc001nnd.3	-	3	234	c.103A>G	c.(103-105)AAA>GAA	p.K35E	GLYATL2_uc009ymq.2_Missense_Mutation_p.K35E	NM_145016	NP_659453	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	35						mitochondrion	glycine N-acyltransferase activity			ovary(1)|skin(1)	2		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	TTTTTATCTTTTATGTTGAAA	0.423					196											0.454545	87.435739	87.538056	25	30	KEEP	---	---	---	---	15	14	20	16	-1	capture	Missense_Mutation	SNP	58605817	58605817	GLYATL2	11	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	6417	145
C11orf82	220042	broad.mit.edu	37	11	82643154	82643154	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82643154T>A	uc001ozt.2	+	6	1018	c.774T>A	c.(772-774)TTT>TTA	p.F258L	C11orf82_uc010rsr.1_5'UTR|C11orf82_uc010rss.1_5'UTR|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	258					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						ATGATGATTTTTCAGCTTCAG	0.413																0.3375	67.694226	69.565548	27	53	KEEP	---	---	---	---	18	15	22	38	-1	capture	Missense_Mutation	SNP	82643154	82643154	C11orf82	11	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	1651	145
DDX10	1662	broad.mit.edu	37	11	108788719	108788719	+	Silent	SNP	T	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108788719T>C	uc001pkm.2	+	17	2489	c.2424T>C	c.(2422-2424)GAT>GAC	p.D808D	DDX10_uc001pkl.1_Silent_p.D808D	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	808							ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		AAGATTCAGATAGTGAAGATA	0.299					268	T	NUP98	AML*								0.267857	43.404292	46.126259	15	41	KEEP	---	---	---	---	7	9	21	26	-1	capture	Silent	SNP	108788719	108788719	DDX10	11	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	4300	145
FAM55D	54827	broad.mit.edu	37	11	114453240	114453240	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:114453240G>A	uc001ppc.2	-	3	781	c.600C>T	c.(598-600)GAC>GAT	p.D200D	FAM55D_uc001ppd.2_Intron	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	200						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		AGATCACCCTGTCATAGCCTT	0.532																0.11236	7.380989	20.59723	10	79	KEEP	---	---	---	---	6	5	49	37	-1	capture	Silent	SNP	114453240	114453240	FAM55D	11	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	5535	145
ETS1	2113	broad.mit.edu	37	11	128354828	128354828	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128354828G>A	uc010sbs.1	-	5	936	c.620C>T	c.(619-621)TCG>TTG	p.S207L	ETS1_uc001qej.2_Missense_Mutation_p.S251L|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Missense_Mutation_p.S207L	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	207					cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GAGAATGACCGAGGGGTAGTC	0.522																0.278846	70.037911	74.609139	29	75	KEEP	---	---	---	---	13	20	47	40	-1	capture	Missense_Mutation	SNP	128354828	128354828	ETS1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5230	145
GDF3	9573	broad.mit.edu	37	12	7848193	7848193	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7848193G>A	uc001qte.2	-	1	168	c.132C>T	c.(130-132)TTC>TTT	p.F44F		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	44					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						GCACAGGTTGGAACTTCTGGG	0.498																0.213115	28.137717	32.780121	13	48	KEEP	---	---	---	---	6	9	27	29	-1	capture	Silent	SNP	7848193	7848193	GDF3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	6255	145
GLI1	2735	broad.mit.edu	37	12	57861990	57861990	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57861990G>C	uc001snx.2	+	10	1369	c.1291G>C	c.(1291-1293)GTG>CTG	p.V431L	GLI1_uc009zpq.2_Missense_Mutation_p.V303L	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	431					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CAGACTGACTGTGCCAGAGGG	0.602	Pancreas(157;841 1936 10503 41495 50368)				277											0.275	31.606923	33.430993	11	29	KEEP	---	---	---	---	4	9	17	16	-1	capture	Missense_Mutation	SNP	57861990	57861990	GLI1	12	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	6373	145
LGR5	8549	broad.mit.edu	37	12	71974190	71974190	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71974190G>A	uc001swl.2	+	16	1587	c.1539G>A	c.(1537-1539)ATG>ATA	p.M513I	LGR5_uc001swm.2_Missense_Mutation_p.M489I|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	513	Extracellular (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						ATGCTGGAATGTTTCAGGCTC	0.388					516											0.028571	-36.085627	6.758495	5	170	KEEP	---	---	---	---	3	3	100	95	-1	capture	Missense_Mutation	SNP	71974190	71974190	LGR5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	8677	145
C12orf51	283450	broad.mit.edu	37	12	112622897	112622897	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112622897C>T	uc009zwc.2	-	54	8625	c.8607G>A	c.(8605-8607)TCG>TCA	p.S2869S		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						AGGAGGAGGACGAGTCACTGA	0.592																0.6	17.350687	17.437974	6	4	KEEP	---	---	---	---	2	4	3	1	-1	capture	Silent	SNP	112622897	112622897	C12orf51	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1682	145
TUBA3C	7278	broad.mit.edu	37	13	19752399	19752399	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19752399C>T	uc009zzj.2	-	3	411	c.362G>A	c.(361-363)CGG>CAG	p.R121Q		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	121					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TTTGCGGATCCGGTCCAGGAC	0.522																0.330097	186.630742	191.90098	68	138	KEEP	---	---	---	---	37	42	80	86	-1	capture	Missense_Mutation	SNP	19752399	19752399	TUBA3C	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16628	145
FLT1	2321	broad.mit.edu	37	13	28919630	28919630	+	Silent	SNP	C	T	T	rs142392658		TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28919630C>T	uc001usb.3	-	16	2592	c.2307G>A	c.(2305-2307)GCG>GCA	p.A769A	FLT1_uc001usa.3_5'UTR	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	769	Helical; (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	p.A769S(1)		lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	AGAAGAGAGTCGCAGCCACAC	0.398					738											0.375	22.764804	23.095289	9	15	KEEP	---	---	---	---	5	5	10	8	-1	capture	Silent	SNP	28919630	28919630	FLT1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	5885	145
TEP1	7011	broad.mit.edu	37	14	20871545	20871545	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20871545C>T	uc001vxe.2	-	7	1297	c.1257G>A	c.(1255-1257)GAG>GAA	p.E419E	TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Silent_p.E311E	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	419	TROVE.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCTTTCTCTGCTCTTCTCTGA	0.408																0.024	-53.426501	9.496422	6	244	KEEP	---	---	---	---	3	3	136	158	-1	capture	Silent	SNP	20871545	20871545	TEP1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	15644	145
OSGEP	55644	broad.mit.edu	37	14	20917163	20917163	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20917163C>T	uc001vxf.2	-	5	873	c.517G>A	c.(517-519)GAC>AAC	p.D173N		NM_017807	NP_060277	Q9NPF4	OSGEP_HUMAN	O-sialoglycoprotein endopeptidase	173					proteolysis|tRNA processing		metal ion binding|metalloendopeptidase activity|protein binding				0	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		GGACTTGGGTCGTTAGAAATC	0.448																0.2625	145.584648	157.789964	63	177	KEEP	---	---	---	---	27	42	108	98	-1	capture	Missense_Mutation	SNP	20917163	20917163	OSGEP	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11191	145
PAPOLA	10914	broad.mit.edu	37	14	97022277	97022277	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:97022277C>G	uc001yfq.2	+	18	1968	c.1758C>G	c.(1756-1758)AGC>AGG	p.S586R	PAPOLA_uc001yfr.2_Missense_Mutation_p.S585R|PAPOLA_uc010twv.1_Missense_Mutation_p.S586R|PAPOLA_uc010avp.2_Missense_Mutation_p.S336R	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	586	Ser/Thr-rich.				mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		CCAGTGAAAGCTCAGGGGGTA	0.398	NSCLC(19;254 734 11908 35501 39234)															0.373494	100.905948	102.0719	31	52	KEEP	---	---	---	---	18	16	25	35	-1	capture	Missense_Mutation	SNP	97022277	97022277	PAPOLA	14	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	11333	145
AHNAK2	113146	broad.mit.edu	37	14	105417016	105417016	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105417016A>T	uc010axc.1	-	7	4892	c.4772T>A	c.(4771-4773)CTC>CAC	p.L1591H	AHNAK2_uc001ypx.2_Missense_Mutation_p.L1491H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1591						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCCCCTTGAGGTCCACTTT	0.592																0.310345	307.351856	320.333911	126	280	KEEP	---	---	---	---	79	63	166	171	-1	capture	Missense_Mutation	SNP	105417016	105417016	AHNAK2	14	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	415	145
DAPK3	1613	broad.mit.edu	37	19	3959627	3959627	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3959627C>T	uc002lzc.1	-	8	930	c.837G>A	c.(835-837)CGG>CGA	p.R279R	DAPK3_uc002lzb.1_Silent_p.R16R|DAPK3_uc002lzd.1_Silent_p.R279R	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3	279					apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTTCCGCCGCCGGATCGCCT	0.687					392											0.34375	27.710767	28.402921	11	21	KEEP	---	---	---	---	5	6	14	13	-1	capture	Silent	SNP	3959627	3959627	DAPK3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	4196	145
KHSRP	8570	broad.mit.edu	37	19	6416419	6416419	+	Splice_Site	SNP	C	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6416419C>A	uc002mer.3	-	15	1599	c.1489_splice	c.e15-1	p.G497_splice		NM_003685	NP_003676	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding			skin(1)	1						AGAGAGGACCCTAGAAGGAAG	0.637	Colon(55;593 1006 2067 9135 22980)															0.12	5.910988	12.998916	6	44	KEEP	---	---	---	---	4	4	33	17	0.5	capture	Splice_Site	SNP	6416419	6416419	KHSRP	19	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	8073	145
TSPAN16	26526	broad.mit.edu	37	19	11417292	11417292	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11417292G>A	uc002mqv.1	+	5	613	c.463G>A	c.(463-465)GGG>AGG	p.G155R	TSPAN16_uc002mqu.1_RNA|uc002mqw.1_Intron	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16	155	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						AAAGTGCTGTGGGGTGAATAA	0.438																0.2	59.212284	70.939817	28	112	KEEP	---	---	---	---	16	16	71	59	-1	capture	Missense_Mutation	SNP	11417292	11417292	TSPAN16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16523	145
NOTCH3	4854	broad.mit.edu	37	19	15272328	15272328	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15272328G>A	uc002nan.2	-	33	6187	c.6111C>T	c.(6109-6111)CAC>CAT	p.H2037H		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	2037	Cytoplasmic (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCCCCAGGCCGTGGGGACCGG	0.682					417											0.190476	7.589246	9.469324	4	17	KEEP	---	---	---	---	3	2	10	9	-1	capture	Silent	SNP	15272328	15272328	NOTCH3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10457	145
TSKS	60385	broad.mit.edu	37	19	50251361	50251361	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50251361C>T	uc002ppm.2	-	4	571	c.560G>A	c.(559-561)GGG>GAG	p.G187E		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	187							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		AATGCAGTACCCCTCCAACTC	0.547																0.268041	136.621022	146.040026	52	142	KEEP	---	---	---	---	39	27	89	89	-1	capture	Missense_Mutation	SNP	50251361	50251361	TSKS	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16509	145
HEATR5B	54497	broad.mit.edu	37	2	37215846	37215846	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37215846C>T	uc002rpp.1	-	35	5950	c.5854G>A	c.(5854-5856)GTT>ATT	p.V1952I	HEATR5B_uc002rpo.1_Missense_Mutation_p.V264I|HEATR5B_uc010ezy.1_Missense_Mutation_p.V447I	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1952							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				CCTTCTTGAACCGCTAAAAGC	0.348																0.291667	49.704122	52.533198	21	51	KEEP	---	---	---	---	15	9	30	29	-1	capture	Missense_Mutation	SNP	37215846	37215846	HEATR5B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	6959	145
RGPD4	285190	broad.mit.edu	37	2	108443529	108443529	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108443529G>A	uc010ywk.1	+	1	142	c.60G>A	c.(58-60)CCG>CCA	p.P20P	LOC729121_uc010ywj.1_5'Flank|LOC729121_uc002tdt.2_5'Flank	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	20					intracellular transport		binding			skin(2)	2						GCTCCGCCCCGTCGCCTCGAA	0.711																0.333333	12.769723	13.138871	5	10	KEEP	---	---	---	---	9	7	4	7	-1	capture	Silent	SNP	108443529	108443529	RGPD4	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13181	145
IL1RN	3557	broad.mit.edu	37	2	113890404	113890404	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113890404G>A	uc002tjb.2	+	4	554	c.490G>A	c.(490-492)GAA>AAA	p.E164K	IL1RN_uc002tix.1_RNA|IL1RN_uc002tiy.2_Missense_Mutation_p.E130K|IL1RN_uc002tiz.2_Missense_Mutation_p.E167K|IL1RN_uc002tja.2_Missense_Mutation_p.E146K	NM_173842	NP_776214	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist isoform 1	164					immune response|inflammatory response|response to glucocorticoid stimulus	centrosome|extracellular space|nucleus|plasma membrane	cytokine activity|interleukin-1 receptor antagonist activity			skin(2)	2					Anakinra(DB00026)	TATGCCTGACGAAGGCGTCAT	0.592					97							Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				0.285714	102.183351	108.244979	42	105	KEEP	---	---	---	---	20	26	65	59	-1	capture	Missense_Mutation	SNP	113890404	113890404	IL1RN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7588	145
ALPPL2	251	broad.mit.edu	37	2	233274348	233274348	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233274348C>T	uc002vss.3	+	11	1418	c.1365C>T	c.(1363-1365)GAC>GAT	p.D455D		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	455					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	CAGGCGAGGACGTGGCGGTGT	0.662																0.314286	26.811234	27.886063	11	24	KEEP	---	---	---	---	4	8	8	22	-1	capture	Silent	SNP	233274348	233274348	ALPPL2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	549	145
ASXL1	171023	broad.mit.edu	37	20	31022345	31022345	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31022345C>T	uc002wxs.2	+	12	2256	c.1830C>T	c.(1828-1830)GGC>GGT	p.G610G	ASXL1_uc010geb.2_Silent_p.G501G	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	610					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	p.Q592fs*5(1)|p.G610G(1)		haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						GTTGGACTGGCGCCAGGACCC	0.632						F|N|Mis		MDS|CMML								0.266667	28.682236	30.893968	12	33	KEEP	---	---	---	---	10	3	18	20	-1	capture	Silent	SNP	31022345	31022345	ASXL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1057	145
C20orf152	140894	broad.mit.edu	37	20	34560629	34560629	+	Missense_Mutation	SNP	C	T	T	rs150690141	byFrequency	TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34560629C>T	uc002xes.1	+	2	286	c.130C>T	c.(130-132)CGG>TGG	p.R44W	C20orf152_uc002xer.1_Missense_Mutation_p.R44W|C20orf152_uc010gfp.1_RNA			Q96M20	CT152_HUMAN	SubName: Full=C20orf152 protein;	44											0	Breast(12;0.00631)					CAGGGGATTCCGGGAATATCA	0.443																0.306667	117.81829	122.804346	46	104	KEEP	---	---	---	---	25	26	56	53	-1	capture	Missense_Mutation	SNP	34560629	34560629	C20orf152	20	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	2074	145
TIAM1	7074	broad.mit.edu	37	21	32638854	32638854	+	Silent	SNP	T	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32638854T>C	uc002yow.1	-	5	907	c.435A>G	c.(433-435)GGA>GGG	p.G145G	TIAM1_uc011adk.1_Silent_p.G145G|TIAM1_uc011adl.1_Silent_p.G145G|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	145					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GCCTCCTGCCTCCCTCAGCCA	0.547					780											0.021898	-28.584604	6.368094	3	134	KEEP	---	---	---	---	1	2	73	77	-1	capture	Silent	SNP	32638854	32638854	TIAM1	21	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	15775	145
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	CA	CA	rs142470496;rs146546850	byFrequency;byFrequency	TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29091840_29091841TG>CA	uc003adu.1	-	11	1188_1189	c.1116_1117CA>TG	c.(1114-1119)TCCAAG>TCTGAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)|p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCAA	0.416					268	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				0.086957	2.566278	10.508684	4	42	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	29091840	29091841	CHEK2	22	TG	CA	CA	CA	1	0	0	0	0	1	0	0	0	819	63	3	3	3301	145
CSN3	1448	broad.mit.edu	37	4	71114964	71114964	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71114964C>A	uc003hfe.3	+	4	395	c.337C>A	c.(337-339)CTG>ATG	p.L113M		NM_005212	NP_005203	P07498	CASK_HUMAN	casein kappa precursor	113						extracellular region	protein binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						TCGCCCAAACCTGCATCCATC	0.468																0.155556	19.985974	30.193518	14	76	KEEP	---	---	---	---	3	11	28	53	0.785714285714	capture	Missense_Mutation	SNP	71114964	71114964	CSN3	4	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	3914	145
ANKRD17	26057	broad.mit.edu	37	4	73984505	73984505	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73984505C>T	uc003hgp.2	-	22	4205	c.4088G>A	c.(4087-4089)GGT>GAT	p.G1363D	ANKRD17_uc003hgo.2_Missense_Mutation_p.G1250D|ANKRD17_uc003hgq.2_Missense_Mutation_p.G1112D|ANKRD17_uc003hgr.2_Missense_Mutation_p.G1362D|ANKRD17_uc011cbd.1_Missense_Mutation_p.G928D	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1363	ANK 24.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGGTGTCCACCATTTGCTGC	0.443																0.230337	88.076793	99.948119	41	137	KEEP	---	---	---	---	32	14	75	74	-1	capture	Missense_Mutation	SNP	73984505	73984505	ANKRD17	4	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	643	145
AFF1	4299	broad.mit.edu	37	4	88047292	88047292	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88047292T>C	uc003hqj.3	+	13	3001	c.2594T>C	c.(2593-2595)CTC>CCC	p.L865P	AFF1_uc011ccz.1_Missense_Mutation_p.L872P|AFF1_uc003hqk.3_Missense_Mutation_p.L865P|AFF1_uc011cda.1_Missense_Mutation_p.L503P	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	865						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAGGAAATGCTCCCCCCGCCA	0.577					332											0.055118	-19.167173	7.769167	7	120	KEEP	---	---	---	---	5	6	68	61	-1	capture	Missense_Mutation	SNP	88047292	88047292	AFF1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	356	145
ADH1B	125	broad.mit.edu	37	4	100239237	100239237	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100239237C>A	uc003hus.3	-	3	309	c.225G>T	c.(223-225)GAG>GAT	p.E75D	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Missense_Mutation_p.E35D|ADH1B_uc011ceh.1_5'UTR|ADH1B_uc011cei.1_Missense_Mutation_p.E35D	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	75					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	CTCCAACACTCTCCACGATGC	0.537																0.024465	-71.396274	10.750356	8	319	KEEP	---	---	---	---	8	6	171	200	0.428571428571	capture	Missense_Mutation	SNP	100239237	100239237	ADH1B	4	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	308	145
ADH1C	126	broad.mit.edu	37	4	100268197	100268197	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100268197T>A	uc003huu.2	-	3	310	c.225A>T	c.(223-225)GAA>GAT	p.E75D		NM_000669	NP_000660	P00326	ADH1G_HUMAN	class I alcohol dehydrogenase, gamma subunit	75					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)	CTCAAACACTTTCCACGATGC	0.502												Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				0.311644	213.508109	222.740079	91	201	KEEP	---	---	---	---	51	52	122	115	-1	capture	Missense_Mutation	SNP	100268197	100268197	ADH1C	4	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	309	145
MMAA	166785	broad.mit.edu	37	4	146576356	146576356	+	Nonsense_Mutation	SNP	A	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146576356A>T	uc003ikh.3	+	7	1112	c.1027A>T	c.(1027-1029)AAA>TAA	p.K343*	MMAA_uc010iow.2_RNA	NM_172250	NP_758454	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria type A precursor	343						mitochondrion	GTP binding|nucleoside-triphosphatase activity			ovary(1)	1	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGATAAAATGAAAGATTTCCA	0.428																0.31746	47.170714	49.041032	20	43	KEEP	---	---	---	---	11	10	24	24	-1	capture	Nonsense_Mutation	SNP	146576356	146576356	MMAA	4	A	T	T	T	1	0	0	0	0	0	1	0	0	117	9	5	4	9551	145
CCDC110	256309	broad.mit.edu	37	4	186382220	186382220	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186382220G>A	uc003ixu.3	-	5	407	c.331C>T	c.(331-333)CGC>TGC	p.R111C	CCDC110_uc003ixv.3_Intron|CCDC110_uc011ckt.1_Missense_Mutation_p.R111C	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	111						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTTCAATGCGCGTGCCAAAC	0.338																0.254545	63.443768	69.461701	28	82	KEEP	---	---	---	---	16	15	45	56	-1	capture	Missense_Mutation	SNP	186382220	186382220	CCDC110	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2721	145
FBN2	2201	broad.mit.edu	37	5	127671244	127671244	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127671244G>A	uc003kuu.2	-	29	4189	c.3750C>T	c.(3748-3750)AAC>AAT	p.N1250N	FBN2_uc003kuv.2_Silent_p.N1217N	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1250	EGF-like 19; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CACAGCCTCCGTTCATTATCA	0.438					1552											0.323699	139.061451	143.824084	56	117	KEEP	---	---	---	---	34	33	81	55	-1	capture	Silent	SNP	127671244	127671244	FBN2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5649	145
PCDHA3	56145	broad.mit.edu	37	5	140181057	140181057	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140181057G>A	uc003lhf.2	+	1	275	c.275G>A	c.(274-276)CGC>CAC	p.R92H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.R92H	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	92	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGATAGACCGCGAGGAACTG	0.587																0.018462	-76.820138	7.926223	6	319	KEEP	---	---	---	---	3	4	153	218	-1	capture	Missense_Mutation	SNP	140181057	140181057	PCDHA3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11428	145
N4BP3	23138	broad.mit.edu	37	5	177547367	177547367	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177547367C>T	uc003mik.1	+	3	766	c.519C>T	c.(517-519)CAC>CAT	p.H173H	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	173						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTGCTGCACGCCCTCAGCC	0.711																0.344262	52.358289	53.664077	21	40	KEEP	---	---	---	---	10	12	20	20	-1	capture	Silent	SNP	177547367	177547367	N4BP3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10023	145
OR2Y1	134083	broad.mit.edu	37	5	180166656	180166656	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180166656T>C	uc003mmf.1	-	1	403	c.403A>G	c.(403-405)ATC>GTC	p.I135V		NM_001001657	NP_001001657	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGTGCATGATGGCCATGTAG	0.587																0.121951	5.159743	10.889196	5	36	KEEP	---	---	---	---	3	3	23	19	-1	capture	Missense_Mutation	SNP	180166656	180166656	OR2Y1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	10939	145
PKHD1	5314	broad.mit.edu	37	6	51918901	51918901	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51918901G>A	uc003pah.1	-	20	2175	c.1899C>T	c.(1897-1899)ATC>ATT	p.I633I	PKHD1_uc003pai.2_Silent_p.I633I	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	633	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTTGAAAGCCGATTGTGAAGG	0.478					1537											0.386667	79.45776	80.301768	29	46	KEEP	---	---	---	---	19	14	26	24	-1	capture	Silent	SNP	51918901	51918901	PKHD1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	11874	145
NMBR	4829	broad.mit.edu	37	6	142397171	142397171	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:142397171G>A	uc003qiu.2	-	3	928	c.787C>T	c.(787-789)CGC>TGC	p.R263C		NM_002511	NP_002502	P28336	NMBR_HUMAN	neuromedin B receptor	263	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity			central_nervous_system(3)|breast(1)	4	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		TTAGCCAGGCGTTTCCGTGTT	0.388																0.48	34.406198	34.414263	12	13	KEEP	---	---	---	---	5	9	7	7	-1	capture	Missense_Mutation	SNP	142397171	142397171	NMBR	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10394	145
PPP1R14C	81706	broad.mit.edu	37	6	150464589	150464589	+	Silent	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:150464589G>A	uc003qnt.2	+	1	402	c.261G>A	c.(259-261)CTG>CTA	p.L87L		NM_030949	NP_112211	Q8TAE6	PP14C_HUMAN	protein phosphatase 1, regulatory (inhibitor)	87					regulation of phosphorylation	cytoplasm|membrane					0		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)		GGCTGGTGCTGGAGGAATGGA	0.637	Melanoma(165;1879 1941 2052 16588 48349)															0.447368	51.469063	51.560927	17	21	KEEP	---	---	---	---	11	8	12	10	-1	capture	Silent	SNP	150464589	150464589	PPP1R14C	6	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	12262	145
PRPS1L1	221823	broad.mit.edu	37	7	18067222	18067222	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18067222C>T	uc003stz.2	-	1	265	c.184G>A	c.(184-186)GAA>AAA	p.E62K		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	62					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					TCGTTGATTTCGCCACAACCA	0.473																0.275387	385.824035	412.248487	160	421	KEEP	---	---	---	---	108	81	231	261	-1	capture	Missense_Mutation	SNP	18067222	18067222	PRPS1L1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12475	145
MLXIPL	51085	broad.mit.edu	37	7	73011080	73011080	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73011080G>A	uc003tyn.1	-	11	1759	c.1711C>T	c.(1711-1713)CCG>TCG	p.P571S	MLXIPL_uc003tyj.1_Intron|MLXIPL_uc003tyk.1_Missense_Mutation_p.P571S|MLXIPL_uc003tyl.1_Missense_Mutation_p.P571S|MLXIPL_uc003tym.1_Missense_Mutation_p.P571S|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Missense_Mutation_p.P477S|MLXIPL_uc003tyq.1_Missense_Mutation_p.P338S	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	571					anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCCGGGGTCGGGGGAAGGAAT	0.701																0.375	15.136439	15.359153	6	10	KEEP	---	---	---	---	4	2	6	4	-1	capture	Missense_Mutation	SNP	73011080	73011080	MLXIPL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9549	145
DYNC1I1	1780	broad.mit.edu	37	7	95616403	95616403	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95616403G>A	uc003uoc.3	+	9	1107	c.830G>A	c.(829-831)CGT>CAT	p.R277H	DYNC1I1_uc003uod.3_Missense_Mutation_p.R260H|DYNC1I1_uc003uob.2_Missense_Mutation_p.R240H|DYNC1I1_uc003uoe.3_Missense_Mutation_p.R257H|DYNC1I1_uc010lfl.2_Missense_Mutation_p.R266H	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	277					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCTTTCAATCGTCAGTTCTAT	0.443																0.072765	-24.355089	66.005543	35	446	KEEP	---	---	---	---	29	13	261	290	-1	capture	Missense_Mutation	SNP	95616403	95616403	DYNC1I1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4797	145
CYP3A5	1577	broad.mit.edu	37	7	99332692	99332692	+	Translation_Start_Site	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99332692C>T	uc003urs.2	-	1	130	c.-76G>A	c.(-78--74)CCGTG>CCATG		ZNF498_uc003urn.2_Intron|CYP3A5_uc010lgg.2_Missense_Mutation_p.V9M|CYP3A7_uc003uru.2_Missense_Mutation_p.V9M			P20815	CP3A5_HUMAN	SubName: Full=Cytochrome P450; Flags: Fragment;						alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	CAGGTTTCCACGGCCAAGTTT	0.498																0.183099	47.067883	60.456408	26	116	KEEP	---	---	---	---	13	15	68	65	-1	capture	Translation_Start_Site	SNP	99332692	99332692	CYP3A5	7	C	T	T	T	1	0	0	0	0	0	0	0	0	247	19	1	1	4140	145
MLL5	55904	broad.mit.edu	37	7	104681416	104681416	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:104681416C>T	uc003vcm.2	+	3	551	c.17C>T	c.(16-18)CCA>CTA	p.P6L	MLL5_uc010lja.1_5'UTR|MLL5_uc010ljb.1_Missense_Mutation_p.P6L|MLL5_uc003vcl.2_Missense_Mutation_p.P6L|MLL5_uc010ljc.2_Missense_Mutation_p.P6L	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	6					cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						ATAGTGATCCCATTGGGGGTT	0.428																0.168831	22.22088	30.225766	13	64	KEEP	---	---	---	---	7	9	37	48	-1	capture	Missense_Mutation	SNP	104681416	104681416	MLL5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	9536	145
PRKAR2B	5577	broad.mit.edu	37	7	106786905	106786905	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106786905T>G	uc003vdx.2	+	6	915	c.740T>G	c.(739-741)TTG>TGG	p.L247W		NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory	247	cAMP 1.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						CTGTGGGGTTTGGTGAGTAAA	0.398																0.2	40.060277	46.752139	16	64	KEEP	---	---	---	---	11	6	40	30	-1	capture	Missense_Mutation	SNP	106786905	106786905	PRKAR2B	7	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	12402	145
DNAJB5	25822	broad.mit.edu	37	9	34996743	34996743	+	Silent	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34996743C>T	uc003zvt.2	+	3	831	c.693C>T	c.(691-693)GGC>GGT	p.G231G	DNAJB5_uc003zvs.2_Silent_p.G265G|DNAJB5_uc011los.1_Silent_p.G303G	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	231					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCAAAGAAGGCGACGCCACAC	0.562																0.309524	32.65872	34.016963	13	29	KEEP	---	---	---	---	8	7	26	11	-1	capture	Silent	SNP	34996743	34996743	DNAJB5	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4579	145
OR13C5	138799	broad.mit.edu	37	9	107360795	107360795	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107360795G>T	uc011lvp.1	-	1	900	c.900C>A	c.(898-900)AAC>AAA	p.N300K		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						TCACATCCTTGTTTCTAAGAC	0.338																0.145455	12.760991	19.413186	8	47	KEEP	---	---	---	---	4	6	19	32	0.4	capture	Missense_Mutation	SNP	107360795	107360795	OR13C5	9	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	10841	145
C9orf140	89958	broad.mit.edu	37	9	139959160	139959160	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139959160C>T	uc011men.1	-	6	1252	c.1136G>A	c.(1135-1137)CGC>CAC	p.R379H		NM_178448	NP_848543	Q86UD0	CI140_HUMAN	tumor specificity and mitosis phase-dependent	379	Potential.					cytoplasm|nucleus				skin(1)	1	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;3.02e-05)|Epithelial(140;0.000499)		GCTCAGGGCGCGGGCCTCAAA	0.647														OREG0019628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.357143	12.771117	13.02273	5	9	KEEP	---	---	---	---	3	3	7	3	-1	capture	Missense_Mutation	SNP	139959160	139959160	C9orf140	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2437	145
MAP3K15	389840	broad.mit.edu	37	X	19391804	19391804	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:19391804C>T	uc004czk.1	-	22	2845	c.1208G>A	c.(1207-1209)CGC>CAC	p.R403H	MAP3K15_uc004czj.1_Missense_Mutation_p.R363H|MAP3K15_uc004czi.1_5'Flank	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	928							ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GACGACACCGCGGGGACCTTC	0.677																0.12	6.175006	13.2076	6	44	KEEP	---	---	---	---	5	5	26	27	-1	capture	Missense_Mutation	SNP	19391804	19391804	MAP3K15	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9163	145
ZNF41	7592	broad.mit.edu	37	X	47307679	47307679	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47307679C>T	uc004dhs.3	-	4	1683	c.1616G>A	c.(1615-1617)TGT>TAT	p.C539Y	ZNF41_uc004dhu.3_Missense_Mutation_p.C531Y|ZNF41_uc004dht.3_Missense_Mutation_p.C411Y|ZNF41_uc004dhv.3_Missense_Mutation_p.C507Y|ZNF41_uc004dhw.3_Missense_Mutation_p.C499Y|ZNF41_uc004dhy.3_Missense_Mutation_p.C497Y|ZNF41_uc004dhx.3_Missense_Mutation_p.C497Y|ZNF41_uc011mlm.1_Missense_Mutation_p.C411Y	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	539	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)				ACATTCTGTACATATATAGGG	0.428																0.213235	56.592244	66.9347	29	107	KEEP	---	---	---	---	16	17	69	51	-1	capture	Missense_Mutation	SNP	47307679	47307679	ZNF41	23	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17769	145
GSPT2	23708	broad.mit.edu	37	X	51487380	51487380	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:51487380G>A	uc004dpl.2	+	1	884	c.658G>A	c.(658-660)GGA>AGA	p.G220R		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	220					cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)					GTCAACCATCGGAGGACAGAT	0.398																0.319149	41.30862	42.674593	15	32	KEEP	---	---	---	---	6	12	14	21	-1	capture	Missense_Mutation	SNP	51487380	51487380	GSPT2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6759	145
ODZ1	10178	broad.mit.edu	37	X	123518365	123518365	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123518365C>T	uc004euj.2	-	29	6459	c.6395G>A	c.(6394-6396)CGC>CAC	p.R2132H	ODZ1_uc011muj.1_Missense_Mutation_p.R2138H|ODZ1_uc010nqy.2_Missense_Mutation_p.R2139H	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2132	Extracellular (Potential).|YD 16.				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TATTACCATGCGGCCCACATT	0.393					623											0.182609	75.12026	96.80088	42	188	KEEP	---	---	---	---	22	27	117	99	-1	capture	Missense_Mutation	SNP	123518365	123518365	ODZ1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10739	145
ACTRT1	139741	broad.mit.edu	37	X	127185914	127185914	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:127185914T>G	uc004eum.2	-	1	469	c.272A>C	c.(271-273)CAT>CCT	p.H91P		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	91						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						CTCAAAGAGATGTTTCCAGAG	0.493																0.200351	293.893471	341.365455	114	455	KEEP	---	---	---	---	79	57	260	279	-1	capture	Missense_Mutation	SNP	127185914	127185914	ACTRT1	23	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	218	145
ARHGEF6	9459	broad.mit.edu	37	X	135754253	135754253	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135754253T>A	uc004fab.2	-	20	2523	c.2061A>T	c.(2059-2061)CAA>CAT	p.Q687H	ARHGEF6_uc011mwd.1_Missense_Mutation_p.Q560H|ARHGEF6_uc011mwe.1_Missense_Mutation_p.Q533H	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	687					apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					GGAGTAGGACTTGTGGAATGG	0.458																0.088146	0.824496	57.263439	29	300	KEEP	---	---	---	---	16	17	151	188	-1	capture	Missense_Mutation	SNP	135754253	135754253	ARHGEF6	23	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	903	145
PNCK	139728	broad.mit.edu	37	X	152936012	152936012	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152936012C>T	uc011myu.1	-	11	1367	c.1181G>A	c.(1180-1182)CGG>CAG	p.R394Q	PNCK_uc011myt.1_Missense_Mutation_p.R328Q|PNCK_uc004fia.2_Missense_Mutation_p.R346Q|PNCK_uc004fhz.3_Missense_Mutation_p.R209Q	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed	311	Calmodulin-binding (By similarity).					cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCCAGCTTCCGGATGTGGCG	0.687					91											0.074627	-3.217905	9.188677	5	62	KEEP	---	---	---	---	4	1	33	35	-1	capture	Missense_Mutation	SNP	152936012	152936012	PNCK	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12048	145
BEST3	144453	broad.mit.edu	37	12	70091534	70091534	+	Frame_Shift_Del	DEL	A	-	-			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70091534delA	uc001svg.2	-	2	272	c.45delT	c.(43-45)TTTfs	p.F15fs	BEST3_uc001svd.1_Frame_Shift_Del_p.F15fs|BEST3_uc001sve.1_Intron|BEST3_uc010stm.1_Intron|BEST3_uc001svh.2_Intron|BEST3_uc001svi.1_Intron	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	15	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TATGAAATCCAAAAAAAGTTG	0.353																0.00			8	2712		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	70091534	70091534	BEST3	12	A	-	-	-	1	0	1	0	1	0	0	0	0	63	5	5	5	1395	145
TJP1	7082	broad.mit.edu	37	15	30012191	30012192	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30012191_30012192insT	uc001zcr.2	-	20	3267_3268	c.2792_2793insA	c.(2791-2793)TACfs	p.Y931fs	TJP1_uc010azl.2_Frame_Shift_Ins_p.Y919fs|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	931					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CAGGCGAAAGGTAAGGGACTGG	0.386	Melanoma(77;681 1843 6309 6570)															0.32			46	96		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	30012191	30012192	TJP1	15	-	T	T	T	1	0	1	1	0	0	0	0	0	568	44	5	5	15814	145
NEDD4L	23327	broad.mit.edu	37	18	55992284	55992286	+	In_Frame_Del	DEL	TCC	-	-			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55992284_55992286delTCC	uc002lgy.2	+	9	844_846	c.570_572delTCC	c.(568-573)CTTCCT>CTT	p.P194del	NEDD4L_uc002lgz.2_In_Frame_Del_p.P194del|NEDD4L_uc002lgx.2_In_Frame_Del_p.P194del|NEDD4L_uc010xee.1_In_Frame_Del_p.P73del|NEDD4L_uc002lhc.2_In_Frame_Del_p.P186del|NEDD4L_uc002lhd.2_In_Frame_Del_p.P73del|NEDD4L_uc002lhb.2_In_Frame_Del_p.P73del|NEDD4L_uc002lhe.2_In_Frame_Del_p.P186del|NEDD4L_uc002lhf.2_In_Frame_Del_p.P73del|NEDD4L_uc002lhg.2_In_Frame_Del_p.P73del|NEDD4L_uc002lhh.2_In_Frame_Del_p.P73del|NEDD4L_uc010dpm.1_In_Frame_Del_p.P45del	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	194	WW 1.				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						AAGAGGAACTTCCTCCTCCTCCT	0.498																0.03			10	324		---	---	---	---						capture_indel	In_Frame_Del	DEL	55992284	55992286	NEDD4L	18	TCC	-	-	-	1	0	1	0	1	0	0	0	0	795	62	5	5	10218	145
UBXN6	80700	broad.mit.edu	37	19	4454085	4454085	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-1450-01	TCGA-14-1450-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4454085delT	uc002man.1	-	2	185	c.89delA	c.(88-90)AAGfs	p.K30fs	UBXN6_uc010dty.1_5'UTR|UBXN6_uc002mam.1_5'UTR	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	30						microtubule organizing center|nucleus	protein binding				0						TTTGTGGGCCTTTTCCCTGGG	0.667																0.02			7	423		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	4454085	4454085	UBXN6	19	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	16799	145
