Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHB2	2048	broad.mit.edu	37	1	23111326	23111326	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23111326G>A	uc009vqj.1	+	3	713	c.568G>A	c.(568-570)GTG>ATG	p.V190M	EPHB2_uc001bge.2_Missense_Mutation_p.V190M|EPHB2_uc001bgf.2_Missense_Mutation_p.V190M|EPHB2_uc010odu.1_Missense_Mutation_p.V190M	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	190	Extracellular (Potential).|Cys-rich.				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CCTCATCGCCGTGCGTGTCTT	0.622					437							Hereditary_Prostate_Cancer				0.292683	29.618254	31.176323	12	29	KEEP	---	---	---	---	6	7	19	12	-1	capture	Missense_Mutation	SNP	23111326	23111326	EPHB2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5130	188
PTPRU	10076	broad.mit.edu	37	1	29606627	29606627	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29606627G>A	uc001bru.2	+	11	1952	c.1842G>A	c.(1840-1842)CCG>CCA	p.P614P	PTPRU_uc001brv.2_Silent_p.P614P|PTPRU_uc001brw.2_Silent_p.P614P|PTPRU_uc009vtq.2_Silent_p.P614P|PTPRU_uc009vtr.2_Silent_p.P614P	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	614	Extracellular (Potential).|Fibronectin type-III 4.				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TGCTGAGGCCGGCACAGGGCC	0.652				p.P614P(SIGM5-Tumor)	874											0.212121	35.118176	40.170429	14	52	KEEP	---	---	---	---	13	5	41	23	-1	capture	Silent	SNP	29606627	29606627	PTPRU	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12708	188
RPL5	6125	broad.mit.edu	37	1	93298990	93298990	+	Nonsense_Mutation	SNP	C	A	A	rs148673599	byFrequency	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93298990C>A	uc001doz.2	+	2	126	c.48C>A	c.(46-48)TAC>TAA	p.Y16*	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_5'UTR|RPL5_uc001dpd.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	16					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TTAAGAGATACCAAGTGAAAT	0.318																0.290909	44.77624	46.931303	16	39	KEEP	---	---	---	---	10	7	23	27	0.411764705882	capture	Nonsense_Mutation	SNP	93298990	93298990	RPL5	1	C	A	A	A	1	0	0	0	0	0	1	0	0	233	18	5	4	13489	188
SYCP1	6847	broad.mit.edu	37	1	115401212	115401212	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115401212G>A	uc001efr.2	+	6	545	c.336G>A	c.(334-336)GAG>GAA	p.E112E	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Silent_p.E112E|SYCP1_uc009wgw.2_Silent_p.E112E	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	112	Potential.				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTATAAGGAGGCTGAAAAGA	0.303																0.209877	42.654048	48.945217	17	64	KEEP	---	---	---	---	10	7	45	34	-1	capture	Silent	SNP	115401212	115401212	SYCP1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	15319	188
SPAG17	200162	broad.mit.edu	37	1	118524021	118524021	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118524021A>G	uc001ehk.2	-	43	5944	c.5876T>C	c.(5875-5877)TTC>TCC	p.F1959S		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1959						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATGTGGCTTGAAATCTAGAAA	0.338																0.170732	35.200735	43.605451	14	68	KEEP	---	---	---	---	8	10	40	38	-1	capture	Missense_Mutation	SNP	118524021	118524021	SPAG17	1	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	14871	188
CRP	1401	broad.mit.edu	37	1	159683681	159683681	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159683681C>A	uc001ftw.2	-	2	413	c.309G>T	c.(307-309)GAG>GAT	p.E103D	CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	103	Pentaxin.				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding	p.E103K(1)		ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	CTTCAGGAACCTCGAATAATA	0.468					63											0.283333	86.696157	91.757836	34	86	KEEP	---	---	---	---	16	18	40	53	0.529411764706	capture	Missense_Mutation	SNP	159683681	159683681	CRP	1	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	3860	188
UHMK1	127933	broad.mit.edu	37	1	162492275	162492275	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162492275G>C	uc001gcc.1	+	8	1331	c.1195G>C	c.(1195-1197)GTT>CTT	p.V399L	UHMK1_uc001gcb.1_Missense_Mutation_p.V325L|UHMK1_uc009wuu.1_3'UTR|uc001gcd.2_5'Flank	NM_175866	NP_787062	Q8TAS1	UHMK1_HUMAN	kinase interacting stathmin	399	RRM.				cell cycle arrest|neuron projection development|peptidyl-serine phosphorylation|positive regulation of translational initiation|protein autophosphorylation|regulation of protein export from nucleus	axon|dendrite cytoplasm|neuronal RNA granule|nucleus	protein binding|protein serine/threonine kinase activity|ribonucleoprotein binding|RNA binding				0	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGGGAAGTTTGTTGTGGCTAC	0.423					266											0.236842	52.711789	57.52143	18	58	KEEP	---	---	---	---	5	14	30	36	-1	capture	Missense_Mutation	SNP	162492275	162492275	UHMK1	1	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	16848	188
C1orf125	126859	broad.mit.edu	37	1	179399690	179399690	+	Missense_Mutation	SNP	A	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179399690A>C	uc001gmo.2	+	14	1563	c.1436A>C	c.(1435-1437)GAG>GCG	p.E479A	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Missense_Mutation_p.E267A|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.E479A	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	479	Potential.										0						TCTACAAGCGAGACACTGAAA	0.368																0.203125	30.133134	35.378259	13	51	KEEP	---	---	---	---	11	4	27	26	-1	capture	Missense_Mutation	SNP	179399690	179399690	C1orf125	1	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	1975	188
TDRD5	163589	broad.mit.edu	37	1	179620128	179620128	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179620128G>A	uc001gnf.1	+	12	2177	c.1927G>A	c.(1927-1929)GAA>AAA	p.E643K	TDRD5_uc010pnp.1_Missense_Mutation_p.E643K|TDRD5_uc001gnh.1_Missense_Mutation_p.E198K	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	643					DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						ATCCTCAAACGAAGATGTCTA	0.413																0.053191	-9.53	10.213162	5	89	KEEP	---	---	---	---	2	3	49	53	-1	capture	Missense_Mutation	SNP	179620128	179620128	TDRD5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15618	188
ITIH2	3698	broad.mit.edu	37	10	7759687	7759687	+	Missense_Mutation	SNP	G	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:7759687G>T	uc001ijs.2	+	6	728	c.566G>T	c.(565-567)AGG>ATG	p.R189M		NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide	189					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						GTGAAGTGGAGGAAGCTGGGC	0.522																0.381944	156.484274	158.246654	55	89	KEEP	---	---	---	---	24	38	58	48	0.387096774194	capture	Missense_Mutation	SNP	7759687	7759687	ITIH2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	7827	188
CTNNA3	29119	broad.mit.edu	37	10	68139038	68139038	+	Missense_Mutation	SNP	C	T	T	rs139378888	by1000genomes	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:68139038C>T	uc009xpn.1	-	12	1727	c.1604G>A	c.(1603-1605)CGT>CAT	p.R535H	CTNNA3_uc001jmw.2_Missense_Mutation_p.R535H	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	535					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ACCCGCAGCACGGTCTAAATT	0.458																0.45098	134.348635	134.559965	46	56	KEEP	---	---	---	---	25	24	35	34	-1	capture	Missense_Mutation	SNP	68139038	68139038	CTNNA3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3977	188
PTEN	5728	broad.mit.edu	37	10	89711915	89711915	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711915A>G	uc001kfb.2	+	7	1564	c.533A>G	c.(532-534)TAT>TGT	p.Y178C		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	178	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.Y178*(1)|p.G165_K342del(1)|p.Y177fs*1(1)|p.G165_*404del(1)|p.V175fs*3(1)|p.Y178fs*5(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTGTATTATTATAGCTACCTG	0.368			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.484848	226.400346	226.426385	64	68	KEEP	---	---	---	---	38	29	41	35	-1	capture	Missense_Mutation	SNP	89711915	89711915	PTEN	10	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	12633	188
IFIT2	3433	broad.mit.edu	37	10	91066921	91066921	+	Missense_Mutation	SNP	A	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:91066921A>T	uc009xts.2	+	2	1383	c.1208A>T	c.(1207-1209)CAG>CTG	p.Q403L	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron	NM_001547	NP_001538	P09913	IFIT2_HUMAN	interferon-induced protein with	403	TPR 6.				negative regulation of protein binding|response to virus|type I interferon-mediated signaling pathway		protein binding			ovary(1)|skin(1)	2		Colorectal(252;0.0161)				AAAATAAACCAGAAATCAAGG	0.398																0.453333	106.529098	106.672587	34	41	KEEP	---	---	---	---	17	18	18	26	-1	capture	Missense_Mutation	SNP	91066921	91066921	IFIT2	10	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	7448	188
SLC22A18	5002	broad.mit.edu	37	11	2939241	2939241	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2939241G>A	uc001lwx.2	+	7	897	c.679G>A	c.(679-681)GAC>AAC	p.D227N	SLC22A18_uc001lwy.2_Missense_Mutation_p.D227N|SLC22A18_uc001lwz.2_Missense_Mutation_p.D129N	NM_183233	NP_899056	Q96BI1	S22AI_HUMAN	tumor suppressing subtransferable candidate 5	227				D -> E (in Ref. 4; AAB82727 and 6; AAC23505).	excretion|organic cation transport	apical plasma membrane|cytoplasmic part|integral to membrane|nuclear envelope	drug:hydrogen antiporter activity|symporter activity|ubiquitin protein ligase binding			central_nervous_system(2)|ovary(1)	3		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		CAGTGTGTTCGACCTGAAGGC	0.672																0.103448	2.004859	6.54495	3	26	KEEP	---	---	---	---	1	2	16	15	-1	capture	Missense_Mutation	SNP	2939241	2939241	SLC22A18	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14342	188
OR4C13	283092	broad.mit.edu	37	11	49974296	49974296	+	Missense_Mutation	SNP	G	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:49974296G>T	uc010rhz.1	+	1	322	c.322G>T	c.(322-324)GTT>TTT	p.V108F		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						TTTCAGAGGTGTTGAGGTCAT	0.423																0.262411	98.019001	105.214725	37	104	KEEP	---	---	---	---	14	26	57	57	0.35	capture	Missense_Mutation	SNP	49974296	49974296	OR4C13	11	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10951	188
OR5L1	219437	broad.mit.edu	37	11	55579768	55579768	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55579768G>A	uc001nhw.1	+	1	826	c.826G>A	c.(826-828)GTG>ATG	p.V276M		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	276	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				AGTGGCCACCGTGTTCTACAC	0.458																0.222222	31.01435	35.488523	14	49	KEEP	---	---	---	---	6	8	20	34	-1	capture	Missense_Mutation	SNP	55579768	55579768	OR5L1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11074	188
OR5M9	390162	broad.mit.edu	37	11	56230082	56230082	+	Missense_Mutation	SNP	C	T	T	rs148447943	byFrequency	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56230082C>T	uc010rjj.1	-	1	796	c.796G>A	c.(796-798)GTA>ATA	p.V266I		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					CCCTGCTCTACGGATTCCTCA	0.468																0.277778	50.67192	53.86968	20	52	KEEP	---	---	---	---	10	11	28	28	-1	capture	Missense_Mutation	SNP	56230082	56230082	OR5M9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11081	188
CTTN	2017	broad.mit.edu	37	11	70266538	70266538	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70266538G>A	uc001opv.3	+	10	918	c.712G>A	c.(712-714)GTG>ATG	p.V238M	CTTN_uc001opu.2_Missense_Mutation_p.V238M|CTTN_uc001opw.3_Missense_Mutation_p.V238M|CTTN_uc010rqm.1_Translation_Start_Site|CTTN_uc001opx.2_5'Flank	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	238	Cortactin 5.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		AAAATTTGGTGTGCAGACAGA	0.458					187											0.272059	89.532397	95.893538	37	99	KEEP	---	---	---	---	15	27	49	63	-1	capture	Missense_Mutation	SNP	70266538	70266538	CTTN	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4005	188
APLP2	334	broad.mit.edu	37	11	129992408	129992408	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129992408G>A	uc010sby.1	+	6	1079	c.922G>A	c.(922-924)GCT>ACT	p.A308T	APLP2_uc001qfp.2_Missense_Mutation_p.A308T|APLP2_uc001qfq.2_Missense_Mutation_p.V308I|APLP2_uc010sbz.1_Missense_Mutation_p.V152I|APLP2_uc001qfr.2_Missense_Mutation_p.V130I|APLP2_uc001qfs.2_Intron|APLP2_uc001qfv.2_Missense_Mutation_p.V255I	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	308	BPTI/Kunitz inhibitor.|Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGATGTCAAAGGTAACCCCAT	0.443																0.264706	24.658685	26.360642	9	25	KEEP	---	---	---	---	4	5	10	18	-1	capture	Missense_Mutation	SNP	129992408	129992408	APLP2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	772	188
KRT79	338785	broad.mit.edu	37	12	53217702	53217702	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53217702A>G	uc001sbb.2	-	6	1148	c.1115T>C	c.(1114-1116)CTG>CCG	p.L372P	KRT79_uc001sba.2_Missense_Mutation_p.L143P	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	372	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						CTCCCCCTGCAGCCTCTGGAT	0.617																0.304348	41.731055	43.303113	14	32	KEEP	---	---	---	---	4	10	18	20	-1	capture	Missense_Mutation	SNP	53217702	53217702	KRT79	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	8412	188
PTPRB	5787	broad.mit.edu	37	12	70974843	70974843	+	Nonsense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70974843G>A	uc001swb.3	-	8	1927	c.1897C>T	c.(1897-1899)CGA>TGA	p.R633*	PTPRB_uc010sto.1_Nonsense_Mutation_p.R633*|PTPRB_uc010stp.1_Nonsense_Mutation_p.R543*|PTPRB_uc001swc.3_Nonsense_Mutation_p.R851*|PTPRB_uc001swa.3_Nonsense_Mutation_p.R851*|PTPRB_uc001swd.3_Nonsense_Mutation_p.R850*|PTPRB_uc009zrr.1_Nonsense_Mutation_p.R730*	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	633	Fibronectin type-III 7.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACCACTTGTCGGGAAGAGATC	0.468																0.239583	56.481891	62.421947	23	73	KEEP	---	---	---	---	14	10	41	37	-1	capture	Nonsense_Mutation	SNP	70974843	70974843	PTPRB	12	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	12691	188
ANO4	121601	broad.mit.edu	37	12	101493475	101493475	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101493475T>C	uc010svm.1	+	22	2698	c.2126T>C	c.(2125-2127)CTC>CCC	p.L709P	ANO4_uc001thw.2_Missense_Mutation_p.L674P|ANO4_uc001thx.2_Missense_Mutation_p.L709P|ANO4_uc001thy.2_Missense_Mutation_p.L229P	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	709	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GCCTATGGACTCTTCGATGAA	0.333													HNSCC(74;0.22)			0.206897	32.867969	37.48487	12	46	KEEP	---	---	---	---	2	10	24	30	-1	capture	Missense_Mutation	SNP	101493475	101493475	ANO4	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	693	188
RNF17	56163	broad.mit.edu	37	13	25373533	25373533	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25373533G>A	uc001upr.2	+	12	1441	c.1400G>A	c.(1399-1401)GGT>GAT	p.G467D	RNF17_uc010tdd.1_Missense_Mutation_p.G326D|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.G467D|RNF17_uc001ups.2_Missense_Mutation_p.G406D	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	467					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CATTATTTAGGTGCAAGAATA	0.328																0.139535	29.660047	45.85335	18	111	KEEP	---	---	---	---	7	14	60	68	-1	capture	Missense_Mutation	SNP	25373533	25373533	RNF17	13	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13353	188
BRCA2	675	broad.mit.edu	37	13	32913746	32913746	+	Missense_Mutation	SNP	C	A	A	rs80358749		TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32913746C>A	uc001uub.1	+	11	5481	c.5254C>A	c.(5254-5256)CAT>AAT	p.H1752N		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1752					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CTATTCCTACCATTCTGATGA	0.308	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)				677	D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			0.24	44.309976	48.939347	18	57	KEEP	---	---	---	---	8	13	35	29	0.619047619048	capture	Missense_Mutation	SNP	32913746	32913746	BRCA2	13	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	1487	188
TNFSF11	8600	broad.mit.edu	37	13	43175077	43175077	+	Silent	SNP	T	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:43175077T>A	uc001uyu.2	+	4	641	c.492T>A	c.(490-492)CCT>CCA	p.P164P	TNFSF11_uc001uyt.2_Silent_p.P91P	NM_003701	NP_003692	O14788	TNF11_HUMAN	tumor necrosis factor ligand superfamily, member	164	Extracellular (Potential).				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding				0		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)		AAGCTCAGCCTTTTGCTCATC	0.428					113											0.166667	29.535861	39.653189	16	80	KEEP	---	---	---	---	9	13	46	49	-1	capture	Silent	SNP	43175077	43175077	TNFSF11	13	T	A	A	A	1	0	0	0	0	0	0	0	1	717	56	4	4	16185	188
OR4M1	441670	broad.mit.edu	37	14	20249338	20249338	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20249338C>T	uc010tku.1	+	1	857	c.857C>T	c.(856-858)CCC>CTC	p.P286L		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	286	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTACTTAATCCCATTATTTAC	0.363																0.258065	42.569137	45.858778	16	46	KEEP	---	---	---	---	7	11	29	22	-1	capture	Missense_Mutation	SNP	20249338	20249338	OR4M1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10979	188
CHD8	57680	broad.mit.edu	37	14	21897227	21897227	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21897227G>C	uc001was.1	-	3	368	c.274C>G	c.(274-276)CAG>GAG	p.Q92E	CHD8_uc001war.1_5'UTR	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	371	Gln-rich.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTCACTGGCTGGGTGGAGGGT	0.547					886											0.192857	66.841304	79.172968	27	113	KEEP	---	---	---	---	18	14	78	58	-1	capture	Missense_Mutation	SNP	21897227	21897227	CHD8	14	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	3297	188
SLC35F4	341880	broad.mit.edu	37	14	58063582	58063582	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58063582G>C	uc001xdb.1	-	1	34	c.34C>G	c.(34-36)CTG>GTG	p.L12V	SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_5'UTR	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2						CCACTGGTCAGTTTGTGGAAG	0.428																0.133333	12.417384	18.289393	6	39	KEEP	---	---	---	---	4	4	20	24	-1	capture	Missense_Mutation	SNP	58063582	58063582	SLC35F4	14	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	14483	188
ATG2B	55102	broad.mit.edu	37	14	96779478	96779478	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96779478T>C	uc001yfi.2	-	25	4131	c.3766A>G	c.(3766-3768)ATC>GTC	p.I1256V		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1256										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGAGATCGGATTGGCAAATAA	0.348																0.2	47.3343	54.442333	17	68	KEEP	---	---	---	---	2	15	39	43	-1	capture	Missense_Mutation	SNP	96779478	96779478	ATG2B	14	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	1085	188
FAM81A	145773	broad.mit.edu	37	15	59752269	59752269	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59752269G>A	uc002agc.2	+	3	345	c.158G>A	c.(157-159)CGG>CAG	p.R53Q	FAM81A_uc010uha.1_Missense_Mutation_p.R53Q	NM_152450	NP_689663	Q8TBF8	FA81A_HUMAN	hypothetical protein LOC145773	53										ovary(1)	1						CACGCCTTTCGGATTAAAGAT	0.502																0.068966	-2.645169	8.49205	4	54	KEEP	---	---	---	---	1	4	27	27	-1	capture	Missense_Mutation	SNP	59752269	59752269	FAM81A	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5574	188
MAN2A2	4122	broad.mit.edu	37	15	91452684	91452684	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91452684T>C	uc010bnz.2	+	9	1439	c.1324T>C	c.(1324-1326)TAC>CAC	p.Y442H	MAN2A2_uc010boa.2_Missense_Mutation_p.Y484H|MAN2A2_uc002bqc.2_Missense_Mutation_p.Y442H|MAN2A2_uc010uql.1_Missense_Mutation_p.Y146H|MAN2A2_uc010uqm.1_Silent_p.T88T|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	442	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GTTCTTCAACTACCAACGGCT	0.567																0.279412	58.708344	61.675961	19	49	KEEP	---	---	---	---	14	8	30	26	-1	capture	Missense_Mutation	SNP	91452684	91452684	MAN2A2	15	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	9129	188
SPATA8	145946	broad.mit.edu	37	15	97326893	97326893	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:97326893C>T	uc002bue.2	+	1	218	c.8C>T	c.(7-9)CCG>CTG	p.P3L	uc010uro.1_5'Flank|uc010urp.1_5'Flank|uc002bud.1_5'Flank	NM_173499	NP_775770	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	3										ovary(1)|skin(1)	2	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			GGAATGGCCCCGGCTGGGATG	0.567																0.254902	34.251183	37.030615	13	38	KEEP	---	---	---	---	6	8	20	23	-1	capture	Missense_Mutation	SNP	97326893	97326893	SPATA8	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14907	188
PDILT	204474	broad.mit.edu	37	16	20373885	20373885	+	Missense_Mutation	SNP	C	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20373885C>G	uc002dhc.1	-	10	1480	c.1257G>C	c.(1255-1257)AAG>AAC	p.K419N		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	419	Thioredoxin.				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						GCATCTTGCACTTTTTAGACC	0.473																0.230769	41.056048	45.415118	15	50	KEEP	---	---	---	---	9	8	34	25	-1	capture	Missense_Mutation	SNP	20373885	20373885	PDILT	16	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	11577	188
ERN2	10595	broad.mit.edu	37	16	23712369	23712369	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23712369A>G	uc002dma.3	-	12	1583	c.1414T>C	c.(1414-1416)TCT>CCT	p.S472P	ERN2_uc010bxp.2_Intron|ERN2_uc010bxq.1_Missense_Mutation_p.S280P	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	424	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CCCAAGTAAGAGTCTGGAGTT	0.562					225											0.24	68.950407	75.119509	24	76	KEEP	---	---	---	---	13	14	50	36	-1	capture	Missense_Mutation	SNP	23712369	23712369	ERN2	16	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5193	188
PRKCB	5579	broad.mit.edu	37	16	24202548	24202548	+	Silent	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24202548A>G	uc002dmd.2	+	16	2057	c.1860A>G	c.(1858-1860)AAA>AAG	p.K620K	PRKCB_uc002dme.2_Silent_p.K620K	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	620	AGC-kinase C-terminal.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	ATAAGCCAAAAGCTGTAAGTA	0.473					395											0.026087	-22.068582	6.498424	3	112	KEEP	---	---	---	---	0	3	63	65	-1	capture	Silent	SNP	24202548	24202548	PRKCB	16	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	12404	188
LPCAT2	54947	broad.mit.edu	37	16	55543215	55543215	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55543215C>T	uc002eie.3	+	1	303	c.122C>T	c.(121-123)CCG>CTG	p.P41L		NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	41	Cytoplasmic (Potential).				cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						CCGCCGGTGCCGAACCCCTTC	0.726																0.388889	21.221793	21.416181	7	11	KEEP	---	---	---	---	2	6	6	8	-1	capture	Missense_Mutation	SNP	55543215	55543215	LPCAT2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8827	188
C16orf46	123775	broad.mit.edu	37	16	81095126	81095126	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81095126G>A	uc002fgc.3	-	4	1087	c.828C>T	c.(826-828)AAC>AAT	p.N276N	C16orf46_uc010chf.2_Silent_p.N276N|C16orf46_uc010vno.1_Silent_p.N3N	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2	276											0						ATGGCGTGTCGTTGACCATAG	0.552																0.087963	2.96892	40.052034	19	197	KEEP	---	---	---	---	13	16	111	119	-1	capture	Silent	SNP	81095126	81095126	C16orf46	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1801	188
KIAA0513	9764	broad.mit.edu	37	16	85120720	85120720	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:85120720G>A	uc002fiu.2	+	12	1354	c.1134G>A	c.(1132-1134)AAG>AAA	p.K378K	KIAA0513_uc010voj.1_Silent_p.K368K	NM_014732	NP_055547	O60268	K0513_HUMAN	hypothetical protein LOC9764	378						cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)		TGAACAAGAAGCTGTGCAATG	0.612														OREG0023994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.246154	42.593021	46.389507	16	49	KEEP	---	---	---	---	16	5	27	29	-1	capture	Silent	SNP	85120720	85120720	KIAA0513	16	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	8103	188
SENP3	26168	broad.mit.edu	37	17	7466491	7466491	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7466491G>A	uc002ghm.2	+	2	371	c.98G>A	c.(97-99)CGT>CAT	p.R33H	EIF4A1_uc002gho.1_5'Flank|SENP3_uc002ghn.1_5'Flank	NM_015670	NP_056485	Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific protease 3	33	Pro-rich.				proteolysis	MLL1 complex|nucleolus	cysteine-type peptidase activity			ovary(1)|central_nervous_system(1)	2		Prostate(122;0.157)				GAGCGTCTTCGTTGGCCCCCA	0.637																0.333333	21.291447	21.882138	8	16	KEEP	---	---	---	---	4	4	7	9	-1	capture	Missense_Mutation	SNP	7466491	7466491	SENP3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13941	188
ALOX15B	247	broad.mit.edu	37	17	7948185	7948185	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7948185G>A	uc002gju.2	+	6	831	c.715G>A	c.(715-717)GCC>ACC	p.A239T	ALOX15B_uc002gjv.2_Missense_Mutation_p.A239T|ALOX15B_uc002gjw.2_Missense_Mutation_p.A239T|ALOX15B_uc010vun.1_Missense_Mutation_p.A239T|ALOX15B_uc010cnp.2_Missense_Mutation_p.A45T	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	239	Lipoxygenase.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						CGCCTTCTTCGCCTCCCAGTT	0.607																0.232143	29.658518	33.330105	13	43	KEEP	---	---	---	---	6	7	30	22	-1	capture	Missense_Mutation	SNP	7948185	7948185	ALOX15B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	539	188
KRT24	192666	broad.mit.edu	37	17	38859417	38859417	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38859417C>T	uc002hvd.2	-	1	586	c.529G>A	c.(529-531)GAC>AAC	p.D177N		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	177	Linker 1.|Rod.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				CCATATTTGTCATACCACTCC	0.458	GBM(61;380 1051 14702 23642 31441)															0.251309	118.979899	129.73912	48	143	KEEP	---	---	---	---	27	29	96	69	-1	capture	Missense_Mutation	SNP	38859417	38859417	KRT24	17	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	8381	188
ABCA6	23460	broad.mit.edu	37	17	67079124	67079124	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67079124G>C	uc002jhw.1	-	36	4681	c.4506C>G	c.(4504-4506)AAC>AAG	p.N1502K		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	1502	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TGCCAAGTTTGTTTTTCAGGT	0.378																0.081481	12.862321	60.99484	22	248	KEEP	---	---	---	---	13	14	150	136	-1	capture	Missense_Mutation	SNP	67079124	67079124	ABCA6	17	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	36	188
ZNF236	7776	broad.mit.edu	37	18	74625839	74625839	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74625839G>A	uc002lmi.2	+	18	3238	c.3040G>A	c.(3040-3042)GAG>AAG	p.E1014K	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1014	C2H2-type 19.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CAAGTCCCACGAGAAGACACA	0.413																0.12766	16.080112	28.746907	12	82	KEEP	---	---	---	---	9	5	45	54	-1	capture	Missense_Mutation	SNP	74625839	74625839	ZNF236	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17669	188
PTPRS	5802	broad.mit.edu	37	19	5221104	5221104	+	Missense_Mutation	SNP	A	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5221104A>C	uc002mbv.2	-	20	3596	c.3362T>G	c.(3361-3363)CTG>CGG	p.L1121R	PTPRS_uc002mbu.1_Missense_Mutation_p.L690R|PTPRS_uc010xin.1_Missense_Mutation_p.L690R|PTPRS_uc002mbw.2_Missense_Mutation_p.L1099R|PTPRS_uc002mbx.2_Missense_Mutation_p.L694R|PTPRS_uc002mby.2_Missense_Mutation_p.L690R	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	1121	Extracellular (Potential).				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		GCCGTTGAGCAGGTTGAAGGC	0.622																0.188679	38.132161	47.754097	20	86	KEEP	---	---	---	---	12	9	64	37	-1	capture	Missense_Mutation	SNP	5221104	5221104	PTPRS	19	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	12706	188
KIAA1543	57662	broad.mit.edu	37	19	7676675	7676675	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7676675G>A	uc002mgv.3	+	11	1397	c.1296G>A	c.(1294-1296)TCG>TCA	p.S432S	KIAA1543_uc002mgu.3_Silent_p.S459S|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	432					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CTGTGAGCTCGGACAGCCTGG	0.687																0.230769	7.420289	8.282372	3	10	KEEP	---	---	---	---	3	0	7	3	-1	capture	Silent	SNP	7676675	7676675	KIAA1543	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8165	188
ZNF99	7652	broad.mit.edu	37	19	22940690	22940690	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22940690T>C	uc010xrh.1	-	5	1748	c.1748A>G	c.(1747-1749)GAG>GGG	p.E583G		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTAGGGTTTCTCTTCAGTATG	0.358																0.191781	37.307319	43.784492	14	59	KEEP	---	---	---	---	7	8	35	28	-1	capture	Missense_Mutation	SNP	22940690	22940690	ZNF99	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	18080	188
SFRS16	11129	broad.mit.edu	37	19	45561033	45561033	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45561033G>A	uc002pak.2	+	7	588	c.490G>A	c.(490-492)GGT>AGT	p.G164S	SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Missense_Mutation_p.G102S|SFRS16_uc002pam.2_Missense_Mutation_p.G164S|SFRS16_uc002pan.1_RNA	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16	164					mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGCTTCCATCGGTTATACCTA	0.592																0.2	43.316458	51.728464	20	80	KEEP	---	---	---	---	9	14	49	39	-1	capture	Missense_Mutation	SNP	45561033	45561033	SFRS16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14065	188
ZNF347	84671	broad.mit.edu	37	19	53645135	53645135	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53645135G>A	uc002qbb.1	-	5	1015	c.946C>T	c.(946-948)CGT>TGT	p.R316C	ZNF347_uc010eql.1_Missense_Mutation_p.R317C|ZNF347_uc002qbc.1_Missense_Mutation_p.R317C	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	316					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		CATTTGTAACGTTTTTCGCCA	0.373	Melanoma(64;205 1597 17324 45721)															0.246269	77.112433	84.966294	33	101	KEEP	---	---	---	---	21	16	57	58	-1	capture	Missense_Mutation	SNP	53645135	53645135	ZNF347	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17741	188
LILRA4	23547	broad.mit.edu	37	19	54850352	54850352	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54850352G>C	uc002qfj.2	-	1	70	c.13C>G	c.(13-15)CTC>GTC	p.L5V	LILRA4_uc002qfi.2_5'UTR	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	5						integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		AGGCTTGTGAGAATGAGGGTC	0.567																0.177419	27.685632	33.762358	11	51	KEEP	---	---	---	---	4	9	35	26	-1	capture	Missense_Mutation	SNP	54850352	54850352	LILRA4	19	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	8707	188
EHD3	30845	broad.mit.edu	37	2	31483756	31483756	+	Missense_Mutation	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31483756A>G	uc002rnu.2	+	4	1491	c.883A>G	c.(883-885)AAC>GAC	p.N295D	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	295					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					GCGCAAGCTCAACGACCTCAT	0.622																0.246154	43.57304	47.383025	16	49	KEEP	---	---	---	---	8	11	26	30	-1	capture	Missense_Mutation	SNP	31483756	31483756	EHD3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	4934	188
RAB11FIP5	26056	broad.mit.edu	37	2	73316366	73316366	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73316366C>T	uc002siu.3	-	2	750	c.509G>A	c.(508-510)CGC>CAC	p.R170H	RAB11FIP5_uc002sit.3_Missense_Mutation_p.R92H	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	170					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						CAGGTTGTTGCGCGTGAACTG	0.532																0.016529	-87.765029	8.133048	6	357	KEEP	---	---	---	---	4	2	223	202	-1	capture	Missense_Mutation	SNP	73316366	73316366	RAB11FIP5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12792	188
NCAPH	23397	broad.mit.edu	37	2	97035182	97035182	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97035182C>A	uc002svz.1	+	17	2194	c.2110C>A	c.(2110-2112)CAG>AAG	p.Q704K	NCAPH_uc010yum.1_Missense_Mutation_p.Q680K|NCAPH_uc010fhw.1_Missense_Mutation_p.Q693K|NCAPH_uc010yun.1_Missense_Mutation_p.Q568K|NCAPH_uc002swa.1_Missense_Mutation_p.Q299K	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	704					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				TGTCATGGCTCAGAACCTCTC	0.438																0.12234	27.817779	54.052293	23	165	KEEP	---	---	---	---	14	13	87	106	0.481481481481	capture	Missense_Mutation	SNP	97035182	97035182	NCAPH	2	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	10116	188
SP3	6670	broad.mit.edu	37	2	174783399	174783399	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174783399C>T	uc002uig.2	-	5	1918	c.1754G>A	c.(1753-1755)GGG>GAG	p.G585E	SP3_uc002uie.2_Missense_Mutation_p.G517E|SP3_uc002uif.2_Missense_Mutation_p.G532E|SP3_uc010zel.1_Missense_Mutation_p.G582E	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	585	Repressor domain.				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TTGTTGGTCCCCTTCTTCATC	0.448																0.245614	109.499859	119.554002	42	129	KEEP	---	---	---	---	17	29	71	77	-1	capture	Missense_Mutation	SNP	174783399	174783399	SP3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	14857	188
TTN	7273	broad.mit.edu	37	2	179483009	179483009	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179483009C>A	uc010zfg.1	-	201	39696	c.39472G>T	c.(39472-39474)GTT>TTT	p.V13158F	TTN_uc010zfh.1_Missense_Mutation_p.V6853F|TTN_uc010zfi.1_Missense_Mutation_p.V6786F|TTN_uc010zfj.1_Missense_Mutation_p.V6661F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14085							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGTACTCAACTCCTCCTTTC	0.458					8722											0.238095	109.271856	121.124956	45	144	KEEP	---	---	---	---	20	26	83	72	0.565217391304	capture	Missense_Mutation	SNP	179483009	179483009	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	16617	188
TTN	7273	broad.mit.edu	37	2	179650718	179650718	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179650718C>T	uc010zfg.1	-	14	2451	c.2227G>A	c.(2227-2229)GCC>ACC	p.A743T	TTN_uc010zfh.1_Missense_Mutation_p.A697T|TTN_uc010zfi.1_Missense_Mutation_p.A697T|TTN_uc010zfj.1_Missense_Mutation_p.A697T|TTN_uc002unb.2_Missense_Mutation_p.A743T|TTN_uc010frg.1_Missense_Mutation_p.A325T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	743							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTTGCGGCGGAAATGCGT	0.547				p.A743T(YD8-Tumor)	8722											0.237288	31.424832	35.145275	14	45	KEEP	---	---	---	---	6	9	27	24	-1	capture	Missense_Mutation	SNP	179650718	179650718	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16617	188
THAP4	51078	broad.mit.edu	37	2	242576398	242576398	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242576398T>C	uc002wbt.2	-	1	258	c.35A>G	c.(34-36)AAC>AGC	p.N12S	ATG4B_uc002wbu.2_5'Flank|ATG4B_uc002wbv.2_5'Flank|ATG4B_uc002wbw.2_5'Flank|ATG4B_uc010zox.1_5'Flank|ATG4B_uc010zoy.1_5'Flank|ATG4B_uc010fzp.2_5'Flank	NM_015963	NP_057047	Q8WY91	THAP4_HUMAN	THAP domain containing 4 isoform 1	12	THAP-type.						DNA binding|metal ion binding				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		TCCCTGCCGGTTGGAGCAGTT	0.418																0.222222	6.04626	6.684214	2	7	KEEP	---	---	---	---	0	2	1	9	-1	capture	Missense_Mutation	SNP	242576398	242576398	THAP4	2	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	15731	188
REM1	28954	broad.mit.edu	37	20	30065686	30065686	+	Silent	SNP	C	T	T	rs147559982		TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30065686C>T	uc002wwa.2	+	3	680	c.396C>T	c.(394-396)GTC>GTT	p.V132V		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	132					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CACTGGTGGTCGTGGACACCT	0.572					265											0.181818	11.931883	15.069354	6	27	KEEP	---	---	---	---	2	6	14	17	-1	capture	Silent	SNP	30065686	30065686	REM1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	13117	188
ITGA9	3680	broad.mit.edu	37	3	37583996	37583996	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37583996G>A	uc003chd.2	+	15	1662	c.1609G>A	c.(1609-1611)GAG>AAG	p.E537K	ITGA9_uc003chc.2_Missense_Mutation_p.E537K	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	537	Extracellular (Potential).				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GCTGCTGGGAGAGACCATGGG	0.527																0.209877	41.128394	47.438566	17	64	KEEP	---	---	---	---	10	9	36	34	-1	capture	Missense_Mutation	SNP	37583996	37583996	ITGA9	3	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	7806	188
SCN10A	6336	broad.mit.edu	37	3	38835414	38835414	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38835414C>T	uc003ciq.2	-	1	88	c.88G>A	c.(88-90)GCC>ACC	p.A30T		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	30					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	CCCTGCTTGGCAGCAATTTGC	0.507																0.27673	106.635286	113.768926	44	115	KEEP	---	---	---	---	27	24	58	68	-1	capture	Missense_Mutation	SNP	38835414	38835414	SCN10A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	13805	188
EPHA3	2042	broad.mit.edu	37	3	89259060	89259060	+	Nonsense_Mutation	SNP	C	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:89259060C>G	uc003dqy.2	+	3	429	c.204C>G	c.(202-204)TAC>TAG	p.Y68*	EPHA3_uc003dqx.1_Nonsense_Mutation_p.Y68*|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	68	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCAGGACTTACCAGGTGTGCA	0.438					416								TSP Lung(6;0.00050)			0.245902	46.89491	50.480477	15	46	KEEP	---	---	---	---	9	11	29	26	-1	capture	Nonsense_Mutation	SNP	89259060	89259060	EPHA3	3	C	G	G	G	1	0	0	0	0	0	1	0	0	233	18	5	4	5123	188
OR5H1	26341	broad.mit.edu	37	3	97852369	97852369	+	Silent	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97852369A>G	uc011bgt.1	+	1	828	c.828A>G	c.(826-828)CTA>CTG	p.L276L		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	276	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TGGAGCCTCTATTCTACACTG	0.388																0.267606	119.607331	126.517803	38	104	KEEP	---	---	---	---	19	25	57	58	-1	capture	Silent	SNP	97852369	97852369	OR5H1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	11063	188
PARP9	83666	broad.mit.edu	37	3	122271392	122271392	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122271392G>A	uc010hri.2	-	5	1230	c.1085C>T	c.(1084-1086)TCG>TTG	p.S362L	PARP9_uc003eff.3_Missense_Mutation_p.S327L|PARP9_uc011bjs.1_Missense_Mutation_p.S327L|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Missense_Mutation_p.S327L|PARP9_uc003efh.2_Missense_Mutation_p.S362L|PARP9_uc003efj.2_Missense_Mutation_p.S327L	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	362	Macro 2.				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		AAGAAATTCCGATTTCATTTC	0.373					175											0.141026	17.143839	26.783755	11	67	KEEP	---	---	---	---	4	7	39	38	-1	capture	Missense_Mutation	SNP	122271392	122271392	PARP9	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11369	188
CPNE4	131034	broad.mit.edu	37	3	131261494	131261494	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:131261494C>T	uc003eok.2	-	15	1881	c.1446G>A	c.(1444-1446)ATG>ATA	p.M482I	CPNE4_uc011blq.1_Missense_Mutation_p.M500I|CPNE4_uc003eol.2_Missense_Mutation_p.M500I|CPNE4_uc003eom.2_Missense_Mutation_p.M482I|CPNE4_uc003eoj.2_Missense_Mutation_p.M33I	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV	482	VWFA.									upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CACCGTCCAGCATCTGCATGT	0.557																0.198276	43.514033	53.409277	23	93	KEEP	---	---	---	---	14	12	51	52	-1	capture	Missense_Mutation	SNP	131261494	131261494	CPNE4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	3779	188
ALG3	10195	broad.mit.edu	37	3	183961666	183961666	+	Missense_Mutation	SNP	G	A	A	rs2233466	by1000genomes	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183961666G>A	uc003fne.2	-	6	876	c.845C>T	c.(844-846)GCG>GTG	p.A282V	ALG3_uc011brc.1_Missense_Mutation_p.A247V|ALG3_uc011brd.1_Missense_Mutation_p.A226V|ALG3_uc011bre.1_Missense_Mutation_p.A234V|ALG3_uc003fnf.1_Missense_Mutation_p.A242V	NM_005787	NP_005778	Q92685	ALG3_HUMAN	alpha-1,3-mannosyltransferase ALG3 isoform a	282					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity				0	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGGAAGAGCGCCTCTGGGAG	0.612																0.133333	7.01611	12.897425	6	39	KEEP	---	---	---	---	2	4	25	20	-1	capture	Missense_Mutation	SNP	183961666	183961666	ALG3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	520	188
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																0.4	20.857842	20.985487	6	9	KEEP	---	---	---	---	3	3	9	5	-1	capture	Missense_Mutation	SNP	195505836	195505836	MUC4	3	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	9888	188
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448	Melanoma(133;755 1763 25578 26334 46021)															0.073446	-25.002126	8.802985	13	164	KEEP	---	---	---	---	7	6	89	97	0.461538461538	capture	Missense_Mutation	SNP	69870669	69870669	UGT2B10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	16838	188
CDKL2	8999	broad.mit.edu	37	4	76522320	76522320	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76522320T>C	uc003hiq.2	-	9	1646	c.1121A>G	c.(1120-1122)AAT>AGT	p.N374S	CDKL2_uc011cbp.1_Missense_Mutation_p.N374S	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2	374					sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ACAGCTGGCATTTGAAGCTCT	0.393					284											0.284483	101.909967	106.759485	33	83	KEEP	---	---	---	---	19	15	45	40	-1	capture	Missense_Mutation	SNP	76522320	76522320	CDKL2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	3124	188
THAP9	79725	broad.mit.edu	37	4	83825996	83825996	+	Missense_Mutation	SNP	C	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:83825996C>G	uc003hnt.2	+	2	307	c.188C>G	c.(187-189)TCC>TGC	p.S63C	THAP9_uc003hns.1_5'UTR|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_5'UTR	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	63	THAP-type.						DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				ATACTGTGTTCCAAACATTTT	0.403																0.040816	-11.879485	10.257345	4	94	KEEP	---	---	---	---	2	3	42	60	-1	capture	Missense_Mutation	SNP	83825996	83825996	THAP9	4	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15736	188
DDX60L	91351	broad.mit.edu	37	4	169279395	169279395	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:169279395C>T	uc003irq.3	-	38	5245	c.5024G>A	c.(5023-5025)CGT>CAT	p.R1675H		NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1675							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TACATTGTCACGCTTATTTTC	0.264																0.297297	28.812454	30.170691	11	26	KEEP	---	---	---	---	5	6	12	15	-1	capture	Missense_Mutation	SNP	169279395	169279395	DDX60L	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4337	188
MYO10	4651	broad.mit.edu	37	5	16877810	16877810	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:16877810G>A	uc003jft.3	-	2	496	c.28C>T	c.(28-30)CGG>TGG	p.R10W	MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Missense_Mutation_p.R10W	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	10	Myosin head-like.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						AGCCAGACCCGTGTTCCCTGT	0.438																0.342857	31.176035	31.94577	12	23	KEEP	---	---	---	---	5	9	14	12	-1	capture	Missense_Mutation	SNP	16877810	16877810	MYO10	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9972	188
PARP8	79668	broad.mit.edu	37	5	50091080	50091080	+	Silent	SNP	A	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:50091080A>G	uc003jon.3	+	13	1439	c.1257A>G	c.(1255-1257)GAA>GAG	p.E419E	PARP8_uc011cpz.1_Silent_p.E311E|PARP8_uc003joo.2_Silent_p.E419E|PARP8_uc003jop.2_Silent_p.E419E	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	419						intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GAATGGAAGAATTATATGGAC	0.438																0.275862	50.412561	53.012518	16	42	KEEP	---	---	---	---	9	7	27	18	-1	capture	Silent	SNP	50091080	50091080	PARP8	5	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	11368	188
DDX4	54514	broad.mit.edu	37	5	55083703	55083703	+	Silent	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55083703T>C	uc003jqg.3	+	15	1121	c.1047T>C	c.(1045-1047)CAT>CAC	p.H349H	DDX4_uc010ivz.2_Silent_p.H329H|DDX4_uc003jqh.3_Silent_p.H315H|DDX4_uc003jqj.2_Silent_p.H200H	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform	349	Helicase ATP-binding.				multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTTGGCTCATATGATGCATG	0.383																0.066667	-2.610776	14.897093	6	84	KEEP	---	---	---	---	0	7	46	49	-1	capture	Silent	SNP	55083703	55083703	DDX4	5	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	4318	188
MAST4	375449	broad.mit.edu	37	5	66460727	66460727	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:66460727C>A	uc003jut.1	+	28	5221	c.5153C>A	c.(5152-5154)GCC>GAC	p.A1718D	MAST4_uc003juw.2_Missense_Mutation_p.A1646D|MAST4_uc003jux.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	1910						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CATCCTACTGCCAGGAGCCCT	0.582					805											0.258621	36.65107	39.678719	15	43	KEEP	---	---	---	---	12	4	28	19	0.25	capture	Missense_Mutation	SNP	66460727	66460727	MAST4	5	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	9240	188
PIK3R1	5295	broad.mit.edu	37	5	67591145	67591145	+	Missense_Mutation	SNP	T	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591145T>G	uc003jva.2	+	13	2298	c.1738T>G	c.(1738-1740)TAC>GAC	p.Y580D	PIK3R1_uc003jvb.2_Missense_Mutation_p.Y580D|PIK3R1_uc003jvc.2_Missense_Mutation_p.Y280D|PIK3R1_uc003jvd.2_Missense_Mutation_p.Y310D|PIK3R1_uc003jve.2_Missense_Mutation_p.Y259D|PIK3R1_uc011crb.1_Missense_Mutation_p.Y250D	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	580					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.R577_M582>K(1)|p.Y580fs*1(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GAGAGACCAATACTTGATGTA	0.368				p.Y580D(SUDHL6-Tumor)	370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.235294	45.447853	49.826961	16	52	KEEP	---	---	---	---	7	10	26	33	-1	capture	Missense_Mutation	SNP	67591145	67591145	PIK3R1	5	T	G	G	G	1	0	0	0	0	1	0	0	0	637	49	4	4	11821	188
PCDHA3	56145	broad.mit.edu	37	5	140182250	140182250	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140182250G>C	uc003lhf.2	+	1	1468	c.1468G>C	c.(1468-1470)GTG>CTG	p.V490L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.V490L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	490	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGCCCTGGTGTCCTACTC	0.677																0.258065	88.029063	94.617204	32	92	KEEP	---	---	---	---	20	27	53	82	-1	capture	Missense_Mutation	SNP	140182250	140182250	PCDHA3	5	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	11428	188
PCDHA13	56136	broad.mit.edu	37	5	140263908	140263908	+	Silent	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263908C>T	uc003lif.2	+	1	2055	c.2055C>T	c.(2053-2055)GGC>GGT	p.G685G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Silent_p.G685G|PCDHA13_uc003lid.2_Silent_p.G685G	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	685	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCGGCAGGCGCTGTGGGTC	0.632	Melanoma(147;1739 1852 5500 27947 37288)															0.242857	36.437431	40.662324	17	53	KEEP	---	---	---	---	9	8	30	25	-1	capture	Silent	SNP	140263908	140263908	PCDHA13	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11426	188
KIF4B	285643	broad.mit.edu	37	5	154393521	154393521	+	Silent	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154393521C>T	uc010jih.1	+	1	262	c.102C>T	c.(100-102)TTC>TTT	p.F34F		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	34	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCCTTTCCTTCGTGCCCGGGG	0.512																0.259259	52.537015	56.790055	21	60	KEEP	---	---	---	---	10	11	36	29	-1	capture	Silent	SNP	154393521	154393521	KIF4B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	8226	188
ADAMTS2	9509	broad.mit.edu	37	5	178579165	178579165	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178579165C>T	uc003mjw.2	-	10	1607	c.1607G>A	c.(1606-1608)GGG>GAG	p.G536E	ADAMTS2_uc011dgm.1_Missense_Mutation_p.G536E	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	536	Disintegrin.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		ACACATAGTCCCGTCCAAGGG	0.602					1974											0.171875	22.578581	29.101507	11	53	KEEP	---	---	---	---	8	3	29	31	-1	capture	Missense_Mutation	SNP	178579165	178579165	ADAMTS2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	265	188
COL11A2	1302	broad.mit.edu	37	6	33132163	33132163	+	Missense_Mutation	SNP	C	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33132163C>A	uc003ocx.1	-	65	5179	c.4951G>T	c.(4951-4953)GTC>TTC	p.V1651F	COL11A2_uc010jul.1_Missense_Mutation_p.V221F|COL11A2_uc003ocy.1_Missense_Mutation_p.V1565F|COL11A2_uc003ocz.1_Missense_Mutation_p.V1544F	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1651	Fibrillar collagen NC1.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						GGGTAGGAGACGTCCTGGTGG	0.622	Melanoma(1;90 116 3946 5341 17093)															0.368421	21.622613	21.910703	7	12	KEEP	---	---	---	---	4	4	4	8	0.5	capture	Missense_Mutation	SNP	33132163	33132163	COL11A2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	3633	188
C6orf127	340204	broad.mit.edu	37	6	35754829	35754829	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35754829C>T	uc003old.3	+	2	211	c.154C>T	c.(154-156)CGT>TGT	p.R52C		NM_001010886	NP_001010886	A2RUU4	CF127_HUMAN	hypothetical protein LOC340204 precursor	52					digestion|lipid catabolic process	extracellular region	enzyme activator activity			skin(1)	1						CTGCTGCCAACGTGCTCCAGA	0.672																0.114286	3.495802	8.612413	4	31	KEEP	---	---	---	---	1	3	14	20	-1	capture	Missense_Mutation	SNP	35754829	35754829	C6orf127	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2304	188
KHDRBS2	202559	broad.mit.edu	37	6	62407128	62407128	+	Silent	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:62407128T>C	uc003peg.2	-	8	1171	c.924A>G	c.(922-924)GGA>GGG	p.G308G		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	308					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		CCTCACTTACTCCATGACCGT	0.378																0.309524	40.759769	42.117177	13	29	KEEP	---	---	---	---	6	7	13	19	-1	capture	Silent	SNP	62407128	62407128	KHDRBS2	6	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	8069	188
NT5E	4907	broad.mit.edu	37	6	86203654	86203654	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:86203654C>T	uc003pko.3	+	9	2213	c.1657C>T	c.(1657-1659)CAC>TAC	p.H553Y	NT5E_uc010kbr.2_Missense_Mutation_p.H503Y	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	553					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	CACAGGAAGTCACTGCCATGG	0.363	Melanoma(140;797 1765 2035 2752 18208)															0.195652	35.147959	43.166239	18	74	KEEP	---	---	---	---	9	11	41	43	-1	capture	Missense_Mutation	SNP	86203654	86203654	NT5E	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	10600	188
ROS1	6098	broad.mit.edu	37	6	117715327	117715327	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117715327G>C	uc003pxp.1	-	10	1361	c.1162C>G	c.(1162-1164)CTG>GTG	p.L388V	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	388	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GGACTAACCAGTTCATCCATG	0.323					1038	T	GOPC|ROS1	glioblastoma|NSCLC								0.192982	29.490465	34.506356	11	46	KEEP	---	---	---	---	2	10	33	18	-1	capture	Missense_Mutation	SNP	117715327	117715327	ROS1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	13423	188
CLVS2	134829	broad.mit.edu	37	6	123319281	123319281	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:123319281T>C	uc003pzi.1	+	2	1228	c.359T>C	c.(358-360)GTC>GCC	p.V120A		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	120	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AAGATTCTAGTCCTTTTTGCT	0.483																0.208333	53.987465	61.520527	20	76	KEEP	---	---	---	---	8	14	46	38	-1	capture	Missense_Mutation	SNP	123319281	123319281	CLVS2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	3537	188
KIAA1244	57221	broad.mit.edu	37	6	138638494	138638494	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138638494G>C	uc003qhu.2	+	27	4452	c.4452G>C	c.(4450-4452)TTG>TTC	p.L1484F		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1484					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TTGAGCTGTTGAGAGATGTGA	0.458																0.3125	49.405877	50.909018	15	33	KEEP	---	---	---	---	10	8	18	21	-1	capture	Missense_Mutation	SNP	138638494	138638494	KIAA1244	6	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	8139	188
SP4	6671	broad.mit.edu	37	7	21469834	21469834	+	Missense_Mutation	SNP	T	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21469834T>A	uc003sva.2	+	3	1232	c.1051T>A	c.(1051-1053)TCA>ACA	p.S351T	SP4_uc003svb.2_Missense_Mutation_p.S38T	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	351					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						TGCAAGCACATCAGCCAGTAG	0.502																0.195652	39.698619	47.641895	18	74	KEEP	---	---	---	---	13	7	32	52	-1	capture	Missense_Mutation	SNP	21469834	21469834	SP4	7	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	14858	188
DYNC1I1	1780	broad.mit.edu	37	7	95665015	95665015	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95665015G>A	uc003uoc.3	+	13	1643	c.1366G>A	c.(1366-1368)GTG>ATG	p.V456M	DYNC1I1_uc003uod.3_Missense_Mutation_p.V439M|DYNC1I1_uc003uob.2_Missense_Mutation_p.V419M|DYNC1I1_uc003uoe.3_Missense_Mutation_p.V436M|DYNC1I1_uc010lfl.2_Missense_Mutation_p.V445M	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	456	WD 4.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAATAACTTCGTGGTTGGCAG	0.473																0.173267	63.300348	83.677857	35	167	KEEP	---	---	---	---	19	18	101	90	-1	capture	Missense_Mutation	SNP	95665015	95665015	DYNC1I1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4797	188
SLC12A9	56996	broad.mit.edu	37	7	100451836	100451836	+	Nonsense_Mutation	SNP	C	G	G			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100451836C>G	uc003uwp.2	+	2	159	c.17C>G	c.(16-18)TCA>TGA	p.S6*	SLC12A9_uc003uwo.1_Nonsense_Mutation_p.S6*|SLC12A9_uc003uwq.2_Nonsense_Mutation_p.S6*|SLC12A9_uc011kki.1_Intron|SLC12A9_uc003uwr.2_5'Flank|SLC12A9_uc003uws.2_5'Flank|SLC12A9_uc003uwt.2_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	6	Cytoplasmic (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGCGAGAGCTCACCTCTGCTG	0.632																0.12	11.884592	22.618751	9	66	KEEP	---	---	---	---	6	4	36	43	-1	capture	Nonsense_Mutation	SNP	100451836	100451836	SLC12A9	7	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	14283	188
PLXNA4	91584	broad.mit.edu	37	7	131883269	131883269	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131883269C>T	uc003vra.3	-	13	2942	c.2713G>A	c.(2713-2715)GTG>ATG	p.V905M		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	905	IPT/TIG 1.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TAACCATCCACTAAAGGGCTG	0.562																0.149533	28.327306	40.933103	16	91	KEEP	---	---	---	---	10	9	54	49	-1	capture	Missense_Mutation	SNP	131883269	131883269	PLXNA4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12025	188
BLK	640	broad.mit.edu	37	8	11400849	11400849	+	Missense_Mutation	SNP	C	T	T	rs142352008	byFrequency	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11400849C>T	uc003wty.2	+	2	697	c.116C>T	c.(115-117)CCG>CTG	p.P39L	BLK_uc003wtz.2_Intron	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	39					intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CCGCCACTGCCGCCCCTGGTG	0.393					676											0.277778	25.73623	27.334806	10	26	KEEP	---	---	---	---	3	7	18	25	-1	capture	Missense_Mutation	SNP	11400849	11400849	BLK	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1432	188
GRHL2	79977	broad.mit.edu	37	8	102585963	102585963	+	Missense_Mutation	SNP	A	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:102585963A>T	uc010mbu.2	+	6	1132	c.802A>T	c.(802-804)ACC>TCC	p.T268S	GRHL2_uc011lhi.1_Missense_Mutation_p.T268S	NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3	268						cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			GGGCCCCATGACCTACCTCAA	0.532																0.321429	47.55562	49.128599	18	38	KEEP	---	---	---	---	9	9	27	16	-1	capture	Missense_Mutation	SNP	102585963	102585963	GRHL2	8	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	6697	188
FER1L6	654463	broad.mit.edu	37	8	124992825	124992825	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124992825G>A	uc003yqw.2	+	11	1390	c.1184G>A	c.(1183-1185)GGC>GAC	p.G395D		NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	395	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCATTCAGGGGCAGAATCTTG	0.507														OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.208333	87.754845	102.840955	40	152	KEEP	---	---	---	---	21	30	86	87	-1	capture	Missense_Mutation	SNP	124992825	124992825	FER1L6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5761	188
CHRAC1	54108	broad.mit.edu	37	8	141525277	141525277	+	Silent	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:141525277G>A	uc003yvl.2	+	3	525	c.327G>A	c.(325-327)GAG>GAA	p.E109E	CHRAC1_uc010mem.1_RNA	NM_017444	NP_059140	Q9NRG0	CHRC1_HUMAN	chromatin accessibility complex 1	109	Potential.				chromatin remodeling	chromatin accessibility complex|epsilon DNA polymerase complex	DNA-directed DNA polymerase activity|sequence-specific DNA binding			ovary(1)	1	all_cancers(97;5.52e-16)|all_epithelial(106;1.22e-13)|Lung NSC(106;4.09e-06)|all_lung(105;6e-06)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.107)			TGCTTAAAGAGGAAAAGAGGG	0.353																0.036036	-18.585651	7.341039	4	107	KEEP	---	---	---	---	3	1	59	54	-1	capture	Silent	SNP	141525277	141525277	CHRAC1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	3336	188
TOPORS	10210	broad.mit.edu	37	9	32543467	32543467	+	Missense_Mutation	SNP	T	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32543467T>C	uc003zrb.2	-	3	1223	c.1056A>G	c.(1054-1056)ATA>ATG	p.I352M	TOPORS_uc003zrc.2_Missense_Mutation_p.I285M	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	352	Required for DNA-binding.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TAAATTCATGTATAAAATGCT	0.398																0.4375	76.172578	76.335222	21	27	KEEP	---	---	---	---	11	12	14	14	-1	capture	Missense_Mutation	SNP	32543467	32543467	TOPORS	9	T	C	C	C	1	0	0	0	0	1	0	0	0	732	57	3	3	16253	188
ZMYND19	116225	broad.mit.edu	37	9	140477434	140477434	+	Splice_Site	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140477434C>T	uc004cno.1	-	5	762	c.540_splice	c.e5+1	p.Q180_splice		NM_138462	NP_612471	Q96E35	ZMY19_HUMAN	zinc finger, MYND domain containing 19							Golgi apparatus|plasma membrane	zinc ion binding			skin(1)	1	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		AGCACACCCACCTGCTTCTCA	0.587																0.222222	77.769911	88.630185	34	119	KEEP	---	---	---	---	14	22	66	67	-1	capture	Splice_Site	SNP	140477434	140477434	ZMYND19	9	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	17590	188
PORCN	64840	broad.mit.edu	37	X	48371104	48371104	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48371104G>A	uc010nie.1	+	6	841	c.683G>A	c.(682-684)CGC>CAC	p.R228H	PORCN_uc004djr.1_Missense_Mutation_p.R228H|PORCN_uc004djs.1_Missense_Mutation_p.R228H|PORCN_uc004djt.1_Missense_Mutation_p.R157H|PORCN_uc011mlx.1_Missense_Mutation_p.R157H|PORCN_uc004dju.1_Missense_Mutation_p.R97H|PORCN_uc004djv.1_Missense_Mutation_p.R228H|PORCN_uc004djw.1_Missense_Mutation_p.R228H	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	228	Extracellular (Potential).		R -> C (in a patient with focal dermal hypoplasia also carrying a frameshift mutation; uncertain pathological significance).		Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						CGCCTCCTTCGCAAGTGAGCA	0.622					97											0.295455	32.201791	33.823949	13	31	KEEP	---	---	---	---	6	8	14	18	-1	capture	Missense_Mutation	SNP	48371104	48371104	PORCN	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12160	188
PQBP1	10084	broad.mit.edu	37	X	48759746	48759746	+	Missense_Mutation	SNP	C	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48759746C>T	uc004dle.2	+	5	718	c.529C>T	c.(529-531)CGC>TGC	p.R177C	PQBP1_uc004dlf.2_Missense_Mutation_p.R177C|PQBP1_uc004dlg.2_Missense_Mutation_p.R177C|PQBP1_uc004dld.2_Intron|PQBP1_uc004dlh.2_Missense_Mutation_p.R177C|PQBP1_uc004dli.2_Missense_Mutation_p.R177C|PQBP1_uc004dlj.1_Missense_Mutation_p.R177C|PQBP1_uc004dln.2_Missense_Mutation_p.R177C|PQBP1_uc010nih.2_RNA|PQBP1_uc010nii.2_Missense_Mutation_p.R135C|PQBP1_uc004dlk.2_Intron|PQBP1_uc004dll.2_Intron|PQBP1_uc004dlm.2_Missense_Mutation_p.R135C|PQBP1_uc010nij.2_Missense_Mutation_p.R77C	NM_001032382	NP_001027554	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	177	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|transcription coactivator activity			large_intestine(1)	1						CAAAGAACGGCGCCACCATCG	0.612																0.152174	11.296501	16.623317	7	39	KEEP	---	---	---	---	5	3	24	24	-1	capture	Missense_Mutation	SNP	48759746	48759746	PQBP1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12318	188
CHM	1121	broad.mit.edu	37	X	85156121	85156121	+	Missense_Mutation	SNP	A	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:85156121A>T	uc004eet.2	-	10	1347	c.1317T>A	c.(1315-1317)TTT>TTA	p.F439L	CHM_uc011mqz.1_Missense_Mutation_p.F291L	NM_000390	NP_000381	P24386	RAE1_HUMAN	choroideremia isoform a	439					intracellular protein transport|protein geranylgeranylation|response to stimulus|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(1)	1		all_lung(315;5.41e-06)				TGTTCTCAGGAAAGTAACTGT	0.393																0.15	4.812131	7.160971	3	17	KEEP	---	---	---	---	2	1	10	13	-1	capture	Missense_Mutation	SNP	85156121	85156121	CHM	23	A	T	T	T	1	0	0	0	0	1	0	0	0	115	9	4	4	3315	188
CXorf61	203413	broad.mit.edu	37	X	115592953	115592953	+	Silent	SNP	A	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115592953A>C	uc004eqj.1	-	2	417	c.297T>G	c.(295-297)CTT>CTG	p.L99L		NM_001017978	NP_001017978	Q5H943	KKLC1_HUMAN	chromosome X open reading frame 61	99	Extracellular (Potential).					integral to membrane|plasma membrane					0						AACCCTTGCTAAGTAGAGTAT	0.418																0.241573	134.846945	145.680775	43	135	KEEP	---	---	---	---	21	24	85	62	-1	capture	Silent	SNP	115592953	115592953	CXorf61	23	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	4076	188
ARHGEF6	9459	broad.mit.edu	37	X	135825762	135825762	+	Missense_Mutation	SNP	G	A	A			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135825762G>A	uc004fab.2	-	5	1105	c.643C>T	c.(643-645)CGT>TGT	p.R215C	ARHGEF6_uc011mwd.1_Missense_Mutation_p.R61C|ARHGEF6_uc011mwe.1_Missense_Mutation_p.R61C	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	215	SH3.				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)					TTAATTTCACGGACATAATTA	0.388																0.221311	61.762999	70.481767	27	95	KEEP	---	---	---	---	15	12	32	67	-1	capture	Missense_Mutation	SNP	135825762	135825762	ARHGEF6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	903	188
MCF2	4168	broad.mit.edu	37	X	138668562	138668562	+	Silent	SNP	C	T	T	rs142128026	byFrequency	TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138668562C>T	uc004fau.2	-	23	2901	c.2607G>A	c.(2605-2607)GCG>GCA	p.A869A	MCF2_uc004fav.2_Silent_p.A885A|MCF2_uc011mwl.1_Silent_p.A846A|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Silent_p.A929A|MCF2_uc011mwo.1_Silent_p.A945A	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	869					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CCTGAACTGACGCAATTGCCT	0.413					693											0.319588	82.191677	84.996668	31	66	KEEP	---	---	---	---	22	13	44	32	-1	capture	Silent	SNP	138668562	138668562	MCF2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9291	188
IDS	3423	broad.mit.edu	37	X	148564457	148564457	+	Silent	SNP	G	T	T			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148564457G>T	uc011mxe.1	-	9	1671	c.1473C>A	c.(1471-1473)TCC>TCA	p.S491S	IDS_uc011mxd.1_Silent_p.S94S|IDS_uc011mxf.1_Silent_p.S401S|IDS_uc011mxg.1_Silent_p.S280S|IDS_uc010nsu.1_Silent_p.S101S|IDS_uc004fcw.3_Silent_p.S280S	NM_000202	NP_000193	P22304	IDS_HUMAN	iduronate-2-sulfatase isoform a precursor	491			S -> F (in MPS2; mild form).			lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TGGTGCGTATGGAATAGCCCA	0.433																0.163934	38.617916	51.708421	20	102	KEEP	---	---	---	---	21	3	54	63	0.875	capture	Silent	SNP	148564457	148564457	IDS	23	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	7428	188
DKC1	1736	broad.mit.edu	37	X	154001511	154001511	+	Missense_Mutation	SNP	G	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154001511G>C	uc004fmm.2	+	11	1352	c.1142G>C	c.(1141-1143)GGT>GCT	p.G381A	DKC1_uc010nvf.2_Missense_Mutation_p.G381A|SNORA56_uc004fmo.2_5'Flank	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1	381					cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGGAAGTGGGGTTTAGGTCCA	0.383												Congenital_Dyskeratosis				0.171053	33.849132	41.60625	13	63	KEEP	---	---	---	---	13	3	35	34	-1	capture	Missense_Mutation	SNP	154001511	154001511	DKC1	23	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	4500	188
FAU	2197	broad.mit.edu	37	11	64888248	64888250	+	In_Frame_Del	DEL	TCT	-	-	rs1065065		TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64888248_64888250delTCT	uc001ocx.2	-	5	412_414	c.305_307delAGA	c.(304-309)AAGACA>ACA	p.K102del	FAU_uc001ocy.1_3'UTR|MRPL49_uc001ocz.1_5'Flank|MRPL49_uc001oda.1_5'Flank	NM_001997	NP_001988	P35544	UBIM_HUMAN	ubiquitin-like protein fubi and ribosomal	Error:Variant_position_missing_in_P35544_after_alignment											0						GCCCGACCTGTCTTCTTCTTCTT	0.542																0.05			7	142		---	---	---	---						capture_indel	In_Frame_Del	DEL	64888248	64888250	FAU	11	TCT	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	5640	188
NPHP3	27031	broad.mit.edu	37	3	132413753	132413754	+	Frame_Shift_Ins	INS	-	C	C			TCGA-26-6174-01	TCGA-26-6174-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132413753_132413754insC	uc003epe.1	-	16	2304_2305	c.2227_2228insG	c.(2227-2229)GATfs	p.D743fs	NPHP3_uc003epd.1_5'UTR	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	743					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						TGAAAGAGTATCTTGACACTGG	0.381																0.22			30	104		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	132413753	132413754	NPHP3	3	-	C	C	C	1	0	1	1	0	0	0	0	0	650	50	5	5	10487	188
