Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SKI	6497	broad.mit.edu	37	1	2234792	2234792	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2234792G>A	uc001aja.3	+	3	1236	c.1164G>A	c.(1162-1164)GCG>GCA	p.A388A		NM_003036	NP_003027	P12755	SKI_HUMAN	v-ski sarcoma viral oncogene homolog	388					anterior/posterior axis specification|BMP signaling pathway|bone morphogenesis|cell motility|cell proliferation|embryonic limb morphogenesis|face morphogenesis|lens morphogenesis in camera-type eye|myelination in peripheral nervous system|myotube differentiation|negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of fibroblast proliferation|negative regulation of osteoblast differentiation|negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|neural tube closure|nose morphogenesis|olfactory bulb development|palate development|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein homotrimerization|regulation of apoptosis|retina development in camera-type eye|skeletal muscle fiber development|SMAD protein signal transduction|somatic stem cell maintenance|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|PML body|transcription factor complex|transcriptional repressor complex	histone deacetylase inhibitor activity|nucleotide binding|protein domain specific binding|protein kinase binding|repressing transcription factor binding|SMAD binding|transcription corepressor activity|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		CAGTGTCAGCGAGTGAGAAAG	0.622	Ovarian(177;144 1678 13697 20086 27838 40755)															0.439306	230.262991	230.82002	76	97	KEEP	---	---	---	---	38	48	47	71	-1	capture	Silent	SNP	2234792	2234792	SKI	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14250	177
HIVEP3	59269	broad.mit.edu	37	1	42048030	42048030	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:42048030C>T	uc001cgz.3	-	4	3652	c.2439G>A	c.(2437-2439)GAG>GAA	p.E813E	HIVEP3_uc001cha.3_Silent_p.E813E|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	813	Ser-rich.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN (By similarity).				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CACTCGGCTGCTCGAGAGAAT	0.557																0.463768	98.888007	98.967336	32	37	KEEP	---	---	---	---	20	23	16	34	-1	capture	Silent	SNP	42048030	42048030	HIVEP3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	7113	177
ZYG11B	79699	broad.mit.edu	37	1	53250588	53250588	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53250588C>T	uc001cuj.2	+	5	1327	c.1132C>T	c.(1132-1134)CCA>TCA	p.P378S	ZYG11B_uc009vzg.2_RNA|ZYG11B_uc010onj.1_Missense_Mutation_p.P369S	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	378							protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TATGAATTTGCCAGTGCAACT	0.458																0.031746	-22.55151	7.616517	4	122	KEEP	---	---	---	---	2	2	70	61	-1	capture	Missense_Mutation	SNP	53250588	53250588	ZYG11B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	18129	177
PCSK9	255738	broad.mit.edu	37	1	55527067	55527067	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55527067G>A	uc001cyf.1	+	11	1992	c.1701G>A	c.(1699-1701)GAG>GAA	p.E567E	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	567					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CCCACTGGGAGGTGGAGGACC	0.642	Pancreas(137;1454 1827 5886 22361 42375)															0.318182	20.517344	21.163717	7	15	KEEP	---	---	---	---	0	8	5	14	-1	capture	Silent	SNP	55527067	55527067	PCSK9	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	11509	177
TACSTD2	4070	broad.mit.edu	37	1	59041860	59041860	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:59041860C>T	uc001cyz.3	-	1	1307	c.969G>A	c.(967-969)TTG>TTA	p.L323L		NM_002353	NP_002344	P09758	TACD2_HUMAN	tumor-associated calcium signal transducer 2	323	Cytoplasmic (Potential).				cell proliferation|cell surface receptor linked signaling pathway|visual perception	cytosol|integral to plasma membrane	receptor activity				0	all_cancers(7;6.54e-05)					CGGGTACCTACAAGCTCGGTT	0.537																0.5	20.223594	20.223594	7	7	KEEP	---	---	---	---	1	7	3	5	-1	capture	Silent	SNP	59041860	59041860	TACSTD2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	15396	177
DDX20	11218	broad.mit.edu	37	1	112305594	112305594	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:112305594C>T	uc001ebs.2	+	10	1634	c.1277C>T	c.(1276-1278)GCC>GTC	p.A426V	DDX20_uc010owf.1_Missense_Mutation_p.A188V|DDX20_uc001ebt.2_Missense_Mutation_p.A34V	NM_007204	NP_009135	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	426	Helicase C-terminal.				assembly of spliceosomal tri-snRNP|ncRNA metabolic process	Cajal body|cytoskeleton|cytosol|spliceosomal complex	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding			lung(1)|kidney(1)	2		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGAGAATTGCCCAGAAATGT	0.353																0.078947	-0.502264	6.37673	3	35	KEEP	---	---	---	---	1	3	12	26	-1	capture	Missense_Mutation	SNP	112305594	112305594	DDX20	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4306	177
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254																0.066667	-1.812314	6.946653	3	42	KEEP	---	---	---	---	3	1	35	28	-1	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	177
CRNN	49860	broad.mit.edu	37	1	152382359	152382359	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152382359G>A	uc001ezx.2	-	3	1273	c.1199C>T	c.(1198-1200)CCG>CTG	p.P400L		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	400					cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCCTCCCGGTACTGTCTC	0.612																0.363636	104.545032	106.175122	36	63	KEEP	---	---	---	---	13	24	30	38	-1	capture	Missense_Mutation	SNP	152382359	152382359	CRNN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3857	177
CD1D	912	broad.mit.edu	37	1	158153825	158153825	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158153825C>T	uc001frr.2	+	6	1485	c.986C>T	c.(985-987)ACT>ATT	p.T329I	CD1D_uc009wss.2_Missense_Mutation_p.T236I	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	329	Cytoplasmic (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					AAGAGGCAAACGTAAGTCTCC	0.512																0.491228	255.765794	255.777554	84	87	KEEP	---	---	---	---	39	48	39	51	-1	capture	Missense_Mutation	SNP	158153825	158153825	CD1D	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2948	177
SERPINC1	462	broad.mit.edu	37	1	173883833	173883833	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173883833C>T	uc001gjt.2	-	2	385	c.266G>A	c.(265-267)CGC>CAC	p.R89H		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	89			R -> C (in AT3D; type-I).		blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)	GGTAGCAAAGCGGGAATTGGC	0.532														OREG0013990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.469231	181.129188	181.228757	61	69	KEEP	---	---	---	---	37	31	36	42	-1	capture	Missense_Mutation	SNP	173883833	173883833	SERPINC1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14002	177
PRG4	10216	broad.mit.edu	37	1	186280588	186280588	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186280588G>A	uc001gru.3	+	10	3704	c.3653G>A	c.(3652-3654)CGT>CAT	p.R1218H	PRG4_uc001grt.3_Missense_Mutation_p.R1177H|PRG4_uc009wyl.2_Missense_Mutation_p.R1125H|PRG4_uc009wym.2_Missense_Mutation_p.R1084H|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1218	Hemopexin-like 2.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CAGTACTGGCGTTTTACCAAT	0.353																0.416667	195.4462	196.392283	65	91	KEEP	---	---	---	---	34	40	40	66	-1	capture	Missense_Mutation	SNP	186280588	186280588	PRG4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12377	177
LHX9	56956	broad.mit.edu	37	1	197889248	197889248	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197889248C>T	uc001guk.1	+	2	758	c.321C>T	c.(319-321)TCC>TCT	p.S107S	LHX9_uc001gui.1_Silent_p.S98S|LHX9_uc001guj.1_Silent_p.S113S	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	107	LIM zinc-binding 1.				motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						CCCTCGAGTCCGAGCTCACCT	0.557																0.464567	373.040499	373.316432	118	136	KEEP	---	---	---	---	54	75	56	97	-1	capture	Silent	SNP	197889248	197889248	LHX9	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8697	177
OBSCN	84033	broad.mit.edu	37	1	228509734	228509734	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228509734G>A	uc009xez.1	+	55	15236	c.15192G>A	c.(15190-15192)GCG>GCA	p.A5064A	OBSCN_uc001hsn.2_Silent_p.A5064A	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5064					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GTTTTGAGGCGCTCACTGAGG	0.612					4006											0.416667	14.072466	14.145279	5	7	KEEP	---	---	---	---	1	4	4	3	-1	capture	Silent	SNP	228509734	228509734	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10717	177
C10orf53	282966	broad.mit.edu	37	10	50901822	50901822	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50901822G>T	uc001jib.2	+	2	160	c.100G>T	c.(100-102)GTG>TTG	p.V34L	CHAT_uc010qgs.1_Silent_p.L542L|C10orf53_uc001jic.1_Missense_Mutation_p.V34L|C10orf53_uc001jid.1_Missense_Mutation_p.V34L	NM_001042427	NP_001035892	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53 isoform b	34											0		all_neural(218;0.107)				CTTCCCAGCTGTGTTGGCCAT	0.468																0.878788	101.197598	105.83693	29	4	KEEP	---	---	---	---	11	20	1	3	0.354838709677	capture	Missense_Mutation	SNP	50901822	50901822	C10orf53	10	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	1594	177
STOX1	219736	broad.mit.edu	37	10	70644150	70644150	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70644150C>T	uc001jos.2	+	3	685	c.598C>T	c.(598-600)CAG>TAG	p.Q200*	STOX1_uc001jor.2_Nonsense_Mutation_p.Q200*|STOX1_uc009xpy.2_Intron|STOX1_uc001joq.2_Nonsense_Mutation_p.Q90*	NM_001130161	NP_001123633	Q6ZVD7	STOX1_HUMAN	storkhead box 1 isoform a	200						cytoplasm|nucleolus	DNA binding			kidney(1)|skin(1)	2						TACAACCACCCAGGAAAATAA	0.443																0.755102	120.4426	123.325973	37	12	KEEP	---	---	---	---	22	22	5	8	-1	capture	Nonsense_Mutation	SNP	70644150	70644150	STOX1	10	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	15209	177
IFITM3	10410	broad.mit.edu	37	11	320606	320606	+	Missense_Mutation	SNP	G	T	T	rs149004156	by1000genomes	TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:320606G>T	uc001lpa.2	-	1	309	c.208C>A	c.(208-210)CCC>ACC	p.P70T	uc001loz.2_Intron	NM_021034	NP_066362	Q01628	IFM3_HUMAN	interferon-induced transmembrane protein 3	70	Interaction with SPP1.|Helical; (Potential).				response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane		p.P70T(1)		central_nervous_system(7)	7		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGGCAGCAGGGGTTCATGAAG	0.632																0.050505	-11.785002	9.397653	5	94	KEEP	---	---	---	---	2	4	51	55	0.333333333333	capture	Missense_Mutation	SNP	320606	320606	IFITM3	11	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	7453	177
KRTAP5-4	387267	broad.mit.edu	37	11	1643251	1643251	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1643251C>T	uc009ycy.1	-	1	118	c.31G>A	c.(31-33)GGC>AGC	p.G11S		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	25						keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagccagagccacagccccca	0.259																0.175439	19.214422	24.881222	10	47	KEEP	---	---	---	---	5	5	38	26	-1	capture	Missense_Mutation	SNP	1643251	1643251	KRTAP5-4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8483	177
SLC6A5	9152	broad.mit.edu	37	11	20636272	20636272	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20636272A>T	uc001mqd.2	+	6	1306	c.1033A>T	c.(1033-1035)ACT>TCT	p.T345S	SLC6A5_uc009yic.2_Missense_Mutation_p.T110S	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	345	Extracellular (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	CAAGAACTCGACTTTCTGCAT	0.403																0.492857	213.073162	213.079296	69	71	KEEP	---	---	---	---	36	42	38	43	-1	capture	Missense_Mutation	SNP	20636272	20636272	SLC6A5	11	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	14579	177
OR8H3	390152	broad.mit.edu	37	11	55890213	55890213	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55890213G>A	uc001nii.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					GCCTATGATCGCTATGCAGCG	0.468																0.387833	281.744984	284.657591	102	161	KEEP	---	---	---	---	43	65	82	112	-1	capture	Missense_Mutation	SNP	55890213	55890213	OR8H3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11143	177
OR5A1	219982	broad.mit.edu	37	11	59210760	59210760	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59210760C>T	uc001nnx.1	+	1	119	c.119C>T	c.(118-120)ACC>ATC	p.T40I		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						ATCTATCTTACCACCCTGGCC	0.502																0.452632	128.215216	128.400356	43	52	KEEP	---	---	---	---	19	29	21	35	-1	capture	Missense_Mutation	SNP	59210760	59210760	OR5A1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11043	177
C11orf66	220004	broad.mit.edu	37	11	61249365	61249365	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61249365C>T	uc001nru.1	+	2	209	c.84C>T	c.(82-84)TAC>TAT	p.Y28Y	C11orf66_uc009ynq.1_Silent_p.Y28Y	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN	IIIG9 protein	28										ovary(1)	1						TGAAATTCTACGCCACCAGCT	0.622																0.416667	29.846651	29.991896	10	14	KEEP	---	---	---	---	2	8	9	7	-1	capture	Silent	SNP	61249365	61249365	C11orf66	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1642	177
OVOL1	5017	broad.mit.edu	37	11	65561705	65561705	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65561705C>T	uc001ofp.2	+	2	620	c.304C>T	c.(304-306)CGC>TGC	p.R102C	OVOL1_uc001ofq.2_Missense_Mutation_p.R40C	NM_004561	NP_004552	O14753	OVOL1_HUMAN	OVO-like 1 binding protein	102					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.17)		TGGCTTCCTGCGCACCAAGAT	0.612																0.349398	80.349024	82.009951	29	54	KEEP	---	---	---	---	12	20	28	30	-1	capture	Missense_Mutation	SNP	65561705	65561705	OVOL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11230	177
KRTAP5-8	57830	broad.mit.edu	37	11	71249153	71249153	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71249153G>A	uc001oqr.1	+	1	83	c.52G>A	c.(52-54)GGC>AGC	p.G18S		NM_021046	NP_066384	O75690	KRA58_HUMAN	keratin associated protein 5-8	18						extracellular region|keratin filament	structural constituent of epidermis				0						TGGGGGCTGCGGCTCTGGCTG	0.652																0.32	89.780156	92.65079	32	68	KEEP	---	---	---	---	15	20	43	36	-1	capture	Missense_Mutation	SNP	71249153	71249153	KRTAP5-8	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8487	177
ARRB1	408	broad.mit.edu	37	11	74979943	74979943	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74979943C>T	uc001owe.1	-	14	1305	c.1083G>A	c.(1081-1083)CCG>CCA	p.P361P	ARRB1_uc001owf.1_Silent_p.P353P	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A	361	Interaction with TRAF6.				G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						CTTCCCGATGCGGGGGTTCCT	0.622																0.358491	49.782759	50.728137	19	34	KEEP	---	---	---	---	8	11	13	22	-1	capture	Silent	SNP	74979943	74979943	ARRB1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	973	177
GRIN2B	2904	broad.mit.edu	37	12	13716218	13716218	+	Silent	SNP	G	C	C			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13716218G>C	uc001rbt.2	-	13	4133	c.3954C>G	c.(3952-3954)GCC>GCG	p.A1318A		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1318	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CGCTGCGCGGGGCCAGGGCGG	0.587					371											0.442857	93.824231	94.035389	31	39	KEEP	---	---	---	---	12	22	26	20	-1	capture	Silent	SNP	13716218	13716218	GRIN2B	12	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	6713	177
OAS1	4938	broad.mit.edu	37	12	113346549	113346549	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113346549G>A	uc001tud.2	+	2	495	c.389G>A	c.(388-390)CGT>CAT	p.R130H	OAS1_uc010syn.1_Missense_Mutation_p.R129H|OAS1_uc010syo.1_Missense_Mutation_p.R129H|OAS1_uc001tub.2_Missense_Mutation_p.R130H|OAS1_uc001tuc.2_Missense_Mutation_p.R130H|OAS1_uc009zwf.2_Missense_Mutation_p.R129H	NM_016816	NP_058132	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 1	130	Necessary for binding to dsRNA.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						GGCAACCCCCGTGCGCTCAGC	0.577																0.458333	99.769294	99.877738	33	39	KEEP	---	---	---	---	15	21	16	26	-1	capture	Missense_Mutation	SNP	113346549	113346549	OAS1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10704	177
OR4K15	81127	broad.mit.edu	37	14	20443959	20443959	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20443959C>T	uc010tkx.1	+	1	282	c.282C>T	c.(280-282)GAC>GAT	p.D94D		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	94	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATTTATAGACGTATGTGTTG	0.453																0.333333	140.260298	143.970926	50	100	KEEP	---	---	---	---	25	35	57	63	-1	capture	Silent	SNP	20443959	20443959	OR4K15	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10974	177
FLJ10357	55701	broad.mit.edu	37	14	21543075	21543075	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21543075G>T	uc001vzp.2	+	3	1215	c.1186G>T	c.(1186-1188)GAC>TAC	p.D396Y	FLJ10357_uc001vzn.1_Missense_Mutation_p.D396Y|FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_5'UTR	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	396					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		CCGAGGAGGGGACAGTGCCCC	0.597																0.409639	86.812409	87.40937	34	49	KEEP	---	---	---	---	20	15	29	28	0.571428571429	capture	Missense_Mutation	SNP	21543075	21543075	FLJ10357	14	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	5871	177
CHD8	57680	broad.mit.edu	37	14	21871175	21871175	+	Splice_Site	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21871175C>T	uc001was.1	-	18	2971	c.2877_splice	c.e18+1	p.Q959_splice	CHD8_uc001war.1_Splice_Site_p.Q855_splice|CHD8_uc001wav.1_Splice_Site_p.Q401_splice	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AATTCCTTTACCTGCAGGTCA	0.403					886											0.535714	46.72547	46.756387	15	13	KEEP	---	---	---	---	9	7	8	5	-1	capture	Splice_Site	SNP	21871175	21871175	CHD8	14	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	3297	177
ACTN1	87	broad.mit.edu	37	14	69356891	69356891	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69356891C>T	uc001xkl.2	-	11	1509	c.1199G>A	c.(1198-1200)CGG>CAG	p.R400Q	ACTN1_uc001xkk.2_5'Flank|ACTN1_uc010ttb.1_Missense_Mutation_p.R335Q|ACTN1_uc001xkm.2_Missense_Mutation_p.R400Q|ACTN1_uc001xkn.2_Missense_Mutation_p.R400Q|ACTN1_uc001xko.1_Missense_Mutation_p.R335Q|ACTN1_uc010ttd.1_Missense_Mutation_p.R379Q	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	400	Spectrin 2.|Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GGCCTTCTGCCGGAACTTCTC	0.647																0.458333	36.524901	36.560869	11	13	KEEP	---	---	---	---	7	5	8	5	-1	capture	Missense_Mutation	SNP	69356891	69356891	ACTN1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	204	177
FMN1	342184	broad.mit.edu	37	15	33261285	33261285	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33261285C>T	uc001zhf.3	-	4	1948	c.1948G>A	c.(1948-1950)GCA>ACA	p.A650T		NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	873	FH1.|Pro-rich.				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GGGATGGATGCGGGAGGCGGA	0.552																0.454545	28.445997	28.485763	10	12	KEEP	---	---	---	---	2	9	7	6	-1	capture	Missense_Mutation	SNP	33261285	33261285	FMN1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5893	177
ITGA11	22801	broad.mit.edu	37	15	68643617	68643617	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68643617G>A	uc002ari.2	-	8	960	c.873C>T	c.(871-873)AAC>AAT	p.N291N	ITGA11_uc010bib.2_Silent_p.N291N	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	291	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	ATCTTGTTACGTTGTCTCTTT	0.552																0.354167	48.66539	49.563271	17	31	KEEP	---	---	---	---	6	12	16	16	-1	capture	Silent	SNP	68643617	68643617	ITGA11	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7797	177
CSPG4	1464	broad.mit.edu	37	15	75980091	75980091	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75980091C>T	uc002baw.2	-	3	3408	c.3315G>A	c.(3313-3315)CTG>CTA	p.L1105L		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	1105	Interaction with COL5A1 (By similarity).|Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).|CSPG 6.				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						CGGACACCTGCAGCTGGATCC	0.657					549											0.520408	148.818495	148.853555	51	47	KEEP	---	---	---	---	26	32	31	28	-1	capture	Silent	SNP	75980091	75980091	CSPG4	15	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	3925	177
C15orf27	123591	broad.mit.edu	37	15	76430102	76430102	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76430102C>T	uc002bbq.2	+	3	248	c.93C>T	c.(91-93)GAC>GAT	p.D31D	C15orf27_uc010bkp.2_Translation_Start_Site|C15orf27_uc002bbr.2_Translation_Start_Site	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	31						integral to membrane					0						AACAAGTAGACGAAGAAACCA	0.537																0.428571	175.051223	175.678292	60	80	KEEP	---	---	---	---	29	33	47	42	-1	capture	Silent	SNP	76430102	76430102	C15orf27	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1774	177
C15orf26	161502	broad.mit.edu	37	15	81429012	81429012	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81429012C>T	uc002bgb.2	+	3	342	c.315C>T	c.(313-315)GAC>GAT	p.D105D	C15orf26_uc010blp.1_Silent_p.D80D	NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	105											0						ATCTGAAAGACGAATTAGAGG	0.448																0.333333	71.262808	73.10147	25	50	KEEP	---	---	---	---	13	12	26	32	-1	capture	Silent	SNP	81429012	81429012	C15orf26	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1773	177
HAPLN3	145864	broad.mit.edu	37	15	89430480	89430480	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89430480C>A	uc002bnc.2	-	2	178	c.50G>T	c.(49-51)GGA>GTA	p.G17V	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Missense_Mutation_p.G79V	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	17					cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)					GAAGGGCAGTCCGTAGGAGCC	0.642																0.431373	59.633756	59.843793	22	29	KEEP	---	---	---	---	16	14	8	24	0.466666666667	capture	Missense_Mutation	SNP	89430480	89430480	HAPLN3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	6883	177
GNPTG	84572	broad.mit.edu	37	16	1412483	1412483	+	Missense_Mutation	SNP	G	A	A	rs139997459		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1412483G>A	uc002clm.2	+	8	592	c.557G>A	c.(556-558)CGG>CAG	p.R186Q		NM_032520	NP_115909	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphotransferase, gamma	186						extracellular region|Golgi apparatus	protein binding			central_nervous_system(1)	1		Hepatocellular(780;0.0893)				GCCCTGCAGCGGCAGTGGGAC	0.682																0.479167	70.714424	70.732883	23	25	KEEP	---	---	---	---	17	9	15	17	-1	capture	Missense_Mutation	SNP	1412483	1412483	GNPTG	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6482	177
TEKT5	146279	broad.mit.edu	37	16	10788509	10788509	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10788509C>T	uc002czz.1	-	1	294	c.222G>A	c.(220-222)CCG>CCA	p.P74P		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	74					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						GGATGGTGGGCGGCCGCAGGG	0.642																0.061856	-9.741711	9.817462	6	91	KEEP	---	---	---	---	1	5	48	54	-1	capture	Silent	SNP	10788509	10788509	TEKT5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15641	177
ITGAM	3684	broad.mit.edu	37	16	31336846	31336846	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31336846G>A	uc002ebq.2	+	21	2629	c.2531G>A	c.(2530-2532)CGC>CAC	p.R844H	ITGAM_uc002ebr.2_Missense_Mutation_p.R845H|ITGAM_uc010can.2_Missense_Mutation_p.R250H|ITGAM_uc002ebs.1_Missense_Mutation_p.R250H	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	844	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CGATCCTGGCGCCTGGCCTGT	0.602																0.56	83.204112	83.361793	28	22	KEEP	---	---	---	---	12	18	15	9	-1	capture	Missense_Mutation	SNP	31336846	31336846	ITGAM	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7810	177
DPEP3	64180	broad.mit.edu	37	16	68010069	68010069	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68010069C>T	uc002evc.3	-	9	1326	c.1232G>A	c.(1231-1233)CGT>CAT	p.R411H	DPEP3_uc010cex.2_Missense_Mutation_p.R410H	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN	dipeptidase 3 isoform a	386					meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		GCTCCAGCTACGACTCAGCAA	0.577																0.126214	15.812032	29.859797	13	90	KEEP	---	---	---	---	6	7	50	50	-1	capture	Missense_Mutation	SNP	68010069	68010069	DPEP3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4670	177
CNTNAP4	85445	broad.mit.edu	37	16	76482757	76482757	+	Missense_Mutation	SNP	G	A	A	rs148969138		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:76482757G>A	uc002feu.1	+	8	1221	c.836G>A	c.(835-837)CGT>CAT	p.R279H	CNTNAP4_uc002fev.1_Missense_Mutation_p.R191H|CNTNAP4_uc010chb.1_Missense_Mutation_p.R254H|CNTNAP4_uc002fex.1_Missense_Mutation_p.R282H|CNTNAP4_uc002few.2_Missense_Mutation_p.R254H	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	279	Extracellular (Potential).|Laminin G-like 1.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CTCATCCAGCGTTTGGGCAAA	0.483																0.387097	34.156244	34.480006	12	19	KEEP	---	---	---	---	5	9	10	10	-1	capture	Missense_Mutation	SNP	76482757	76482757	CNTNAP4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3614	177
SDR42E1	93517	broad.mit.edu	37	16	82033639	82033639	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:82033639G>A	uc002fgu.2	-	3	387	c.259C>T	c.(259-261)CGG>TGG	p.R87W		NM_145168	NP_660151	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E,	87					steroid biosynthetic process	integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding				0						AGTTGCTCCCGCCCTGACATA	0.498																0.387387	115.778583	117.01791	43	68	KEEP	---	---	---	---	15	28	35	39	-1	capture	Missense_Mutation	SNP	82033639	82033639	SDR42E1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	13866	177
CDH13	1012	broad.mit.edu	37	16	83704506	83704506	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:83704506G>A	uc002fgx.2	+	9	1333	c.1213G>A	c.(1213-1215)GGA>AGA	p.G405R	CDH13_uc010vns.1_Missense_Mutation_p.G452R|CDH13_uc010vnt.1_Missense_Mutation_p.G151R|CDH13_uc010vnu.1_Missense_Mutation_p.G366R	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	405	Cadherin 3.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CATCATCAACGGAAACCCCGG	0.498																0.362745	106.851889	108.540565	37	65	KEEP	---	---	---	---	17	22	32	39	-1	capture	Missense_Mutation	SNP	83704506	83704506	CDH13	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3070	177
TNFAIP1	7126	broad.mit.edu	37	17	26666722	26666722	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26666722G>A	uc002hax.1	+	2	194	c.175G>A	c.(175-177)GGG>AGG	p.G59R	TNFAIP1_uc002hay.2_Missense_Mutation_p.G59R|TNFAIP1_uc010waf.1_Intron	NM_021137	NP_066960	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1	59	BTB.				apoptosis|cell migration|DNA replication|embryo development|immune response|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|endosome|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity				0	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CATGTTCAGTGGGCGCATGGA	0.617																0.491228	88.684197	88.688275	28	29	KEEP	---	---	---	---	23	19	23	18	-1	capture	Missense_Mutation	SNP	26666722	26666722	TNFAIP1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16155	177
KRT32	3882	broad.mit.edu	37	17	39619277	39619277	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39619277G>A	uc002hwr.2	-	6	1083	c.1022C>T	c.(1021-1023)ACG>ATG	p.T341M		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	341	Coil 2.|Rod.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)				CTCACTCTCCGTCAGCGTGTT	0.572																0.388889	59.256478	59.842229	21	33	KEEP	---	---	---	---	18	9	24	15	-1	capture	Missense_Mutation	SNP	39619277	39619277	KRT32	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8388	177
DCC	1630	broad.mit.edu	37	18	50451729	50451729	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50451729T>C	uc002lfe.1	+	5	1561	c.974T>C	c.(973-975)CTC>CCC	p.L325P	DCC_uc010xdr.1_Missense_Mutation_p.L173P	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	325	Extracellular (Potential).|Ig-like C2-type 3.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCTGCAGAGCTCACAGTCTTG	0.388																0.398601	189.936029	191.224765	57	86	KEEP	---	---	---	---	26	41	44	61	-1	capture	Missense_Mutation	SNP	50451729	50451729	DCC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	4241	177
ATCAY	85300	broad.mit.edu	37	19	3909561	3909561	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3909561G>A	uc002lyy.3	+	7	1155	c.725G>A	c.(724-726)CGG>CAG	p.R242Q	ATCAY_uc010xhz.1_Missense_Mutation_p.R248Q|ATCAY_uc010dts.2_5'UTR	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	242	CRAL-TRIO.				transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		ACGCCCCGGCGGAGGATGCCT	0.592																0.296296	23.792411	24.792648	8	19	KEEP	---	---	---	---	5	4	4	17	-1	capture	Missense_Mutation	SNP	3909561	3909561	ATCAY	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1068	177
TNFSF9	8744	broad.mit.edu	37	19	6534936	6534936	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6534936C>T	uc002mfh.2	+	3	662	c.624C>T	c.(622-624)GCC>GCT	p.A208A		NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,	208	Extracellular (Potential).				apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						ACCTGAGTGCCGGCCAGCGCC	0.697																0.291667	19.114316	20.048	7	17	KEEP	---	---	---	---	3	5	8	15	-1	capture	Silent	SNP	6534936	6534936	TNFSF9	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16195	177
DOCK6	57572	broad.mit.edu	37	19	11361720	11361720	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11361720G>A	uc002mqs.3	-	6	591	c.550C>T	c.(550-552)CGA>TGA	p.R184*		NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	184					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CCACTGCTTCGAGGGGTGTCT	0.567																0.222222	9.390517	10.668193	4	14	KEEP	---	---	---	---	3	2	8	11	-1	capture	Nonsense_Mutation	SNP	11361720	11361720	DOCK6	19	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	4647	177
OR10H5	284433	broad.mit.edu	37	19	15905063	15905063	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15905063A>G	uc010xos.1	+	1	205	c.205A>G	c.(205-207)ACC>GCC	p.T69A		NM_001004466	NP_001004466	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCTCTCCATCACCGAGATCCT	0.622																0.315789	86.918388	89.784498	30	65	KEEP	---	---	---	---	10	21	29	41	-1	capture	Missense_Mutation	SNP	15905063	15905063	OR10H5	19	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10813	177
HIF3A	64344	broad.mit.edu	37	19	46832519	46832519	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46832519A>G	uc002peh.2	+	12	1525	c.1496A>G	c.(1495-1497)GAC>GGC	p.D499G	HIF3A_uc002peg.3_Missense_Mutation_p.D499G|HIF3A_uc002pei.3_Missense_Mutation_p.D443G|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Missense_Mutation_p.D443G|HIF3A_uc010xxy.1_Missense_Mutation_p.D430G|HIF3A_uc002pel.2_Missense_Mutation_p.D497G|HIF3A_uc010xxz.1_Missense_Mutation_p.D448G	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	499	NTAD.|ODD.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		ATGGATGATGACTTCCAGCTC	0.552																0.276596	77.034038	81.242959	26	68	KEEP	---	---	---	---	10	20	33	47	-1	capture	Missense_Mutation	SNP	46832519	46832519	HIF3A	19	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	7030	177
FPR2	2358	broad.mit.edu	37	19	52272915	52272915	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52272915C>T	uc002pxr.2	+	2	1049	c.1004C>T	c.(1003-1005)ACG>ATG	p.T335M	FPR2_uc002pxs.3_Missense_Mutation_p.T335M|FPR2_uc010epf.2_Missense_Mutation_p.T335M	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	335	Cytoplasmic (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4						ACTAATGACACGGCTGCCAAT	0.537																0.408163	56.056039	56.424719	20	29	KEEP	---	---	---	---	9	14	13	19	-1	capture	Missense_Mutation	SNP	52272915	52272915	FPR2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5983	177
ZNF71	58491	broad.mit.edu	37	19	57133247	57133247	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57133247C>T	uc002qnm.3	+	3	830	c.592C>T	c.(592-594)CGC>TGC	p.R198C		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	198	C2H2-type 3.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CTTCAGCCAGCGCATGAACCT	0.637																0.419355	37.570536	37.746176	13	18	KEEP	---	---	---	---	6	7	12	9	-1	capture	Missense_Mutation	SNP	57133247	57133247	ZNF71	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17990	177
IL18RAP	8807	broad.mit.edu	37	2	103040451	103040451	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103040451G>T	uc002tbx.2	+	4	735	c.251G>T	c.(250-252)TGG>TTG	p.W84L	IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	84	Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						GATGTCCAATGGTACCAACAA	0.458																0.383333	67.908415	68.625356	23	37	KEEP	---	---	---	---	10	15	17	24	0.4	capture	Missense_Mutation	SNP	103040451	103040451	IL18RAP	2	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	7571	177
LRP2	4036	broad.mit.edu	37	2	170112639	170112639	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170112639G>A	uc002ues.2	-	19	2960	c.2747C>T	c.(2746-2748)CCG>CTG	p.P916L	LRP2_uc010zdf.1_Missense_Mutation_p.P779L	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	916	LDL-receptor class B 9.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AAGTCCAAACGGATGTGTCAT	0.378					2055											0.379747	89.535997	90.536249	30	49	KEEP	---	---	---	---	11	22	22	29	-1	capture	Missense_Mutation	SNP	170112639	170112639	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8872	177
TTN	7273	broad.mit.edu	37	2	179442111	179442111	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179442111G>A	uc010zfg.1	-	273	61471	c.61247C>T	c.(61246-61248)GCA>GTA	p.A20416V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A14111V|TTN_uc010zfi.1_Missense_Mutation_p.A14044V|TTN_uc010zfj.1_Missense_Mutation_p.A13919V|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21343							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTTTTCCTGCCTTGGACCA	0.403					8722											0.351852	51.006711	52.052939	19	35	KEEP	---	---	---	---	16	6	17	19	-1	capture	Missense_Mutation	SNP	179442111	179442111	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	16617	177
MFF	56947	broad.mit.edu	37	2	228195421	228195421	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228195421A>T	uc002vos.2	+	4	536	c.118A>T	c.(118-120)ACT>TCT	p.T40S	MFF_uc002vot.2_Missense_Mutation_p.T14S|MFF_uc002vou.2_Missense_Mutation_p.T40S|MFF_uc002vov.2_Missense_Mutation_p.T14S|MFF_uc002vow.2_Missense_Mutation_p.T14S|MFF_uc002vox.2_Missense_Mutation_p.T14S|MFF_uc002voy.2_Missense_Mutation_p.T40S|MFF_uc002voz.2_Missense_Mutation_p.T14S	NM_020194	NP_064579	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	40	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane				large_intestine(1)	1						AATGGAATATACTGAAGGCAT	0.458																0.441176	46.522097	46.624276	15	19	KEEP	---	---	---	---	7	8	12	10	-1	capture	Missense_Mutation	SNP	228195421	228195421	MFF	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	9431	177
UGT1A10	54575	broad.mit.edu	37	2	234545533	234545533	+	Missense_Mutation	SNP	C	T	T	rs145610800		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234545533C>T	uc002vur.2	+	1	411	c.365C>T	c.(364-366)TCG>TTG	p.S122L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Missense_Mutation_p.S122L	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	122					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTATTTTTTTCGCATTGCAGG	0.363																0.413534	168.296495	169.165767	55	78	KEEP	---	---	---	---	27	36	38	53	-1	capture	Missense_Mutation	SNP	234545533	234545533	UGT1A10	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16827	177
NEU4	129807	broad.mit.edu	37	2	242755707	242755707	+	Missense_Mutation	SNP	G	A	A	rs138212045		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242755707G>A	uc010fzr.2	+	2	112	c.26G>A	c.(25-27)CGG>CAG	p.R9Q	NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.R9Q|NEU4_uc002wcn.1_Missense_Mutation_p.R21Q|NEU4_uc002wco.1_Missense_Mutation_p.R9Q|NEU4_uc002wcp.1_Missense_Mutation_p.R21Q	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN	sialidase 4	9						lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		ACCCCTTCACGGACAGTGCTC	0.692																0.416667	30.445854	30.591298	10	14	KEEP	---	---	---	---	7	4	9	5	-1	capture	Missense_Mutation	SNP	242755707	242755707	NEU4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10251	177
CHGB	1114	broad.mit.edu	37	20	5903871	5903871	+	Missense_Mutation	SNP	C	T	T	rs144051265		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5903871C>T	uc002wmg.2	+	4	1387	c.1081C>T	c.(1081-1083)CGC>TGC	p.R361C	CHGB_uc010zqz.1_Missense_Mutation_p.R44C	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	361						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GGAGTGGGAGCGCTATAGGGG	0.527																0.278481	105.12906	112.108841	44	114	KEEP	---	---	---	---	22	23	61	67	-1	capture	Missense_Mutation	SNP	5903871	5903871	CHGB	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3305	177
SNTA1	6640	broad.mit.edu	37	20	32000203	32000203	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:32000203C>T	uc002wzd.1	-	5	1211	c.939G>A	c.(937-939)CTG>CTA	p.L313L	SNTA1_uc010zuf.1_Intron	NM_003098	NP_003089	Q13424	SNTA1_HUMAN	acidic alpha 1 syntrophin	313	PH 2.				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1						TTAGCAGGGCCAGGGTGGGGG	0.652																0.37931	32.920715	33.290255	11	18	KEEP	---	---	---	---	6	5	10	11	-1	capture	Silent	SNP	32000203	32000203	SNTA1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	14763	177
SRMS	6725	broad.mit.edu	37	20	62178625	62178625	+	Silent	SNP	C	T	T	rs140773907		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62178625C>T	uc002yfi.1	-	1	233	c.192G>A	c.(190-192)GCG>GCA	p.A64A		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	64	SH3.						ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CGCCACACCGCGCCGTGAAGT	0.692					557											0.272512	270.215491	289.864296	115	307	KEEP	---	---	---	---	84	77	221	212	-1	capture	Silent	SNP	62178625	62178625	SRMS	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15044	177
PCNT	5116	broad.mit.edu	37	21	47850134	47850134	+	Missense_Mutation	SNP	T	C	C			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47850134T>C	uc002zji.3	+	36	8008	c.7901T>C	c.(7900-7902)GTC>GCC	p.V2634A	PCNT_uc002zjj.2_Missense_Mutation_p.V2516A	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2634	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CAGCAGGAGGTCCTCCAGCTG	0.607																0.090909	2.203972	7.767096	3	30	KEEP	---	---	---	---	0	4	14	19	-1	capture	Missense_Mutation	SNP	47850134	47850134	PCNT	21	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	11493	177
FBLN2	2199	broad.mit.edu	37	3	13670420	13670420	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13670420C>T	uc011avb.1	+	11	2569	c.2444C>T	c.(2443-2445)ACG>ATG	p.T815M	FBLN2_uc011auz.1_Missense_Mutation_p.T841M|FBLN2_uc011ava.1_Missense_Mutation_p.T862M|FBLN2_uc011avc.1_Missense_Mutation_p.T862M	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	815	EGF-like 5; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			AACGAGTGCACGTCACTGTCC	0.662																0.266667	10.398781	11.132951	4	11	KEEP	---	---	---	---	1	3	7	5	-1	capture	Missense_Mutation	SNP	13670420	13670420	FBLN2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5645	177
FBLN2	2199	broad.mit.edu	37	3	13670486	13670486	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13670486A>G	uc011avb.1	+	11	2635	c.2510A>G	c.(2509-2511)CAG>CGG	p.Q837R	FBLN2_uc011auz.1_Missense_Mutation_p.Q863R|FBLN2_uc011ava.1_Missense_Mutation_p.Q884R|FBLN2_uc011avc.1_Missense_Mutation_p.Q884R	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	837	EGF-like 5; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TACACATGCCAGAGGAACCCG	0.652																0.375	16.043923	16.264122	6	10	KEEP	---	---	---	---	3	3	2	9	-1	capture	Missense_Mutation	SNP	13670486	13670486	FBLN2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5645	177
KCNH8	131096	broad.mit.edu	37	3	19575088	19575088	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:19575088G>A	uc003cbk.1	+	16	3016	c.2821G>A	c.(2821-2823)GGG>AGG	p.G941R	KCNH8_uc010hex.1_Missense_Mutation_p.G402R	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	941	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						GCAAACAGGCGGGGCTGCTTA	0.547	NSCLC(124;1625 1765 8018 24930 42026)															0.460317	91.569257	91.65554	29	34	KEEP	---	---	---	---	12	18	21	16	-1	capture	Missense_Mutation	SNP	19575088	19575088	KCNH8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7960	177
RTP3	83597	broad.mit.edu	37	3	46542293	46542293	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46542293C>T	uc003cps.1	+	2	671	c.603C>T	c.(601-603)TAC>TAT	p.Y201Y		NM_031440	NP_113628	Q9BQQ7	RTP3_HUMAN	transmembrane protein 7	201	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TCTATTCCTACGCATGCCAAA	0.433																0.383721	98.081658	99.091206	33	53	KEEP	---	---	---	---	15	22	25	36	-1	capture	Silent	SNP	46542293	46542293	RTP3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13627	177
DNAH1	25981	broad.mit.edu	37	3	52433096	52433096	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52433096G>C	uc011bef.1	+	76	12581	c.12320G>C	c.(12319-12321)GGC>GCC	p.G4107A	DNAH1_uc003ddv.2_Missense_Mutation_p.G965A	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	4172					ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCCAAGATGGCATCCCAGCT	0.532																0.047794	-29.890214	29.566774	13	259	KEEP	---	---	---	---	6	8	116	160	-1	capture	Missense_Mutation	SNP	52433096	52433096	DNAH1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	4555	177
NT5DC2	64943	broad.mit.edu	37	3	52563292	52563292	+	Silent	SNP	G	A	A	rs148646310		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52563292G>A	uc003deo.2	-	2	604	c.180C>T	c.(178-180)AAC>AAT	p.N60N	NT5DC2_uc003dem.2_5'Flank|NT5DC2_uc003den.2_Silent_p.N97N|NT5DC2_uc010hmi.2_Silent_p.N97N|NT5DC2_uc010hmj.2_Translation_Start_Site	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2	60							hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GGCTGATCTCGTTGTTGGCGT	0.592																0.416667	57.790503	58.081649	20	28	KEEP	---	---	---	---	11	9	15	14	-1	capture	Silent	SNP	52563292	52563292	NT5DC2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10598	177
KIAA1524	57650	broad.mit.edu	37	3	108276241	108276241	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108276241C>A	uc003dxb.3	-	17	2303	c.2034G>T	c.(2032-2034)ATG>ATT	p.M678I		NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	678	Potential.					cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						CTTCTCTCAACATACTAGCAA	0.368																0.461538	37.494795	37.528533	12	14	KEEP	---	---	---	---	4	8	2	12	0.666666666667	capture	Missense_Mutation	SNP	108276241	108276241	KIAA1524	3	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	8161	177
PLSCR2	57047	broad.mit.edu	37	3	146177634	146177634	+	Splice_Site	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:146177634C>T	uc003evv.1	-	3	390	c.57_splice	c.e3+1	p.Q19_splice	PLSCR2_uc003evw.1_Splice_Site_p.Q88_splice	NM_020359	NP_065092	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0						TTTGAAATTACCTGACTTAAG	0.373																0.048387	-7.111211	6.319005	3	59	KEEP	---	---	---	---	1	3	44	23	-1	capture	Splice_Site	SNP	146177634	146177634	PLSCR2	3	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	12013	177
NFXL1	152518	broad.mit.edu	37	4	47864932	47864932	+	Silent	SNP	T	C	C			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47864932T>C	uc010igh.2	-	19	2424	c.2247A>G	c.(2245-2247)AGA>AGG	p.R749R	NFXL1_uc003gxo.2_Silent_p.R74R|NFXL1_uc003gxp.2_Silent_p.R749R|NFXL1_uc003gxq.3_RNA|NFXL1_uc010igi.2_Silent_p.R749R	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like	749						integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TGGTTATTTTTCTAAAAATAA	0.269																0.03871	-23.086414	12.551449	6	149	KEEP	---	---	---	---	4	3	60	93	-1	capture	Silent	SNP	47864932	47864932	NFXL1	4	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	10295	177
TXK	7294	broad.mit.edu	37	4	48069656	48069656	+	Nonstop_Mutation	SNP	A	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48069656A>T	uc003gxx.3	-	15	1668	c.1582T>A	c.(1582-1584)TGA>AGA	p.*528R	TXK_uc010igj.2_RNA|TXK_uc011bzj.1_Nonstop_Mutation_p.*215R	NM_003328	NP_003319	P42681	TXK_HUMAN	TXK tyrosine kinase	528						cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GTTTCCGGTCACCAGGTTTCC	0.483					451											0.446667	213.936057	214.302058	67	83	KEEP	---	---	---	---	39	38	50	48	-1	capture	Nonstop_Mutation	SNP	48069656	48069656	TXK	4	A	T	T	T	1	0	0	0	0	0	0	0	0	78	6	5	4	16668	177
TMPRSS11F	389208	broad.mit.edu	37	4	68934340	68934340	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68934340A>G	uc003hdt.1	-	7	800	c.751T>C	c.(751-753)TGG>CGG	p.W251R	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	251	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						ACTTACTTCCAAAAGCAGTGA	0.522																0.5	58.594025	58.594025	20	20	KEEP	---	---	---	---	10	11	10	12	-1	capture	Missense_Mutation	SNP	68934340	68934340	TMPRSS11F	4	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	16126	177
CDH18	1016	broad.mit.edu	37	5	19503219	19503219	+	Splice_Site	SNP	C	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19503219C>G	uc003jgc.2	-	10	1890	c.1513_splice	c.e10-1	p.V505_splice	CDH18_uc003jgd.2_Splice_Site_p.V505_splice|CDH18_uc011cnm.1_Splice_Site_p.V505_splice	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TATGAATAACCTAAAGAAAAG	0.303																0.508197	104.326137	104.329736	31	30	KEEP	---	---	---	---	21	13	25	5	-1	capture	Splice_Site	SNP	19503219	19503219	CDH18	5	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	3074	177
CDH9	1007	broad.mit.edu	37	5	26881626	26881626	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26881626G>A	uc003jgs.1	-	12	2158	c.1989C>T	c.(1987-1989)GGC>GGT	p.G663G	CDH9_uc011cnv.1_Silent_p.G256G	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	663	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CTTCCCCGCCGCCTTCATCGT	0.438	Melanoma(8;187 585 15745 40864 52829)															0.417219	176.805859	177.706162	63	88	KEEP	---	---	---	---	29	44	45	54	-1	capture	Silent	SNP	26881626	26881626	CDH9	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3088	177
UGT3A2	167127	broad.mit.edu	37	5	36035988	36035988	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36035988C>T	uc003jjz.1	-	7	1477	c.1384G>A	c.(1384-1386)GTC>ATC	p.V462I	UGT3A2_uc011cos.1_Missense_Mutation_p.V428I|UGT3A2_uc011cot.1_Missense_Mutation_p.V160I	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	462	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTCTGGAGGACGTGGTCAATC	0.617																0.4	32.995608	33.257288	12	18	KEEP	---	---	---	---	4	9	7	12	-1	capture	Missense_Mutation	SNP	36035988	36035988	UGT3A2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16846	177
PCDHA7	56141	broad.mit.edu	37	5	140215418	140215418	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140215418G>A	uc003lhq.2	+	1	1450	c.1450G>A	c.(1450-1452)GCG>ACG	p.A484T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A484T	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	484	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGCGGACGCGCAGAAGAA	0.677	NSCLC(160;258 2013 5070 22440 28951)															0.457627	71.705815	71.79876	27	32	KEEP	---	---	---	---	17	14	15	22	-1	capture	Missense_Mutation	SNP	140215418	140215418	PCDHA7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11432	177
DRD1	1812	broad.mit.edu	37	5	174869392	174869392	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:174869392G>A	uc003mcz.2	-	2	1656	c.711C>T	c.(709-711)CAC>CAT	p.H237H		NM_000794	NP_000785	P21728	DRD1_HUMAN	dopamine receptor D1	237	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|adult walking behavior|cerebral cortex GABAergic interneuron migration|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|mating behavior|positive regulation of cAMP biosynthetic process|positive regulation of cell migration|positive regulation of potassium ion transport|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of synaptic transmission, glutamatergic|prepulse inhibition|response to drug|synapse assembly|visual learning	endoplasmic reticulum membrane|membrane fraction	protein binding			ovary(2)|skin(1)	3	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Carphenazine(DB01038)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Cocaine(DB00907)|Dopamine(DB00988)|Fenoldopam(DB00800)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methylergonovine(DB00353)|Minaprine(DB00805)|Olanzapine(DB00334)|Pegademase bovine(DB00061)|Pergolide(DB01186)|Perphenazine(DB00850)|Prochlorperazine(DB00433)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Triflupromazine(DB00508)|Zuclopenthixol(DB01624)	AATTCTTGGCGTGGACTGCTG	0.483																0.413793	107.505629	108.064035	36	51	KEEP	---	---	---	---	20	18	23	31	-1	capture	Silent	SNP	174869392	174869392	DRD1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4711	177
EEF1A1	1915	broad.mit.edu	37	6	74229088	74229088	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74229088A>G	uc003phi.2	-	2	333	c.296T>C	c.(295-297)ATC>ACC	p.I99T	EEF1A1_uc003phd.2_5'Flank|EEF1A1_uc003phe.2_Missense_Mutation_p.I99T|EEF1A1_uc003phf.2_Missense_Mutation_p.I99T|EEF1A1_uc003phg.2_Missense_Mutation_p.I99T|EEF1A1_uc003phh.2_Intron|EEF1A1_uc003phj.2_Missense_Mutation_p.I99T|EEF1A1_uc003phk.2_Missense_Mutation_p.I99T|EEF1A1_uc003phl.2_Intron|EEF1A1_uc003phm.1_Intron	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha	99						cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						CATGTTTTTGATAAAGTCTCT	0.408														OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.38843	152.279932	153.604357	47	74	KEEP	---	---	---	---	31	19	42	46	-1	capture	Missense_Mutation	SNP	74229088	74229088	EEF1A1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	4878	177
BACH2	60468	broad.mit.edu	37	6	90660866	90660866	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90660866G>A	uc011eab.1	-	7	1768	c.959C>T	c.(958-960)CCC>CTC	p.P320L	BACH2_uc003pnw.2_Missense_Mutation_p.P320L|BACH2_uc010kch.2_Missense_Mutation_p.P320L	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	320						nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		TGGGGCCGTGGGGGTAGGGGC	0.637																0.575	78.830673	79.026697	23	17	KEEP	---	---	---	---	14	10	8	11	-1	capture	Missense_Mutation	SNP	90660866	90660866	BACH2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	1273	177
FAM184A	79632	broad.mit.edu	37	6	119301415	119301415	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:119301415G>A	uc003pyj.2	-	10	2537	c.2189C>T	c.(2188-2190)ACG>ATG	p.T730M	FAM184A_uc003pyk.3_Missense_Mutation_p.T610M|FAM184A_uc003pyl.3_Missense_Mutation_p.T610M	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	730	Potential.									ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						AAGCTCTTGCGTAAGCCGCTG	0.423																0.483871	90.345113	90.359221	30	32	KEEP	---	---	---	---	16	16	16	18	-1	capture	Missense_Mutation	SNP	119301415	119301415	FAM184A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5463	177
TTYH3	80727	broad.mit.edu	37	7	2687687	2687687	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2687687G>T	uc003smp.2	+	5	908	c.721G>T	c.(721-723)GGG>TGG	p.G241W	TTYH3_uc010ksn.2_Intron|TTYH3_uc003smq.2_Missense_Mutation_p.G70W	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN	tweety 3	241	Helical; Name=4; (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CATCCTGGTGGGGTGAGTCTG	0.662																0.333333	75.6135	77.770266	29	58	KEEP	---	---	---	---	15	15	28	35	0.5	capture	Missense_Mutation	SNP	2687687	2687687	TTYH3	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	16623	177
AHR	196	broad.mit.edu	37	7	17379818	17379818	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:17379818C>T	uc011jxz.1	+	10	2982	c.2369C>T	c.(2368-2370)CCA>CTA	p.P790L	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	790					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					CAGTACAATCCAGTACTGCCA	0.443																0.037383	-17.592391	7.204226	4	103	KEEP	---	---	---	---	2	2	57	60	-1	capture	Missense_Mutation	SNP	17379818	17379818	AHR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	416	177
MGC26647	219557	broad.mit.edu	37	7	88423665	88423665	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:88423665C>T	uc003ujv.2	-	2	774	c.592G>A	c.(592-594)GAT>AAT	p.D198N	ZNF804B_uc011khi.1_Intron	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	hypothetical protein LOC219557	198											0	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		STAD - Stomach adenocarcinoma(171;0.229)			TGTAAGTTATCGCCTGGTCCT	0.423																0.344828	141.40149	144.53387	50	95	KEEP	---	---	---	---	31	21	48	54	-1	capture	Missense_Mutation	SNP	88423665	88423665	MGC26647	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9462	177
RELN	5649	broad.mit.edu	37	7	103205876	103205876	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103205876A>G	uc003vca.2	-	34	5219	c.5059T>C	c.(5059-5061)TCT>CCT	p.S1687P	RELN_uc010liz.2_Missense_Mutation_p.S1687P	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1687	BNR 7.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTGTTCAGAGAATACTGGAGC	0.473	NSCLC(146;835 1944 15585 22231 52158)															0.413793	41.395903	41.583873	12	17	KEEP	---	---	---	---	10	3	11	8	-1	capture	Missense_Mutation	SNP	103205876	103205876	RELN	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	13115	177
RELN	5649	broad.mit.edu	37	7	103338351	103338351	+	Silent	SNP	G	A	A	rs142192165		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103338351G>A	uc003vca.2	-	10	1252	c.1092C>T	c.(1090-1092)CTC>CTT	p.L364L	RELN_uc010liz.2_Silent_p.L364L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	364					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCACTGGGTCGAGACTATCTT	0.418	NSCLC(146;835 1944 15585 22231 52158)															0.288889	107.290783	112.672283	39	96	KEEP	---	---	---	---	18	25	37	63	-1	capture	Silent	SNP	103338351	103338351	RELN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	13115	177
CNTNAP2	26047	broad.mit.edu	37	7	146825899	146825899	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146825899A>G	uc003weu.1	+	7	1570	c.1054A>G	c.(1054-1056)AGA>GGA	p.R352G		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	352	Laminin G-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGATCTTGCCAGAAGGAAGAA	0.388													HNSCC(39;0.1)			0.262032	136.185727	145.769944	49	138	KEEP	---	---	---	---	22	34	77	78	-1	capture	Missense_Mutation	SNP	146825899	146825899	CNTNAP2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	3612	177
REPIN1	29803	broad.mit.edu	37	7	150069842	150069842	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150069842G>A	uc010lpq.1	+	4	2001	c.1512G>A	c.(1510-1512)TCG>TCA	p.S504S	REPIN1_uc003whd.2_Silent_p.S493S|REPIN1_uc010lpr.1_Silent_p.S561S|REPIN1_uc003whc.2_Silent_p.S504S|REPIN1_uc003whe.2_Silent_p.S504S	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	504	C2H2-type 13.				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			ACCTGGTGTCGCACCGGCGCA	0.667																0.4	50.812374	51.24107	20	30	KEEP	---	---	---	---	8	13	15	18	-1	capture	Silent	SNP	150069842	150069842	REPIN1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13122	177
TEX15	56154	broad.mit.edu	37	8	30701172	30701172	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30701172G>A	uc003xil.2	-	1	5362	c.5362C>T	c.(5362-5364)CGA>TGA	p.R1788*		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1788										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTAACCTGTCGTTTGTACTTT	0.343																0.489362	71.825624	71.830156	23	24	KEEP	---	---	---	---	14	12	12	12	-1	capture	Nonsense_Mutation	SNP	30701172	30701172	TEX15	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	15664	177
DPY19L4	286148	broad.mit.edu	37	8	95792643	95792643	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95792643G>A	uc003ygx.2	+	15	1756	c.1632G>A	c.(1630-1632)GAG>GAA	p.E544E		NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4	544						integral to membrane				ovary(2)	2	Breast(36;3.85e-06)					TATGGAAAGAGGtaaaaaaat	0.294																0.575	80.230515	80.426522	23	17	KEEP	---	---	---	---	14	10	13	5	-1	capture	Silent	SNP	95792643	95792643	DPY19L4	8	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	4698	177
HAS2	3037	broad.mit.edu	37	8	122641443	122641443	+	Silent	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:122641443A>G	uc003yph.2	-	2	676	c.138T>C	c.(136-138)TTT>TTC	p.F46F		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	46	Helical; Name=2; (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CATACAGTCCAAAAGAGAAAT	0.418																0.329114	166.021093	170.073892	52	106	KEEP	---	---	---	---	23	30	53	58	-1	capture	Silent	SNP	122641443	122641443	HAS2	8	A	G	G	G	1	0	0	0	0	0	0	0	1	63	5	3	3	6889	177
FAM75C1	441452	broad.mit.edu	37	9	90536465	90536465	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90536465C>T	uc010mqi.2	+	4	1672	c.1643C>T	c.(1642-1644)GCG>GTG	p.A548V	FAM75C1_uc004apq.3_Missense_Mutation_p.A531V	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						GTTCTGGGGGCGACCTCTGAG	0.512																0.49505	149.144068	149.146225	50	51	KEEP	---	---	---	---	21	33	32	36	-1	capture	Missense_Mutation	SNP	90536465	90536465	FAM75C1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5569	177
CTSL2	1515	broad.mit.edu	37	9	99799549	99799549	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99799549C>T	uc004awt.2	-	4	578	c.381G>A	c.(379-381)ACG>ACA	p.T127T	CTSL2_uc010msi.2_Silent_p.T127T|CTSL2_uc004awu.2_Silent_p.T72T|CTSL2_uc010msj.1_Silent_p.T72T|CTSL2_uc010msk.2_Silent_p.T72T	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein	127						lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				TCTTCACTGGCGTCACGTAGC	0.483					95											0.404255	52.330953	52.702024	19	28	KEEP	---	---	---	---	12	9	17	13	-1	capture	Silent	SNP	99799549	99799549	CTSL2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4000	177
C9orf98	158067	broad.mit.edu	37	9	135702390	135702390	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135702390C>T	uc004cbu.1	-	8	1164	c.608G>A	c.(607-609)CGT>CAT	p.R203H	C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_5'UTR	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98	203						cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		CACCATGAGACGGTTCTGGAT	0.517																0.401674	280.349563	282.368434	96	143	KEEP	---	---	---	---	45	57	80	87	-1	capture	Missense_Mutation	SNP	135702390	135702390	C9orf98	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2485	177
CACNA1B	774	broad.mit.edu	37	9	140881238	140881238	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140881238A>G	uc004cog.2	+	15	2051	c.1906A>G	c.(1906-1908)AAC>GAC	p.N636D	CACNA1B_uc011mfd.1_Missense_Mutation_p.N167D	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	636	Extracellular (Potential).|II.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CCTCAGGTTCAACTTCCAGGA	0.602																0.417722	184.550708	185.497241	66	92	KEEP	---	---	---	---	19	50	43	57	-1	capture	Missense_Mutation	SNP	140881238	140881238	CACNA1B	9	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	2515	177
ZRSR2	8233	broad.mit.edu	37	X	15841126	15841126	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15841126G>A	uc004cxg.3	+	11	1255	c.1210G>A	c.(1210-1212)GGG>AGG	p.G404R		NM_005089	NP_005080	Q15696	U2AFM_HUMAN	U2 small nuclear RNA auxiliary factor 1-like 2	404					spliceosome assembly	U12-type spliceosomal complex	nucleotide binding|pre-mRNA 3'-splice site binding|protein binding|zinc ion binding			breast(3)	3	Hepatocellular(33;0.183)					TCGTCACAGGGGGAAGAAATC	0.552	NSCLC(197;1631 3042 5741 31152)															0.357143	47.739717	48.48321	15	27	KEEP	---	---	---	---	6	9	8	22	-1	capture	Missense_Mutation	SNP	15841126	15841126	ZRSR2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	18101	177
FTHL17	53940	broad.mit.edu	37	X	31089936	31089936	+	Silent	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:31089936G>A	uc004dcl.1	-	1	238	c.135C>T	c.(133-135)GAC>GAT	p.D45D		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	45	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						GGGCCACGTCGTCCCGGTTGA	0.582																0.395833	106.317292	107.232019	38	58	KEEP	---	---	---	---	16	28	23	39	-1	capture	Silent	SNP	31089936	31089936	FTHL17	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6025	177
FAM155B	27112	broad.mit.edu	37	X	68725733	68725733	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:68725733C>T	uc004dxk.2	+	1	656	c.608C>T	c.(607-609)ACG>ATG	p.T203M		NM_015686	NP_056501	O75949	F155B_HUMAN	transmembrane protein 28	203						integral to membrane				ovary(1)|breast(1)	2						GACACCTACACGGTCTGGGAC	0.632																0.314815	42.624076	44.290893	17	37	KEEP	---	---	---	---	6	12	21	19	-1	capture	Missense_Mutation	SNP	68725733	68725733	FAM155B	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5420	177
AIFM1	9131	broad.mit.edu	37	X	129272643	129272643	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129272643G>A	uc004evg.2	-	9	1070	c.892C>T	c.(892-894)CGG>TGG	p.R298W	AIFM1_uc011mur.1_5'Flank|AIFM1_uc011mus.1_Missense_Mutation_p.R298W|AIFM1_uc004evh.2_Missense_Mutation_p.R294W|AIFM1_uc004evi.2_Intron|AIFM1_uc004evk.2_RNA	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1	298	FAD-dependent oxidoreductase (By similarity).				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5						TTGACTTCCCGTGAAATCTTC	0.433					210											0.355556	89.892391	91.538975	32	58	KEEP	---	---	---	---	14	22	30	36	-1	capture	Missense_Mutation	SNP	129272643	129272643	AIFM1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	426	177
GPR112	139378	broad.mit.edu	37	X	135431775	135431775	+	Silent	SNP	C	T	T			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135431775C>T	uc004ezu.1	+	6	6201	c.5910C>T	c.(5908-5910)GAC>GAT	p.D1970D	GPR112_uc010nsb.1_Silent_p.D1765D|GPR112_uc010nsc.1_Silent_p.D1737D	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1970	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CATTGGCTGACGTTAAGCACA	0.413				p.D1970D(DMS114-Tumor)	487											0.438356	194.394943	194.875075	64	82	KEEP	---	---	---	---	34	33	36	56	-1	capture	Silent	SNP	135431775	135431775	GPR112	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6563	177
SRPK3	26576	broad.mit.edu	37	X	153049211	153049211	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153049211C>A	uc004fil.2	+	9	811	c.779C>A	c.(778-780)ACC>AAC	p.T260N	SRPK3_uc004fik.2_Missense_Mutation_p.T326N|SRPK3_uc010nul.2_Missense_Mutation_p.T217N|SRPK3_uc004fin.2_Missense_Mutation_p.T259N|SRPK3_uc004fim.2_Missense_Mutation_p.T259N	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3	260	Protein kinase.				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TGACAGCAGACCGGTAAGCTG	0.622	Esophageal Squamous(167;766 3400 32156)				307											0.333333	29.609752	30.4237	11	22	KEEP	---	---	---	---	5	7	9	15	0.583333333333	capture	Missense_Mutation	SNP	153049211	153049211	SRPK3	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	15053	177
PTEN	5728	broad.mit.edu	37	10	89692810	89692810	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692810delA	uc001kfb.2	+	6	1325	c.294delA	c.(292-294)CTAfs	p.L98fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	98	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.H93fs*5(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CACCACAGCTAGAACTTATCA	0.358			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.75			52	17		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89692810	89692810	PTEN	10	A	-	-	-	1	0	1	0	1	0	0	0	0	184	15	5	5	12633	177
CCDC88A	55704	broad.mit.edu	37	2	55563820	55563821	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:55563820_55563821delTC	uc002ryv.2	-	14	2494_2495	c.1652_1653delGA	c.(1651-1653)AGAfs	p.R551fs	CCDC88A_uc010yoz.1_Frame_Shift_Del_p.R551fs|CCDC88A_uc010ypa.1_Frame_Shift_Del_p.R551fs|CCDC88A_uc010ypb.1_Frame_Shift_Del_p.R453fs|CCDC88A_uc002ryu.2_5'Flank|CCDC88A_uc002ryw.2_5'Flank	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	551	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TATGAACCTGTCTCTCTGAATT	0.262																0.28			17	43		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	55563820	55563821	CCDC88A	2	TC	-	-	-	1	0	1	0	1	0	0	0	0	751	58	5	5	2836	177
SMYD5	10322	broad.mit.edu	37	2	73453009	73453011	+	In_Frame_Del	DEL	GAG	-	-			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73453009_73453011delGAG	uc002siw.2	+	13	1221_1223	c.1192_1194delGAG	c.(1192-1194)GAGdel	p.E403del	SMYD5_uc010yre.1_In_Frame_Del_p.E287del|SMYD5_uc002six.1_RNA	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	403	Glu-rich.						metal ion binding				0						ggaagaggaagaggaggaggagg	0.468																0.41			28	40		---	---	---	---						capture_indel	In_Frame_Del	DEL	73453009	73453011	SMYD5	2	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	14717	177
SCARB2	950	broad.mit.edu	37	4	77102252	77102255	+	Splice_Site	DEL	TCCC	-	-	rs145870223		TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77102252_77102255delTCCC	uc003hju.1	-	3	615	c.276_splice	c.e3-1	p.R92_splice	SCARB2_uc011cbu.1_Intron	NM_005506	NP_005497	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2						cell adhesion|protein targeting to lysosome	integral to plasma membrane|lysosomal lumen|lysosomal membrane|membrane fraction	enzyme binding|receptor activity				0			Lung(101;0.196)			GTTTCTGAGTTCCCTAAAAGAAAG	0.319																0.32			19	41		---	---	---	---						capture_indel	Splice_Site	DEL	77102252	77102255	SCARB2	4	TCCC	-	-	-	1	0	1	0	1	0	0	1	0	806	62	5	5	13774	177
HUWE1	10075	broad.mit.edu	37	X	53591568	53591568	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-5959-01	TCGA-19-5959-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53591568delC	uc004dsp.2	-	51	7398	c.6996delG	c.(6994-6996)GGGfs	p.G2332fs	HUWE1_uc004dsn.2_Frame_Shift_Del_p.G1156fs	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2332	Glu-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CCTCAGGCTGCCCAGCAATCA	0.562																0.36			16	28		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	53591568	53591568	HUWE1	23	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	7386	177
