Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MAGOH	4116	broad.mit.edu	37	1	53692748	53692748	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53692748A>G	uc001cvf.1	-	5	498	c.410T>C	c.(409-411)ATT>ACT	p.I137T	MAGOH_uc010ont.1_Missense_Mutation_p.I100T	NM_002370	NP_002361	P61326	MGN_HUMAN	mago-nashi homolog	137					mRNA 3'-end processing|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|exon-exon junction complex|nuclear speck	protein binding|RNA binding				0						GTGTAATCCAATAAGACTGAA	0.378	Colon(150;521 2416 7674 18129)															0.034091	-12.649718	8.150015	3	85	KEEP	---	---	---	---	1	2	48	58	-1	capture	Missense_Mutation	SNP	53692748	53692748	MAGOH	1	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9108	186
VPS72	6944	broad.mit.edu	37	1	151149180	151149180	+	Silent	SNP	A	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151149180A>T	uc001exe.1	-	6	1078	c.1035T>A	c.(1033-1035)CCT>CCA	p.P345P	TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	345	Poly-Pro.|Pro-rich.				chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGGCTCAGGAGGTGGCGGGC	0.572	Pancreas(109;1131 2287 3209 24201)															0.384615	216.857788	219.915735	100	160	KEEP	---	---	---	---	63	50	77	96	-1	capture	Silent	SNP	151149180	151149180	VPS72	1	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	17099	186
YY1AP1	55249	broad.mit.edu	37	1	155646478	155646478	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155646478A>G	uc001fln.2	-	5	407	c.383T>C	c.(382-384)TTT>TCT	p.F128S	YY1AP1_uc010pgg.1_5'UTR|YY1AP1_uc010pgh.1_Missense_Mutation_p.F51S|YY1AP1_uc010pgi.1_Missense_Mutation_p.F200S|YY1AP1_uc001flh.2_Missense_Mutation_p.F200S|YY1AP1_uc009wqt.2_Missense_Mutation_p.F51S|YY1AP1_uc001flk.2_Missense_Mutation_p.F51S|YY1AP1_uc001fll.2_Missense_Mutation_p.F62S|YY1AP1_uc009wqv.2_5'UTR|YY1AP1_uc001flm.2_Missense_Mutation_p.F51S|YY1AP1_uc001fli.2_Missense_Mutation_p.F62S|YY1AP1_uc009wqu.2_5'UTR|YY1AP1_uc001flj.2_Missense_Mutation_p.F62S|YY1AP1_uc009wqw.2_Missense_Mutation_p.F51S|YY1AP1_uc001flo.2_5'UTR|YY1AP1_uc001flp.2_Missense_Mutation_p.F62S|YY1AP1_uc010pgj.1_Missense_Mutation_p.F128S|YY1AP1_uc009wqx.2_Missense_Mutation_p.F200S|YY1AP1_uc010pgk.1_Missense_Mutation_p.F200S	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	128					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CAGCTGTTCAAATAGTTCCTT	0.438																0.372951	306.2847	309.735607	91	153	KEEP	---	---	---	---	57	41	87	72	-1	capture	Missense_Mutation	SNP	155646478	155646478	YY1AP1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	17389	186
PEAR1	375033	broad.mit.edu	37	1	156875138	156875138	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156875138C>T	uc001fqj.1	+	4	345	c.229C>T	c.(229-231)CGT>TGT	p.R77C	PEAR1_uc009wsl.1_5'Flank|PEAR1_uc001fqk.1_5'Flank	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	77	EMI.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GACCGTGTACCGTCAGGTGGT	0.657																0.363636	44.285806	45.006497	16	28	KEEP	---	---	---	---	10	14	12	21	-1	capture	Missense_Mutation	SNP	156875138	156875138	PEAR1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11615	186
CD5L	922	broad.mit.edu	37	1	157804444	157804444	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157804444G>A	uc001frk.3	-	4	614	c.471C>T	c.(469-471)AAC>AAT	p.N157N		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	157	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TATACCACTGGTTCTGGTGCT	0.622																0.374429	202.67486	205.712355	82	137	KEEP	---	---	---	---	51	50	88	80	-1	capture	Silent	SNP	157804444	157804444	CD5L	1	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	2998	186
OR4C46	119749	broad.mit.edu	37	11	51516009	51516009	+	Missense_Mutation	SNP	C	T	T	rs137991158		TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:51516009C>T	uc010ric.1	+	1	728	c.728C>T	c.(727-729)ACG>ATG	p.T243M		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TCCCACATCACGGTTGTCATC	0.468																0.382222	201.959792	204.707794	86	139	KEEP	---	---	---	---	49	42	75	76	-1	capture	Missense_Mutation	SNP	51516009	51516009	OR4C46	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10955	186
LRRC23	10233	broad.mit.edu	37	12	7021983	7021983	+	Missense_Mutation	SNP	C	T	T	rs78482853	by1000genomes	TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7021983C>T	uc001qrt.3	+	7	1240	c.848C>T	c.(847-849)ACG>ATG	p.T283M	LRRC23_uc001qrp.2_Missense_Mutation_p.T283M|LRRC23_uc001qrq.2_Intron|LRRC23_uc001qrr.2_Missense_Mutation_p.T232M|LRRC23_uc001qrs.2_Intron|LRRC23_uc009zfh.2_Intron|ENO2_uc001qru.1_5'Flank|ENO2_uc009zfi.1_5'Flank|ENO2_uc010sfq.1_5'Flank|ENO2_uc001qrv.1_5'Flank	NM_001135217	NP_001128689	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23 isoform a	283	LRRCT.									ovary(1)	1						AACCCATGCACGGACGAAACC	0.602																0.366667	177.08501	180.379838	77	133	KEEP	---	---	---	---	35	47	63	77	-1	capture	Missense_Mutation	SNP	7021983	7021983	LRRC23	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8894	186
PTPN6	5777	broad.mit.edu	37	12	7061224	7061224	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7061224G>A	uc001qsb.2	+	3	452	c.210G>A	c.(208-210)GCG>GCA	p.A70A	PTPN6_uc001qsa.1_Silent_p.A72A|PTPN6_uc010sfr.1_Silent_p.A31A|PTPN6_uc009zfl.1_Silent_p.A70A|PTPN6_uc010sfs.1_Silent_p.A58A	NM_002831	NP_002822	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type	70	SH2 1.				apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity			breast(1)	1						AGAAGTTTGCGACTCTGACAG	0.587																0.41954	170.50253	171.493467	73	101	KEEP	---	---	---	---	30	48	52	59	-1	capture	Silent	SNP	7061224	7061224	PTPN6	12	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	12687	186
ADAMTS20	80070	broad.mit.edu	37	12	43823483	43823483	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43823483G>A	uc010skx.1	-	24	3426	c.3426C>T	c.(3424-3426)ACC>ACT	p.T1142T	ADAMTS20_uc001rno.1_Intron|ADAMTS20_uc001rnp.1_Silent_p.T296T	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1142						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTAATAAAGCGGTCTCAAGTT	0.338					2149											0.24	13.736175	15.27986	6	19	KEEP	---	---	---	---	3	3	10	14	-1	capture	Silent	SNP	43823483	43823483	ADAMTS20	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	266	186
GALNT4	8693	broad.mit.edu	37	12	89917757	89917757	+	Silent	SNP	G	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:89917757G>T	uc001tbd.2	-	1	779	c.570C>A	c.(568-570)ATC>ATA	p.I190I	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Silent_p.I187I|GALNT4_uc010suo.1_Intron	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	190	Lumenal (Potential).|Catalytic subdomain A.				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0						CAAGATTGCTGATGTAAGTTT	0.458														OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.491329	217.127116	217.139222	85	88	KEEP	---	---	---	---	48	41	42	52	0.539325842697	capture	Silent	SNP	89917757	89917757	GALNT4	12	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	6155	186
USP30	84749	broad.mit.edu	37	12	109495849	109495849	+	Silent	SNP	C	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109495849C>A	uc010sxi.1	+	3	416	c.312C>A	c.(310-312)TCC>TCA	p.S104S	USP30_uc001tnu.3_Silent_p.S73S	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	104	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						CCCAGTACTCCAGGGATCAGA	0.478																0.013314	-174.58558	8.321609	9	667	KEEP	---	---	---	---	6	6	391	387	0.5	capture	Silent	SNP	109495849	109495849	USP30	12	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	16943	186
CCDC60	160777	broad.mit.edu	37	12	119773039	119773039	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119773039C>T	uc001txe.2	+	1	523	c.58C>T	c.(58-60)CGG>TGG	p.R20W		NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	20										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGGGGCTGTCCGGCCCTTTTA	0.463																0.341317	145.710824	149.433118	57	110	KEEP	---	---	---	---	31	37	63	66	-1	capture	Missense_Mutation	SNP	119773039	119773039	CCDC60	12	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	2805	186
EXD1	161829	broad.mit.edu	37	15	41501708	41501708	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41501708G>A	uc001znk.2	-	5	542	c.351C>T	c.(349-351)TGC>TGT	p.C117C	EXD1_uc010ucv.1_Silent_p.C175C	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	117	3'-5' exonuclease.				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						CCTGCAGCCAGCACAGTTTGC	0.373																0.037037	-16.697482	8.38328	4	104	KEEP	---	---	---	---	2	2	57	56	-1	capture	Silent	SNP	41501708	41501708	EXD1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	5252	186
PKD1L2	114780	broad.mit.edu	37	16	81175094	81175094	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81175094C>G	uc002fgh.1	-	31	5225	c.5225G>C	c.(5224-5226)AGT>ACT	p.S1742T	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1742	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CCAGGGGCCACTCCGTGCCGC	0.582																0.217391	13.662073	15.355875	5	18	KEEP	---	---	---	---	2	5	9	11	-1	capture	Missense_Mutation	SNP	81175094	81175094	PKD1L2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	11868	186
AZI1	22994	broad.mit.edu	37	17	79164553	79164553	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79164553C>T	uc002jzp.1	-	24	3202	c.3002G>A	c.(3001-3003)CGC>CAC	p.R1001H	AZI1_uc002jzm.1_Missense_Mutation_p.R433H|AZI1_uc002jzn.1_Missense_Mutation_p.R998H|AZI1_uc002jzo.1_Missense_Mutation_p.R962H|AZI1_uc010wum.1_Missense_Mutation_p.R965H|AZI1_uc002jzq.2_Missense_Mutation_p.R149H	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	1001					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GAACTCCTGGCGGATCACCTG	0.692																0.222222	12.978273	15.538801	8	28	KEEP	---	---	---	---	6	4	17	15	-1	capture	Missense_Mutation	SNP	79164553	79164553	AZI1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1230	186
DSG4	147409	broad.mit.edu	37	18	28989414	28989414	+	Splice_Site	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28989414G>A	uc002kwq.2	+	13	2069	c.1934_splice	c.e13-1	p.L645_splice	DSG4_uc002kwr.2_Splice_Site_p.L645_splice	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein						homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTCTTGGGCAGTGGCTCCACT	0.498																0.414179	307.247136	308.977406	111	157	KEEP	---	---	---	---	70	56	104	91	-1	capture	Splice_Site	SNP	28989414	28989414	DSG4	18	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	4734	186
C18orf34	374864	broad.mit.edu	37	18	30950074	30950074	+	Silent	SNP	G	C	C			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:30950074G>C	uc002kxn.2	-	5	430	c.288C>G	c.(286-288)GTC>GTG	p.V96V	C18orf34_uc010xbr.1_Silent_p.V96V|C18orf34_uc010dmf.1_Silent_p.V96V|C18orf34_uc002kxo.2_Silent_p.V96V|C18orf34_uc002kxp.2_Silent_p.V96V	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	96										ovary(1)	1						TCATTTTGTTGACACAAGGTG	0.378																0.389937	225.820155	227.505872	62	97	KEEP	---	---	---	---	29	37	56	49	-1	capture	Silent	SNP	30950074	30950074	C18orf34	18	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	1886	186
SERPINB13	5275	broad.mit.edu	37	18	61262397	61262397	+	Silent	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61262397C>T	uc002ljc.2	+	7	918	c.750C>T	c.(748-750)AAC>AAT	p.N250N	SERPINB13_uc002ljd.2_Silent_p.N114N|SERPINB13_uc010xep.1_Silent_p.N259N|SERPINB13_uc010xeq.1_Silent_p.N71N|SERPINB13_uc010xer.1_Silent_p.N71N	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN	serine (or cysteine) proteinase inhibitor, clade	250					regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1						TTCTGCCCAACGACATCGATG	0.458																0.369176	235.994874	240.211791	103	176	KEEP	---	---	---	---	51	69	105	91	-1	capture	Silent	SNP	61262397	61262397	SERPINB13	18	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13993	186
TJP3	27134	broad.mit.edu	37	19	3728405	3728405	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3728405C>T	uc010xhv.1	+	1	32	c.32C>T	c.(31-33)CCC>CTC	p.P11L	TJP3_uc010xhs.1_Intron|TJP3_uc010xht.1_Intron|TJP3_uc010xhu.1_Intron|TJP3_uc010xhw.1_Missense_Mutation_p.P11L	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	Error:Variant_position_missing_in_O95049_after_alignment						tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCATCTTCCCCGCTCCCCTC	0.413																0.314607	73.764084	76.487893	28	61	KEEP	---	---	---	---	18	17	37	37	-1	capture	Missense_Mutation	SNP	3728405	3728405	TJP3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15816	186
CD70	970	broad.mit.edu	37	19	6586314	6586314	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6586314C>T	uc002mfi.2	-	3	449	c.299G>A	c.(298-300)CGT>CAT	p.R100H	CD70_uc010xjf.1_Missense_Mutation_p.R100H	NM_001252	NP_001243	P32970	CD70_HUMAN	tumor necrosis factor ligand superfamily, member	100	Extracellular (Potential).				cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to membrane of membrane fraction|integral to plasma membrane	cytokine activity|protease binding|tumor necrosis factor receptor binding				0						GATGCCATCACGATGGATACG	0.642	Pancreas(183;2617 2876 10173 34193)															0.268908	62.130149	67.881113	32	87	KEEP	---	---	---	---	17	17	41	51	-1	capture	Missense_Mutation	SNP	6586314	6586314	CD70	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3004	186
RETN	56729	broad.mit.edu	37	19	7734784	7734784	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7734784G>A	uc002mhf.1	+	3	242	c.196G>A	c.(196-198)GGC>AGC	p.G66S	RETN_uc002mhg.1_Missense_Mutation_p.G66S|RETN_uc010dvm.1_Intron	NM_020415	NP_065148	Q9HD89	RETN_HUMAN	resistin	66							hormone activity			ovary(1)	1						TTGCCCCCGAGGTGAGTGCAG	0.627																0.306818	72.089128	75.019222	27	61	KEEP	---	---	---	---	13	16	25	38	-1	capture	Missense_Mutation	SNP	7734784	7734784	RETN	19	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	13131	186
PODNL1	79883	broad.mit.edu	37	19	14046601	14046601	+	Missense_Mutation	SNP	C	T	T	rs147712582	byFrequency	TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14046601C>T	uc002mxr.2	-	5	722	c.448G>A	c.(448-450)GCG>ACG	p.A150T	PODNL1_uc010xni.1_Missense_Mutation_p.A68T|PODNL1_uc010xnj.1_Missense_Mutation_p.A148T|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101	Q6PEZ8	PONL1_HUMAN	podocan-like 1 isoform 1	150	Leu-rich.|LRR 4.					proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			GCCAGATCCGCGACACGGAGG	0.667																0.117647	3.010587	10.351092	6	45	KEEP	---	---	---	---	2	5	31	17	-1	capture	Missense_Mutation	SNP	14046601	14046601	PODNL1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12082	186
FCGBP	8857	broad.mit.edu	37	19	40395990	40395990	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40395990G>A	uc002omp.3	-	15	7415	c.7407C>T	c.(7405-7407)TTC>TTT	p.F2469F		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2469	VWFD 6.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCATGAAGTCGAAGCGGCGGC	0.672																0.100917	4.985971	39.668151	22	196	KEEP	---	---	---	---	14	18	132	145	-1	capture	Silent	SNP	40395990	40395990	FCGBP	19	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	5724	186
PRR12	57479	broad.mit.edu	37	19	50105110	50105110	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50105110G>A	uc002poo.3	+	6	4708	c.4708G>A	c.(4708-4710)GGA>AGA	p.G1570R		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	749							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CGAGAGTGGCGGAGAGGGCAT	0.647																0.411765	35.338808	35.570977	14	20	KEEP	---	---	---	---	3	13	15	21	-1	capture	Missense_Mutation	SNP	50105110	50105110	PRR12	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12480	186
MYT1L	23040	broad.mit.edu	37	2	1926965	1926965	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1926965G>A	uc002qxe.2	-	10	1403	c.576C>T	c.(574-576)GAC>GAT	p.D192D	MYT1L_uc002qxd.2_Silent_p.D192D|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	192					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TGTCATATTCGTCATTATTGT	0.368																0.408451	66.039191	66.564303	29	42	KEEP	---	---	---	---	15	18	24	21	-1	capture	Silent	SNP	1926965	1926965	MYT1L	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10017	186
XDH	7498	broad.mit.edu	37	2	31620554	31620554	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31620554C>A	uc002rnv.1	-	6	554	c.475G>T	c.(475-477)GGC>TGC	p.G159C		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	159					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GTCCGGAAGCCCTGGAGGATG	0.552	Colon(66;682 1445 30109 40147)															0.29703	180.389699	191.583736	90	213	KEEP	---	---	---	---	54	49	109	131	0.47572815534	capture	Missense_Mutation	SNP	31620554	31620554	XDH	2	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	17307	186
TMPRSS6	164656	broad.mit.edu	37	22	37482392	37482392	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37482392C>T	uc003aqs.1	-	8	1045	c.931G>A	c.(931-933)GTC>ATC	p.V311I	TMPRSS6_uc003aqt.1_Missense_Mutation_p.V302I|TMPRSS6_uc003aqu.2_Missense_Mutation_p.V302I	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	311	CUB 1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						TTCTTCCAGACGACCGCCATG	0.667																0.478261	23.795889	23.806438	11	12	KEEP	---	---	---	---	6	6	11	11	-1	capture	Missense_Mutation	SNP	37482392	37482392	TMPRSS6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16134	186
CHL1	10752	broad.mit.edu	37	3	440026	440026	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:440026A>T	uc003bou.2	+	24	3434	c.3163A>T	c.(3163-3165)AAT>TAT	p.N1055Y	CHL1_uc003bot.2_Missense_Mutation_p.N1071Y|CHL1_uc003bow.1_Missense_Mutation_p.N1055Y|CHL1_uc011asi.1_Intron	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	1055	Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TTGGGGCGATAATGATAGCAT	0.383					659											0.331429	132.791881	137.197662	58	117	KEEP	---	---	---	---	26	44	69	57	-1	capture	Missense_Mutation	SNP	440026	440026	CHL1	3	A	T	T	T	1	0	0	0	0	1	0	0	0	169	13	4	4	3314	186
FGD5	152273	broad.mit.edu	37	3	14861539	14861539	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14861539G>A	uc003bzc.2	+	1	1071	c.961G>A	c.(961-963)GCC>ACC	p.A321T	FGD5_uc011avk.1_Missense_Mutation_p.A321T	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	321	Glu-rich.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						GGATGAGTCCGCCGAGGAGAG	0.552																0.398148	96.376482	97.362791	43	65	KEEP	---	---	---	---	22	22	33	39	-1	capture	Missense_Mutation	SNP	14861539	14861539	FGD5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5782	186
VILL	50853	broad.mit.edu	37	3	38035909	38035909	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38035909A>G	uc003chj.2	+	4	579	c.293A>G	c.(292-294)CAG>CGG	p.Q98R	VILL_uc003chk.1_Missense_Mutation_p.Q98R|VILL_uc003chl.2_Missense_Mutation_p.Q98R|VILL_uc010hgu.2_5'UTR	NM_015873	NP_056957	O15195	VILL_HUMAN	villin-like protein	98					actin filament capping|cytoskeleton organization	actin cytoskeleton	actin binding|structural constituent of cytoskeleton				0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CGCGAGGCGCAGGGCCACGAG	0.721																0.068966	-1.633496	9.491066	4	54	KEEP	---	---	---	---	3	2	37	36	-1	capture	Missense_Mutation	SNP	38035909	38035909	VILL	3	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	17047	186
NPRL2	10641	broad.mit.edu	37	3	50385755	50385755	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50385755G>A	uc003daj.1	-	8	1210	c.807C>T	c.(805-807)ACC>ACT	p.T269T	ZMYND10_uc003dag.1_5'Flank|ZMYND10_uc010hll.1_5'Flank|ZMYND10_uc003dah.1_5'Flank|ZMYND10_uc010hlm.1_5'Flank|NPRL2_uc003dai.1_Silent_p.T149T|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN	tumor suppressor candidate 4	269					negative regulation of kinase activity		protein binding|protein kinase activity			lung(1)	1						TACCTTGCTTGGTCACGTAGG	0.577					248											0.359223	93.431374	95.234781	37	66	KEEP	---	---	---	---	20	19	39	33	-1	capture	Silent	SNP	50385755	50385755	NPRL2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	10504	186
STXBP5L	9515	broad.mit.edu	37	3	120833881	120833881	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120833881A>G	uc003eec.3	+	6	720	c.580A>G	c.(580-582)ATC>GTC	p.I194V	STXBP5L_uc011bji.1_Missense_Mutation_p.I194V	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	194	WD 3.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		TGGATATGTTATCATGTGGAA	0.318																0.349112	211.02312	214.39596	59	110	KEEP	---	---	---	---	27	39	55	70	-1	capture	Missense_Mutation	SNP	120833881	120833881	STXBP5L	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	15247	186
SI	6476	broad.mit.edu	37	3	164730787	164730787	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:164730787G>A	uc003fei.2	-	34	4105	c.4043C>T	c.(4042-4044)ACG>ATG	p.T1348M		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1348	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTCATCTTCCGTTAGAGTTTT	0.323													HNSCC(35;0.089)			0.32646	208.680484	216.478227	95	196	KEEP	---	---	---	---	47	61	121	108	-1	capture	Missense_Mutation	SNP	164730787	164730787	SI	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14190	186
DGKQ	1609	broad.mit.edu	37	4	956666	956666	+	Silent	SNP	C	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:956666C>A	uc003gbw.2	-	17	2003	c.1929G>T	c.(1927-1929)GTG>GTT	p.V643V	DGKQ_uc010ibn.2_Silent_p.V630V	NM_001347	NP_001338	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta	643	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding			kidney(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CGCCACCACACACCAGCACCC	0.682	Esophageal Squamous(17;537 645 4447 26373)															0.130435	4.407821	7.464862	3	20	KEEP	---	---	---	---	2	1	9	16	0.333333333333	capture	Silent	SNP	956666	956666	DGKQ	4	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	4431	186
PRKG2	5593	broad.mit.edu	37	4	82056416	82056416	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82056416C>T	uc003hmh.2	-	13	1683	c.1669G>A	c.(1669-1671)GTT>ATT	p.V557I	PRKG2_uc011ccf.1_Missense_Mutation_p.V137I|PRKG2_uc011ccg.1_Missense_Mutation_p.V137I|PRKG2_uc011cch.1_Missense_Mutation_p.V528I	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	557	Protein kinase.				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						ACACAAGCAACGCAGAATTTG	0.413				p.V557I(SNU466-Tumor)	728											0.359375	152.979886	156.339055	69	123	KEEP	---	---	---	---	37	38	68	68	-1	capture	Missense_Mutation	SNP	82056416	82056416	PRKG2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12419	186
FAT4	79633	broad.mit.edu	37	4	126372061	126372061	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:126372061G>A	uc003ifj.3	+	9	9890	c.9890G>A	c.(9889-9891)CGT>CAT	p.R3297H	FAT4_uc011cgp.1_Missense_Mutation_p.R1595H|FAT4_uc003ifi.1_Missense_Mutation_p.R775H	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3297	Cadherin 31.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TATGTGCCCCGTTTTGTTTCC	0.403																0.354651	137.994552	141.209736	61	111	KEEP	---	---	---	---	30	36	70	48	-1	capture	Missense_Mutation	SNP	126372061	126372061	FAT4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5638	186
DCHS2	54798	broad.mit.edu	37	4	155241880	155241880	+	Silent	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155241880C>T	uc003inw.2	-	14	3306	c.3306G>A	c.(3304-3306)ACG>ACA	p.T1102T		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1102	Cadherin 9.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAAATGGATTCGTGCCAGGGT	0.453																0.411111	446.819274	449.938782	185	265	KEEP	---	---	---	---	95	117	147	148	-1	capture	Silent	SNP	155241880	155241880	DCHS2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	4247	186
KIAA1430	57587	broad.mit.edu	37	4	186111564	186111564	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186111564T>C	uc003ixf.3	-	2	934	c.787A>G	c.(787-789)ATT>GTT	p.I263V	KIAA1430_uc003ixg.2_Missense_Mutation_p.I263V	NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587	263											0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		AGAGGGCTAATGTCTGGAGTT	0.398																0.444444	81.702369	81.845864	24	30	KEEP	---	---	---	---	13	12	17	15	-1	capture	Missense_Mutation	SNP	186111564	186111564	KIAA1430	4	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	8154	186
TUBB4Q	56604	broad.mit.edu	37	4	190904404	190904404	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:190904404T>C	uc011clg.1	-	4	579	c.576A>G	c.(574-576)ATA>ATG	p.I192M		NM_020040	NP_064424	Q99867	TBB4Q_HUMAN	tubulin, beta polypeptide 4, member Q	193					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;4.1e-31)|Epithelial(3;1.44e-30)|OV - Ovarian serous cystadenocarcinoma(60;2.03e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00839)|READ - Rectum adenocarcinoma(43;0.155)		CTGCGTTTTCTATGAGCTGGT	0.507																0.020134	-31.895991	6.55701	3	146	KEEP	---	---	---	---	3	0	138	119	-1	capture	Missense_Mutation	SNP	190904404	190904404	TUBB4Q	4	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	16641	186
CDH18	1016	broad.mit.edu	37	5	19544032	19544032	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19544032G>A	uc003jgc.2	-	8	1713	c.1336C>T	c.(1336-1338)CTC>TTC	p.L446F	CDH18_uc003jgd.2_Missense_Mutation_p.L446F|CDH18_uc011cnm.1_Missense_Mutation_p.L446F	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	446	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TCTCTGTCGAGAACCTTTGTA	0.363																0.410526	212.395954	213.729016	78	112	KEEP	---	---	---	---	38	49	62	60	-1	capture	Missense_Mutation	SNP	19544032	19544032	CDH18	5	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	3074	186
CDK7	1022	broad.mit.edu	37	5	68555711	68555711	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68555711G>A	uc003jvs.3	+	7	656	c.475G>A	c.(475-477)GCC>ACC	p.A159T	CDK7_uc003jvt.3_Missense_Mutation_p.A118T|CDK7_uc003jvu.3_Missense_Mutation_p.A66T	NM_001799	NP_001790	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	159	Protein kinase.				androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity			lung(1)	1		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		TTTTGGCCTGGCCAAATCTTT	0.388					197						NER					0.032258	-36.850386	7.60518	6	180	KEEP	---	---	---	---	5	1	87	102	-1	capture	Missense_Mutation	SNP	68555711	68555711	CDK7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3119	186
FAM13B	51306	broad.mit.edu	37	5	137275998	137275998	+	Silent	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137275998C>T	uc003lbz.2	-	23	3198	c.2664G>A	c.(2662-2664)GAG>GAA	p.E888E	FAM13B_uc003lcb.2_Silent_p.E764E|FAM13B_uc003lca.2_Silent_p.E860E|PKD2L2_uc003lbw.1_3'UTR|PKD2L2_uc003lbx.2_3'UTR|PKD2L2_uc003lby.2_Intron|PKD2L2_uc011cyi.1_3'UTR	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	888					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						ACTCTCTGTACTCCTCAAGCA	0.353																0.378205	161.270711	163.306899	59	97	KEEP	---	---	---	---	35	30	59	52	-1	capture	Silent	SNP	137275998	137275998	FAM13B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	5407	186
PREP	5550	broad.mit.edu	37	6	105800946	105800946	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:105800946C>T	uc003prc.2	-	7	927	c.724G>A	c.(724-726)GAT>AAT	p.D242N		NM_002726	NP_002717	P48147	PPCE_HUMAN	prolyl endopeptidase	242					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CGGCCATCATCAGATAACTAA	0.353																0.360714	224.314127	229.128755	101	179	KEEP	---	---	---	---	50	57	92	96	-1	capture	Missense_Mutation	SNP	105800946	105800946	PREP	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12370	186
SLC29A4	222962	broad.mit.edu	37	7	5340251	5340251	+	Silent	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5340251C>T	uc003sod.2	+	10	1569	c.1408C>T	c.(1408-1410)CTG>TTG	p.L470L	SLC29A4_uc003soc.2_Silent_p.L470L|SLC29A4_uc003soe.2_Silent_p.L456L|SLC29A4_uc010ksw.2_Intron	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	470	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		GCCCATGATCCTGGCGGCAGG	0.706																0.050562	-20.384587	17.735378	9	169	KEEP	---	---	---	---	8	17	75	104	-1	capture	Silent	SNP	5340251	5340251	SLC29A4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	14429	186
DNAH11	8701	broad.mit.edu	37	7	21641054	21641054	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21641054G>A	uc003svc.2	+	18	3497	c.3466G>A	c.(3466-3468)GGA>AGA	p.G1156R		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1156	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GACAGATTCCGGACTTCAGAG	0.343												Kartagener_syndrome				0.270588	106.385665	114.451819	46	124	KEEP	---	---	---	---	25	29	72	69	-1	capture	Missense_Mutation	SNP	21641054	21641054	DNAH11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4557	186
EGFR	1956	broad.mit.edu	37	7	55220278	55220278	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220278G>A	uc003tqk.2	+	6	914	c.668G>A	c.(667-669)TGC>TAC	p.C223Y	EGFR_uc003tqh.2_Missense_Mutation_p.C223Y|EGFR_uc003tqi.2_Missense_Mutation_p.C223Y|EGFR_uc003tqj.2_Missense_Mutation_p.C223Y|EGFR_uc010kzg.1_Missense_Mutation_p.C178Y|EGFR_uc011kco.1_Missense_Mutation_p.C170Y|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	223	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCCGGGCGCTGCCGTGGCAAG	0.602			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.02681	-163.399274	21.415035	20	726	KEEP	---	---	---	---	13	10	523	447	-1	capture	Missense_Mutation	SNP	55220278	55220278	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	186
EGFR	1956	broad.mit.edu	37	7	55238870	55238870	+	Missense_Mutation	SNP	G	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55238870G>T	uc003tqk.2	+	16	2129	c.1883G>T	c.(1882-1884)TGC>TTC	p.C628F	EGFR_uc010kzg.1_Missense_Mutation_p.C583F|EGFR_uc011kco.1_Missense_Mutation_p.C575F|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	628	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCCTACAGATGCACTGGGCCA	0.393			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.814422	2312.543374	2399.84632	768	175	KEEP	---	---	---	---	421	391	93	94	0.518472906404	capture	Missense_Mutation	SNP	55238870	55238870	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	4922	186
POM121C	100101267	broad.mit.edu	37	7	75068439	75068439	+	Silent	SNP	G	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75068439G>T	uc010lde.1	-	4	1017	c.1017C>A	c.(1015-1017)CCC>CCA	p.P339P	POM121C_uc003udk.3_Silent_p.P97P			A8CG34	P121C_HUMAN	Homo sapiens POM121-2 mRNA for nuclear pore membrane protein 121-2, partial cds.	339	Required for targeting to the nucleus and nuclear pore complex.|Pore side (Potential).|Ser-rich.				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						CAAAAGAAGCGGGGACTCCAC	0.468																0.013536	-149.212354	10.30036	8	583	KEEP	---	---	---	---	4	4	318	329	0.5	capture	Silent	SNP	75068439	75068439	POM121C	7	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	12142	186
MYOM2	9172	broad.mit.edu	37	8	2005570	2005570	+	Missense_Mutation	SNP	G	A	A	rs147661043		TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:2005570G>A	uc003wpx.3	+	4	506	c.368G>A	c.(367-369)CGC>CAC	p.R123H	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	123					muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCCCAGGCCCGCGACAAGCTG	0.617																0.382353	29.959654	30.374581	13	21	KEEP	---	---	---	---	8	5	10	13	-1	capture	Missense_Mutation	SNP	2005570	2005570	MYOM2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10002	186
CHRNB3	1142	broad.mit.edu	37	8	42587374	42587374	+	Silent	SNP	C	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42587374C>A	uc003xpi.1	+	5	1052	c.924C>A	c.(922-924)ACC>ACA	p.T308T		NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta	308	Helical; (Potential).				synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TTTTTGTGACCCTGTCCATCA	0.448																0.659193	381.170452	386.134383	147	76	KEEP	---	---	---	---	77	80	44	39	0.509554140127	capture	Silent	SNP	42587374	42587374	CHRNB3	8	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	3357	186
KCNV1	27012	broad.mit.edu	37	8	110984560	110984560	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110984560G>A	uc003ynr.3	-	2	1260	c.918C>T	c.(916-918)AAC>AAT	p.N306N	KCNV1_uc010mcw.2_Silent_p.N306N	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	306	Extracellular (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TGCGCCCCACGTTCTCCAGCT	0.532																0.336957	66.379595	68.551069	31	61	KEEP	---	---	---	---	20	14	33	31	-1	capture	Silent	SNP	110984560	110984560	KCNV1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8016	186
GCNT1	2650	broad.mit.edu	37	9	79117571	79117571	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79117571G>A	uc010mpf.2	+	3	615	c.274G>A	c.(274-276)GAC>AAC	p.D92N	GCNT1_uc010mpg.2_Missense_Mutation_p.D92N|GCNT1_uc010mph.2_Missense_Mutation_p.D92N|GCNT1_uc004akf.3_Missense_Mutation_p.D92N|GCNT1_uc010mpi.2_Missense_Mutation_p.D92N|GCNT1_uc004akh.3_Missense_Mutation_p.D92N	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	92	Lumenal (Potential).|Stem region (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						GACACCTGACGACTATATAAA	0.393																0.033333	-59.008724	12.328756	10	290	KEEP	---	---	---	---	3	10	153	171	-1	capture	Missense_Mutation	SNP	79117571	79117571	GCNT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6240	186
FAM47B	170062	broad.mit.edu	37	X	34962542	34962542	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34962542C>T	uc004ddi.1	+	1	1612	c.1594C>T	c.(1594-1596)CGC>TGC	p.R532C		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	532										ovary(3)|breast(1)	4						GGACAGGAGACGCCGGGCGGC	0.498																0.050314	-25.151305	9.163262	8	151	KEEP	---	---	---	---	5	3	91	70	-1	capture	Missense_Mutation	SNP	34962542	34962542	FAM47B	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5518	186
WNK3	65267	broad.mit.edu	37	X	54319681	54319681	+	Silent	SNP	T	C	C			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54319681T>C	uc004dtd.1	-	9	2212	c.1773A>G	c.(1771-1773)TCA>TCG	p.S591S	WNK3_uc004dtc.1_Silent_p.S591S	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	591					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TCGTTTGATTTGAGGAATAGG	0.398					290											0.345455	181.346392	184.816238	57	108	KEEP	---	---	---	---	27	37	57	66	-1	capture	Silent	SNP	54319681	54319681	WNK3	23	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	17260	186
LAS1L	81887	broad.mit.edu	37	X	64744052	64744052	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64744052G>A	uc004dwa.1	-	10	1256	c.1184C>T	c.(1183-1185)ACG>ATG	p.T395M	LAS1L_uc004dwc.1_Missense_Mutation_p.T378M|LAS1L_uc004dwd.1_Missense_Mutation_p.T336M	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	395						MLL1 complex|nucleolus	protein binding	p.T395T(1)		ovary(3)|large_intestine(1)	4						TAGGGCCTGCGTGAAGTTCTG	0.567																0.385714	61.081699	61.890953	27	43	KEEP	---	---	---	---	18	13	23	23	-1	capture	Missense_Mutation	SNP	64744052	64744052	LAS1L	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8556	186
BTK	695	broad.mit.edu	37	X	100611220	100611220	+	Silent	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100611220G>A	uc004ehg.2	-	15	1579	c.1386C>T	c.(1384-1386)GGC>GGT	p.G462G	BTK_uc004ehf.2_Intron|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_Intron|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Silent_p.G32G|BTK_uc010nnn.2_Intron|BTK_uc010nno.2_Silent_p.G496G|BTK_uc004ehh.1_Intron|BTK_uc004ehi.2_Silent_p.G462G	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	462	Protein kinase.		G -> D (in XLA).|G -> V (in XLA).		calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						TGGTGCAGACGCCATACAACT	0.522					247							Agammaglobulinemia_X-linked				0.358696	71.122688	72.75088	33	59	KEEP	---	---	---	---	20	15	30	35	-1	capture	Silent	SNP	100611220	100611220	BTK	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1545	186
SOX3	6658	broad.mit.edu	37	X	139586734	139586734	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:139586734C>G	uc004fbd.1	-	1	492	c.492G>C	c.(490-492)ATG>ATC	p.M164I		NM_005634	NP_005625	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	164	HMG box.				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding			pancreas(1)	1	Acute lymphoblastic leukemia(192;7.65e-05)					CAGAATTGTGCATCTTGGGGT	0.622																0.353333	172.729866	175.575314	53	97	KEEP	---	---	---	---	26	32	67	42	-1	capture	Missense_Mutation	SNP	139586734	139586734	SOX3	23	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	14843	186
PNMA5	114824	broad.mit.edu	37	X	152159506	152159506	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152159506G>A	uc010ntw.2	-	3	976	c.637C>T	c.(637-639)CGG>TGG	p.R213W	PNMA5_uc004fha.3_Missense_Mutation_p.R213W|PNMA5_uc010ntx.2_Missense_Mutation_p.R213W|PNMA5_uc004fgy.3_Missense_Mutation_p.R213W	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN	paraneoplastic antigen like 5	213					apoptosis					ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGAGCACCCGCATGATTGAC	0.527																0.334711	175.772829	181.637331	81	161	KEEP	---	---	---	---	35	52	94	86	-1	capture	Missense_Mutation	SNP	152159506	152159506	PNMA5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12059	186
F8	2157	broad.mit.edu	37	X	154185438	154185438	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154185438G>A	uc004fmt.2	-	11	1717	c.1546C>T	c.(1546-1548)CAT>TAT	p.H516Y		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	516	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCCTTCAAATGTTTTACACCT	0.378					359											0.419811	213.904911	215.099994	89	123	KEEP	---	---	---	---	43	55	62	69	-1	capture	Missense_Mutation	SNP	154185438	154185438	F8	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5304	186
RIC8B	55188	broad.mit.edu	37	12	107177813	107177814	+	Frame_Shift_Ins	INS	-	A	A			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107177813_107177814insA	uc001tlx.2	+	2	248_249	c.123_124insA	c.(121-126)GATAAAfs	p.D41fs	RIC8B_uc001tlw.2_Frame_Shift_Ins_p.D41fs|RIC8B_uc001tly.2_5'UTR|RIC8B_uc001tlz.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	41_42					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CAGATGAAGATAAAAGAAAGGT	0.351																0.32			63	137		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	107177813	107177814	RIC8B	12	-	A	A	A	1	0	1	1	0	0	0	0	0	634	49	5	5	13248	186
POLR2A	5430	broad.mit.edu	37	17	7417217	7417217	+	Frame_Shift_Del	DEL	T	-	-			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7417217delT	uc002ghf.3	+	29	5868	c.5634delT	c.(5632-5634)AGTfs	p.S1878fs		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1878	41.|52 X 7 AA approximate tandem repeats of Y-[ST]-P-[STQ]-[ST]-P-[SRTEVKGN].				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				CGCCTACCAGTcccacctatt	0.269																0.41			83	118		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7417217	7417217	POLR2A	17	T	-	-	-	1	0	1	0	1	0	0	0	0	751	58	5	5	12117	186
PIK3R1	5295	broad.mit.edu	37	5	67591247	67591249	+	Splice_Site	DEL	GGT	-	-			TCGA-26-5139-01	TCGA-26-5139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591247_67591249delGGT	uc003jva.2	+	14	2306	c.1746_splice	c.e14-1	p.M582_splice	PIK3R1_uc003jvb.2_Splice_Site_p.M582_splice|PIK3R1_uc003jvc.2_Splice_Site_p.M282_splice|PIK3R1_uc003jvd.2_Splice_Site_p.M312_splice|PIK3R1_uc003jve.2_Splice_Site_p.M261_splice|PIK3R1_uc011crb.1_Splice_Site_p.M252_splice	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.M582_D605>I(4)|p.?(3)|p.Y580fs*1(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CTGTTTTTCAGGTGGTTGACTCA	0.365					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.35			43	81		---	---	---	---						capture_indel	Splice_Site	DEL	67591247	67591249	PIK3R1	5	GGT	-	-	-	1	0	1	0	1	0	0	1	0	455	35	5	5	11821	186
