Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SERINC2	347735	broad.mit.edu	37	1	31905860	31905860	+	Missense_Mutation	SNP	G	A	A	rs139208281	byFrequency	TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31905860G>A	uc010ogh.1	+	9	1273	c.1072G>A	c.(1072-1074)GAG>AAG	p.E358K	SERINC2_uc010ogg.1_Missense_Mutation_p.E355K|SERINC2_uc001bst.2_Missense_Mutation_p.E354K|SERINC2_uc001bsu.2_Missense_Mutation_p.E299K|SERINC2_uc001bsv.2_Missense_Mutation_p.E299K	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	354						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		GATGCAGACCGAGGAGTGCCC	0.617																0.444444	46.393074	46.490043	16	20	KEEP	---	---	---	---	11	6	10	13	-1	capture	Missense_Mutation	SNP	31905860	31905860	SERINC2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13973	155
ZC3H12A	80149	broad.mit.edu	37	1	37948876	37948876	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37948876C>T	uc001cbb.3	+	6	1614	c.1464C>T	c.(1462-1464)GGC>GGT	p.G488G	ZC3H12A_uc001cbc.1_Silent_p.G283G	NM_025079	NP_079355	Q5D1E8	ZC12A_HUMAN	zinc finger CCCH-type containing 12A	488	Pro-rich.				angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGCCTTTGGCCGGGCCATGG	0.662																0.026667	-30.836673	6.315764	4	146	KEEP	---	---	---	---	2	2	87	85	-1	capture	Silent	SNP	37948876	37948876	ZC3H12A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	17441	155
MFSD2A	84879	broad.mit.edu	37	1	40432533	40432533	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40432533C>T	uc001cev.2	+	8	1076	c.895C>T	c.(895-897)CGG>TGG	p.R299W	MFSD2A_uc010ojb.1_Missense_Mutation_p.R247W|MFSD2A_uc001ceu.2_Missense_Mutation_p.R286W|MFSD2A_uc010ojc.1_Missense_Mutation_p.R130W|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_5'Flank	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	299					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2						CCGGGGCCTACGGCTGGTCAT	0.572					141											0.239726	85.162303	94.184375	35	111	KEEP	---	---	---	---	30	25	105	54	-1	capture	Missense_Mutation	SNP	40432533	40432533	MFSD2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	9442	155
FAM151A	338094	broad.mit.edu	37	1	55078368	55078368	+	Silent	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55078368G>T	uc001cxn.2	-	5	723	c.591C>A	c.(589-591)GTC>GTA	p.V197V	ACOT11_uc001cxm.1_Intron	NM_176782	NP_788954	Q8WW52	F151A_HUMAN	hypothetical protein LOC338094	197						integral to membrane					0						ACTTCTCCTGGACCAGGGCCA	0.562																0.402062	107.097693	107.913261	39	58	KEEP	---	---	---	---	31	16	37	28	0.659574468085	capture	Silent	SNP	55078368	55078368	FAM151A	1	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	5412	155
TM2D1	83941	broad.mit.edu	37	1	62190705	62190705	+	Missense_Mutation	SNP	T	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62190705T>A	uc001czz.1	-	1	391	c.88A>T	c.(88-90)ACA>TCA	p.T30S		NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN	beta-amyloid binding protein precursor	30					apoptosis					ovary(1)	1						CAGGGTCCTGTAGTGACTGAG	0.647																0.306667	60.801218	63.298655	23	52	KEEP	---	---	---	---	10	15	27	28	-1	capture	Missense_Mutation	SNP	62190705	62190705	TM2D1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	15848	155
HRNR	388697	broad.mit.edu	37	1	152193139	152193139	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152193139G>A	uc001ezt.1	-	3	1042	c.966C>T	c.(964-966)CAC>CAT	p.H322H		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	322	3.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGTTGGCCGTGGCTGGAGG	0.607																0.036697	-18.091281	7.271977	4	105	KEEP	---	---	---	---	4	0	85	76	-1	capture	Silent	SNP	152193139	152193139	HRNR	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7284	155
YY1AP1	55249	broad.mit.edu	37	1	155629971	155629971	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155629971A>T	uc001fln.2	-	11	1892	c.1868T>A	c.(1867-1869)GTC>GAC	p.V623D	YY1AP1_uc001flg.2_Missense_Mutation_p.V362D|YY1AP1_uc010pgg.1_Missense_Mutation_p.V462D|YY1AP1_uc010pgh.1_Missense_Mutation_p.V566D|YY1AP1_uc010pgi.1_Missense_Mutation_p.V715D|YY1AP1_uc001flh.2_Missense_Mutation_p.V695D|YY1AP1_uc009wqt.2_Missense_Mutation_p.V546D|YY1AP1_uc001flk.2_Missense_Mutation_p.V566D|YY1AP1_uc001fll.2_Missense_Mutation_p.V577D|YY1AP1_uc009wqv.2_Missense_Mutation_p.V294D|YY1AP1_uc001flm.2_Missense_Mutation_p.V566D|YY1AP1_uc001fli.2_Missense_Mutation_p.V577D|YY1AP1_uc009wqu.2_Missense_Mutation_p.V410D|YY1AP1_uc001flj.2_Missense_Mutation_p.V557D|YY1AP1_uc009wqw.2_Missense_Mutation_p.V546D|YY1AP1_uc001flo.2_Missense_Mutation_p.V511D|YY1AP1_uc001flp.2_Missense_Mutation_p.V577D	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	623					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGCCGCATTGACAGGCTGGAT	0.557																0.423729	69.562818	69.862584	25	34	KEEP	---	---	---	---	19	9	28	27	-1	capture	Missense_Mutation	SNP	155629971	155629971	YY1AP1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	17389	155
OLFML2B	25903	broad.mit.edu	37	1	161987297	161987297	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161987297G>A	uc001gbu.2	-	3	863	c.439C>T	c.(439-441)CTC>TTC	p.L147F	OLFML2B_uc010pkq.1_Missense_Mutation_p.L147F	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	147										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			ATTGTGGAGAGCTATGAAACA	0.522																0.319588	82.812499	85.606648	31	66	KEEP	---	---	---	---	21	13	41	26	-1	capture	Missense_Mutation	SNP	161987297	161987297	OLFML2B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10763	155
LGR6	59352	broad.mit.edu	37	1	202249926	202249926	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202249926G>A	uc001gxu.2	+	6	662	c.662G>A	c.(661-663)CGC>CAC	p.R221H	LGR6_uc001gxv.2_Missense_Mutation_p.R169H|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_RNA	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	221	LRR 6.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						CATAACAACCGCATCCAGCAT	0.567																0.027972	-28.125691	6.994825	4	139	KEEP	---	---	---	---	2	3	97	68	-1	capture	Missense_Mutation	SNP	202249926	202249926	LGR6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8678	155
LAMB3	3914	broad.mit.edu	37	1	209797264	209797264	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209797264G>A	uc001hhg.2	-	14	2448	c.2058C>T	c.(2056-2058)GAC>GAT	p.D686D	LAMB3_uc009xco.2_Silent_p.D686D|LAMB3_uc001hhh.2_Silent_p.D686D|LAMB3_uc010psl.1_RNA|hsa-mir-4260|MI0015859_5'Flank	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	686	Domain II.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGAAGCTTCTGTCAAGACTCT	0.547																0.081761	-3.165844	25.256161	13	146	KEEP	---	---	---	---	5	9	99	60	-1	capture	Silent	SNP	209797264	209797264	LAMB3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	8532	155
VDAC2	7417	broad.mit.edu	37	10	76970926	76970926	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:76970926C>T	uc001jwz.2	+	2	169	c.10C>T	c.(10-12)CAC>TAC	p.H4Y	VDAC2_uc010qld.1_5'UTR|VDAC2_uc001jxa.2_5'UTR|VDAC2_uc010qle.1_5'UTR	NM_003375	NP_003366	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	4						mitochondrial nucleoid|mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	CATGGCGACCCACGGACAGAC	0.627																0.857143	40.307981	42.027707	12	2	KEEP	---	---	---	---	8	10	1	1	-1	capture	Missense_Mutation	SNP	76970926	76970926	VDAC2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	17029	155
PTEN	5728	broad.mit.edu	37	10	89690846	89690846	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89690846G>T	uc001kfb.2	+	5	1284	c.253G>T	c.(253-255)GTT>TTT	p.V85F		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	85	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.V85A(2)|p.C71fs*6(2)|p.L70fs*7(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.V85G(1)|p.N82_P95del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TAATTGCAGAGGTAGGTATGA	0.318			31	(NCIH446-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.595745	89.506171	89.882125	28	19	KEEP	---	---	---	---	16	16	6	14	0.5	capture	Missense_Mutation	SNP	89690846	89690846	PTEN	10	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	12633	155
SEC23IP	11196	broad.mit.edu	37	10	121668628	121668628	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:121668628A>G	uc001leu.1	+	5	1249	c.1177A>G	c.(1177-1179)ATG>GTG	p.M393V	SEC23IP_uc010qtc.1_Missense_Mutation_p.M182V	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	393					Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GACAATTGTTATGCACAATCC	0.303																0.763889	205.865108	210.451292	55	17	KEEP	---	---	---	---	39	19	13	5	-1	capture	Missense_Mutation	SNP	121668628	121668628	SEC23IP	10	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	13886	155
TH	7054	broad.mit.edu	37	11	2186970	2186970	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2186970G>A	uc001lvq.2	-	12	1240	c.1221C>T	c.(1219-1221)TTC>TTT	p.F407F	TH_uc001lvp.2_Silent_p.F403F|TH_uc001lvr.2_Silent_p.F376F|TH_uc010qxj.1_Silent_p.F380F|TH_uc001lvs.2_Silent_p.F282F|TH_uc001lvt.2_Silent_p.F286F|TH_uc009ydh.1_RNA	NM_199292	NP_954986	P07101	TY3H_HUMAN	tyrosine hydroxylase isoform a	407					dopamine biosynthetic process from tyrosine|embryonic camera-type eye morphogenesis|epinephrine biosynthetic process|eye photoreceptor cell development|heart morphogenesis|hormone biosynthetic process|learning|locomotory behavior|memory|neurotransmitter biosynthetic process|neurotransmitter secretion|norepinephrine biosynthetic process|pigmentation|regulation of heart contraction|response to ethanol|response to hypoxia|synaptic transmission, dopaminergic|visual perception	cytosol|internal side of plasma membrane|melanosome membrane|nucleus|perikaryon|smooth endoplasmic reticulum	protein binding|tyrosine 3-monooxygenase activity				0		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	TACACAGCCCGAACTCCACCG	0.667																0.142857	6.481008	9.922689	4	24	KEEP	---	---	---	---	1	4	12	16	-1	capture	Silent	SNP	2186970	2186970	TH	11	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	15723	155
OR51A4	401666	broad.mit.edu	37	11	4967921	4967921	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4967921A>G	uc010qys.1	-	1	410	c.410T>C	c.(409-411)ATC>ACC	p.I137T		NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGTTGTCAGGATTGAGGTGTA	0.428																0.311547	450.765347	465.276164	143	316	KEEP	---	---	---	---	96	72	240	144	-1	capture	Missense_Mutation	SNP	4967921	4967921	OR51A4	11	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	10991	155
NAV2	89797	broad.mit.edu	37	11	19961278	19961278	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:19961278A>G	uc010rdm.1	+	9	2535	c.2174A>G	c.(2173-2175)CAC>CGC	p.H725R	NAV2_uc001mpp.2_Missense_Mutation_p.H638R|NAV2_uc001mpr.3_Missense_Mutation_p.H702R	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	725						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GAGCCCAGCCACTTCACCAAG	0.532																0.2	16.505503	19.434818	7	28	KEEP	---	---	---	---	4	5	28	19	-1	capture	Missense_Mutation	SNP	19961278	19961278	NAV2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10091	155
SPRYD5	84767	broad.mit.edu	37	11	55655591	55655591	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55655591C>A	uc010rip.1	+	4	683	c.591C>A	c.(589-591)CAC>CAA	p.H197Q	SPRYD5_uc010riq.1_Missense_Mutation_p.H54Q	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	197						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				AGCAACATCACTTGGAAAGGC	0.423																0.2	24.694906	29.297787	11	44	KEEP	---	---	---	---	4	7	25	26	0.636363636364	capture	Missense_Mutation	SNP	55655591	55655591	SPRYD5	11	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	15003	155
BIN2	51411	broad.mit.edu	37	12	51696870	51696870	+	Splice_Site	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51696870C>T	uc001ryg.2	-	3	269	c.217_splice	c.e3+1	p.V73_splice	BIN2_uc009zlz.2_Splice_Site_p.V73_splice|BIN2_uc001ryh.2_Splice_Site|BIN2_uc010sng.1_Splice_Site_p.V47_splice	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						GCATTGCCCACCTTTGACTGC	0.433																0.337349	159.246465	163.131806	56	110	KEEP	---	---	---	---	40	27	77	55	-1	capture	Splice_Site	SNP	51696870	51696870	BIN2	12	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	1421	155
OR6C75	390323	broad.mit.edu	37	12	55759400	55759400	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55759400C>G	uc010spk.1	+	1	506	c.506C>G	c.(505-507)TCC>TGC	p.S169C		NM_001005497	NP_001005497	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3						TTCTGTGCCTCCAATGTAATT	0.433																0.302158	137.899219	142.754988	42	97	KEEP	---	---	---	---	31	14	72	35	-1	capture	Missense_Mutation	SNP	55759400	55759400	OR6C75	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	11103	155
FGD6	55785	broad.mit.edu	37	12	95604181	95604181	+	Silent	SNP	T	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95604181T>C	uc001tdp.3	-	2	1103	c.879A>G	c.(877-879)TCA>TCG	p.S293S	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	293					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						CTTTGACTTCTGATTTCTTAC	0.388																0.397727	216.505912	218.118444	70	106	KEEP	---	---	---	---	58	20	72	44	-1	capture	Silent	SNP	95604181	95604181	FGD6	12	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	5783	155
TBX5	6910	broad.mit.edu	37	12	114804065	114804065	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114804065C>A	uc001tvo.2	-	8	1382	c.887G>T	c.(886-888)GGT>GTT	p.G296V	TBX5_uc001tvp.2_Missense_Mutation_p.G296V|TBX5_uc001tvq.2_Missense_Mutation_p.G246V|TBX5_uc010syv.1_Missense_Mutation_p.G296V	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	296					cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCCGGAAACACCATTCTCACA	0.552	NSCLC(152;1358 1980 4050 23898 40356)															0.382353	111.400653	112.638357	39	63	KEEP	---	---	---	---	22	17	35	30	0.435897435897	capture	Missense_Mutation	SNP	114804065	114804065	TBX5	12	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	15548	155
FAM124A	220108	broad.mit.edu	37	13	51825705	51825705	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:51825705G>A	uc001vfg.1	+	3	333	c.202G>A	c.(202-204)GTC>ATC	p.V68I	FAM124A_uc001vfe.2_Missense_Mutation_p.V68I|FAM124A_uc001vff.1_Missense_Mutation_p.V104I	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	68										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CATCGACAACGTCCTGGCGTG	0.682																0.261905	27.407055	29.560746	11	31	KEEP	---	---	---	---	8	6	24	13	-1	capture	Missense_Mutation	SNP	51825705	51825705	FAM124A	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5379	155
FOXA1	3169	broad.mit.edu	37	14	38061904	38061904	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38061904C>T	uc001wuf.2	-	2	397	c.85G>A	c.(85-87)GTC>ATC	p.V29I	FOXA1_uc010tpz.1_5'UTR	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	29					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CTGACCGGGACGGAGGAGTAG	0.632																0.353448	108.260125	110.490967	41	75	KEEP	---	---	---	---	23	21	59	22	-1	capture	Missense_Mutation	SNP	38061904	38061904	FOXA1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5933	155
UNC13C	440279	broad.mit.edu	37	15	54556392	54556392	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:54556392G>A	uc002ack.2	+	7	3475	c.3475G>A	c.(3475-3477)GGT>AGT	p.G1159S	UNC13C_uc002acl.2_5'UTR	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1159					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTCTAAACATGGTGCCGAAGA	0.398					2691											0.6	18.650999	18.738233	6	4	KEEP	---	---	---	---	3	3	5	0	-1	capture	Missense_Mutation	SNP	54556392	54556392	UNC13C	15	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16868	155
FAM108C1	58489	broad.mit.edu	37	15	81041941	81041941	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81041941C>T	uc002bfu.2	+	2	797	c.678C>T	c.(676-678)TGC>TGT	p.C226C	FAM108C1_uc002bft.2_Intron	NM_021214	NP_067037	Q6PCB6	F108C_HUMAN	hypothetical protein LOC58489	226							hydrolase activity				0						GGTATGAATGCGCAGCGGTAA	0.507																0.042105	-13.878525	7.51365	4	91	KEEP	---	---	---	---	3	1	58	40	-1	capture	Silent	SNP	81041941	81041941	FAM108C1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5347	155
SLC28A1	9154	broad.mit.edu	37	15	85448820	85448820	+	Silent	SNP	A	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85448820A>T	uc002blg.2	+	8	856	c.654A>T	c.(652-654)GGA>GGT	p.G218G	SLC28A1_uc010upd.1_Silent_p.G140G|SLC28A1_uc010bnb.2_Silent_p.G218G|SLC28A1_uc010upe.1_Silent_p.G218G|SLC28A1_uc010upf.1_Silent_p.G218G|SLC28A1_uc010upg.1_Silent_p.G218G	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	218	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TTGTACTTGGACTCCTCGTCA	0.567																0.115942	8.755121	18.771203	8	61	KEEP	---	---	---	---	8	2	47	24	-1	capture	Silent	SNP	85448820	85448820	SLC28A1	15	A	T	T	T	1	0	0	0	0	0	0	0	1	119	10	4	4	14423	155
IL4R	3566	broad.mit.edu	37	16	27357926	27357926	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27357926A>T	uc002don.2	+	6	742	c.500A>T	c.(499-501)AAC>ATC	p.N167I	IL4R_uc002dom.2_Missense_Mutation_p.N167I|IL4R_uc002dop.3_Missense_Mutation_p.N152I|IL4R_uc010bxy.2_Missense_Mutation_p.N167I|IL4R_uc002doo.2_Missense_Mutation_p.T9S	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	167	Extracellular (Potential).|Fibronectin type-III.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						TGGAGTGAAAACGACCCGGCA	0.542																0.325926	121.354379	124.983185	44	91	KEEP	---	---	---	---	24	25	49	52	-1	capture	Missense_Mutation	SNP	27357926	27357926	IL4R	16	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	7621	155
ZNF319	57567	broad.mit.edu	37	16	58030933	58030933	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58030933C>T	uc002emx.1	-	2	1860	c.1237G>A	c.(1237-1239)GAG>AAG	p.E413K		NM_020807	NP_065858	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	413	C2H2-type 11; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGCAGCAGCTCGGCAGATTGG	0.647																0.419753	97.729707	98.185996	34	47	KEEP	---	---	---	---	20	17	28	29	-1	capture	Missense_Mutation	SNP	58030933	58030933	ZNF319	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17717	155
HYDIN	54768	broad.mit.edu	37	16	70917863	70917863	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70917863G>A	uc002ezr.2	-	59	10064	c.9936C>T	c.(9934-9936)GCC>GCT	p.A3312A		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3313										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				AAAGAATGCCGGCAGGGTGGA	0.488																0.175439	22.417048	28.076995	10	47	KEEP	---	---	---	---	6	5	39	25	-1	capture	Silent	SNP	70917863	70917863	HYDIN	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7392	155
MYBBP1A	10514	broad.mit.edu	37	17	4449142	4449142	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4449142G>C	uc002fyb.3	-	14	1982	c.1920C>G	c.(1918-1920)ATC>ATG	p.I640M	MYBBP1A_uc002fxz.3_Missense_Mutation_p.I640M|MYBBP1A_uc010vsa.1_5'Flank	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2	640					nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						AGGACCCACCGATGGTCTTGG	0.652																0.647059	40.831386	41.15645	11	6	KEEP	---	---	---	---	6	8	3	4	-1	capture	Missense_Mutation	SNP	4449142	4449142	MYBBP1A	17	G	C	C	C	1	0	0	0	0	1	0	0	0	473	37	4	4	9918	155
TP53	7157	broad.mit.edu	37	17	7578395	7578395	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578395G>A	uc002gim.2	-	5	729	c.535C>T	c.(535-537)CAT>TAT	p.H179Y	TP53_uc002gig.1_Missense_Mutation_p.H179Y|TP53_uc002gih.2_Missense_Mutation_p.H179Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H47Y|TP53_uc010cng.1_Missense_Mutation_p.H47Y|TP53_uc002gii.1_Missense_Mutation_p.H47Y|TP53_uc010cnh.1_Missense_Mutation_p.H179Y|TP53_uc010cni.1_Missense_Mutation_p.H179Y|TP53_uc002gij.2_Missense_Mutation_p.H179Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H86Y|TP53_uc002gio.2_Missense_Mutation_p.H47Y|TP53_uc010vug.1_Missense_Mutation_p.H140Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	179	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H179R(99)|p.H179Y(74)|p.H179L(31)|p.H179Q(17)|p.H179N(13)|p.H179D(10)|p.P177_C182delPHHERC(8)|p.0?(7)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.R175_E180delRCPHHE(3)|p.H179fs*68(2)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.R174fs*3(1)|p.H178_H179>QY(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGCGCTCATGGTGGGGGCAG	0.642	Pancreas(47;798 1329 9957 10801)		111	p.R174fs(THP1-Tumor)|p.H179D(FUOV1-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.596774	113.681411	114.188191	37	25	KEEP	---	---	---	---	26	17	18	15	-1	capture	Missense_Mutation	SNP	7578395	7578395	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16264	155
MYOCD	93649	broad.mit.edu	37	17	12656063	12656063	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12656063G>A	uc002gnn.2	+	10	1757	c.1458G>A	c.(1456-1458)CCG>CCA	p.P486P	MYOCD_uc002gno.2_Silent_p.P486P|MYOCD_uc002gnp.1_Silent_p.P390P|MYOCD_uc002gnq.2_Silent_p.P205P	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	486	Ser-rich.				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCCTGCACCCGTCCCCAGTCC	0.632																0.537037	85.874383	85.93872	29	25	KEEP	---	---	---	---	15	14	7	18	-1	capture	Silent	SNP	12656063	12656063	MYOCD	17	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9997	155
LRRC30	339291	broad.mit.edu	37	18	7231554	7231554	+	Nonsense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7231554C>T	uc010wzk.1	+	1	418	c.418C>T	c.(418-420)CGA>TGA	p.R140*		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	140										ovary(1)|liver(1)	2						GAGCTTGTGCCGAAAGCTGGA	0.572																0.263889	52.522064	56.132152	19	53	KEEP	---	---	---	---	9	10	26	28	-1	capture	Nonsense_Mutation	SNP	7231554	7231554	LRRC30	18	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8901	155
MIB1	57534	broad.mit.edu	37	18	19395686	19395686	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19395686G>A	uc002ktq.2	+	11	1589	c.1589G>A	c.(1588-1590)CGA>CAA	p.R530Q	MIB1_uc002ktp.2_Missense_Mutation_p.R169Q	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	530	ANK 4.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			AACAAGCGCCGACAGACACCA	0.438																0.1	4.068523	15.273878	7	63	KEEP	---	---	---	---	5	2	46	24	-1	capture	Missense_Mutation	SNP	19395686	19395686	MIB1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9478	155
SERPINB11	89778	broad.mit.edu	37	18	61377523	61377523	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61377523G>A	uc002ljk.3	+	2	158	c.96G>A	c.(94-96)TCG>TCA	p.S32S	SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_5'UTR|SERPINB11_uc002ljj.3_5'UTR|SERPINB11_uc010dqe.2_5'UTR|SERPINB11_uc010dqf.2_Silent_p.S32S	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11	32					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				TCTTTTCTTCGCTGAGTCTGC	0.433	Ovarian(27;496 784 5942 8975 23930)															0.175439	19.91762	25.57799	10	47	KEEP	---	---	---	---	6	4	28	21	-1	capture	Silent	SNP	61377523	61377523	SERPINB11	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13991	155
SALL3	27164	broad.mit.edu	37	18	76753193	76753193	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:76753193C>T	uc002lmt.2	+	2	1202	c.1202C>T	c.(1201-1203)CCG>CTG	p.P401L	SALL3_uc010dra.2_Missense_Mutation_p.P8L	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	401					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		AAGGGCAAGCCGCCCAATGTG	0.662																0.473684	28.774015	28.785445	9	10	KEEP	---	---	---	---	3	8	7	5	-1	capture	Missense_Mutation	SNP	76753193	76753193	SALL3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13704	155
HCN2	610	broad.mit.edu	37	19	605149	605149	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:605149G>A	uc002lpe.2	+	3	1198	c.1145G>A	c.(1144-1146)GGC>GAC	p.G382D		NM_001194	NP_001185	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic	382	Helical; Name=Segment S5; (Potential).				cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTGGGACGGCTGCCTGCAG	0.617	Melanoma(145;1175 2427 8056 36306)															0.036036	-18.266957	7.638764	4	107	KEEP	---	---	---	---	3	2	98	44	-1	capture	Missense_Mutation	SNP	605149	605149	HCN2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6923	155
REEP6	92840	broad.mit.edu	37	19	1496383	1496383	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1496383G>T	uc002ltc.2	+	4	552	c.448G>T	c.(448-450)GCC>TCC	p.A150S		NM_138393	NP_612402	Q96HR9	REEP6_HUMAN	receptor accessory protein 6	150						integral to membrane					0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCACGGGGCCGTAGACAG	0.657																0.08	-6.345447	7.177017	6	69	KEEP	---	---	---	---	3	4	41	37	0.428571428571	capture	Missense_Mutation	SNP	1496383	1496383	REEP6	19	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	13104	155
ADAT3	113179	broad.mit.edu	37	19	1912807	1912807	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1912807G>T	uc002luh.2	+	2	941	c.713G>T	c.(712-714)CGC>CTC	p.R238L	SCAMP4_uc002lui.1_Intron|SCAMP4_uc002luj.2_Intron|SCAMP4_uc002luk.2_Intron|SCAMP4_uc010dss.2_Intron	NM_138422	NP_612431	Q96EY9	ADAT3_HUMAN	tRNA-specific adenosine deaminase 3	238					tRNA processing		hydrolase activity|zinc ion binding			breast(1)|skin(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCAGGGCCGCGGCACCTAC	0.741																0.307692	23.098785	23.951194	8	18	KEEP	---	---	---	---	6	2	7	12	0.75	capture	Missense_Mutation	SNP	1912807	1912807	ADAT3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	286	155
ILF3	3609	broad.mit.edu	37	19	10794068	10794068	+	Silent	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10794068A>G	uc002mpn.2	+	15	2018	c.1701A>G	c.(1699-1701)CAA>CAG	p.Q567Q	ILF3_uc002mpm.2_Silent_p.Q571Q|ILF3_uc002mpl.2_Silent_p.Q567Q|ILF3_uc002mpk.2_Silent_p.Q567Q|ILF3_uc010xli.1_Silent_p.Q165Q|ILF3_uc002mpo.2_Silent_p.Q571Q|ILF3_uc002mpp.2_Silent_p.Q392Q|ILF3_uc002mpq.2_5'Flank	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	567	DRBM 2.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			AGAAGTTCCAAGGTGCTGGTT	0.572																0.409091	118.784274	119.419411	36	52	KEEP	---	---	---	---	13	24	40	15	-1	capture	Silent	SNP	10794068	10794068	ILF3	19	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	7635	155
OR10H5	284433	broad.mit.edu	37	19	15905136	15905136	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15905136C>T	uc010xos.1	+	1	278	c.278C>T	c.(277-279)GCC>GTC	p.A93V		NM_001004466	NP_001004466	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CGCTCCATCGCCTTCCTGGCC	0.607																0.183099	49.066907	62.458745	26	116	KEEP	---	---	---	---	22	11	86	71	-1	capture	Missense_Mutation	SNP	15905136	15905136	OR10H5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10813	155
MYO9B	4650	broad.mit.edu	37	19	17312748	17312748	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17312748G>A	uc010eak.2	+	27	4729	c.4577G>A	c.(4576-4578)CGT>CAT	p.R1526H	MYO9B_uc002nfi.2_Missense_Mutation_p.R1526H|MYO9B_uc002nfj.1_Missense_Mutation_p.R1526H|MYO9B_uc002nfl.1_Missense_Mutation_p.R75H	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1526	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						AATGACCTCCGTTCCCAGAAG	0.572																0.181818	8.492045	10.58028	4	18	KEEP	---	---	---	---	0	5	8	12	-1	capture	Missense_Mutation	SNP	17312748	17312748	MYO9B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9995	155
PIK3R2	5296	broad.mit.edu	37	19	18280016	18280016	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18280016C>T	uc002nia.1	+	16	2611	c.2099C>T	c.(2098-2100)TCG>TTG	p.S700L	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	700	SH2 2.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						CAGCACGCCTCGCTGGTGCAG	0.542					186											0.381818	60.865109	61.537561	21	34	KEEP	---	---	---	---	9	12	18	17	-1	capture	Missense_Mutation	SNP	18280016	18280016	PIK3R2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11822	155
SLC7A10	56301	broad.mit.edu	37	19	33706697	33706697	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33706697C>T	uc002num.2	-	2	481	c.334G>A	c.(334-336)GAG>AAG	p.E112K	SLC7A10_uc010xrq.1_Intron	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN	solute carrier family 7, member 10	112			E -> D (in a family with cystinuria).		blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(110;0.137)					CCGAAGATCTCTGTGACGTAG	0.657																0.375	8.622693	8.732562	3	5	KEEP	---	---	---	---	0	4	4	2	-1	capture	Missense_Mutation	SNP	33706697	33706697	SLC7A10	19	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	14585	155
FAM71E1	112703	broad.mit.edu	37	19	50979619	50979619	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50979619G>A	uc002psh.2	-	1	385	c.27C>T	c.(25-27)CTC>CTT	p.L9L	FAM71E1_uc002psg.2_Silent_p.L9L|FAM71E1_uc002psi.2_RNA|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	9										breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		GCGGCTCCTGGAGATCAGGCC	0.682																0.072165	-3.40858	14.831315	7	90	KEEP	---	---	---	---	6	2	66	37	-1	capture	Silent	SNP	50979619	50979619	FAM71E1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	5559	155
ZNF776	284309	broad.mit.edu	37	19	58265771	58265771	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58265771G>T	uc002qpx.2	+	3	1496	c.1273G>T	c.(1273-1275)GTT>TTT	p.V425F	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.V425F	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	425	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		ACACCAGAGAGTTCACACTGG	0.428																0.065693	-6.642635	20.182045	9	128	KEEP	---	---	---	---	3	6	60	77	0.333333333333	capture	Missense_Mutation	SNP	58265771	58265771	ZNF776	19	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	18025	155
BCL11A	53335	broad.mit.edu	37	2	60688453	60688453	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:60688453C>T	uc002sae.1	-	4	1822	c.1594G>A	c.(1594-1596)GCG>ACG	p.A532T	BCL11A_uc002sab.2_Missense_Mutation_p.A532T|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Missense_Mutation_p.A201T|BCL11A_uc010ypj.1_Missense_Mutation_p.A498T|BCL11A_uc002sad.1_Missense_Mutation_p.A380T|BCL11A_uc002saf.1_Missense_Mutation_p.A498T	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	532					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CCCACGACCGCGCCCCGCGAG	0.637					131	T	IGH@	B-CLL								0.115385	3.065437	6.802853	3	23	KEEP	---	---	---	---	0	4	11	15	-1	capture	Missense_Mutation	SNP	60688453	60688453	BCL11A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1352	155
MYO7B	4648	broad.mit.edu	37	2	128370138	128370138	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128370138C>T	uc002top.2	+	25	3333	c.3280C>T	c.(3280-3282)CAC>TAC	p.H1094Y		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1094	MyTH4 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GGAGAAGGTGCACTTCATCGT	0.602																0.2	10.16116	12.253834	5	20	KEEP	---	---	---	---	4	2	13	9	-1	capture	Missense_Mutation	SNP	128370138	128370138	MYO7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9993	155
SCN9A	6335	broad.mit.edu	37	2	167056246	167056246	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167056246A>T	uc010fpl.2	-	27	5211	c.4870T>A	c.(4870-4872)TTT>ATT	p.F1624I	uc002udp.2_RNA	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1635	IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ATCAAAGCAAAGAGCAGCGTG	0.507																0.524229	362.920052	363.03516	119	108	KEEP	---	---	---	---	67	59	51	59	-1	capture	Missense_Mutation	SNP	167056246	167056246	SCN9A	2	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	13818	155
HOXD4	3233	broad.mit.edu	37	2	177017342	177017342	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:177017342C>T	uc002uks.2	+	2	689	c.440C>T	c.(439-441)CCC>CTC	p.P147L		NM_014621	NP_055436	P09016	HXD4_HUMAN	homeobox D4	147						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GCAGTGAACCCCAACTACACC	0.527																0.236111	44.439746	49.02249	17	55	KEEP	---	---	---	---	10	9	33	31	-1	capture	Missense_Mutation	SNP	177017342	177017342	HOXD4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7249	155
COL3A1	1281	broad.mit.edu	37	2	189858803	189858803	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189858803G>A	uc002uqj.1	+	17	1306	c.1189G>A	c.(1189-1191)GAA>AAA	p.E397K	COL3A1_uc010frw.1_RNA	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	397	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TGGTAAAGGCGAAATGGTAAG	0.373					1079											0.5	124.885536	124.885536	40	40	KEEP	---	---	---	---	36	11	25	18	-1	capture	Missense_Mutation	SNP	189858803	189858803	COL3A1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3653	155
PRKAG3	53632	broad.mit.edu	37	2	219689035	219689035	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219689035C>T	uc002vjb.1	-	12	1282	c.1263G>A	c.(1261-1263)CTG>CTA	p.L421L		NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	421					cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)|lung(1)	2		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTCTGCCTCAGGGCTTCTC	0.597																0.5	102.206885	102.206885	35	35	KEEP	---	---	---	---	27	13	22	20	-1	capture	Silent	SNP	219689035	219689035	PRKAG3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	12398	155
SEL1L2	80343	broad.mit.edu	37	20	13830942	13830942	+	Missense_Mutation	SNP	C	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13830942C>A	uc010gcf.2	-	19	1924	c.1842G>T	c.(1840-1842)TTG>TTT	p.L614F	SEL1L2_uc002woq.3_Missense_Mutation_p.L475F|SEL1L2_uc010zrl.1_Missense_Mutation_p.L501F|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	614	Extracellular (Potential).|Sel1-like 11.					integral to membrane	binding			ovary(2)	2						CCATGTCGTACAATCTTCTGG	0.448																0.098592	5.868128	17.31472	7	64	KEEP	---	---	---	---	6	3	41	40	0.333333333333	capture	Missense_Mutation	SNP	13830942	13830942	SEL1L2	20	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	13904	155
ZBP1	81030	broad.mit.edu	37	20	56190589	56190589	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56190589G>A	uc002xyo.2	-	3	588	c.307C>T	c.(307-309)CCT>TCT	p.P103S	ZBP1_uc010gjm.2_Missense_Mutation_p.P103S|ZBP1_uc002xyp.2_Missense_Mutation_p.P28S|ZBP1_uc010zzn.1_Missense_Mutation_p.P103S	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1 isoform a	103	DRADA 2.					cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			CTGAACTGAGGGCCAGGGGTC	0.592																0.31068	91.407138	94.671111	32	71	KEEP	---	---	---	---	21	12	46	36	-1	capture	Missense_Mutation	SNP	56190589	56190589	ZBP1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	17401	155
C1QTNF6	114904	broad.mit.edu	37	22	37578306	37578306	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37578306G>A	uc003aqw.1	-	2	1207	c.702C>T	c.(700-702)CGC>CGT	p.R234R	C1QTNF6_uc003aqx.1_Silent_p.R253R|C1QTNF6_uc003aqy.1_Silent_p.R253R|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	234	C1q.					collagen					0						TGGCGTTCTCGCGCTGGCGCT	0.652																0.428571	64.414835	64.657361	24	32	KEEP	---	---	---	---	17	9	22	11	-1	capture	Silent	SNP	37578306	37578306	C1QTNF6	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1949	155
SH3BP1	23616	broad.mit.edu	37	22	38046222	38046222	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38046222G>A	uc003ati.2	+	15	1491	c.1380G>A	c.(1378-1380)GCG>GCA	p.A460A	SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_Missense_Mutation_p.R493H|SH3BP1_uc003ath.1_Silent_p.A460A|SH3BP1_uc003atj.1_Silent_p.A396A|SH3BP1_uc003atk.1_Silent_p.A374A|uc003atl.1_Intron	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	460	Rho-GAP.				signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TCGTCGAGGCGCTGATCCAGA	0.577																0.352941	47.934456	48.90712	18	33	KEEP	---	---	---	---	10	11	15	21	-1	capture	Silent	SNP	38046222	38046222	SH3BP1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14137	155
SMC1B	27127	broad.mit.edu	37	22	45754668	45754668	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:45754668G>A	uc003bgc.2	-	19	2922	c.2870C>T	c.(2869-2871)ACT>ATT	p.T957I	SMC1B_uc003bgd.2_Missense_Mutation_p.T957I	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	957					chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTCTGCTTCAGTTCCCATCTG	0.214																0.377049	131.115771	132.735922	46	76	KEEP	---	---	---	---	32	19	54	25	-1	capture	Missense_Mutation	SNP	45754668	45754668	SMC1B	22	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	14674	155
GRM7	2917	broad.mit.edu	37	3	6903256	6903256	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:6903256G>T	uc003bqm.2	+	1	455	c.181G>T	c.(181-183)GGT>TGT	p.G61C	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.G61C|GRM7_uc003bql.2_Missense_Mutation_p.G61C	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	61	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	GCACGCCAAGGGTCCCAGCGG	0.672																0.285714	19.891211	21.043425	8	20	KEEP	---	---	---	---	6	3	11	10	0.666666666667	capture	Missense_Mutation	SNP	6903256	6903256	GRM7	3	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	6735	155
CD38	952	broad.mit.edu	37	4	15835885	15835885	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15835885A>G	uc011bxc.1	+	4	652	c.545A>G	c.(544-546)AAC>AGC	p.N182S	CD38_uc003gol.1_Missense_Mutation_p.N182S	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen	182	Extracellular (Potential).				B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						GACTGCAGCAACAACCCTGTT	0.388																0.037037	-18.840138	12.501063	5	130	KEEP	---	---	---	---	4	3	95	62	-1	capture	Missense_Mutation	SNP	15835885	15835885	CD38	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2980	155
GALNT7	51809	broad.mit.edu	37	4	174219326	174219326	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:174219326C>T	uc003isz.3	+	6	1109	c.1026C>T	c.(1024-1026)CCC>CCT	p.P342P	GALNT7_uc011ckb.1_Intron	NM_017423	NP_059119	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	342	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		AAATTATACCCCAAGGGGGTG	0.473																0.525773	163.725023	163.780746	51	46	KEEP	---	---	---	---	35	18	33	14	-1	capture	Silent	SNP	174219326	174219326	GALNT7	4	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	6158	155
C9	735	broad.mit.edu	37	5	39316092	39316092	+	Missense_Mutation	SNP	C	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:39316092C>G	uc003jlv.3	-	6	744	c.655G>C	c.(655-657)GAA>CAA	p.E219Q		NM_001737	NP_001728	P02748	CO9_HUMAN	complement component 9 precursor	219	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex					0	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TCAATTTGTTCTTCGTAATGT	0.303																0.246753	55.792667	60.283307	19	58	KEEP	---	---	---	---	12	7	35	25	-1	capture	Missense_Mutation	SNP	39316092	39316092	C9	5	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	2420	155
HEATR7B2	133558	broad.mit.edu	37	5	41061824	41061824	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41061824G>T	uc003jmj.3	-	6	953	c.463C>A	c.(463-465)CTT>ATT	p.L155I		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	155							binding			ovary(6)|central_nervous_system(2)	8						AATTTCTCAAGGGCTGCATTT	0.398																0.416667	119.882017	120.464316	40	56	KEEP	---	---	---	---	24	17	26	30	0.585365853659	capture	Missense_Mutation	SNP	41061824	41061824	HEATR7B2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	6961	155
POLR3G	10622	broad.mit.edu	37	5	89802453	89802453	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89802453G>A	uc003kjq.2	+	7	747	c.547G>A	c.(547-549)GCA>ACA	p.A183T	POLR3G_uc011cuc.1_Missense_Mutation_p.A183T	NM_006467	NP_006458	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	183	Glu-rich.				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		cgatgatgccgcagaacagga	0.090																0.404494	107.607664	108.309311	36	53	KEEP	---	---	---	---	25	12	35	22	-1	capture	Missense_Mutation	SNP	89802453	89802453	POLR3G	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12136	155
C5orf46	389336	broad.mit.edu	37	5	147286057	147286057	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147286057A>C	uc010jgp.2	-	1	45	c.8T>G	c.(7-9)GTC>GGC	p.V3G	C5orf46_uc003lou.2_Missense_Mutation_p.V3G|C5orf46_uc003lov.3_Missense_Mutation_p.V3G	NM_206966	NP_996849	Q6UWT4	CE046_HUMAN	hypothetical protein LOC389336 precursor	3						extracellular region					0						AAGTACTGAGACAGCCATTCT	0.453																0.216216	3.594856	6.58569	8	29	KEEP	---	---	---	---	14	6	17	20	-1	capture	Missense_Mutation	SNP	147286057	147286057	C5orf46	5	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	2282	155
SH3TC2	79628	broad.mit.edu	37	5	148427540	148427540	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148427540G>C	uc003lpu.2	-	3	316	c.164C>G	c.(163-165)TCC>TGC	p.S55C	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Missense_Mutation_p.S55C|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_5'UTR|SH3TC2_uc003lpw.1_Missense_Mutation_p.S55C	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	55							binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACACAGAAGGAGAGTGTCAG	0.498																0.428571	301.377798	302.248638	84	112	KEEP	---	---	---	---	43	49	62	64	-1	capture	Missense_Mutation	SNP	148427540	148427540	SH3TC2	5	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	14155	155
KIAA0319	9856	broad.mit.edu	37	6	24563628	24563628	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24563628C>T	uc011djo.1	-	16	2787	c.2550G>A	c.(2548-2550)TCG>TCA	p.S850S	KIAA0319_uc011djp.1_Silent_p.S805S|KIAA0319_uc003neh.1_Silent_p.S850S|KIAA0319_uc011djq.1_Silent_p.S841S|KIAA0319_uc011djr.1_Silent_p.S850S|KIAA0319_uc010jpt.1_Silent_p.S261S	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	850	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						CCTTAATGTCCGAGTCCAGCA	0.587																0.561644	126.767338	127.007969	41	32	KEEP	---	---	---	---	21	21	20	13	-1	capture	Silent	SNP	24563628	24563628	KIAA0319	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8090	155
PHACTR2	9749	broad.mit.edu	37	6	144033221	144033221	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:144033221T>C	uc003qjq.3	+	2	212	c.82T>C	c.(82-84)TTC>CTC	p.F28L	PHACTR2_uc010khh.2_Missense_Mutation_p.F28L|PHACTR2_uc010khi.2_Missense_Mutation_p.F39L|PHACTR2_uc003qjr.3_Missense_Mutation_p.F39L	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	28							actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AACACCTCCCTTCAAAAGAAA	0.433	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)															0.022472	-36.158515	9.101093	4	174	KEEP	---	---	---	---	0	4	95	84	-1	capture	Missense_Mutation	SNP	144033221	144033221	PHACTR2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11713	155
SDK1	221935	broad.mit.edu	37	7	4213951	4213951	+	Missense_Mutation	SNP	C	T	T	rs140602039		TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4213951C>T	uc003smx.2	+	33	5037	c.4898C>T	c.(4897-4899)ACG>ATG	p.T1633M	SDK1_uc010kso.2_Missense_Mutation_p.T909M|SDK1_uc003smy.2_Missense_Mutation_p.T120M	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1633	Fibronectin type-III 10.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GAGGCCAAGACGCTCAAAAAC	0.562																0.028916	-80.250041	21.057046	12	403	KEEP	---	---	---	---	9	5	284	175	-1	capture	Missense_Mutation	SNP	4213951	4213951	SDK1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13861	155
CPVL	54504	broad.mit.edu	37	7	29160576	29160576	+	Silent	SNP	T	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29160576T>C	uc003szv.2	-	2	221	c.102A>G	c.(100-102)CCA>CCG	p.P34P	CPVL_uc003szw.2_Silent_p.P34P|CPVL_uc003szx.2_Silent_p.P34P	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like	34					proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						CTCCCTTAGGTGGCATGGAAA	0.468																0.349206	118.025622	120.56979	44	82	KEEP	---	---	---	---	22	23	41	45	-1	capture	Silent	SNP	29160576	29160576	CPVL	7	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	3800	155
AEBP1	165	broad.mit.edu	37	7	44148536	44148536	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44148536G>A	uc003tkb.2	+	7	1284	c.979G>A	c.(979-981)GAT>AAT	p.D327N	AEBP1_uc003tkc.3_5'Flank|AEBP1_uc003tkd.2_5'Flank	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	327					cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCAGAAGCCCGATGCTGAGCG	0.652																0.363636	23.394486	23.754217	8	14	KEEP	---	---	---	---	3	5	4	12	-1	capture	Missense_Mutation	SNP	44148536	44148536	AEBP1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	349	155
ZNF680	340252	broad.mit.edu	37	7	64004099	64004099	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64004099A>G	uc003tta.2	-	3	412	c.239T>C	c.(238-240)GTA>GCA	p.V80A	ZNF680_uc010kzr.2_Intron|ZNF680_uc003ttb.2_Missense_Mutation_p.V80A	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	80	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				GGGTTTGGCTACCATCTCCTG	0.428																0.214286	93.301439	104.900095	33	121	KEEP	---	---	---	---	23	15	84	53	-1	capture	Missense_Mutation	SNP	64004099	64004099	ZNF680	7	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	17965	155
ZAN	7455	broad.mit.edu	37	7	100377161	100377161	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100377161G>A	uc003uwj.2	+	36	6576	c.6411G>A	c.(6409-6411)GCG>GCA	p.A2137A	ZAN_uc003uwk.2_Silent_p.A2137A|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.A224A	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2137	Extracellular (Potential).|VWFD 3.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TCCGCAGGGCGCGGGAAAAGT	0.637																0.361111	34.863142	35.475137	13	23	KEEP	---	---	---	---	11	2	15	12	-1	capture	Silent	SNP	100377161	100377161	ZAN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17394	155
MUC17	140453	broad.mit.edu	37	7	100674926	100674926	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100674926G>A	uc003uxp.1	+	3	282	c.229G>A	c.(229-231)GTG>ATG	p.V77M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	77	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACAAATGTCGTGGAGCCAAG	0.448																0.192982	47.285517	57.315993	22	92	KEEP	---	---	---	---	10	15	65	41	-1	capture	Missense_Mutation	SNP	100674926	100674926	MUC17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9884	155
RELN	5649	broad.mit.edu	37	7	103124180	103124180	+	Silent	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103124180G>A	uc003vca.2	-	62	10261	c.10101C>T	c.(10099-10101)AAC>AAT	p.N3367N	RELN_uc010liz.2_Silent_p.N3367N	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3367	BNR 16.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGGTGATCCCGTTGTTGACGC	0.552	NSCLC(146;835 1944 15585 22231 52158)															0.104693	21.647928	64.633351	29	248	KEEP	---	---	---	---	19	12	157	107	-1	capture	Silent	SNP	103124180	103124180	RELN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13115	155
PUS7	54517	broad.mit.edu	37	7	105111170	105111170	+	Missense_Mutation	SNP	A	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:105111170A>C	uc003vcx.2	-	11	1582	c.1363T>G	c.(1363-1365)TAT>GAT	p.Y455D	PUS7_uc010lji.2_Missense_Mutation_p.Y461D|PUS7_uc003vcy.2_Missense_Mutation_p.Y455D|PUS7_uc003vcz.1_Missense_Mutation_p.Y455D	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog	455	TRUD.				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1						TTCATTCCATATTTTGAAAGT	0.423	Colon(138;2387 3051 17860)															0.263374	195.50653	207.798289	64	179	KEEP	---	---	---	---	49	24	113	83	-1	capture	Missense_Mutation	SNP	105111170	105111170	PUS7	7	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	12728	155
GIMAP7	168537	broad.mit.edu	37	7	150217096	150217096	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150217096G>A	uc003whk.2	+	2	164	c.34G>A	c.(34-36)GTT>ATT	p.V12I		NM_153236	NP_694968	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	12							GTP binding			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCTGAGGATCGTTCTGGTAGG	0.498																0.303571	89.404638	93.263213	34	78	KEEP	---	---	---	---	18	17	48	36	-1	capture	Missense_Mutation	SNP	150217096	150217096	GIMAP7	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6323	155
INTS9	55756	broad.mit.edu	37	8	28627526	28627526	+	Silent	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:28627526G>T	uc003xha.2	-	16	1979	c.1680C>A	c.(1678-1680)GCC>GCA	p.A560A	INTS9_uc011lav.1_Silent_p.A536A|INTS9_uc011law.1_Silent_p.A539A|INTS9_uc011lax.1_Silent_p.A453A|INTS9_uc010lvc.2_RNA	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1	560					snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		TCGTGGGCTGGGCGGGCCGAG	0.602														OREG0018682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.491228	80.994759	80.998611	28	29	KEEP	---	---	---	---	15	16	15	16	0.483870967742	capture	Silent	SNP	28627526	28627526	INTS9	8	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	7708	155
PRKDC	5591	broad.mit.edu	37	8	48772255	48772255	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48772255G>A	uc003xqi.2	-	47	6181	c.6124C>T	c.(6124-6126)CAA>TAA	p.Q2042*	PRKDC_uc003xqj.2_Nonsense_Mutation_p.Q2042*|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2042					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				AAATCAAATTGACTCATTTCC	0.423	Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566						NHEJ					0.242647	77.40057	85.618955	33	103	KEEP	---	---	---	---	23	10	59	46	-1	capture	Nonsense_Mutation	SNP	48772255	48772255	PRKDC	8	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	12417	155
RP1	6101	broad.mit.edu	37	8	55540932	55540932	+	Missense_Mutation	SNP	A	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55540932A>T	uc003xsd.1	+	4	4638	c.4490A>T	c.(4489-4491)GAG>GTG	p.E1497V	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1497					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	p.E1497E(1)		skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATCCAAGAAGAGGTAGAGGCT	0.313	Colon(91;1014 1389 7634 14542 40420)															0.454545	77.172469	77.27086	25	30	KEEP	---	---	---	---	21	19	26	21	-1	capture	Missense_Mutation	SNP	55540932	55540932	RP1	8	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	13424	155
TRPA1	8989	broad.mit.edu	37	8	72973980	72973980	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72973980G>A	uc003xza.2	-	7	999	c.824C>T	c.(823-825)GCC>GTC	p.A275V		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	275	Cytoplasmic (Potential).|ANK 7.					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	AAAATGAATGGCTGTGCACCT	0.393																0.25	45.384752	49.705351	19	57	KEEP	---	---	---	---	11	9	34	25	-1	capture	Missense_Mutation	SNP	72973980	72973980	TRPA1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16460	155
MAPK15	225689	broad.mit.edu	37	8	144801307	144801307	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144801307G>T	uc003yzj.2	+	6	603	c.562G>T	c.(562-564)GTG>TTG	p.V188L		NM_139021	NP_620590	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	188	Protein kinase.				protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding			lung(2)	2	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGCACCGGAGGTGCTGCTCTC	0.687					103											0.583333	23.130183	23.204268	7	5	KEEP	---	---	---	---	2	6	3	2	0.25	capture	Missense_Mutation	SNP	144801307	144801307	MAPK15	8	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9190	155
NCBP1	4686	broad.mit.edu	37	9	100433448	100433448	+	Silent	SNP	C	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100433448C>T	uc004axq.2	+	23	2799	c.2340C>T	c.(2338-2340)GCC>GCT	p.A780A		NM_002486	NP_002477	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	780					gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA cleavage|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of mRNA 3'-end processing|positive regulation of viral transcription|regulation of translational initiation|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm|ribonucleoprotein complex	protein binding|RNA cap binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.158)				ATATCTTGGCCGTGTTCCAGC	0.423	Ovarian(36;879 898 2893 44212 50307)															0.047619	-9.955263	8.330667	4	80	KEEP	---	---	---	---	4	1	60	36	-1	capture	Silent	SNP	100433448	100433448	NCBP1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10118	155
DMD	1756	broad.mit.edu	37	X	32429932	32429932	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32429932G>C	uc004dda.1	-	30	4414	c.4170C>G	c.(4168-4170)GAC>GAG	p.D1390E	DMD_uc004dcw.2_Missense_Mutation_p.D46E|DMD_uc004dcx.2_Missense_Mutation_p.D49E|DMD_uc004dcz.2_Missense_Mutation_p.D1267E|DMD_uc004dcy.1_Missense_Mutation_p.D1386E|DMD_uc004ddb.1_Missense_Mutation_p.D1382E|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1390					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCAACTGCTTGTCAATGAATG	0.473																0.792453	156.479459	160.678287	42	11	KEEP	---	---	---	---	30	14	7	4	-1	capture	Missense_Mutation	SNP	32429932	32429932	DMD	23	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	4538	155
USP11	8237	broad.mit.edu	37	X	47104414	47104414	+	Splice_Site	SNP	G	C	C			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47104414G>C	uc004dhp.2	+	16	2216	c.2216_splice	c.e16-1	p.A739_splice	USP11_uc004dhq.2_Splice_Site_p.A465_splice	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CTCACCCCCAGCCCAGCCGTA	0.567																0.25	6.318253	7.001071	3	9	KEEP	---	---	---	---	6	2	9	1	-1	capture	Splice_Site	SNP	47104414	47104414	USP11	23	G	C	C	C	1	0	0	0	0	0	0	1	0	442	34	5	4	16924	155
PCDH11X	27328	broad.mit.edu	37	X	91133526	91133526	+	Missense_Mutation	SNP	T	A	A			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91133526T>A	uc004efk.1	+	2	3132	c.2287T>A	c.(2287-2289)TTC>ATC	p.F763I	PCDH11X_uc004efl.1_Missense_Mutation_p.F763I|PCDH11X_uc004efo.1_Missense_Mutation_p.F763I|PCDH11X_uc010nmv.1_Missense_Mutation_p.F763I|PCDH11X_uc004efm.1_Missense_Mutation_p.F763I|PCDH11X_uc004efn.1_Missense_Mutation_p.F763I|PCDH11X_uc004efh.1_Missense_Mutation_p.F763I|PCDH11X_uc004efj.1_Missense_Mutation_p.F763I	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	763	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TGATTCTCTCTTCAGTGTTGT	0.433	NSCLC(38;925 1092 2571 38200 45895)															0.797297	195.663606	201.736125	59	15	KEEP	---	---	---	---	57	29	31	30	-1	capture	Missense_Mutation	SNP	91133526	91133526	PCDH11X	23	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	11411	155
GABRE	2564	broad.mit.edu	37	X	151124002	151124002	+	Silent	SNP	G	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151124002G>T	uc004ffi.2	-	8	1029	c.975C>A	c.(973-975)ACC>ACA	p.T325T	GABRE_uc011myd.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	325					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TACGAGAAAAGGTGCCCAACG	0.493																0.722222	81.959306	83.556401	26	10	KEEP	---	---	---	---	12	14	8	3	0.461538461538	capture	Silent	SNP	151124002	151124002	GABRE	23	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	6112	155
POLE	5426	broad.mit.edu	37	12	133220099	133220100	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133220099_133220100delCA	uc001uks.1	-	34	4381_4382	c.4337_4338delTG	c.(4336-4338)GTGfs	p.V1446fs	POLE_uc001ukq.1_5'Flank|POLE_uc001ukr.1_Frame_Shift_Del_p.V250fs|POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Frame_Shift_Del_p.V1419fs	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1446					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		GTTTATTGACCACACACACACA	0.604											DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					0.02			9	407		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	133220099	133220100	POLE	12	CA	-	-	-	1	0	1	0	1	0	0	0	0	262	21	5	5	12099	155
FOXG1	2290	broad.mit.edu	37	14	29236624	29236626	+	In_Frame_Del	DEL	CAC	-	-			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:29236624_29236626delCAC	uc001wqe.2	+	1	338_340	c.139_141delCAC	c.(139-141)CACdel	p.H57del		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	57	His-rich.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ccacccccagcaccaccaccacc	0.241																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	29236624	29236626	FOXG1	14	CAC	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	5951	155
TSHZ3	57616	broad.mit.edu	37	19	31769684	31769685	+	Frame_Shift_Ins	INS	-	T	T			TCGA-16-0846-01	TCGA-16-0846-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:31769684_31769685insT	uc002nsy.3	-	2	1079_1080	c.1014_1015insA	c.(1012-1017)GGTGGAfs	p.G338fs		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	338_339					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					TTGGGGGTTCCACCTGTGGAAT	0.564																0.11			31	256		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	31769684	31769685	TSHZ3	19	-	T	T	T	1	0	1	1	0	0	0	0	0	273	21	5	5	16508	155
