Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CLCN6	1185	broad.mit.edu	37	1	11897139	11897139	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11897139C>T	uc001ate.3	+	19	2177	c.2064C>T	c.(2062-2064)AAC>AAT	p.N688N	CLCN6_uc010oat.1_Silent_p.N404N|CLCN6_uc010oau.1_Silent_p.N666N	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	688	Cytoplasmic (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGCTACGGAACATGTGTGATG	0.632																0.1	3.238456	11.229991	5	45	KEEP	---	---	---	---	1	5	26	20	-1	capture	Silent	SNP	11897139	11897139	CLCN6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	3432	175
PADI3	51702	broad.mit.edu	37	1	17609431	17609431	+	Missense_Mutation	SNP	C	T	T	rs144763474	byFrequency	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17609431C>T	uc001bai.2	+	16	1892	c.1852C>T	c.(1852-1854)CGG>TGG	p.R618W		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	618					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGAGAAGGTGCGGTCCCTGCT	0.602																0.133333	10.379874	18.194024	8	52	KEEP	---	---	---	---	7	2	25	29	-1	capture	Missense_Mutation	SNP	17609431	17609431	PADI3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11283	175
CNR2	1269	broad.mit.edu	37	1	24202118	24202118	+	Translation_Start_Site	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24202118C>A	uc001bif.2	-	2	117	c.-10G>T	c.(-12--8)AAGGG>AATGG			NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)						behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	GGGGTGGGCCCTTCAGATTCC	0.458																0.054878	-16.86407	17.364753	9	155	KEEP	---	---	---	---	5	4	79	101	0.444444444444	capture	Translation_Start_Site	SNP	24202118	24202118	CNR2	1	C	A	A	A	1	0	0	0	0	0	0	0	0	300	24	4	4	3597	175
TMEM57	55219	broad.mit.edu	37	1	25784890	25784890	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:25784890G>A	uc001bkk.2	+	6	863	c.661G>A	c.(661-663)GGA>AGA	p.G221R	TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_RNA	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	221						axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		AGCAGCCAAAGGATTACCTGA	0.378																0.159236	106.959577	141.683976	50	264	KEEP	---	---	---	---	31	29	145	151	-1	capture	Missense_Mutation	SNP	25784890	25784890	TMEM57	1	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16067	175
SFRS11	9295	broad.mit.edu	37	1	70716405	70716405	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70716405G>T	uc001des.2	+	13	1496	c.1372G>T	c.(1372-1374)GAA>TAA	p.E458*	SFRS11_uc001det.2_Nonsense_Mutation_p.E457*|SFRS11_uc001dev.2_Nonsense_Mutation_p.E268*|SFRS11_uc001dew.2_Nonsense_Mutation_p.E398*	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11	458					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						ATGTTCTGTGGAAAAGGGAAC	0.398																0.157895	26.159075	36.765908	15	80	KEEP	---	---	---	---	4	12	38	47	0.25	capture	Nonsense_Mutation	SNP	70716405	70716405	SFRS11	1	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	14059	175
C1orf173	127254	broad.mit.edu	37	1	75037396	75037396	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75037396C>T	uc001dgg.2	-	14	4217	c.3998G>A	c.(3997-3999)GGA>GAA	p.G1333E		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1333	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CCTTCCTCCTCCCATGCCCTC	0.562																0.263158	66.732402	71.551368	25	70	KEEP	---	---	---	---	15	11	37	34	-1	capture	Missense_Mutation	SNP	75037396	75037396	C1orf173	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	1996	175
FNDC7	163479	broad.mit.edu	37	1	109270578	109270578	+	Silent	SNP	G	A	A	rs151239518	by1000genomes	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109270578G>A	uc001dvx.2	+	7	1260	c.1260G>A	c.(1258-1260)GCG>GCA	p.A420A	FNDC7_uc010ova.1_Silent_p.A187A	NM_001144937	NP_001138409	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	421	Fibronectin type-III 5.					extracellular region				ovary(1)|skin(1)	2		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		CTACTCCTGCGTGCACCCTTT	0.483																0.184	44.849351	56.596221	23	102	KEEP	---	---	---	---	10	16	46	59	-1	capture	Silent	SNP	109270578	109270578	FNDC7	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5917	175
FLG	2312	broad.mit.edu	37	1	152276186	152276186	+	Missense_Mutation	SNP	G	A	A	rs145171931	byFrequency	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152276186G>A	uc001ezu.1	-	3	11212	c.11176C>T	c.(11176-11178)CGG>TGG	p.R3726W		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3726	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCCAGCCCGTCCATGGGCA	0.607												Ichthyosis				0.176329	135.764634	176.624237	73	341	KEEP	---	---	---	---	35	42	161	204	-1	capture	Missense_Mutation	SNP	152276186	152276186	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5867	175
NUF2	83540	broad.mit.edu	37	1	163306614	163306614	+	Silent	SNP	G	A	A	rs148215962		TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:163306614G>A	uc001gcq.1	+	6	711	c.411G>A	c.(409-411)ACG>ACA	p.T137T	NUF2_uc001gcp.2_Silent_p.T137T|NUF2_uc001gcr.1_Silent_p.T137T|NUF2_uc009wvc.1_Silent_p.T137T	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	137	Interaction with the N-terminus of NDC80.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					GCCGTGAAACGTATATGGAAT	0.313																0.211765	41.500094	48.031326	18	67	KEEP	---	---	---	---	15	7	47	40	-1	capture	Silent	SNP	163306614	163306614	NUF2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10654	175
PAPPA2	60676	broad.mit.edu	37	1	176734853	176734853	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:176734853T>C	uc001gkz.2	+	15	5367	c.4203T>C	c.(4201-4203)CTT>CTC	p.L1401L	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1401	Sushi 1.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CATTGCTGCTTGATCATGCTG	0.507																0.037736	-25.491514	11.286292	6	153	KEEP	---	---	---	---	5	2	90	80	-1	capture	Silent	SNP	176734853	176734853	PAPPA2	1	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	11337	175
SLC45A3	85414	broad.mit.edu	37	1	205632180	205632180	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205632180G>A	uc001hda.1	-	3	1078	c.739C>T	c.(739-741)CGC>TGC	p.R247C	SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_Missense_Mutation_p.R81C|SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	247					transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			AAAGCCAAGCGGGCCCGGCAT	0.716					123	T	ETV1|ETV5|ELK4|ERG	prostate 								0.06383	-2.911628	6.390832	3	44	KEEP	---	---	---	---	1	2	17	31	-1	capture	Missense_Mutation	SNP	205632180	205632180	SLC45A3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14534	175
LEFTY2	7044	broad.mit.edu	37	1	226125177	226125177	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226125177C>T	uc001hpt.1	-	4	1145	c.1065G>A	c.(1063-1065)TCG>TCA	p.S355S	LEFTY2_uc010pvk.1_Silent_p.S321S|LEFTY2_uc009xek.1_3'UTR	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	355					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					GCGCCCCATCCGAGGCACAGC	0.602	Colon(172;116 2643 9098 43333)															0.179687	47.653877	60.002145	23	105	KEEP	---	---	---	---	12	12	51	62	-1	capture	Silent	SNP	226125177	226125177	LEFTY2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8636	175
OR2M2	391194	broad.mit.edu	37	1	248343988	248343988	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248343988G>A	uc010pzf.1	+	1	701	c.701G>A	c.(700-702)CGT>CAT	p.R234H		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAGAGGGTCGTTGCAAAGCT	0.468																0.152318	39.755642	57.204125	23	128	KEEP	---	---	---	---	19	18	92	90	-1	capture	Missense_Mutation	SNP	248343988	248343988	OR2M2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10914	175
OR2T27	403239	broad.mit.edu	37	1	248813409	248813409	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248813409G>A	uc010pzo.1	-	1	777	c.777C>T	c.(775-777)TAC>TAT	p.Y259Y		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	259	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGGCAGCACGTATGTGTACA	0.532																0.263158	13.365752	14.33	5	14	KEEP	---	---	---	---	3	3	12	11	-1	capture	Silent	SNP	248813409	248813409	OR2T27	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10925	175
HTR7	3363	broad.mit.edu	37	10	92508680	92508680	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:92508680C>T	uc001kha.2	-	2	1454	c.1211G>A	c.(1210-1212)CGG>CAG	p.R404Q	HTR7_uc001kgz.2_Missense_Mutation_p.R404Q|HTR7_uc001khb.2_Missense_Mutation_p.R404Q	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	404	Cytoplasmic (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GTTGATATTCCGGTACTGGCA	0.507																0.222749	120.52979	135.434569	47	164	KEEP	---	---	---	---	26	24	80	97	-1	capture	Missense_Mutation	SNP	92508680	92508680	HTR7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7377	175
OR4D10	390197	broad.mit.edu	37	11	59245250	59245250	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59245250G>A	uc001nnz.1	+	1	348	c.348G>A	c.(346-348)TCG>TCA	p.S116S		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TTTCTCTTTCGGTGATGGCAT	0.473																0.165049	35.438913	46.382835	17	86	KEEP	---	---	---	---	13	6	51	37	-1	capture	Silent	SNP	59245250	59245250	OR4D10	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10958	175
ST8SIA1	6489	broad.mit.edu	37	12	22354787	22354787	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22354787C>T	uc001rfo.3	-	5	1252	c.770G>A	c.(769-771)CGT>CAT	p.R257H	ST8SIA1_uc009zix.2_Missense_Mutation_p.R114H	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1	257	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						TCCAATGCTACGCAGAAAGTT	0.478																0.173554	41.809158	53.976081	21	100	KEEP	---	---	---	---	6	17	42	67	-1	capture	Missense_Mutation	SNP	22354787	22354787	ST8SIA1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15121	175
SRGAP1	57522	broad.mit.edu	37	12	64502748	64502748	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:64502748G>A	uc010ssp.1	+	16	1906	c.1850G>A	c.(1849-1851)CGC>CAC	p.R617H	SRGAP1_uc001srv.2_Missense_Mutation_p.R554H	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	617	Rho-GAP.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTTCACATCCGCAAACTCCTC	0.463																0.041379	-20.83608	11.828356	6	139	KEEP	---	---	---	---	4	3	75	91	-1	capture	Missense_Mutation	SNP	64502748	64502748	SRGAP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15037	175
GRIP1	23426	broad.mit.edu	37	12	66765507	66765507	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66765507C>T	uc001stk.2	-	22	3064	c.2823G>A	c.(2821-2823)GAG>GAA	p.E941E	GRIP1_uc010sta.1_Silent_p.E885E|GRIP1_uc001stj.2_Silent_p.E708E|GRIP1_uc001stl.1_Silent_p.E818E|GRIP1_uc001stm.2_Silent_p.E926E	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	993					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GAGACATGATCTCCTTTATTT	0.493																0.194118	80.484573	95.316685	33	137	KEEP	---	---	---	---	18	19	66	79	-1	capture	Silent	SNP	66765507	66765507	GRIP1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	6720	175
C12orf43	64897	broad.mit.edu	37	12	121444130	121444130	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121444130C>T	uc001tzh.1	-	4	378	c.355G>A	c.(355-357)GAT>AAT	p.D119N	C12orf43_uc009zxa.1_Missense_Mutation_p.D150N|C12orf43_uc010szo.1_Missense_Mutation_p.D77N|C12orf43_uc010szp.1_Missense_Mutation_p.D119N|C12orf43_uc001tzi.1_Missense_Mutation_p.D119N	NM_022895	NP_075046	Q96C57	CL043_HUMAN	hypothetical protein LOC64897	119											0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCACCATCATCCTCCAAAGCG	0.284																0.118644	9.179397	17.60969	7	52	KEEP	---	---	---	---	5	2	18	37	-1	capture	Missense_Mutation	SNP	121444130	121444130	C12orf43	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	1675	175
RNF17	56163	broad.mit.edu	37	13	25419167	25419167	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25419167T>A	uc001upr.2	+	22	3092	c.3051T>A	c.(3049-3051)AAT>AAA	p.N1017K	RNF17_uc010tdd.1_Missense_Mutation_p.N876K|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.N1017K|RNF17_uc001ups.2_Missense_Mutation_p.N956K|RNF17_uc010aac.2_Missense_Mutation_p.N215K|RNF17_uc010aad.2_Missense_Mutation_p.N69K	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1017	Tudor 2.				multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTGAAGAAAATCTAAAGACAA	0.308																0.215686	53.904329	61.50545	22	80	KEEP	---	---	---	---	13	12	52	39	-1	capture	Missense_Mutation	SNP	25419167	25419167	RNF17	13	T	A	A	A	1	0	0	0	0	1	0	0	0	647	50	4	4	13353	175
TEP1	7011	broad.mit.edu	37	14	20873722	20873722	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20873722C>G	uc001vxe.2	-	4	798	c.758G>C	c.(757-759)TGC>TCC	p.C253S	TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.C253S	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	253	TROVE.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAGAGTAGAGCACAGCAAGCT	0.468																0.186047	19.6556	23.657904	8	35	KEEP	---	---	---	---	2	6	23	17	-1	capture	Missense_Mutation	SNP	20873722	20873722	TEP1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	15644	175
TEP1	7011	broad.mit.edu	37	14	20873724	20873724	+	Silent	SNP	C	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20873724C>G	uc001vxe.2	-	4	796	c.756G>C	c.(754-756)CTG>CTC	p.L252L	TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Silent_p.L252L	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	252	TROVE.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GAGTAGAGCACAGCAAGCTCA	0.463																0.190476	18.454304	22.248333	8	34	KEEP	---	---	---	---	2	6	22	17	-1	capture	Silent	SNP	20873724	20873724	TEP1	14	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	15644	175
NOVA1	4857	broad.mit.edu	37	14	26941562	26941562	+	Silent	SNP	A	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:26941562A>C	uc001wpy.2	-	4	801	c.483T>G	c.(481-483)TCT>TCG	p.S161S	NOVA1_uc001wpz.2_Intron|NOVA1_uc001wqa.2_Silent_p.S39S|NOVA1_uc001wqb.2_Silent_p.S161S	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	164					locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		GATCAGATGGAGAGGACTTGG	0.428					340											0.153846	12.423573	16.892066	6	33	KEEP	---	---	---	---	3	5	21	18	-1	capture	Silent	SNP	26941562	26941562	NOVA1	14	A	C	C	C	1	0	0	0	0	0	0	0	1	132	11	4	4	10461	175
RTN1	6252	broad.mit.edu	37	14	60212931	60212931	+	Missense_Mutation	SNP	C	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60212931C>G	uc001xen.1	-	2	719	c.510G>C	c.(508-510)ATG>ATC	p.M170I		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	170					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CTGCAGGAGTCATCTCTATTC	0.512																0.079365	4.869924	27.606337	10	116	KEEP	---	---	---	---	5	5	57	66	-1	capture	Missense_Mutation	SNP	60212931	60212931	RTN1	14	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	13617	175
RTN1	6252	broad.mit.edu	37	14	60213169	60213169	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60213169T>C	uc001xen.1	-	2	481	c.272A>G	c.(271-273)CAC>CGC	p.H91R		NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	91					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TGAGAAGGTGTGGTCCATGGC	0.478																0.222222	29.289177	33.797302	14	49	KEEP	---	---	---	---	7	10	24	33	-1	capture	Missense_Mutation	SNP	60213169	60213169	RTN1	14	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	13617	175
SYNE2	23224	broad.mit.edu	37	14	64430685	64430685	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64430685T>C	uc001xgm.2	+	10	1187	c.957T>C	c.(955-957)GAT>GAC	p.D319D	SYNE2_uc001xgl.2_Silent_p.D319D	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	319	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCTAAAGGATTCAGAGAATG	0.308																0.170732	14.82208	19.010788	7	34	KEEP	---	---	---	---	2	5	16	24	-1	capture	Silent	SNP	64430685	64430685	SYNE2	14	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	15334	175
NEDD4	4734	broad.mit.edu	37	15	56132880	56132880	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56132880G>A	uc002adj.2	-	16	3441	c.3141C>T	c.(3139-3141)AAC>AAT	p.N1047N	NEDD4_uc002adl.2_Silent_p.N628N|NEDD4_uc002adi.2_Silent_p.N975N|NEDD4_uc010ugj.1_Silent_p.N1031N|NEDD4_uc010bfm.2_Silent_p.N1030N|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	1047	HECT.				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GGTGATCTTCGTTACACAATC	0.338																0.07971	-0.14359	24.696766	11	127	KEEP	---	---	---	---	6	9	64	77	-1	capture	Silent	SNP	56132880	56132880	NEDD4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10217	175
HS3ST6	64711	broad.mit.edu	37	16	1962204	1962204	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1962204C>A	uc002cnf.2	-	2	323	c.323G>T	c.(322-324)AGT>ATT	p.S108I		NM_001009606	NP_001009606	C9JH64	C9JH64_HUMAN	heparan sulfate (glucosamine)	108											0						GGGCATCAGACTCCTGCGGGA	0.706																0.384615	14.172331	14.323886	5	8	KEEP	---	---	---	---	3	3	3	7	0.5	capture	Missense_Mutation	SNP	1962204	1962204	HS3ST6	16	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	7294	175
PHF12	57649	broad.mit.edu	37	17	27240276	27240276	+	Missense_Mutation	SNP	G	A	A	rs141809044		TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27240276G>A	uc002hdg.1	-	9	1843	c.1313C>T	c.(1312-1314)GCG>GTG	p.A438V	PHF12_uc010wbb.1_Missense_Mutation_p.A420V|PHF12_uc002hdi.1_Missense_Mutation_p.A434V|PHF12_uc002hdj.1_Missense_Mutation_p.A438V|PHF12_uc010crw.1_Missense_Mutation_p.A141V|PHF12_uc002hdh.1_Missense_Mutation_p.A221V	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	438	Interaction with SIN3A.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			GCACTGGAGCGCAACAACACT	0.532																0.027972	-28.544079	6.499864	4	139	KEEP	---	---	---	---	1	3	61	89	-1	capture	Missense_Mutation	SNP	27240276	27240276	PHF12	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11726	175
ACACA	31	broad.mit.edu	37	17	35633950	35633950	+	Silent	SNP	A	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35633950A>G	uc002hnm.2	-	7	858	c.667T>C	c.(667-669)TTG>CTG	p.L223L	ACACA_uc002hnk.2_Silent_p.L145L|ACACA_uc002hnl.2_Silent_p.L165L|ACACA_uc002hnn.2_Silent_p.L223L|ACACA_uc002hno.2_Silent_p.L260L|ACACA_uc010cuz.2_Silent_p.L223L|ACACA_uc002hnq.2_Silent_p.L145L	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	223	Biotin carboxylation.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CCATTTTTCAAGAGAAGTTCC	0.403	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)				742											0.181818	53.973587	65.484236	22	99	KEEP	---	---	---	---	9	16	57	64	-1	capture	Silent	SNP	35633950	35633950	ACACA	17	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	106	175
KRTAP4-7	100132476	broad.mit.edu	37	17	39240673	39240673	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240673C>T	uc010wfn.1	+	1	215	c.215C>T	c.(214-216)ACG>ATG	p.T72M		NM_033061	NP_149050			keratin associated protein 4-7												0						TGCTGTGAGACGACctgctgc	0.338																0.131148	10.371859	18.42965	8	53	KEEP	---	---	---	---	5	3	31	29	-1	capture	Missense_Mutation	SNP	39240673	39240673	KRTAP4-7	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8475	175
KRTAP4-9	100132386	broad.mit.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	T	T	rs113059833	by1000genomes	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39261693A>T	uc010wfp.1	+	1	53	c.53A>T	c.(52-54)GAC>GTC	p.D18V		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18						keratin filament					0						TGCGGCCAAGACCTCTGTCAG	0.627																0.081081	-0.002366	6.612104	3	34	KEEP	---	---	---	---	2	1	22	13	-1	capture	Missense_Mutation	SNP	39261693	39261693	KRTAP4-9	17	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	8477	175
COL1A1	1277	broad.mit.edu	37	17	48263379	48263379	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48263379G>A	uc002iqm.2	-	50	4134	c.4008C>T	c.(4006-4008)TTC>TTT	p.F1336F		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1336	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	CGCCATACTCGAACTGCAGGG	0.637					504	T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						0.166667	19.911235	26.232749	10	50	KEEP	---	---	---	---	3	8	30	32	-1	capture	Silent	SNP	48263379	48263379	COL1A1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	3642	175
ABCC3	8714	broad.mit.edu	37	17	48757178	48757178	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48757178G>A	uc002isl.2	+	26	3805	c.3725G>A	c.(3724-3726)TGG>TAG	p.W1242*	ABCC3_uc002isn.2_5'UTR	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	1242	ABC transmembrane type-1 2.|Helical; Name=17; (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	GCTCTGAACTGGATGATACGA	0.517					438											0.170732	28.795302	37.205972	14	68	KEEP	---	---	---	---	10	7	33	44	-1	capture	Nonsense_Mutation	SNP	48757178	48757178	ABCC3	17	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	54	175
SOX9	6662	broad.mit.edu	37	17	70120351	70120351	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:70120351C>T	uc002jiw.2	+	3	1725	c.1353C>T	c.(1351-1353)TAC>TAT	p.Y451Y		NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	451					cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CCAGCTCCTACTACAGCCACG	0.637	Pancreas(42;83 1041 2320 35205 39456)															0.211765	84.003162	97.066462	36	134	KEEP	---	---	---	---	17	23	55	104	-1	capture	Silent	SNP	70120351	70120351	SOX9	17	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	14850	175
SEPT9	10801	broad.mit.edu	37	17	75398771	75398771	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:75398771C>T	uc002jts.3	+	3	833	c.707C>T	c.(706-708)CCC>CTC	p.P236L	SEPT9_uc010wtk.1_Missense_Mutation_p.P217L|SEPT9_uc002jtt.3_Missense_Mutation_p.P72L|SEPT9_uc002jtu.3_Missense_Mutation_p.P218L|SEPT9_uc002jtv.2_Missense_Mutation_p.P229L|SEPT9_uc002jtw.2_Missense_Mutation_p.P72L|SEPT9_uc002jtx.1_Missense_Mutation_p.P72L|SEPT9_uc010wtl.1_5'Flank	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a	236					cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			GAGGCTACACCCCGGAGCCAG	0.627					329											0.230769	22.053372	24.645124	9	30	KEEP	---	---	---	---	4	7	15	25	-1	capture	Missense_Mutation	SNP	75398771	75398771	SEPT9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13964	175
GAA	2548	broad.mit.edu	37	17	78083809	78083809	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78083809G>A	uc002jxo.2	+	10	1574	c.1392G>A	c.(1390-1392)AGG>AGA	p.R464R	GAA_uc002jxp.2_Silent_p.R464R|GAA_uc002jxq.2_Silent_p.R464R	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	464					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GTCTGCGGAGGGGGGTTTTCA	0.657																0.119658	17.2645	33.878604	14	103	KEEP	---	---	---	---	8	9	59	62	-1	capture	Silent	SNP	78083809	78083809	GAA	17	G	A	A	A	1	0	0	0	0	0	0	0	1	555	43	2	2	6089	175
SMCHD1	23347	broad.mit.edu	37	18	2700844	2700844	+	Missense_Mutation	SNP	A	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2700844A>C	uc002klm.3	+	12	1764	c.1575A>C	c.(1573-1575)AAA>AAC	p.K525N	SMCHD1_uc002klk.3_RNA	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	525					chromosome organization		ATP binding				0						GCACAAATAAATTGACGTTTA	0.338																0.135593	32.243862	47.401973	16	102	KEEP	---	---	---	---	11	8	57	59	-1	capture	Missense_Mutation	SNP	2700844	2700844	SMCHD1	18	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	14680	175
CIDEA	1149	broad.mit.edu	37	18	12274238	12274238	+	Silent	SNP	C	T	T	rs143526030	byFrequency	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12274238C>T	uc002kqt.3	+	4	542	c.477C>T	c.(475-477)TAC>TAT	p.Y159Y	CIDEA_uc002kqu.3_Silent_p.Y193Y|CIDEA_uc010dlc.2_RNA	NM_001279	NP_001270	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a isoform	159					DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|lipid metabolic process|lipid storage|negative regulation of apoptosis|negative regulation of cytokine secretion|negative regulation of lipid catabolic process|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of sequestering of triglyceride|temperature homeostasis	mitochondrial envelope|nucleus	protein homodimerization activity			ovary(1)|central_nervous_system(1)	2						CCGTGTCCTACGACATCCGGT	0.587																0.16	37.130181	50.881801	20	105	KEEP	---	---	---	---	8	13	45	69	-1	capture	Silent	SNP	12274238	12274238	CIDEA	18	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3390	175
TICAM1	148022	broad.mit.edu	37	19	4817811	4817811	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4817811G>A	uc002mbi.2	-	2	830	c.579C>T	c.(577-579)TCC>TCT	p.S193S		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	193					apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGGATCGCAGGGAGCACCCTT	0.652																0.125	17.653171	33.09087	14	98	KEEP	---	---	---	---	7	8	53	57	-1	capture	Silent	SNP	4817811	4817811	TICAM1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	15777	175
MUC16	94025	broad.mit.edu	37	19	9058146	9058146	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9058146T>C	uc002mkp.2	-	3	29504	c.29300A>G	c.(29299-29301)AAG>AGG	p.K9767R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9769	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCTGTAGTCTTCACCAGGCC	0.493																0.133333	14.777117	22.590332	8	52	KEEP	---	---	---	---	5	4	26	26	-1	capture	Missense_Mutation	SNP	9058146	9058146	MUC16	19	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	9883	175
MUC16	94025	broad.mit.edu	37	19	9084687	9084687	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9084687G>A	uc002mkp.2	-	1	7332	c.7128C>T	c.(7126-7128)ACC>ACT	p.T2376T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2376	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAGCTATGGAGGTGTTGATCA	0.438																0.074627	-0.480785	11.965466	5	62	KEEP	---	---	---	---	1	4	41	34	-1	capture	Silent	SNP	9084687	9084687	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	9883	175
IL28B	282617	broad.mit.edu	37	19	39734655	39734655	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39734655C>T	uc010xut.1	-	3	405	c.401G>A	c.(400-402)CGG>CAG	p.R134Q	IL28B_uc010xuu.1_Missense_Mutation_p.R134Q	NM_172139	NP_742151	Q8IZI9	IL28B_HUMAN	interleukin 28B	134					response to virus	extracellular space	cytokine activity				0	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CACACAGGCCCGGAGCTGGGA	0.667																0.085106	2.176545	18.545318	8	86	KEEP	---	---	---	---	4	5	49	46	-1	capture	Missense_Mutation	SNP	39734655	39734655	IL28B	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7606	175
KLC3	147700	broad.mit.edu	37	19	45853908	45853908	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45853908C>T	uc002pbf.1	+	11	1397	c.1282C>T	c.(1282-1284)CGC>TGC	p.R428C	KLC3_uc010ejy.1_Missense_Mutation_p.R427C|KLC3_uc002pbg.1_Missense_Mutation_p.R442C	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3	428						cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGCCCTTCGCCGCAGCAGCTC	0.692					4											0.2	16.870471	20.232069	8	32	KEEP	---	---	---	---	3	5	11	21	-1	capture	Missense_Mutation	SNP	45853908	45853908	KLC3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8256	175
TMEM143	55260	broad.mit.edu	37	19	48845929	48845929	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48845929C>T	uc002pix.1	-	6	842	c.833G>A	c.(832-834)CGC>CAC	p.R278H	TMEM143_uc002piw.1_Intron|TMEM143_uc002piy.1_Missense_Mutation_p.R243H|TMEM143_uc010xzn.1_Missense_Mutation_p.R213H|TMEM143_uc010elw.1_Missense_Mutation_p.R178H|TMEM143_uc010xzo.1_Missense_Mutation_p.R68H	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143	278						integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		GAGCAGGGCGCGCTGCAGGGT	0.637																0.177215	26.604272	34.357299	14	65	KEEP	---	---	---	---	5	9	31	46	-1	capture	Missense_Mutation	SNP	48845929	48845929	TMEM143	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15941	175
TMEM150B	284417	broad.mit.edu	37	19	55828201	55828201	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55828201G>A	uc010esw.1	-	7	631	c.458C>T	c.(457-459)CCC>CTC	p.P153L	TMEM150B_uc010yfu.1_Missense_Mutation_p.P153L|TMEM150B_uc010yfv.1_RNA|TMEM150B_uc010yfw.1_RNA	NM_001085488	NP_001078957	A6NC51	T150B_HUMAN	transmembrane protein 150B precursor	153	Cytoplasmic (Potential).					integral to membrane					0						CAGGCGGAGGGGCCCAATCCA	0.617																0.235294	9.790392	10.880699	4	13	KEEP	---	---	---	---	1	4	8	6	-1	capture	Missense_Mutation	SNP	55828201	55828201	TMEM150B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15952	175
DCTN1	1639	broad.mit.edu	37	2	74598790	74598790	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74598790C>T	uc002skx.2	-	8	830	c.519G>A	c.(517-519)GCG>GCA	p.A173A	DCTN1_uc002skv.2_Silent_p.A39A|DCTN1_uc002sku.2_Silent_p.A39A|DCTN1_uc002skw.1_Silent_p.A149A|DCTN1_uc010ffd.2_Silent_p.A153A|DCTN1_uc002sky.2_Silent_p.A136A	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	173	Ser-rich.				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						CACCTGCTGACGCTGAGCCAG	0.652																0.142857	5.111187	7.691968	3	18	KEEP	---	---	---	---	1	2	8	13	-1	capture	Silent	SNP	74598790	74598790	DCTN1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4265	175
IL1RL2	8808	broad.mit.edu	37	2	102849423	102849423	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102849423A>T	uc002tbs.2	+	10	1262	c.1136A>T	c.(1135-1137)GAT>GTT	p.D379V	IL1RL2_uc002tbt.2_Missense_Mutation_p.D261V	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	379	Cytoplasmic (Potential).				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						TCCTTTTCAGATGGGAAGCTG	0.507																0.033898	-19.904201	8.02856	4	114	KEEP	---	---	---	---	0	5	48	82	-1	capture	Missense_Mutation	SNP	102849423	102849423	IL1RL2	2	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	7587	175
TTN	7273	broad.mit.edu	37	2	179446667	179446667	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179446667G>A	uc010zfg.1	-	264	58949	c.58725C>T	c.(58723-58725)GAC>GAT	p.D19575D	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.D13270D|TTN_uc010zfi.1_Silent_p.D13203D|TTN_uc010zfj.1_Silent_p.D13078D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20502							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTGGATGCGTCACTGGGTT	0.438					8722											0.178571	30.083596	38.245121	15	69	KEEP	---	---	---	---	5	11	38	37	-1	capture	Silent	SNP	179446667	179446667	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16617	175
TTN	7273	broad.mit.edu	37	2	179666963	179666963	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179666963G>A	uc002und.2	-	3	422	c.197C>T	c.(196-198)ACG>ATG	p.T66M	TTN_uc010zfg.1_Missense_Mutation_p.T66M|TTN_uc010zfh.1_Missense_Mutation_p.T66M|TTN_uc010zfi.1_Missense_Mutation_p.T66M|TTN_uc010zfj.1_Missense_Mutation_p.T66M|TTN_uc002unb.2_Missense_Mutation_p.T66M			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	66							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCGGGGATCGTCAGTTTAGC	0.547					8722											0.214286	44.939874	52.316023	21	77	KEEP	---	---	---	---	5	17	36	49	-1	capture	Missense_Mutation	SNP	179666963	179666963	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16617	175
SIRPD	128646	broad.mit.edu	37	20	1517818	1517818	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1517818C>T	uc002wfi.2	-	3	604	c.560G>A	c.(559-561)CGG>CAG	p.R187Q		NM_178460	NP_848555	Q9H106	SIRPD_HUMAN	signal-regulatory protein delta precursor	187						extracellular region				ovary(1)|kidney(1)|skin(1)	3						TCCCAGCAGCCGGAGGCAGCA	0.612																0.22	54.393302	61.616107	22	78	KEEP	---	---	---	---	16	7	28	61	-1	capture	Missense_Mutation	SNP	1517818	1517818	SIRPD	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14228	175
C20orf132	140699	broad.mit.edu	37	20	35776290	35776290	+	Missense_Mutation	SNP	A	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35776290A>C	uc010zvu.1	-	12	1218	c.1127T>G	c.(1126-1128)CTT>CGT	p.L376R	C20orf132_uc002xgk.2_Missense_Mutation_p.L49R|C20orf132_uc002xgm.2_Missense_Mutation_p.L376R|C20orf132_uc002xgn.2_Missense_Mutation_p.L341R	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	251											0		Myeloproliferative disorder(115;0.00878)				TAGGTGTCCAAGTCTTTGGAA	0.478																0.189189	13.999981	17.348009	7	30	KEEP	---	---	---	---	5	4	15	15	-1	capture	Missense_Mutation	SNP	35776290	35776290	C20orf132	20	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	2068	175
PLXNB2	23654	broad.mit.edu	37	22	50717405	50717405	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50717405G>A	uc003bkv.3	-	28	4531	c.4425C>T	c.(4423-4425)GAC>GAT	p.D1475D	PLXNB2_uc003bkt.1_Silent_p.D267D|PLXNB2_uc003bku.1_Silent_p.D460D	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1475	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCGGGATGGCGTCCACTCCCT	0.622																0.155172	15.346219	21.927842	9	49	KEEP	---	---	---	---	3	7	26	26	-1	capture	Silent	SNP	50717405	50717405	PLXNB2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12027	175
DCLK3	85443	broad.mit.edu	37	3	36779980	36779980	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:36779980G>A	uc003cgi.2	-	2	662	c.171C>T	c.(169-171)ACC>ACT	p.T57T		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	57						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						TGGGGGTCTCGGTCTCCCCAC	0.617					128											0.224806	74.37554	83.303304	29	100	KEEP	---	---	---	---	19	11	44	62	-1	capture	Silent	SNP	36779980	36779980	DCLK3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4252	175
GOLGA4	2803	broad.mit.edu	37	3	37360647	37360647	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37360647C>T	uc003cgv.2	+	12	1811	c.1507C>T	c.(1507-1509)CGA>TGA	p.R503*	GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Nonsense_Mutation_p.R525*|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Nonsense_Mutation_p.R384*	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	503	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						GCTTCAGACCCGAGAAAGGGA	0.378																0.149533	28.433589	41.035567	16	91	KEEP	---	---	---	---	6	11	42	54	-1	capture	Nonsense_Mutation	SNP	37360647	37360647	GOLGA4	3	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	6491	175
VIPR1	7433	broad.mit.edu	37	3	42567437	42567437	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42567437G>A	uc003clf.2	+	4	475	c.351G>A	c.(349-351)CCG>CCA	p.P117P	VIPR1_uc011azl.1_Silent_p.P70P|VIPR1_uc011azm.1_5'UTR|VIPR1_uc011azn.1_Silent_p.P90P	NM_004624	NP_004615	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	117	Extracellular (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)		AGCCTGGCCCGTACCCCATTG	0.662																0.12	3.710097	7.249245	3	22	KEEP	---	---	---	---	2	2	16	14	-1	capture	Silent	SNP	42567437	42567437	VIPR1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17051	175
GRM2	2912	broad.mit.edu	37	3	51746533	51746533	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51746533C>T	uc010hlv.2	+	3	734	c.495C>T	c.(493-495)TAC>TAT	p.Y165Y	GRM2_uc003dbo.3_Intron|GRM2_uc010hlu.2_RNA	NM_000839	NP_000830	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2 isoform a	165	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)	AGATTAGCTACGCCTCTACCA	0.532																0.217742	61.577906	70.671449	27	97	KEEP	---	---	---	---	14	13	35	65	-1	capture	Silent	SNP	51746533	51746533	GRM2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6730	175
TRAT1	50852	broad.mit.edu	37	3	108572525	108572525	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108572525G>A	uc003dxi.1	+	6	506	c.362G>A	c.(361-363)CGT>CAT	p.R121H	TRAT1_uc010hpx.1_Missense_Mutation_p.R84H	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	121	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						AAGGGGAAGCGTAGAAAGCCC	0.423																0.152381	27.629977	39.775732	16	89	KEEP	---	---	---	---	6	10	41	51	-1	capture	Missense_Mutation	SNP	108572525	108572525	TRAT1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16349	175
GPR156	165829	broad.mit.edu	37	3	119962857	119962857	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119962857G>A	uc011bjf.1	-	1	89	c.89C>T	c.(88-90)ACA>ATA	p.T30I	GPR156_uc011bjg.1_Missense_Mutation_p.T30I	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	30	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)		TACAATTGTTGTCTTGCAGAG	0.433																0.136364	11.7463	20.185669	9	57	KEEP	---	---	---	---	4	5	23	38	-1	capture	Missense_Mutation	SNP	119962857	119962857	GPR156	3	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	6595	175
DBR1	51163	broad.mit.edu	37	3	137890532	137890532	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137890532G>A	uc003erv.2	-	3	482	c.346C>T	c.(346-348)CGA>TGA	p.R116*	DBR1_uc003eru.2_Nonsense_Mutation_p.R65*	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	116						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						CTTACACCTCGGTATTTTACC	0.343																0.032258	-15.458484	6.778222	3	90	KEEP	---	---	---	---	2	1	41	72	-1	capture	Nonsense_Mutation	SNP	137890532	137890532	DBR1	3	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	4216	175
CLSTN2	64084	broad.mit.edu	37	3	140185512	140185512	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140185512G>A	uc003etn.2	+	8	1473	c.1283G>A	c.(1282-1284)CGG>CAG	p.R428Q	CLSTN2_uc003etm.2_Missense_Mutation_p.R428Q	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	428	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TTTCTCTTGCGGAAGGACTTC	0.542	GBM(45;858 913 3709 36904 37282)												HNSCC(16;0.037)			0.277778	41.901803	44.301035	15	39	KEEP	---	---	---	---	11	5	31	15	-1	capture	Missense_Mutation	SNP	140185512	140185512	CLSTN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3527	175
ZBBX	79740	broad.mit.edu	37	3	167083682	167083682	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:167083682C>A	uc003fep.2	-	6	588	c.265G>T	c.(265-267)GTT>TTT	p.V89F	ZBBX_uc011bpc.1_Missense_Mutation_p.V89F|ZBBX_uc003feq.2_Missense_Mutation_p.V60F	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	89						intracellular	zinc ion binding			ovary(2)	2						ACCTTAACAACATTTCCTTTA	0.294																0.166667	20.460231	26.132802	9	45	KEEP	---	---	---	---	6	4	21	32	0.4	capture	Missense_Mutation	SNP	167083682	167083682	ZBBX	3	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	17397	175
FRYL	285527	broad.mit.edu	37	4	48559529	48559529	+	Missense_Mutation	SNP	A	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48559529A>C	uc003gyh.1	-	34	4671	c.4066T>G	c.(4066-4068)TGG>GGG	p.W1356G	FRYL_uc003gyk.2_Missense_Mutation_p.W1356G|FRYL_uc003gyg.1_Missense_Mutation_p.W52G|FRYL_uc003gyi.1_Missense_Mutation_p.W245G	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1356					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GGAGATCCCCATCCTTCTCCC	0.423																0.057851	-17.98641	7.252499	7	114	KEEP	---	---	---	---	6	10	60	72	-1	capture	Missense_Mutation	SNP	48559529	48559529	FRYL	4	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	6007	175
CWH43	80157	broad.mit.edu	37	4	49040170	49040170	+	Silent	SNP	A	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:49040170A>C	uc003gyv.2	+	13	1958	c.1776A>C	c.(1774-1776)CTA>CTC	p.L592L	CWH43_uc011bzl.1_Silent_p.L565L	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	592					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						GAGATTATCTACAGCTCACTG	0.323																0.165323	103.429396	129.776356	41	207	KEEP	---	---	---	---	24	23	110	125	-1	capture	Silent	SNP	49040170	49040170	CWH43	4	A	C	C	C	1	0	0	0	0	0	0	0	1	171	14	4	4	4033	175
CSN2	1447	broad.mit.edu	37	4	70823249	70823249	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70823249G>T	uc003hes.3	-	5	431	c.418C>A	c.(418-420)CAT>AAT	p.H140N	CSN2_uc003het.3_Missense_Mutation_p.H139N	NM_001891	NP_001882	P05814	CASB_HUMAN	casein beta precursor	140				H -> Q (in Ref. 3; CAA34916).	calcium ion transport	extracellular region	calcium ion binding|enzyme inhibitor activity|transporter activity				0						AGAGGAAGATGCAGATTTTCA	0.507																0.149425	22.453393	32.6798	13	74	KEEP	---	---	---	---	5	9	34	58	0.357142857143	capture	Missense_Mutation	SNP	70823249	70823249	CSN2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	3913	175
WDFY3	23001	broad.mit.edu	37	4	85719250	85719250	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:85719250C>T	uc003hpd.2	-	18	3242	c.2834G>A	c.(2833-2835)CGT>CAT	p.R945H		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	945						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ACTTGCCAAACGTAAAAACTC	0.313																0.234043	52.097955	58.190117	22	72	KEEP	---	---	---	---	7	15	35	43	-1	capture	Missense_Mutation	SNP	85719250	85719250	WDFY3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17151	175
ADAM29	11086	broad.mit.edu	37	4	175898963	175898963	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175898963G>C	uc003iuc.2	+	5	2957	c.2287G>C	c.(2287-2289)GTG>CTG	p.V763L	ADAM29_uc003iud.2_Missense_Mutation_p.V763L|ADAM29_uc010irr.2_Missense_Mutation_p.V763L|ADAM29_uc011cki.1_Missense_Mutation_p.V763L	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	763	Cytoplasmic (Potential).|9 X 9 AA approximate repeats.|3.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCAACCTCCTGTGACACCCTC	0.567	Ovarian(140;1727 1835 21805 25838 41440)				106											0.152866	57.305832	75.39711	24	133	KEEP	---	---	---	---	10	18	64	92	-1	capture	Missense_Mutation	SNP	175898963	175898963	ADAM29	4	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	247	175
PIK3R1	5295	broad.mit.edu	37	5	67591246	67591246	+	Splice_Site	SNP	A	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591246A>G	uc003jva.2	+	14	2306	c.1746_splice	c.e14-2	p.M582_splice	PIK3R1_uc003jvb.2_Splice_Site_p.M582_splice|PIK3R1_uc003jvc.2_Splice_Site_p.M282_splice|PIK3R1_uc003jvd.2_Splice_Site_p.M312_splice|PIK3R1_uc003jve.2_Splice_Site_p.M261_splice|PIK3R1_uc011crb.1_Splice_Site_p.M252_splice	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(2)|p.Y580fs*1(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	ACTGTTTTTCAGGTGGTTGAC	0.363				(ONCODG1-Tumor)|(NIHOVCAR3-Tumor)|(OV56-Tumor)|(PF382-Tumor)	370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.179775	35.144691	43.729786	16	73	KEEP	---	---	---	---	8	8	40	34	-1	capture	Splice_Site	SNP	67591246	67591246	PIK3R1	5	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	11821	175
SLCO6A1	133482	broad.mit.edu	37	5	101709074	101709074	+	Silent	SNP	T	C	C	rs146381310	byFrequency	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101709074T>C	uc003knn.2	-	13	2314	c.2142A>G	c.(2140-2142)AAA>AAG	p.K714K	SLCO6A1_uc003kno.2_Silent_p.K461K|SLCO6A1_uc003knp.2_Silent_p.K714K|SLCO6A1_uc003knq.2_Silent_p.K652K	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	714	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CAGTTTCTTCTTTTTTCTTAA	0.269																0.147826	36.172113	49.920925	17	98	KEEP	---	---	---	---	8	12	51	66	-1	capture	Silent	SNP	101709074	101709074	SLCO6A1	5	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	14624	175
PCDHA11	56138	broad.mit.edu	37	5	140249928	140249928	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140249928C>A	uc003lia.2	+	1	2098	c.1240C>A	c.(1240-1242)CGC>AGC	p.R414S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.R414S	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	414	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCCTGGACCGCGAGAACGT	0.627																0.065574	-13.157907	34.617764	16	228	KEEP	---	---	---	---	12	7	105	147	0.368421052632	capture	Missense_Mutation	SNP	140249928	140249928	PCDHA11	5	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	11424	175
PCDHA11	56138	broad.mit.edu	37	5	140250294	140250294	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140250294G>A	uc003lia.2	+	1	2464	c.1606G>A	c.(1606-1608)GCG>ACG	p.A536T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.A536T	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	536	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGGTGAGCGCGCGCGATGC	0.672																0.081481	-4.146851	43.952632	22	248	KEEP	---	---	---	---	10	14	133	137	-1	capture	Missense_Mutation	SNP	140250294	140250294	PCDHA11	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11424	175
PCDHB7	56129	broad.mit.edu	37	5	140553185	140553185	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140553185G>A	uc003lit.2	+	1	943	c.769G>A	c.(769-771)GTT>ATT	p.V257I		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	257	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATAGCCCCGTTGGTTCCAT	0.502																0.160377	29.433891	41.054705	17	89	KEEP	---	---	---	---	8	10	37	62	-1	capture	Missense_Mutation	SNP	140553185	140553185	PCDHB7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11450	175
PCDHB14	56122	broad.mit.edu	37	5	140605446	140605446	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140605446G>A	uc003ljb.2	+	1	2369	c.2369G>A	c.(2368-2370)CGA>CAA	p.R790Q	PCDHB14_uc011dal.1_Missense_Mutation_p.R637Q	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	790	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAACTTTCGAAATAGCTTT	0.348	Ovarian(141;50 1831 27899 33809 37648)															0.157895	30.289037	40.869605	15	80	KEEP	---	---	---	---	5	10	38	49	-1	capture	Missense_Mutation	SNP	140605446	140605446	PCDHB14	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11442	175
BTBD9	114781	broad.mit.edu	37	6	38256068	38256068	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38256068C>T	uc003ooa.3	-	9	2010	c.1434G>A	c.(1432-1434)CCG>CCA	p.P478P	BTBD9_uc003ony.3_Silent_p.P410P|BTBD9_uc010jwv.2_Silent_p.P439P|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Silent_p.P478P	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a	478					cell adhesion						0						CAATCATGTACGGTTGTGCCA	0.398																0.185567	38.396247	47.383266	18	79	KEEP	---	---	---	---	10	12	38	58	-1	capture	Silent	SNP	38256068	38256068	BTBD9	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1536	175
PKHD1	5314	broad.mit.edu	37	6	51524416	51524416	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51524416A>G	uc003pah.1	-	61	10784	c.10508T>C	c.(10507-10509)CTC>CCC	p.L3503P		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3503	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GGGGCTCTGGAGCTCATGGTA	0.438					1537											0.141414	28.756161	40.972955	14	85	KEEP	---	---	---	---	3	11	41	48	-1	capture	Missense_Mutation	SNP	51524416	51524416	PKHD1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11874	175
DOPEY1	23033	broad.mit.edu	37	6	83847935	83847935	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:83847935T>C	uc003pjs.1	+	21	4434	c.4174T>C	c.(4174-4176)TTG>CTG	p.L1392L	DOPEY1_uc011dyy.1_Silent_p.L1383L|DOPEY1_uc010kbl.1_Silent_p.L1383L|DOPEY1_uc003pjt.2_RNA	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	1392					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAAAGCCATCTTGAAAACTAA	0.383																0.017391	-52.10655	8.354068	4	226	KEEP	---	---	---	---	5	0	111	126	-1	capture	Silent	SNP	83847935	83847935	DOPEY1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	4663	175
IKZF1	10320	broad.mit.edu	37	7	50468241	50468241	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50468241C>A	uc003tow.3	+	9	1644	c.1476C>A	c.(1474-1476)TGC>TGA	p.C492*	IKZF1_uc003tox.3_Nonsense_Mutation_p.C450*|IKZF1_uc003toy.3_Nonsense_Mutation_p.C450*|IKZF1_uc011kck.1_Nonsense_Mutation_p.C405*|IKZF1_uc003toz.3_Nonsense_Mutation_p.C462*|IKZF1_uc010kyx.2_Nonsense_Mutation_p.C232*|IKZF1_uc003tpa.3_Nonsense_Mutation_p.C234*	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	492	C2H2-type 6.				cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CTTTTGAGTGCAACATGTGCG	0.592					226	D		ALL								0.107143	5.526046	14.087216	6	50	KEEP	---	---	---	---	3	3	23	34	0.5	capture	Nonsense_Mutation	SNP	50468241	50468241	IKZF1	7	C	A	A	A	1	0	0	0	0	0	1	0	0	324	25	5	4	7537	175
BAIAP2L1	55971	broad.mit.edu	37	7	97944874	97944874	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97944874T>C	uc003upj.2	-	7	800	c.537A>G	c.(535-537)GCA>GCG	p.A179A		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	179	IMD.				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TGCAACCATCTGCAATGAATT	0.358																0.030303	-37.498679	10.403687	6	192	KEEP	---	---	---	---	2	4	95	123	-1	capture	Silent	SNP	97944874	97944874	BAIAP2L1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	1291	175
CLDN15	24146	broad.mit.edu	37	7	100877603	100877603	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100877603T>C	uc003uyg.1	-	2	592	c.338A>G	c.(337-339)AAA>AGA	p.K113R	CLDN15_uc003uyh.1_Missense_Mutation_p.K113R|CLDN15_uc003uyi.2_3'UTR	NM_014343	NP_055158	P56746	CLD15_HUMAN	claudin 15	113	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)					CAGCTTGGCTTTCCTGGAGAG	0.662																0.126506	35.334281	57.993605	21	145	KEEP	---	---	---	---	10	15	73	94	-1	capture	Missense_Mutation	SNP	100877603	100877603	CLDN15	7	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	3441	175
GRM8	2918	broad.mit.edu	37	7	126409978	126409978	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126409978C>T	uc003vlr.2	-	6	1609	c.1298G>A	c.(1297-1299)CGA>CAA	p.R433Q	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.R433Q|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.R154Q	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	433	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GGTACTCATTCGTGGACAAAG	0.403													HNSCC(24;0.065)			0.164773	56.063152	74.83899	29	147	KEEP	---	---	---	---	17	15	90	80	-1	capture	Missense_Mutation	SNP	126409978	126409978	GRM8	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6736	175
STC1	6781	broad.mit.edu	37	8	23702306	23702306	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:23702306G>A	uc003xdw.1	-	4	1005	c.721C>T	c.(721-723)CGC>TGC	p.R241C		NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor	241					cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TGGGATGTGCGTTTGATGTGG	0.507																0.147541	14.945998	22.214416	9	52	KEEP	---	---	---	---	3	6	29	29	-1	capture	Missense_Mutation	SNP	23702306	23702306	STC1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15165	175
EBF2	64641	broad.mit.edu	37	8	25718727	25718727	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25718727G>A	uc003xes.1	-	13	1197	c.1180C>T	c.(1180-1182)CGA>TGA	p.R394*	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	394					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TCTGCGGCTCGCTTCAAAATG	0.488	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)															0.186275	36.424633	45.79219	19	83	KEEP	---	---	---	---	9	10	39	55	-1	capture	Nonsense_Mutation	SNP	25718727	25718727	EBF2	8	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	4836	175
LYN	4067	broad.mit.edu	37	8	56866431	56866431	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56866431T>C	uc003xsk.3	+	8	960	c.678T>C	c.(676-678)TGT>TGC	p.C226C	LYN_uc003xsl.3_Silent_p.C205C	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene	226	SH2.				erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			AGAAGGCTTGTATTAGTCCCA	0.478					240											0.151515	31.583614	43.078296	15	84	KEEP	---	---	---	---	10	8	44	45	-1	capture	Silent	SNP	56866431	56866431	LYN	8	T	C	C	C	1	0	0	0	0	0	0	0	1	738	57	3	3	9022	175
PRDM14	63978	broad.mit.edu	37	8	70980585	70980585	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70980585T>C	uc003xym.2	-	4	994	c.792A>G	c.(790-792)CCA>CCG	p.P264P		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	264	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CACCAAAATGTGGGACTTCAC	0.488	NSCLC(129;99 1813 5906 40656 46114)															0.101266	4.340714	16.883793	8	71	KEEP	---	---	---	---	4	4	32	44	-1	capture	Silent	SNP	70980585	70980585	PRDM14	8	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	12351	175
PABPC1	26986	broad.mit.edu	37	8	101730507	101730507	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101730507C>T	uc003yjs.1	-	2	699	c.195G>A	c.(193-195)GCG>GCA	p.A65A	PABPC1_uc011lhc.1_Silent_p.A65A|PABPC1_uc011lhd.1_Silent_p.A20A|PABPC1_uc003yjt.1_Silent_p.A65A|PABPC1_uc003yju.2_RNA	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	65	RRM 1.				mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			AAGCACGCTCCGCTGCAGGAA	0.433																0.142857	10.144279	15.287658	6	36	KEEP	---	---	---	---	2	4	18	18	-1	capture	Silent	SNP	101730507	101730507	PABPC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11267	175
RIMS2	9699	broad.mit.edu	37	8	104778688	104778688	+	Silent	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104778688T>C	uc003ylp.2	+	3	760	c.621T>C	c.(619-621)CAT>CAC	p.H207H		NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	238					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTCGATCTCATGGGCTCACAA	0.443					728								HNSCC(12;0.0054)			0.246377	36.51869	40.583079	17	52	KEEP	---	---	---	---	6	14	23	34	-1	capture	Silent	SNP	104778688	104778688	RIMS2	8	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	13260	175
FREM1	158326	broad.mit.edu	37	9	14775892	14775892	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14775892C>T	uc003zlm.2	-	25	5342	c.4752G>A	c.(4750-4752)GGG>GGA	p.G1584G	FREM1_uc010mic.2_Intron|FREM1_uc003zlk.2_5'Flank|FREM1_uc003zll.2_Silent_p.G120G	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1584	CSPG 11.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TCTGGGAGTCCCCTCCTGAGT	0.512																0.137255	25.805949	38.769947	14	88	KEEP	---	---	---	---	6	9	49	47	-1	capture	Silent	SNP	14775892	14775892	FREM1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	5987	175
RRAGA	10670	broad.mit.edu	37	9	19050342	19050342	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19050342G>A	uc003znj.2	+	1	971	c.685G>A	c.(685-687)GAG>AAG	p.E229K		NM_006570	NP_006561	Q7L523	RRAGA_HUMAN	Ras-related GTP binding A	229				E -> G (in Ref. 2; AAB63255).	apoptosis|cellular protein localization|cellular response to amino acid stimulus|positive regulation of cytolysis|positive regulation of TOR signaling cascade|virus-host interaction	Golgi apparatus|lysosome|nucleus	GTP binding|phosphoprotein binding|protein heterodimerization activity|protein homodimerization activity				0						CCACCGGTTTGAGAAGATCAG	0.473																0.222222	32.816586	37.288546	14	49	KEEP	---	---	---	---	4	10	29	28	-1	capture	Missense_Mutation	SNP	19050342	19050342	RRAGA	9	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	13564	175
TAF1L	138474	broad.mit.edu	37	9	32632340	32632340	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32632340G>A	uc003zrg.1	-	1	3328	c.3238C>T	c.(3238-3240)CGT>TGT	p.R1080C	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1080					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTTTGTAACGCTCTTGATGC	0.473					234											0.231293	78.04898	87.723806	34	113	KEEP	---	---	---	---	12	25	48	72	-1	capture	Missense_Mutation	SNP	32632340	32632340	TAF1L	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15411	175
FGD3	89846	broad.mit.edu	37	9	95738835	95738835	+	Silent	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95738835C>T	uc004asw.2	+	3	925	c.297C>T	c.(295-297)GGC>GGT	p.G99G	FGD3_uc004asx.2_Silent_p.G99G|FGD3_uc004asz.2_Silent_p.G99G	NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	99					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						TGGAGGCTGGCCCAAGCCCCA	0.657																0.175	12.825797	16.792385	7	33	KEEP	---	---	---	---	4	3	22	19	-1	capture	Silent	SNP	95738835	95738835	FGD3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	5780	175
ASTN2	23245	broad.mit.edu	37	9	119488220	119488220	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:119488220T>C	uc004bjs.1	-	16	2737	c.2636A>G	c.(2635-2637)AAT>AGT	p.N879S	ASTN2_uc004bjr.1_Missense_Mutation_p.N875S|ASTN2_uc004bjt.1_Missense_Mutation_p.N828S	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	879	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CTTGAGAACATTAGTGAAGCC	0.542																0.188119	49.4257	58.57509	19	82	KEEP	---	---	---	---	8	12	42	45	-1	capture	Missense_Mutation	SNP	119488220	119488220	ASTN2	9	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	1056	175
FCN2	2220	broad.mit.edu	37	9	137777089	137777089	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137777089G>A	uc004cfg.1	+	5	316	c.306G>A	c.(304-306)CCG>CCA	p.P102P	FCN2_uc004cfh.1_Silent_p.P64P	NM_004108	NP_004099	Q15485	FCN2_HUMAN	ficolin 2 isoform a precursor	102	Fibrinogen C-terminal.				complement activation, lectin pathway|opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|calcium-dependent protein binding|receptor binding|sugar binding			large_intestine(1)	1		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		TCCCAGGCCCGCGTACCTGCA	0.662																0.2	23.299753	27.901062	11	44	KEEP	---	---	---	---	5	8	19	31	-1	capture	Silent	SNP	137777089	137777089	FCN2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5738	175
PIM2	11040	broad.mit.edu	37	X	48771532	48771532	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48771532G>A	uc004dls.2	-	6	1114	c.812C>T	c.(811-813)CCT>CTT	p.P271L	SLC35A2_uc004dlo.1_5'Flank|SLC35A2_uc011mml.1_5'Flank|SLC35A2_uc004dlp.1_5'Flank|SLC35A2_uc011mmm.1_5'Flank|SLC35A2_uc011mmn.1_5'Flank|SLC35A2_uc004dlq.2_5'Flank|SLC35A2_uc011mmo.1_5'Flank	NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	271	Protein kinase.				anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4						TCGGGAAGAAGGTTTGGGGGC	0.602					33											0.411765	23.62258	23.738031	7	10	KEEP	---	---	---	---	2	6	9	2	-1	capture	Missense_Mutation	SNP	48771532	48771532	PIM2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11831	175
ATP7A	538	broad.mit.edu	37	X	77243835	77243835	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77243835C>A	uc004ecx.3	+	3	378	c.218C>A	c.(217-219)GCT>GAT	p.A73D	ATP7A_uc004ecw.2_Missense_Mutation_p.A73D	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	73	HMA 1.|Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						GGCTTTGATGCTGTTATCCAT	0.423																0.02027	-67.319137	9.093151	6	290	KEEP	---	---	---	---	3	4	165	159	0.571428571429	capture	Missense_Mutation	SNP	77243835	77243835	ATP7A	23	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	1181	175
STAG2	10735	broad.mit.edu	37	X	123220476	123220476	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123220476C>T	uc004etz.3	+	29	3472	c.3133C>T	c.(3133-3135)CGA>TGA	p.R1045*	STAG2_uc004eua.2_Nonsense_Mutation_p.R1045*|STAG2_uc004eub.2_Nonsense_Mutation_p.R1045*|STAG2_uc004euc.2_Nonsense_Mutation_p.R1045*|STAG2_uc004eud.2_Nonsense_Mutation_p.R1045*|STAG2_uc004eue.2_Nonsense_Mutation_p.R1045*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	1045					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						GATGTCTTACCGAAATTCTTT	0.433																0.067797	-2.720165	8.662276	4	55	KEEP	---	---	---	---	1	3	31	31	-1	capture	Nonsense_Mutation	SNP	123220476	123220476	STAG2	23	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	15133	175
L1CAM	3897	broad.mit.edu	37	X	153129351	153129351	+	Silent	SNP	G	A	A			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153129351G>A	uc004fjb.2	-	25	3552	c.3444C>T	c.(3442-3444)GGC>GGT	p.G1148G	L1CAM_uc004fjc.2_Silent_p.G1148G|L1CAM_uc010nuo.2_Silent_p.G1143G	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	1148	Cytoplasmic (Potential).				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTATTTGCCGCCCTTGCTGC	0.627																0.121951	6.65196	12.386028	5	36	KEEP	---	---	---	---	2	4	15	23	-1	capture	Silent	SNP	153129351	153129351	L1CAM	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8508	175
MYO3A	53904	broad.mit.edu	37	10	26315330	26315330	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26315330delG	uc001isn.2	+	10	1182	c.822delG	c.(820-822)AAGfs	p.K274fs	MYO3A_uc009xko.1_Frame_Shift_Del_p.K274fs|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Frame_Shift_Del_p.K274fs	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	274	Protein kinase.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						ATTATGAAAAGCGTCCAACAG	0.328					781											0.28			22	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	26315330	26315330	MYO3A	10	G	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	9986	175
PTEN	5728	broad.mit.edu	37	10	89725130	89725130	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89725130delC	uc001kfb.2	+	10	2144	c.1113delC	c.(1111-1113)GACfs	p.D371fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	371					activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y27fs*1(2)|p.N212fs*1(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATGTTAGTGACAATGAACCTG	0.388			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.30			9	21		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89725130	89725130	PTEN	10	C	-	-	-	1	0	1	0	1	0	0	0	0	220	17	5	5	12633	175
ATM	472	broad.mit.edu	37	11	108199882	108199882	+	Frame_Shift_Del	DEL	G	-	-	rs145747513	byFrequency	TCGA-19-5955-01	TCGA-19-5955-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108199882delG	uc001pkb.1	+	49	7609	c.7224delG	c.(7222-7224)TCGfs	p.S2408fs	ATM_uc009yxr.1_Frame_Shift_Del_p.S2408fs|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Frame_Shift_Del_p.S1060fs|ATM_uc001pkg.1_Frame_Shift_Del_p.S765fs	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2408	FAT.		S -> L (in a colorectal adenocarcinoma sample; somatic mutation).		cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	p.S2408L(1)		haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TGAAATCATCGGAATTTGAAA	0.373					1073	D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			0.15			11	60		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	108199882	108199882	ATM	11	G	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	1100	175
