Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF2	65122	broad.mit.edu	37	1	12919829	12919829	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12919829C>T	uc001aum.1	+	3	656	c.569C>T	c.(568-570)ACG>ATG	p.T190M		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	190											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AATTATCTAACGCCAATTAAA	0.398																0.372943	599.55756	607.314016	204	343	KEEP	---	---	---	---	120	113	211	188	-1	capture	Missense_Mutation	SNP	12919829	12919829	PRAMEF2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12335	203
ATP13A2	23400	broad.mit.edu	37	1	17318252	17318252	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17318252C>T	uc001baa.2	-	20	2418	c.2228G>A	c.(2227-2229)CGC>CAC	p.R743H	ATP13A2_uc001azz.1_5'Flank|ATP13A2_uc001bab.2_Missense_Mutation_p.R738H|ATP13A2_uc001bac.2_Missense_Mutation_p.R738H	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	743	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GGCGCGGATGCGGGTCCTTCG	0.622																0.405714	208.09237	209.451469	71	104	KEEP	---	---	---	---	41	44	69	56	-1	capture	Missense_Mutation	SNP	17318252	17318252	ATP13A2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1115	203
WDR78	79819	broad.mit.edu	37	1	67301450	67301450	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67301450C>T	uc001dcx.2	-	11	1648	c.1592G>A	c.(1591-1593)CGT>CAT	p.R531H	WDR78_uc009waw.2_Missense_Mutation_p.R277H|WDR78_uc009wax.2_Intron	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	531										ovary(2)	2						CTGATAAATACGTTCTGGCCA	0.368																0.359477	153.030999	155.669372	55	98	KEEP	---	---	---	---	32	33	56	63	-1	capture	Missense_Mutation	SNP	67301450	67301450	WDR78	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17209	203
CELSR2	1952	broad.mit.edu	37	1	109795999	109795999	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109795999G>A	uc001dxa.3	+	1	3359	c.3298G>A	c.(3298-3300)GTG>ATG	p.V1100M		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1100	Cadherin 9.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CATCATGAGCGTGCTGGTGTC	0.637	NSCLC(158;1285 2011 34800 34852 42084)															0.425532	57.395321	57.621799	20	27	KEEP	---	---	---	---	9	14	10	21	-1	capture	Missense_Mutation	SNP	109795999	109795999	CELSR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3190	203
HRNR	388697	broad.mit.edu	37	1	152191194	152191194	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152191194C>G	uc001ezt.1	-	3	2987	c.2911G>C	c.(2911-2913)GAA>CAA	p.E971Q		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	971	11.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTTGTTCGCTCCTAGAT	0.562																0.339806	472.108816	481.438511	140	272	KEEP	---	---	---	---	73	81	142	147	-1	capture	Missense_Mutation	SNP	152191194	152191194	HRNR	1	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	7284	203
CD5L	922	broad.mit.edu	37	1	157804375	157804375	+	Silent	SNP	T	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157804375T>C	uc001frk.3	-	4	683	c.540A>G	c.(538-540)GGA>GGG	p.G180G		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	180	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCTCCCACATCCCAGCTGCC	0.587																0.028369	-28.205578	6.414089	4	137	KEEP	---	---	---	---	5	4	78	69	-1	capture	Silent	SNP	157804375	157804375	CD5L	1	T	C	C	C	1	0	0	0	0	0	0	0	1	639	50	3	3	2998	203
MAT1A	4143	broad.mit.edu	37	10	82034790	82034790	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:82034790G>A	uc001kbw.2	-	7	1189	c.934C>T	c.(934-936)CGG>TGG	p.R312W		NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	312					methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AGCACTCTCCGGCAGAGCCCT	0.632																0.666667	13.50184	13.649386	4	2	KEEP	---	---	---	---	2	2	1	2	-1	capture	Missense_Mutation	SNP	82034790	82034790	MAT1A	10	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	9242	203
PTEN	5728	broad.mit.edu	37	10	89692923	89692923	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692923G>A	uc001kfb.2	+	6	1438	c.407G>A	c.(406-408)TGT>TAT	p.C136Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	136	Phosphatase tensin-type.		C -> Y (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P3).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.C136Y(7)|p.R55fs*1(4)|p.C136F(3)|p.C136fs*1(2)|p.C136R(2)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.I135_A137>T(1)|p.A121_F145del(1)|p.I135fs*6(1)|p.C136_A137insGM(1)|p.C136W(1)|p.T131fs*42(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTAATGATATGTGCATATTTA	0.393			31	p.C136Y(MDAMB415-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.731092	277.765478	283.495156	87	32	KEEP	---	---	---	---	43	53	14	21	-1	capture	Missense_Mutation	SNP	89692923	89692923	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12633	203
OR9G4	283189	broad.mit.edu	37	11	56510803	56510803	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56510803C>A	uc010rjo.1	-	1	485	c.485G>T	c.(484-486)GGC>GTC	p.G162V		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	162	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TATGTAGGAGCCAGCAACAAG	0.463																0.355828	160.00055	162.986582	58	105	KEEP	---	---	---	---	33	30	41	76	0.47619047619	capture	Missense_Mutation	SNP	56510803	56510803	OR9G4	11	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	11155	203
TECTA	7007	broad.mit.edu	37	11	121028677	121028677	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121028677G>A	uc010rzo.1	+	13	4433	c.4433G>A	c.(4432-4434)GGC>GAC	p.G1478D		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1478					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGGGTGCGCGGCTGCTTCAGC	0.682																0.488372	124.29226	124.30026	42	44	KEEP	---	---	---	---	23	24	24	31	-1	capture	Missense_Mutation	SNP	121028677	121028677	TECTA	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15632	203
LRIG3	121227	broad.mit.edu	37	12	59270251	59270251	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59270251A>G	uc001sqr.2	-	16	2917	c.2671T>C	c.(2671-2673)TTC>CTC	p.F891L	LRIG3_uc009zqh.2_Missense_Mutation_p.F831L|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	891						integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TGTGGTAAGAAAAATCCAGCA	0.418																0.4	85.424069	85.995869	26	39	KEEP	---	---	---	---	13	14	19	23	-1	capture	Missense_Mutation	SNP	59270251	59270251	LRIG3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	8862	203
LRIG3	121227	broad.mit.edu	37	12	59271192	59271192	+	Silent	SNP	A	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59271192A>G	uc001sqr.2	-	15	2772	c.2526T>C	c.(2524-2526)ATT>ATC	p.I842I	LRIG3_uc009zqh.2_Silent_p.I782I|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	842						integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			CTGTGTTGGTAATGCTGCAAT	0.493																0.178862	58.189617	70.114116	22	101	KEEP	---	---	---	---	12	13	51	58	-1	capture	Silent	SNP	59271192	59271192	LRIG3	12	A	G	G	G	1	0	0	0	0	0	0	0	1	164	13	3	3	8862	203
PLBD2	196463	broad.mit.edu	37	12	113825637	113825637	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113825637G>A	uc001tve.2	+	11	1563	c.1528G>A	c.(1528-1530)GAC>AAC	p.D510N	PLBD2_uc001tvf.2_Missense_Mutation_p.D478N	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1	510					lipid catabolic process	lysosomal lumen	hydrolase activity				0						CGCCCGCTCCGACCTCAACCC	0.617																0.42515	410.118655	411.743246	142	192	KEEP	---	---	---	---	82	94	117	129	-1	capture	Missense_Mutation	SNP	113825637	113825637	PLBD2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11929	203
ZMYM2	7750	broad.mit.edu	37	13	20625722	20625722	+	Silent	SNP	T	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20625722T>C	uc001umr.2	+	14	2740	c.2442T>C	c.(2440-2442)CCT>CCC	p.P814P	ZMYM2_uc001ums.2_Silent_p.P814P|ZMYM2_uc001umt.2_Silent_p.P814P|ZMYM2_uc010tco.1_RNA|ZMYM2_uc001umv.2_Silent_p.P194P|ZMYM2_uc001umw.2_Silent_p.P267P	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	814					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AGAAAGGACCTGAAAACTTAC	0.368					348											0.032258	-15.658556	6.579922	3	90	KEEP	---	---	---	---	1	3	43	68	-1	capture	Silent	SNP	20625722	20625722	ZMYM2	13	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	17580	203
GALC	2581	broad.mit.edu	37	14	88416243	88416243	+	Silent	SNP	G	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88416243G>T	uc001xvt.2	-	12	1683	c.1284C>A	c.(1282-1284)ACC>ACA	p.T428T	GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.T402T|GALC_uc010tvy.1_Silent_p.T405T|GALC_uc010tvz.1_Silent_p.T372T	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	428					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						TTCCAAGTTTGGTATACCATA	0.333																0.018692	-49.306225	6.489607	4	210	KEEP	---	---	---	---	2	4	114	132	0.333333333333	capture	Silent	SNP	88416243	88416243	GALC	14	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	6141	203
CKMT1B	1159	broad.mit.edu	37	15	43891425	43891425	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43891425G>A	uc001zsc.2	+	10	1600	c.1208G>A	c.(1207-1209)GGC>GAC	p.G403D	CKMT1B_uc010uds.1_Missense_Mutation_p.G434D|CKMT1B_uc001zsd.3_Missense_Mutation_p.G403D|CKMT1B_uc010bdj.2_RNA	NM_020990	NP_066270	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B precursor	403					creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	CTGGAGAGAGGCCAGGATATC	0.493																0.394737	206.469858	208.316539	75	115	KEEP	---	---	---	---	33	46	80	82	-1	capture	Missense_Mutation	SNP	43891425	43891425	CKMT1B	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3415	203
FBN1	2200	broad.mit.edu	37	15	48760692	48760692	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:48760692C>T	uc001zwx.1	-	37	4827	c.4499G>A	c.(4498-4500)GGG>GAG	p.G1500E	FBN1_uc010beo.1_5'Flank	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1500	EGF-like 26; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GACACAGTTCCCACTGATGCA	0.473					2933											0.395062	98.385502	99.165228	32	49	KEEP	---	---	---	---	18	16	25	29	-1	capture	Missense_Mutation	SNP	48760692	48760692	FBN1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5648	203
IGF1R	3480	broad.mit.edu	37	15	99251008	99251008	+	Silent	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99251008G>A	uc002bul.2	+	2	362	c.312G>A	c.(310-312)ACG>ACA	p.T104T	IGF1R_uc010urq.1_Silent_p.T104T|IGF1R_uc010bon.2_Silent_p.T104T	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	104					anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CCAACCTCACGGTCATCCGCG	0.547					471											0.434783	61.69328	61.863833	20	26	KEEP	---	---	---	---	9	12	11	17	-1	capture	Silent	SNP	99251008	99251008	IGF1R	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7496	203
RLTPR	146206	broad.mit.edu	37	16	67681065	67681065	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67681065C>T	uc002etn.2	+	9	778	c.658C>T	c.(658-660)CGG>TGG	p.R220W	RLTPR_uc010cel.1_Missense_Mutation_p.R220W|RLTPR_uc010vjr.1_Missense_Mutation_p.R220W	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	220										breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CCTGTGGTTCCGGTGCCTCTC	0.672																0.385965	65.34073	65.988177	22	35	KEEP	---	---	---	---	6	20	18	20	-1	capture	Missense_Mutation	SNP	67681065	67681065	RLTPR	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	13286	203
C19orf28	126321	broad.mit.edu	37	19	3550991	3550991	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3550991G>A	uc002lxz.2	-	2	670	c.500C>T	c.(499-501)ACG>ATG	p.T167M	C19orf28_uc002lxw.2_Missense_Mutation_p.T167M|C19orf28_uc002lxx.2_Missense_Mutation_p.T167M|C19orf28_uc002lxy.2_Missense_Mutation_p.T158M	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	167					transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGAGTGCCGTGAGCTCCAC	0.557																0.085714	0.726364	6.789982	3	32	KEEP	---	---	---	---	0	3	22	13	-1	capture	Missense_Mutation	SNP	3550991	3550991	C19orf28	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1900	203
MUC16	94025	broad.mit.edu	37	19	9021119	9021119	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9021119C>T	uc002mkp.2	-	19	37408	c.37204G>A	c.(37204-37206)GGG>AGG	p.G12402R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12404	Extracellular (Potential).|SEA 3.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATGTCCTCCCCATACTGCAGG	0.547																0.463087	217.958437	218.135531	69	80	KEEP	---	---	---	---	36	35	37	49	-1	capture	Missense_Mutation	SNP	9021119	9021119	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	9883	203
NWD1	284434	broad.mit.edu	37	19	16874718	16874718	+	Missense_Mutation	SNP	A	G	G	rs111332125		TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16874718A>G	uc002neu.3	+	9	2635	c.2213A>G	c.(2212-2214)CAC>CGC	p.H738R	NWD1_uc002net.3_Missense_Mutation_p.H603R|NWD1_uc002nev.3_Missense_Mutation_p.H532R			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	738							ATP binding			skin(3)|ovary(2)|pancreas(2)	7						CACCTGCTTCACTCGGGCCGC	0.612																0.373737	112.957665	114.340387	37	62	KEEP	---	---	---	---	24	19	39	33	-1	capture	Missense_Mutation	SNP	16874718	16874718	NWD1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10688	203
SLC5A6	8884	broad.mit.edu	37	2	27425742	27425742	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27425742C>T	uc002rjd.2	-	12	1605	c.1214G>A	c.(1213-1215)GGC>GAC	p.G405D	SLC5A6_uc010eyv.1_Missense_Mutation_p.G405D	NM_021095	NP_066918	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium-dependent	405	Helical; (Potential).				biotin metabolic process|pantothenate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|Lipoic Acid(DB00166)	CAGCCCATAGCCAAAGGCTGG	0.493																0.382353	229.933732	232.397632	78	126	KEEP	---	---	---	---	42	47	59	87	-1	capture	Missense_Mutation	SNP	27425742	27425742	SLC5A6	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14561	203
SLC1A4	6509	broad.mit.edu	37	2	65237852	65237852	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:65237852A>G	uc010yqa.1	+	4	1077	c.755A>G	c.(754-756)AAT>AGT	p.N252S	SLC1A4_uc010ypy.1_Missense_Mutation_p.N32S|SLC1A4_uc010ypz.1_Missense_Mutation_p.N32S|SLC1A4_uc010fcv.2_Missense_Mutation_p.N252S|SLC1A4_uc002sdh.2_Missense_Mutation_p.N32S	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	252					cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)	CGTTTCTTCAATTCCCTCAAC	0.498																0.417112	273.826653	274.94601	78	109	KEEP	---	---	---	---	49	39	61	62	-1	capture	Missense_Mutation	SNP	65237852	65237852	SLC1A4	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	14327	203
GPR45	11250	broad.mit.edu	37	2	105858641	105858641	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:105858641T>C	uc002tco.1	+	1	442	c.326T>C	c.(325-327)CTC>CCC	p.L109P		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	109	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						TTCTGCCGCCTCTCAGCCACG	0.612																0.029412	-17.854473	6.956285	3	99	KEEP	---	---	---	---	1	2	69	68	-1	capture	Missense_Mutation	SNP	105858641	105858641	GPR45	2	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	6629	203
NDUFA10	4705	broad.mit.edu	37	2	240944658	240944658	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:240944658C>T	uc002vyn.2	-	8	939	c.859G>A	c.(859-861)GAC>AAC	p.D287N	NDUFA10_uc010fzc.1_Missense_Mutation_p.D317N	NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	287					mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	GTGCGATTGTCCTGCTTGAGC	0.463																0.385027	212.377644	214.536451	72	115	KEEP	---	---	---	---	36	45	57	74	-1	capture	Missense_Mutation	SNP	240944658	240944658	NDUFA10	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10167	203
SYCP2	10388	broad.mit.edu	37	20	58471554	58471554	+	Silent	SNP	A	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:58471554A>G	uc002yaz.2	-	18	1573	c.1434T>C	c.(1432-1434)TCT>TCC	p.S478S		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	478					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TTGATGCTTCAGACATTTTTC	0.313																0.295775	119.989305	125.290632	42	100	KEEP	---	---	---	---	25	25	53	65	-1	capture	Silent	SNP	58471554	58471554	SYCP2	20	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	15320	203
SFRS15	57466	broad.mit.edu	37	21	33044602	33044602	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33044602C>T	uc002ypd.2	-	20	2980	c.2554G>A	c.(2554-2556)GCC>ACC	p.A852T	SFRS15_uc002ype.2_Missense_Mutation_p.A830T|SFRS15_uc010glu.2_Missense_Mutation_p.A837T	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	852						nucleus	nucleotide binding|RNA binding				0						CCGGGCCGGGCGCCAAGAAGA	0.562																0.220779	77.497987	88.531781	34	120	KEEP	---	---	---	---	22	18	58	77	-1	capture	Missense_Mutation	SNP	33044602	33044602	SFRS15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14064	203
PITPNB	23760	broad.mit.edu	37	22	28310333	28310333	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:28310333C>T	uc003adk.2	-	2	99	c.23G>A	c.(22-24)CGT>CAT	p.R8H	PITPNB_uc011akh.1_Missense_Mutation_p.R10H|PITPNB_uc003adl.2_Missense_Mutation_p.R8H	NM_012399	NP_036531	P48739	PIPNB_HUMAN	phosphatidylinositol transfer protein, beta	8					lipid metabolic process|transport	Golgi apparatus	lipid binding			skin(1)	1						CAAAACCACACGGCTAAAAAG	0.318																0.1	2.969934	9.363486	4	36	KEEP	---	---	---	---	3	1	18	21	-1	capture	Missense_Mutation	SNP	28310333	28310333	PITPNB	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11851	203
DPPA2	151871	broad.mit.edu	37	3	109026881	109026881	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:109026881G>A	uc003dxo.2	-	6	903	c.656C>T	c.(655-657)TCT>TTT	p.S219F		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	219						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						GATCTTACCAGAGGCTTGCAT	0.438																0.454545	113.116215	113.254903	35	42	KEEP	---	---	---	---	16	21	23	25	-1	capture	Missense_Mutation	SNP	109026881	109026881	DPPA2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4689	203
CD200R1L	344807	broad.mit.edu	37	3	112546470	112546470	+	Silent	SNP	T	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112546470T>C	uc003dzi.1	-	3	400	c.174A>G	c.(172-174)GCA>GCG	p.A58A	CD200R1L_uc011bhw.1_Silent_p.A37A|CD200R1L_uc010hqf.1_Silent_p.A37A	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2	58	Ig-like V-type.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)	1						AATTTCTTAATGCGATAGGAG	0.393																0.452055	326.409881	326.846847	99	120	KEEP	---	---	---	---	45	66	67	74	-1	capture	Silent	SNP	112546470	112546470	CD200R1L	3	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	2953	203
RNF168	165918	broad.mit.edu	37	3	196230195	196230195	+	Translation_Start_Site	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196230195C>T	uc003fwq.2	-	1	388	c.-150G>A	c.(-152--148)ACGTG>ACATG		RNF168_uc010iah.2_Translation_Start_Site	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168						double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GCATCCAACACGTCTTGAAGC	0.493																0.8	13.608118	14.021313	4	1	KEEP	---	---	---	---	0	4	0	1	-1	capture	Translation_Start_Site	SNP	196230195	196230195	RNF168	3	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	13351	203
CRIPAK	285464	broad.mit.edu	37	4	1389373	1389373	+	Silent	SNP	T	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1389373T>C	uc003gdf.2	+	1	4034	c.1074T>C	c.(1072-1074)CAT>CAC	p.H358H		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	358				H -> Y (in Ref. 1; BAC03741).	ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.657																0.037209	-36.306019	13.526624	8	207	KEEP	---	---	---	---	11	12	188	158	-1	capture	Silent	SNP	1389373	1389373	CRIPAK	4	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	3842	203
HGFAC	3083	broad.mit.edu	37	4	3451018	3451018	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3451018G>A	uc003ghc.2	+	14	1843	c.1840G>A	c.(1840-1842)GGC>AGC	p.G614S	HGFAC_uc010icw.2_Missense_Mutation_p.G621S	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	614	Peptidase S1.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TTACCTCTACGGCATCATCAG	0.672																0.333333	100.041064	102.537872	34	68	KEEP	---	---	---	---	30	17	39	51	-1	capture	Missense_Mutation	SNP	3451018	3451018	HGFAC	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7011	203
RBM47	54502	broad.mit.edu	37	4	40439840	40439840	+	Silent	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40439840G>A	uc003gvc.2	-	4	1781	c.1071C>T	c.(1069-1071)TAC>TAT	p.Y357Y	RBM47_uc003gvd.2_Silent_p.Y357Y|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Silent_p.Y319Y|RBM47_uc003gvg.1_Silent_p.Y357Y	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	357						nucleus	nucleotide binding|RNA binding			breast(3)	3						AGGGGTAGCCGTAGTAGGCCA	0.642																0.415094	61.32343	61.660197	22	31	KEEP	---	---	---	---	24	7	22	17	-1	capture	Silent	SNP	40439840	40439840	RBM47	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13036	203
ANK2	287	broad.mit.edu	37	4	114276299	114276299	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114276299C>G	uc003ibe.3	+	38	6625	c.6525C>G	c.(6523-6525)AAC>AAG	p.N2175K	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.N2190K	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2142					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTCCTTTCAACACAACATTTC	0.433																0.029412	-17.365409	7.455063	3	99	KEEP	---	---	---	---	0	3	34	69	-1	capture	Missense_Mutation	SNP	114276299	114276299	ANK2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	618	203
DNAH5	1767	broad.mit.edu	37	5	13876806	13876806	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13876806T>A	uc003jfd.2	-	22	3425	c.3383A>T	c.(3382-3384)AAC>ATC	p.N1128I		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1128	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTTGGTGGAGTTGATAATTGT	0.378												Kartagener_syndrome				0.352113	142.410971	145.148398	50	92	KEEP	---	---	---	---	29	27	53	49	-1	capture	Missense_Mutation	SNP	13876806	13876806	DNAH5	5	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	4561	203
C6	729	broad.mit.edu	37	5	41186199	41186199	+	Silent	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41186199C>T	uc003jmk.2	-	6	909	c.699G>A	c.(697-699)CCG>CCA	p.P233P	C6_uc003jml.1_Silent_p.P233P	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	233	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CCAGATTGGCCGGAACACGGT	0.443																0.285714	113.347197	119.112767	40	100	KEEP	---	---	---	---	20	28	59	56	-1	capture	Silent	SNP	41186199	41186199	C6	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2292	203
PCDHB7	56129	broad.mit.edu	37	5	140554315	140554315	+	Silent	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140554315C>T	uc003lit.2	+	1	2073	c.1899C>T	c.(1897-1899)CGC>CGT	p.R633R		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	633	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGCGAGCGCGACGCAGCCA	0.687																0.254902	63.921117	69.468214	26	76	KEEP	---	---	---	---	19	21	52	71	-1	capture	Silent	SNP	140554315	140554315	PCDHB7	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11450	203
SH3TC2	79628	broad.mit.edu	37	5	148407984	148407984	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148407984G>C	uc003lpu.2	-	11	1463	c.1311C>G	c.(1309-1311)GAC>GAG	p.D437E	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc010jgw.2_Missense_Mutation_p.D81E|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Missense_Mutation_p.D430E|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_Missense_Mutation_p.D322E	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	437							binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGATAGCTGTCTGAGGTGG	0.622																0.368421	139.622402	141.356459	42	72	KEEP	---	---	---	---	29	22	41	44	-1	capture	Missense_Mutation	SNP	148407984	148407984	SH3TC2	5	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	14155	203
GABRB2	2561	broad.mit.edu	37	5	160761758	160761758	+	Splice_Site	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160761758C>T	uc003lys.1	-	8	1050	c.832_splice	c.e8+1	p.G278_splice	GABRB2_uc011deh.1_Splice_Site_p.G117_splice|GABRB2_uc003lyr.1_Splice_Site_p.G278_splice|GABRB2_uc003lyt.1_Splice_Site_p.G278_splice|GABRB2_uc010jiu.1_Splice_Site_p.G215_splice	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AAATGGCCTACCTAATGCCAC	0.443																0.521008	192.182898	192.231136	62	57	KEEP	---	---	---	---	27	46	29	34	-1	capture	Splice_Site	SNP	160761758	160761758	GABRB2	5	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	6109	203
GABRA6	2559	broad.mit.edu	37	5	161117359	161117359	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161117359G>A	uc003lyu.2	+	7	1164	c.826G>A	c.(826-828)GGG>AGG	p.G276R	GABRA6_uc003lyv.2_Missense_Mutation_p.G47R	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	276	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AACTGTTTTTGGTATATGTCA	0.378													TCGA Ovarian(5;0.080)			0.449761	308.425272	308.884503	94	115	KEEP	---	---	---	---	60	50	66	62	-1	capture	Missense_Mutation	SNP	161117359	161117359	GABRA6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	6107	203
TAP2	6891	broad.mit.edu	37	6	32803482	32803482	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32803482C>T	uc003occ.2	-	3	708	c.677G>A	c.(676-678)CGG>CAG	p.R226Q	TAP2_uc011dqf.1_Missense_Mutation_p.R226Q|TAP2_uc003ocb.1_Missense_Mutation_p.R226Q|TAP2_uc003ocd.2_Missense_Mutation_p.R226Q	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	226	Cytoplasmic (Potential).|ABC transmembrane type-1.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						AAGCTGCTCCCGGATCCGCAA	0.582																0.029703	-17.954521	6.569881	3	98	KEEP	---	---	---	---	0	3	56	50	-1	capture	Missense_Mutation	SNP	32803482	32803482	TAP2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15439	203
DNAH8	1769	broad.mit.edu	37	6	38750809	38750809	+	Silent	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38750809C>T	uc003ooe.1	+	15	2238	c.1638C>T	c.(1636-1638)GAC>GAT	p.D546D		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CAAGTCCGGACGGTAAAGCTG	0.378					2979											0.419355	154.576497	155.28087	52	72	KEEP	---	---	---	---	29	30	48	33	-1	capture	Silent	SNP	38750809	38750809	DNAH8	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4563	203
MANEA	79694	broad.mit.edu	37	6	96053740	96053740	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:96053740C>T	uc003poo.1	+	5	988	c.848C>T	c.(847-849)ACC>ATC	p.T283I		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	283	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		AATCTGTTAACCACCTCAGGG	0.398																0.346369	170.067045	173.809987	62	117	KEEP	---	---	---	---	32	34	56	74	-1	capture	Missense_Mutation	SNP	96053740	96053740	MANEA	6	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	9135	203
SIM1	6492	broad.mit.edu	37	6	100841630	100841630	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100841630C>T	uc003pqj.3	-	10	1510	c.1303G>A	c.(1303-1305)GCC>ACC	p.A435T	SIM1_uc010kcu.2_Missense_Mutation_p.A435T	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	435	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TGTCTGTAGGCGCACGATGCG	0.617																0.403509	126.625618	127.552439	46	68	KEEP	---	---	---	---	28	27	44	40	-1	capture	Missense_Mutation	SNP	100841630	100841630	SIM1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14216	203
ZNF727	442319	broad.mit.edu	37	7	63529345	63529345	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63529345G>A	uc011kdm.1	+	2	259	c.80G>A	c.(79-81)CGT>CAT	p.R27H		NM_001159522	NP_001152994	A8MUV8	ZN727_HUMAN	zinc finger protein 727	27	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCTCAGCAGCGTTTGTATAGG	0.393																0.16129	8.9547	12.33904	5	26	KEEP	---	---	---	---	2	3	19	11	-1	capture	Missense_Mutation	SNP	63529345	63529345	ZNF727	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17999	203
CALCR	799	broad.mit.edu	37	7	93108720	93108720	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93108720C>T	uc003umv.1	-	4	466	c.205G>A	c.(205-207)GCA>ACA	p.A69T	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.A51T|CALCR_uc003umw.2_Missense_Mutation_p.A51T	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	51	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	TTGTACTGTGCATCCATCATC	0.418																0.189771	281.313532	348.219799	141	602	KEEP	---	---	---	---	79	88	334	353	-1	capture	Missense_Mutation	SNP	93108720	93108720	CALCR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2555	203
TMEM130	222865	broad.mit.edu	37	7	98457803	98457803	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98457803C>T	uc003upo.2	-	3	739	c.550G>A	c.(550-552)GGG>AGG	p.G184R	TMEM130_uc011kiq.1_Missense_Mutation_p.G165R|TMEM130_uc011kir.1_Missense_Mutation_p.G184R|TMEM130_uc003upn.2_Missense_Mutation_p.G82R	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a	184	Extracellular (Potential).|PKD.					Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGGACCTACCCGTCCCCGAAG	0.557																0.2	36.789498	43.061354	15	60	KEEP	---	---	---	---	6	9	41	28	-1	capture	Missense_Mutation	SNP	98457803	98457803	TMEM130	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15927	203
LAMB4	22798	broad.mit.edu	37	7	107745023	107745023	+	Silent	SNP	C	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107745023C>T	uc010ljo.1	-	9	996	c.912G>A	c.(910-912)CCG>CCA	p.P304P	LAMB4_uc003vey.2_Silent_p.P304P	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	304	Laminin EGF-like 1.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TCTCACAGTTCGGACCATCTG	0.522																0.193985	286.476155	344.590478	129	536	KEEP	---	---	---	---	72	82	279	315	-1	capture	Silent	SNP	107745023	107745023	LAMB4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	8533	203
RP1L1	94137	broad.mit.edu	37	8	10467799	10467799	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10467799G>A	uc003wtc.2	-	4	4038	c.3809C>T	c.(3808-3810)GCC>GTC	p.A1270V		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1270					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CTCATTGGTGGCACAAGCGCA	0.517																0.0181	-51.258945	6.533012	4	217	KEEP	---	---	---	---	3	2	132	122	-1	capture	Missense_Mutation	SNP	10467799	10467799	RP1L1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13425	203
CSMD3	114788	broad.mit.edu	37	8	113420591	113420591	+	Nonsense_Mutation	SNP	G	T	T			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113420591G>T	uc003ynu.2	-	34	5720	c.5561C>A	c.(5560-5562)TCA>TAA	p.S1854*	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Nonsense_Mutation_p.S1814*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.S1750*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1854	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGGTCCAACTGAAGTAAATCG	0.343					2888								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			0.308411	176.854285	183.864529	66	148	KEEP	---	---	---	---	33	45	79	98	0.423076923077	capture	Nonsense_Mutation	SNP	113420591	113420591	CSMD3	8	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	3911	203
ELK1	2002	broad.mit.edu	37	X	47509844	47509844	+	Translation_Start_Site	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47509844G>A	uc004dik.3	-	1	160	c.-162C>T	c.(-164--160)AACGC>AATGC		ELK1_uc010nhv.2_Translation_Start_Site|ELK1_uc010nhw.2_Translation_Start_Site|ELK1_uc004dil.3_RNA	NM_001114123	NP_001107595	P19419	ELK1_HUMAN	ELK1 protein						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TGGCGGTGGCGTTGGCAATGT	0.622					33											0.296296	20.691609	21.692425	8	19	KEEP	---	---	---	---	11	2	10	14	-1	capture	Translation_Start_Site	SNP	47509844	47509844	ELK1	23	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	5014	203
PNMA3	29944	broad.mit.edu	37	X	152226004	152226004	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152226004G>A	uc004fhc.2	+	2	928	c.592G>A	c.(592-594)GAG>AAG	p.E198K	PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN	paraneoplastic cancer-testis-brain antigen	198					apoptosis	nucleolus	nucleic acid binding|zinc ion binding			skin(2)|large_intestine(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					gcaggtgcccgagggggaaaa	0.000																0.412903	187.560956	188.590179	64	91	KEEP	---	---	---	---	34	35	56	51	-1	capture	Missense_Mutation	SNP	152226004	152226004	PNMA3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12058	203
CEP350	9857	broad.mit.edu	37	1	180063502	180063505	+	Frame_Shift_Del	DEL	GACA	-	-			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180063502_180063505delGACA	uc001gnt.2	+	34	8645_8648	c.8262_8265delGACA	c.(8260-8265)CTGACAfs	p.L2754fs	CEP350_uc009wxl.2_Frame_Shift_Del_p.L2753fs|CEP350_uc001gnv.2_Frame_Shift_Del_p.L889fs|CEP350_uc001gnw.1_Frame_Shift_Del_p.L511fs|CEP350_uc001gnx.1_Frame_Shift_Del_p.L511fs	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2754_2755						centrosome|nucleus|spindle				ovary(4)	4						TCAGCTTACTGACAGACAGTTTAC	0.358																0.30			17	40		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	180063502	180063505	CEP350	1	GACA	-	-	-	1	0	1	0	1	0	0	0	0	574	45	5	5	3222	203
HIST1H1C	3006	broad.mit.edu	37	6	26056237	26056245	+	In_Frame_Del	DEL	CTTCTTGGG	-	-	rs149712381	by1000genomes	TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26056237_26056245delCTTCTTGGG	uc003nfw.2	-	1	455_463	c.412_420delCCCAAGAAG	c.(412-420)CCCAAGAAGdel	p.PKK138del		NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c	138_140					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						CGCCAGCCGCCTTCTTGGGCTTCTTGGCT	0.565																0.25			59	178		---	---	---	---						capture_indel	In_Frame_Del	DEL	26056237	26056245	HIST1H1C	6	CTTCTTGGG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	7049	203
UBE3C	9690	broad.mit.edu	37	7	157041080	157041081	+	In_Frame_Ins	INS	-	TGG	TGG			TCGA-27-2526-01	TCGA-27-2526-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157041080_157041081insTGG	uc010lqs.2	+	19	2812_2813	c.2500_2501insTGG	c.(2500-2502)CTG>CTGGTG	p.835_836insV	UBE3C_uc003wni.3_In_Frame_Ins_p.198_199insV	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	835_836	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TGAGAACATGCTGGTGGAGCTG	0.470																0.14			56	344		---	---	---	---						capture_indel	In_Frame_Ins	INS	157041080	157041081	UBE3C	7	-	TGG	TGG	TGG	1	0	1	1	0	0	0	0	0	363	28	5	5	16763	203
