Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TAS1R2	80834	broad.mit.edu	37	1	19181421	19181421	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19181421C>T	uc001bba.1	-	3	544	c.543G>A	c.(541-543)CTG>CTA	p.L181L		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	181	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GTGTGGTACGCAGCAAAGCCG	0.622																0.123077	7.453686	16.494615	8	57	KEEP	---	---	---	---	4	4	30	33	-1	capture	Silent	SNP	19181421	19181421	TAS1R2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	15451	204
COL16A1	1307	broad.mit.edu	37	1	32126216	32126216	+	Silent	SNP	G	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32126216G>T	uc001btk.1	-	62	4214	c.3849C>A	c.(3847-3849)CCC>CCA	p.P1283P	COL16A1_uc001bti.1_5'UTR|COL16A1_uc001btj.1_Silent_p.P1081P	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1283	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GTCTTCCCTGGGGTCCCATGG	0.547	Colon(143;498 1786 21362 25193 36625)															0.134615	33.284502	53.463109	21	135	KEEP	---	---	---	---	8	14	67	86	0.363636363636	capture	Silent	SNP	32126216	32126216	COL16A1	1	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	3638	204
DAB1	1600	broad.mit.edu	37	1	57491656	57491656	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57491656G>A	uc001cys.1	-	12	1458	c.784C>T	c.(784-786)CCC>TCC	p.P262S	DAB1_uc001cyt.1_Missense_Mutation_p.P260S|DAB1_uc001cyq.1_Missense_Mutation_p.P260S|DAB1_uc001cyr.1_Missense_Mutation_p.P176S|DAB1_uc009vzw.1_Missense_Mutation_p.P244S|DAB1_uc009vzx.1_Missense_Mutation_p.P262S	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	295				P -> S (in Ref. 6; AAH67447).	cell differentiation|nervous system development					skin(2)|ovary(1)	3						ATACTTACGGGGGGAGAGGTT	0.358					395											0.167364	83.857961	108.91227	40	199	KEEP	---	---	---	---	24	20	114	126	-1	capture	Missense_Mutation	SNP	57491656	57491656	DAB1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4177	204
HFM1	164045	broad.mit.edu	37	1	91846537	91846537	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91846537C>T	uc001doa.3	-	7	905	c.805G>A	c.(805-807)GCA>ACA	p.A269T	HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Missense_Mutation_p.A269T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	269							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CTAAATTTTGCCGCTTACAAT	0.209																0.023952	-34.689665	7.320386	4	163	KEEP	---	---	---	---	1	4	80	109	-1	capture	Missense_Mutation	SNP	91846537	91846537	HFM1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7008	204
CCDC18	343099	broad.mit.edu	37	1	93649564	93649564	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93649564C>T	uc001dpq.2	+	3	686	c.518C>T	c.(517-519)GCC>GTC	p.A173V		NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	55										ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCTGATTATGCCCCTAATCCT	0.323																0.029851	-25.9253	6.610477	4	130	KEEP	---	---	---	---	1	3	73	85	-1	capture	Missense_Mutation	SNP	93649564	93649564	CCDC18	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2768	204
PHGDH	26227	broad.mit.edu	37	1	120285535	120285535	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120285535C>G	uc001ehz.2	+	11	1542	c.1315C>G	c.(1315-1317)CAA>GAA	p.Q439E	PHGDH_uc009whm.2_Missense_Mutation_p.Q337E|PHGDH_uc001eia.2_Missense_Mutation_p.Q438E|PHGDH_uc009whn.2_Intron|PHGDH_uc001eib.2_Missense_Mutation_p.Q405E|PHGDH_uc001eic.2_RNA	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	439					brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	GGGCTTGGTCCAAGGCACTAC	0.657																0.122222	11.363642	23.951131	11	79	KEEP	---	---	---	---	5	7	44	41	-1	capture	Missense_Mutation	SNP	120285535	120285535	PHGDH	1	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	11744	204
YY1AP1	55249	broad.mit.edu	37	1	155629578	155629578	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155629578C>G	uc001fln.2	-	11	2285	c.2261G>C	c.(2260-2262)GGA>GCA	p.G754A	YY1AP1_uc001flg.2_Missense_Mutation_p.G493A|YY1AP1_uc010pgg.1_Missense_Mutation_p.G593A|YY1AP1_uc010pgh.1_Missense_Mutation_p.G697A|YY1AP1_uc010pgi.1_Missense_Mutation_p.G846A|YY1AP1_uc001flh.2_Missense_Mutation_p.G826A|YY1AP1_uc009wqt.2_Missense_Mutation_p.G677A|YY1AP1_uc001flk.2_Missense_Mutation_p.G697A|YY1AP1_uc001fll.2_Missense_Mutation_p.G708A|YY1AP1_uc009wqv.2_Missense_Mutation_p.G425A|YY1AP1_uc001flm.2_Missense_Mutation_p.G697A|YY1AP1_uc001fli.2_Missense_Mutation_p.G708A|YY1AP1_uc009wqu.2_Missense_Mutation_p.G541A|YY1AP1_uc001flj.2_Missense_Mutation_p.G688A|YY1AP1_uc009wqw.2_Missense_Mutation_p.G677A|YY1AP1_uc001flo.2_Missense_Mutation_p.G642A|YY1AP1_uc001flp.2_Missense_Mutation_p.G708A	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	754					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGCTTGCCTTCCCTCCTCTGT	0.527																0.066964	-4.899859	38.565293	15	209	KEEP	---	---	---	---	4	12	114	110	-1	capture	Missense_Mutation	SNP	155629578	155629578	YY1AP1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	17389	204
CFHR3	10878	broad.mit.edu	37	1	196749091	196749091	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196749091T>C	uc001gtl.2	+	3	505	c.418T>C	c.(418-420)TGC>CGC	p.C140R	CFHR3_uc001gtk.2_Missense_Mutation_p.C140R|CFHR3_uc010poy.1_Missense_Mutation_p.C140R|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor	140	Sushi 2.					extracellular space					0						TACTCCCAGATGCATCCGTGT	0.493																0.289855	55.673152	58.403311	20	49	KEEP	---	---	---	---	10	14	26	32	-1	capture	Missense_Mutation	SNP	196749091	196749091	CFHR3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	3252	204
CFHR3	10878	broad.mit.edu	37	1	196749101	196749101	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196749101T>A	uc001gtl.2	+	3	515	c.428T>A	c.(427-429)GTC>GAC	p.V143D	CFHR3_uc001gtk.2_Missense_Mutation_p.V143D|CFHR3_uc010poy.1_Missense_Mutation_p.V143D|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor	143				V -> D (in Ref. 1; CAA48639).		extracellular space					0						TGCATCCGTGTCAGTAAGTAC	0.478																0.257576	43.744518	47.259696	17	49	KEEP	---	---	---	---	9	11	28	31	-1	capture	Missense_Mutation	SNP	196749101	196749101	CFHR3	1	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	3252	204
OR2G2	81470	broad.mit.edu	37	1	247752159	247752159	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247752159C>T	uc010pyy.1	+	1	498	c.498C>T	c.(496-498)ACC>ACT	p.T166T		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCACCCTCACCCTGCAGCTGC	0.542																0.024561	-59.930737	11.596511	7	278	KEEP	---	---	---	---	3	4	164	154	-1	capture	Silent	SNP	247752159	247752159	OR2G2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	10902	204
PDCD11	22984	broad.mit.edu	37	10	105176336	105176336	+	Missense_Mutation	SNP	A	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105176336A>G	uc001kwy.1	+	13	1694	c.1607A>G	c.(1606-1608)TAT>TGT	p.Y536C		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	536					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ATTACCTGCTATGCCGATGCC	0.493					545									OREG0020494	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.099476	22.187462	52.80316	19	172	KEEP	---	---	---	---	10	13	83	101	-1	capture	Missense_Mutation	SNP	105176336	105176336	PDCD11	10	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11520	204
KIAA1598	57698	broad.mit.edu	37	10	118671332	118671332	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118671332T>G	uc009xyw.2	-	14	1826	c.1328A>C	c.(1327-1329)GAA>GCA	p.E443A	KIAA1598_uc001lcz.3_Missense_Mutation_p.E443A|KIAA1598_uc010qso.1_Missense_Mutation_p.E383A|KIAA1598_uc010qsp.1_Missense_Mutation_p.E443A|KIAA1598_uc010qsq.1_Missense_Mutation_p.E383A|KIAA1598_uc001lcy.3_Missense_Mutation_p.E413A	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a	443					axon guidance	axon					0				all cancers(201;0.00494)		CACTGCACTTTCGCAGCCTTT	0.299																0.144737	50.047228	68.50628	22	130	KEEP	---	---	---	---	11	21	68	81	-1	capture	Missense_Mutation	SNP	118671332	118671332	KIAA1598	10	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	8168	204
CPXM2	119587	broad.mit.edu	37	10	125506512	125506512	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:125506512C>T	uc001lhk.1	-	14	2364	c.2039G>A	c.(2038-2040)CGC>CAC	p.R680H	CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	680					cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GTTCAGGAGGCGCCAGTAATC	0.547																0.192182	128.968219	156.11991	59	248	KEEP	---	---	---	---	39	29	131	160	-1	capture	Missense_Mutation	SNP	125506512	125506512	CPXM2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3803	204
HPS5	11234	broad.mit.edu	37	11	18309168	18309168	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18309168C>T	uc001mod.1	-	18	2909	c.2631G>A	c.(2629-2631)TCG>TCA	p.S877S	HPS5_uc001moe.1_Silent_p.S763S|HPS5_uc001mof.1_Silent_p.S763S	NM_181507	NP_852608	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a	877						cytosol				ovary(1)|pancreas(1)|skin(1)	3						GTATGATATCCGATGGCAAAA	0.408												Hermansky-Pudlak_syndrome				0.164062	45.396676	59.111562	21	107	KEEP	---	---	---	---	10	13	42	75	-1	capture	Silent	SNP	18309168	18309168	HPS5	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7267	204
EXT2	2132	broad.mit.edu	37	11	44129545	44129545	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:44129545C>T	uc001mxz.2	+	2	617	c.283C>T	c.(283-285)CGC>TGC	p.R95C	EXT2_uc010rfo.1_Missense_Mutation_p.R123C|EXT2_uc001mxy.2_Missense_Mutation_p.R108C|EXT2_uc009ykt.2_Missense_Mutation_p.R95C|EXT2_uc001mya.2_Missense_Mutation_p.R128C	NM_207122	NP_997005	Q93063	EXT2_HUMAN	exostosin 2 isoform 2	95	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5						TGATGTCTATCGCTGTGGCTT	0.512					271	Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				0.169231	22.283965	29.015968	11	54	KEEP	---	---	---	---	6	7	25	30	-1	capture	Missense_Mutation	SNP	44129545	44129545	EXT2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5279	204
OR4A5	81318	broad.mit.edu	37	11	51412077	51412077	+	Missense_Mutation	SNP	C	T	T	rs5002407		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:51412077C>T	uc001nhi.1	-	1	319	c.319G>A	c.(319-321)GGG>AGG	p.G107R		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				ACCTCAGCCCCACCAAAGAAA	0.443																0.161905	33.211254	44.625594	17	88	KEEP	---	---	---	---	6	12	55	43	-1	capture	Missense_Mutation	SNP	51412077	51412077	OR4A5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10947	204
MMP13	4322	broad.mit.edu	37	11	102816396	102816396	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102816396C>A	uc001phl.2	-	9	1322	c.1294G>T	c.(1294-1296)GAT>TAT	p.D432Y		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	432	Hemopexin-like 4.	Calcium 3; via carbonyl oxygen (By similarity).			collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		TAGACAGCATCTACTTTATCA	0.328																0.154762	40.82963	59.978441	26	142	KEEP	---	---	---	---	11	16	71	95	0.592592592593	capture	Missense_Mutation	SNP	102816396	102816396	MMP13	11	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	9564	204
MMP13	4322	broad.mit.edu	37	11	102826101	102826101	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102826101C>T	uc001phl.2	-	2	270	c.242G>A	c.(241-243)GGC>GAC	p.G81D		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	81					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		GTCAAGTTTGCCAGTCACCTC	0.473																0.013661	-91.038685	7.63087	5	361	KEEP	---	---	---	---	3	2	226	183	-1	capture	Missense_Mutation	SNP	102826101	102826101	MMP13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9564	204
OR10G8	219869	broad.mit.edu	37	11	123900834	123900834	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123900834G>A	uc001pzp.1	+	1	505	c.505G>A	c.(505-507)GGA>AGA	p.G169R		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	169	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GCCCTACTGTGGACCCAACTG	0.537																0.017857	-65.35701	8.018002	5	275	KEEP	---	---	---	---	2	3	166	146	-1	capture	Missense_Mutation	SNP	123900834	123900834	OR10G8	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	10807	204
CACNA1C	775	broad.mit.edu	37	12	2716164	2716164	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2716164C>T	uc009zdu.1	+	27	3597	c.3284C>T	c.(3283-3285)ACG>ATG	p.T1095M	CACNA1C_uc009zdv.1_Missense_Mutation_p.T1072M|CACNA1C_uc001qkb.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkc.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qke.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkf.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qjz.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkd.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkg.2_Missense_Mutation_p.T1075M|CACNA1C_uc009zdw.1_Missense_Mutation_p.T1075M|CACNA1C_uc001qkh.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkl.2_Missense_Mutation_p.T1095M|CACNA1C_uc001qkn.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qko.2_Missense_Mutation_p.T1095M|CACNA1C_uc001qkp.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkr.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qku.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkq.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qks.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qkt.2_Missense_Mutation_p.T1075M|CACNA1C_uc001qka.1_Missense_Mutation_p.T610M|CACNA1C_uc001qki.1_Missense_Mutation_p.T811M|CACNA1C_uc001qkj.1_Missense_Mutation_p.T811M|CACNA1C_uc001qkk.1_Missense_Mutation_p.T811M|CACNA1C_uc001qkm.1_Missense_Mutation_p.T811M	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1095	Extracellular (Potential).|III.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	AACTACATCACGTACAAAGAC	0.557																0.175676	26.531081	33.8692	13	61	KEEP	---	---	---	---	5	9	37	38	-1	capture	Missense_Mutation	SNP	2716164	2716164	CACNA1C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2516	204
C1S	716	broad.mit.edu	37	12	7174399	7174399	+	Missense_Mutation	SNP	T	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7174399T>A	uc001qsj.2	+	12	1763	c.1044T>A	c.(1042-1044)AGT>AGA	p.S348R	C1S_uc001qsk.2_Missense_Mutation_p.S348R|C1S_uc001qsl.2_Missense_Mutation_p.S348R|C1S_uc009zfr.2_Missense_Mutation_p.S181R|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	348	Sushi 1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GAAAGTGGAGTAATTCCAAAC	0.368	GBM(156;750 1943 12971 24779 31015)															0.120482	24.387525	47.841083	20	146	KEEP	---	---	---	---	10	10	78	89	-1	capture	Missense_Mutation	SNP	7174399	7174399	C1S	12	T	A	A	A	1	0	0	0	0	1	0	0	0	738	57	4	4	1956	204
SYT10	341359	broad.mit.edu	37	12	33538180	33538180	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:33538180G>A	uc001rll.1	-	4	1421	c.1124C>T	c.(1123-1125)CCG>CTG	p.P375L	SYT10_uc009zju.1_Missense_Mutation_p.P185L	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	375	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					CCCAGCCGTCGGTAGGTAACA	0.438																0.185185	59.106331	71.640829	25	110	KEEP	---	---	---	---	9	17	55	59	-1	capture	Missense_Mutation	SNP	33538180	33538180	SYT10	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15354	204
C12orf68	387856	broad.mit.edu	37	12	48578422	48578422	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48578422C>T	uc001rrj.2	+	1	1057	c.517C>T	c.(517-519)CCA>TCA	p.P173S		NM_001013635	NP_001013657	Q52MB2	CL068_HUMAN	hypothetical protein LOC387856	173						cytoplasm				central_nervous_system(1)	1						GGGGGACGGGCCACTTGTGGA	0.607																0.25	8.491152	9.40129	4	12	KEEP	---	---	---	---	1	3	3	10	-1	capture	Missense_Mutation	SNP	48578422	48578422	C12orf68	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1696	204
SCN8A	6334	broad.mit.edu	37	12	52180608	52180608	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52180608G>A	uc001ryw.2	+	22	4403	c.4225G>A	c.(4225-4227)GTA>ATA	p.V1409I	SCN8A_uc010snl.1_Missense_Mutation_p.V1233I|SCN8A_uc001rza.1_RNA	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1409	III.				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	CCTTCTTCAAGTAGTAAGTAG	0.403																0.088889	1.663651	9.348618	4	41	KEEP	---	---	---	---	0	5	27	20	-1	capture	Missense_Mutation	SNP	52180608	52180608	SCN8A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	13817	204
KIAA0748	9840	broad.mit.edu	37	12	55356553	55356553	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55356553C>T	uc001sgn.3	-	9	1239	c.1129G>A	c.(1129-1131)GCA>ACA	p.A377T	KIAA0748_uc001sgl.3_Missense_Mutation_p.A239T|KIAA0748_uc001sgm.3_Missense_Mutation_p.A124T|KIAA0748_uc010spb.1_Missense_Mutation_p.A124T|KIAA0748_uc010spc.1_Missense_Mutation_p.A239T|KIAA0748_uc010spd.1_Missense_Mutation_p.A377T|KIAA0748_uc001sgo.3_RNA	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	377								p.T377N(1)		ovary(1)|central_nervous_system(1)	2						TGGGATGGTGCTAGCACTGTG	0.527																0.146552	31.894481	45.8233	17	99	KEEP	---	---	---	---	5	14	46	57	-1	capture	Missense_Mutation	SNP	55356553	55356553	KIAA0748	12	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8112	204
GPR109A	338442	broad.mit.edu	37	12	123187080	123187080	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123187080G>A	uc001ucx.1	-	1	825	c.751C>T	c.(751-753)CGG>TGG	p.R251W	GPR81_uc001ucw.1_Intron	NM_177551	NP_808219	Q8TDS4	HCAR2_HUMAN	G protein-coupled receptor 109A	251	Extracellular (Potential).				negative regulation of lipid catabolic process|neutrophil apoptosis|positive regulation of adiponectin secretion|positive regulation of neutrophil apoptosis	integral to membrane|plasma membrane	nicotinic acid receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	ATGCGGATCCGCACAACCACG	0.542																0.149123	30.512648	43.965473	17	97	KEEP	---	---	---	---	8	11	52	69	-1	capture	Missense_Mutation	SNP	123187080	123187080	GPR109A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	6559	204
KLHL1	57626	broad.mit.edu	37	13	70535514	70535514	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:70535514G>A	uc001vip.2	-	3	1537	c.743C>T	c.(742-744)GCC>GTC	p.A248V	KLHL1_uc010thm.1_Missense_Mutation_p.A187V	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	248	BTB.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTCTTGCTTGGCTTCACAAAC	0.413																0.164474	45.824857	62.036437	25	127	KEEP	---	---	---	---	14	13	62	72	-1	capture	Missense_Mutation	SNP	70535514	70535514	KLHL1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8285	204
SPTB	6710	broad.mit.edu	37	14	65245925	65245925	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65245925C>T	uc001xht.2	-	21	4567	c.4513G>A	c.(4513-4515)GAC>AAC	p.D1505N	SPTB_uc001xhr.2_Missense_Mutation_p.D1505N|SPTB_uc001xhs.2_Missense_Mutation_p.D1505N|SPTB_uc001xhu.2_Missense_Mutation_p.D1505N|SPTB_uc010aqi.2_Missense_Mutation_p.D166N	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1505	Spectrin 12.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GTGCCATAGTCGGCTGACTGG	0.532																0.142857	5.182742	8.624742	4	24	KEEP	---	---	---	---	2	5	21	9	-1	capture	Missense_Mutation	SNP	65245925	65245925	SPTB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15010	204
TYRO3	7301	broad.mit.edu	37	15	41859568	41859568	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41859568C>A	uc001zof.1	+	7	1018	c.794C>A	c.(793-795)GCC>GAC	p.A265D		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	265	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	p.A265G(1)		ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTGACACAGGCCCCAGGAGGC	0.557					1052											0.041096	-42.493312	7.563954	9	210	KEEP	---	---	---	---	6	4	121	136	0.4	capture	Missense_Mutation	SNP	41859568	41859568	TYRO3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	16696	204
SPTBN5	51332	broad.mit.edu	37	15	42168354	42168354	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42168354G>A	uc001zos.2	-	21	4308	c.3975C>T	c.(3973-3975)AGC>AGT	p.S1325S		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1360	Spectrin 10.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGAGTAGCTCGCTCTCAGCTG	0.622																0.15493	19.40915	27.462754	11	60	KEEP	---	---	---	---	9	6	35	39	-1	capture	Silent	SNP	42168354	42168354	SPTBN5	15	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	15014	204
HERC1	8925	broad.mit.edu	37	15	63948489	63948489	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63948489C>T	uc002amp.2	-	49	9816	c.9668G>A	c.(9667-9669)CGA>CAA	p.R3223Q		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3223					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GCACATTAATCGAACTAGCGT	0.532																0.178571	19.735963	25.166804	10	46	KEEP	---	---	---	---	5	6	26	27	-1	capture	Missense_Mutation	SNP	63948489	63948489	HERC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6983	204
TMC3	342125	broad.mit.edu	37	15	81628948	81628948	+	Splice_Site	SNP	A	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81628948A>G	uc002bgo.1	-	20	2203	c.2203_splice	c.e20+1	p.A735_splice	TMC3_uc010blr.1_Splice_Site	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						GGAAATACTTACCTTCTACCA	0.214																0.145669	89.320131	119.967988	37	217	KEEP	---	---	---	---	22	19	117	129	-1	capture	Splice_Site	SNP	81628948	81628948	TMC3	15	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	15871	204
IL34	146433	broad.mit.edu	37	16	70693910	70693910	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70693910C>A	uc002ezh.1	+	6	932	c.549C>A	c.(547-549)AGC>AGA	p.S183R	IL34_uc002ezi.1_Missense_Mutation_p.S182R	NM_152456	NP_689669	Q6ZMJ4	IL34_HUMAN	interleukin 34 precursor	183					positive regulation of cell proliferation|positive regulation of protein phosphorylation	extracellular space	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding			central_nervous_system(1)|skin(1)	2						GTAAACAAAGCTCCGTCCTAA	0.562																0.143885	89.154235	140.075518	60	357	KEEP	---	---	---	---	35	36	216	218	0.507042253521	capture	Missense_Mutation	SNP	70693910	70693910	IL34	16	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	7617	204
TTC25	83538	broad.mit.edu	37	17	40092757	40092757	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40092757G>A	uc002hyj.3	+	4	518	c.429G>A	c.(427-429)GGG>GGA	p.G143G	TTC25_uc010cxt.2_RNA|TTC25_uc010cxs.1_Silent_p.G143G	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25	143						cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				AGAACAAAGGGGACCTCTCCT	0.522																0.219178	40.710046	45.978026	16	57	KEEP	---	---	---	---	12	8	35	29	-1	capture	Silent	SNP	40092757	40092757	TTC25	17	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	16575	204
BZRAP1	9256	broad.mit.edu	37	17	56389930	56389930	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56389930C>G	uc002ivx.3	-	17	3123	c.2252G>C	c.(2251-2253)GGC>GCC	p.G751A	BZRAP1_uc010dcs.2_Missense_Mutation_p.G691A|BZRAP1_uc010wnt.1_Missense_Mutation_p.G751A	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	751						mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTACTGCTGCCACCCCCACC	0.632																0.135135	30.764732	45.070332	15	96	KEEP	---	---	---	---	9	9	55	58	-1	capture	Missense_Mutation	SNP	56389930	56389930	BZRAP1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	1565	204
RYR1	6261	broad.mit.edu	37	19	38990280	38990280	+	Missense_Mutation	SNP	A	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38990280A>C	uc002oit.2	+	44	7163	c.7033A>C	c.(7033-7035)AGC>CGC	p.S2345R	RYR1_uc002oiu.2_Missense_Mutation_p.S2345R|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2345	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCCAGGCGAGAGCGTGGAGGA	0.667																0.1	5.355758	13.330237	5	45	KEEP	---	---	---	---	3	2	33	31	-1	capture	Missense_Mutation	SNP	38990280	38990280	RYR1	19	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	13660	204
CADM4	199731	broad.mit.edu	37	19	44130439	44130439	+	Silent	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44130439T>C	uc002oxc.1	-	5	550	c.501A>G	c.(499-501)GGA>GGG	p.G167G		NM_145296	NP_660339	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4 precursor	167	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion	integral to membrane					0		Prostate(69;0.0199)				TGCTGCTCACTCCTGCCACAC	0.592																0.222222	6.594492	7.992606	4	14	KEEP	---	---	---	---	12	8	8	14	-1	capture	Silent	SNP	44130439	44130439	CADM4	19	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	2545	204
EML2	24139	broad.mit.edu	37	19	46124852	46124852	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46124852G>A	uc002pcn.2	-	10	920	c.885C>T	c.(883-885)GGC>GGT	p.G295G	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Silent_p.G179G|EML2_uc010xxl.1_Silent_p.G442G|EML2_uc010xxm.1_Silent_p.G496G|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Silent_p.G295G|EML2_uc010ekj.2_Missense_Mutation_p.A262V	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	295	WD 5.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CAAACACGCCGCCGTCGTGGG	0.687																0.181818	16.673853	20.858424	8	36	KEEP	---	---	---	---	2	7	22	19	-1	capture	Silent	SNP	46124852	46124852	EML2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5052	204
ZNF324B	388569	broad.mit.edu	37	19	58967238	58967238	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58967238C>T	uc002qsv.1	+	4	1034	c.927C>T	c.(925-927)GGC>GGT	p.G309G	ZNF324B_uc002qsu.1_Silent_p.G299G|ZNF324B_uc010euq.1_Silent_p.G309G	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	309					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TCCACAGCGGCGAGACGCCCT	0.687																0.217391	22.560896	25.923463	10	36	KEEP	---	---	---	---	7	4	31	49	-1	capture	Silent	SNP	58967238	58967238	ZNF324B	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17725	204
NRXN1	9378	broad.mit.edu	37	2	50850508	50850508	+	Missense_Mutation	SNP	C	T	T	rs34326676		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50850508C>T	uc010fbq.2	-	6	2654	c.1177G>A	c.(1177-1179)GGA>AGA	p.G393R	NRXN1_uc002rxb.3_Missense_Mutation_p.G40R|NRXN1_uc002rxe.3_Missense_Mutation_p.G360R|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTAAACTTTCCATTCACAGGC	0.458																0.119266	18.491984	34.00675	13	96	KEEP	---	---	---	---	5	8	38	60	-1	capture	Missense_Mutation	SNP	50850508	50850508	NRXN1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10572	204
PROM2	150696	broad.mit.edu	37	2	95947910	95947910	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:95947910C>T	uc002suh.1	+	14	1797	c.1664C>T	c.(1663-1665)GCG>GTG	p.A555V	PROM2_uc002sui.2_Missense_Mutation_p.A555V|PROM2_uc002suj.2_Missense_Mutation_p.A209V|PROM2_uc002suk.2_Missense_Mutation_p.A555V|PROM2_uc002sul.2_Missense_Mutation_p.A81V|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	555	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						GAAGGGGCAGCGCTCTGGACA	0.627																0.078431	-1.03404	8.224626	4	47	KEEP	---	---	---	---	0	4	20	32	-1	capture	Missense_Mutation	SNP	95947910	95947910	PROM2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12452	204
MCM6	4175	broad.mit.edu	37	2	136630337	136630337	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136630337C>G	uc002tuw.2	-	2	260	c.184G>C	c.(184-186)GTT>CTT	p.V62L		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	62					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	AAACTCACAACCAATGTGTTT	0.403	Ovarian(196;141 2104 8848 24991 25939)															0.066327	-3.486837	34.744146	13	183	KEEP	---	---	---	---	4	11	104	89	-1	capture	Missense_Mutation	SNP	136630337	136630337	MCM6	2	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	9304	204
TTN	7273	broad.mit.edu	37	2	179458739	179458739	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179458739C>T	uc010zfg.1	-	246	50901	c.50677G>A	c.(50677-50679)GTG>ATG	p.V16893M	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V10588M|TTN_uc010zfi.1_Missense_Mutation_p.V10521M|TTN_uc010zfj.1_Missense_Mutation_p.V10396M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17820							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTTCTCCACAACCACACAG	0.403					8722											0.175824	89.51174	116.583752	48	225	KEEP	---	---	---	---	26	27	123	134	-1	capture	Missense_Mutation	SNP	179458739	179458739	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16617	204
ALS2CR12	130540	broad.mit.edu	37	2	202216040	202216040	+	Missense_Mutation	SNP	G	A	A	rs143899839		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202216040G>A	uc010ftg.2	-	2	532	c.88C>T	c.(88-90)CGC>TGC	p.R30C	ALS2CR12_uc002uya.3_Missense_Mutation_p.R30C|ALS2CR12_uc010fth.2_RNA	NM_139163	NP_631902	Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	30					regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						GAGTTCTTGCGTGGTAGTTGA	0.517																0.139785	21.613027	33.266878	13	80	KEEP	---	---	---	---	12	2	48	41	-1	capture	Missense_Mutation	SNP	202216040	202216040	ALS2CR12	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	553	204
THAP4	51078	broad.mit.edu	37	2	242573479	242573479	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242573479G>A	uc002wbt.2	-	2	316	c.93C>T	c.(91-93)GAC>GAT	p.D31D		NM_015963	NP_057047	Q8WY91	THAP4_HUMAN	THAP domain containing 4 isoform 1	31	THAP-type.						DNA binding|metal ion binding				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		GACGTTTTGAGTCCTTTAGGG	0.353																0.180952	78.710622	98.815679	38	172	KEEP	---	---	---	---	19	25	92	96	-1	capture	Silent	SNP	242573479	242573479	THAP4	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	15731	204
ADAMTS1	9510	broad.mit.edu	37	21	28212824	28212824	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:28212824C>A	uc002ymf.2	-	5	1891	c.1436G>T	c.(1435-1437)GGC>GTC	p.G479V		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	479	Disintegrin.				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		GTACGAGGTGCCAGGGAGATC	0.527																0.069767	-3.508766	12.918494	6	80	KEEP	---	---	---	---	3	3	48	57	0.5	capture	Missense_Mutation	SNP	28212824	28212824	ADAMTS1	21	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	255	204
PRAME	23532	broad.mit.edu	37	22	22893261	22893261	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22893261T>C	uc002zwf.2	-	3	428	c.272A>G	c.(271-273)CAT>CGT	p.H91R	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.H75R|PRAME_uc010gtr.2_Missense_Mutation_p.H91R|PRAME_uc002zwg.2_Missense_Mutation_p.H91R|PRAME_uc002zwh.2_Missense_Mutation_p.H91R|PRAME_uc002zwi.2_Missense_Mutation_p.H91R|PRAME_uc002zwj.2_Missense_Mutation_p.H91R|PRAME_uc002zwk.2_Missense_Mutation_p.H91R	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	91					apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		CAGGTGAAGATGTTGTCCCTT	0.582	Melanoma(73;1707 1838 15168 27201)				1184											0.22549	113.047752	127.167159	46	158	KEEP	---	---	---	---	25	23	77	95	-1	capture	Missense_Mutation	SNP	22893261	22893261	PRAME	22	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	12325	204
FANCD2	2177	broad.mit.edu	37	3	10108908	10108908	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10108908T>C	uc003buw.2	+	26	2479	c.2401T>C	c.(2401-2403)TGC>CGC	p.C801R	FANCD2_uc003bux.1_Missense_Mutation_p.C801R|FANCD2_uc003buy.1_Missense_Mutation_p.C801R|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	801					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AAATGCCTTCTGCCAGGAAAC	0.378					587	D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				0.16129	22.708689	29.476594	10	52	KEEP	---	---	---	---	7	7	31	27	-1	capture	Missense_Mutation	SNP	10108908	10108908	FANCD2	3	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	5611	204
IRAK2	3656	broad.mit.edu	37	3	10254939	10254939	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10254939G>A	uc003bve.1	+	5	653	c.577G>A	c.(577-579)GGA>AGA	p.G193R		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	193					activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						GAGCTTGGCTGGAGACAGCCT	0.493					288											0.194245	59.436559	71.566288	27	112	KEEP	---	---	---	---	17	17	66	76	-1	capture	Missense_Mutation	SNP	10254939	10254939	IRAK2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	7746	204
FGD5	152273	broad.mit.edu	37	3	14862951	14862951	+	Silent	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862951C>A	uc003bzc.2	+	1	2483	c.2373C>A	c.(2371-2373)CCC>CCA	p.P791P	FGD5_uc011avk.1_Silent_p.P791P	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	791					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	p.A791A(1)		ovary(3)|kidney(1)|pancreas(1)	5						AGATTCCACCCCGGAGACCTG	0.537																0.109434	23.81319	63.826822	29	236	KEEP	---	---	---	---	10	24	116	170	0.705882352941	capture	Silent	SNP	14862951	14862951	FGD5	3	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	5782	204
XIRP1	165904	broad.mit.edu	37	3	39229284	39229284	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39229284C>T	uc003cjk.1	-	2	1874	c.1653G>A	c.(1651-1653)CGG>CGA	p.R551R	XIRP1_uc003cji.2_Silent_p.R551R|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	551	Interaction with CTNNB1 (By similarity).|Xin 12.						actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAAAAAGCCACCGAGCTGTGC	0.632																0.172727	35.225031	46.302357	19	91	KEEP	---	---	---	---	9	11	50	47	-1	capture	Silent	SNP	39229284	39229284	XIRP1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	223	18	2	2	17310	204
IMPDH2	3615	broad.mit.edu	37	3	49062153	49062153	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49062153G>A	uc003cvt.2	-	12	1470	c.1378C>T	c.(1378-1380)CTG>TTG	p.L460L		NM_000884	NP_000875	P12268	IMDH2_HUMAN	inosine monophosphate dehydrogenase 2	460					GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	IMP dehydrogenase activity|metal ion binding|nucleotide binding|protein binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)	CCAGCAATCAGGTAAGGGACA	0.552																0.076305	1.615933	47.413625	19	230	KEEP	---	---	---	---	8	12	113	139	-1	capture	Silent	SNP	49062153	49062153	IMPDH2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7650	204
PBRM1	55193	broad.mit.edu	37	3	52595840	52595840	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52595840G>A	uc003des.2	-	25	4243	c.4231C>T	c.(4231-4233)CGC>TGC	p.R1411C	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.R1411C|PBRM1_uc003der.2_Missense_Mutation_p.R1379C|PBRM1_uc003det.2_Missense_Mutation_p.R1426C|PBRM1_uc003deu.2_Missense_Mutation_p.R1426C|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.R1411C|PBRM1_uc010hmk.1_Missense_Mutation_p.R1386C|PBRM1_uc003dey.2_Missense_Mutation_p.R1359C|PBRM1_uc003dez.1_Missense_Mutation_p.R1410C	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1411	HMG box.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CCCACCAGGCGGCTGAGCTCC	0.498						Mis|N|F|S|D|O		clear cell renal carcinoma|breast								0.156371	160.942227	219.322772	81	437	KEEP	---	---	---	---	41	48	223	254	-1	capture	Missense_Mutation	SNP	52595840	52595840	PBRM1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11394	204
FNDC3B	64778	broad.mit.edu	37	3	172065012	172065012	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172065012G>C	uc003fhy.2	+	21	2547	c.2375G>C	c.(2374-2376)AGT>ACT	p.S792T	FNDC3B_uc003fhz.3_Missense_Mutation_p.S792T	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	792	Fibronectin type-III 6.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGTCCTGATAGTTCTGGTGCT	0.398																0.023437	-49.893283	14.810579	6	250	KEEP	---	---	---	---	4	2	141	142	-1	capture	Missense_Mutation	SNP	172065012	172065012	FNDC3B	3	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	5914	204
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	G	G	rs121913279		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178952085A>G	uc003fjk.2	+	21	3297	c.3140A>G	c.(3139-3141)CAT>CGT	p.H1047R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGATGCACATCATGGTGGC	0.378	Colon(199;1504 1750 3362 26421 31210 32040)	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	p.H1047R(LS180-Tumor)|p.H1047R(UACC893-Tumor)|p.H1047R(HSC2-Tumor)|p.H1047R(BT20-Tumor)|p.H1047R(SKOV3-Tumor)|p.H1047L(GP2D-Tumor)|p.H1047R(T47D-Tumor)|p.H1047R(SNU840-Tumor)|p.H1047R(CAL148-Tumor)|p.H1047R(HCT116-Tumor)|p.H1047R(SNUC5-Tumor)|p.H1047R(MCAS-Tumor)|p.H1047R(SNU1076-Tumor)|p.H1047R(HCC1954-Tumor)|p.H1047L(OAW42-Tumor)|p.H1047L(EFM19-Tumor)|p.H1047R(RKO-Tumor)|p.H1047R(CAL29-Tumor)|p.H1047R(CAL33-Tumor)|p.H1047R(MDAMB453-Tumor)|p.H1047R(NCIH1048-Tumor)|p.H1047R(SNU407-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.096154	8.471402	25.478876	10	94	KEEP	---	---	---	---	5	7	50	51	-1	capture	Missense_Mutation	SNP	178952085	178952085	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11816	204
IL1RAP	3556	broad.mit.edu	37	3	190345166	190345166	+	Missense_Mutation	SNP	G	A	A	rs138101360		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:190345166G>A	uc003fsm.1	+	8	1036	c.830G>A	c.(829-831)CGC>CAC	p.R277H	IL1RAP_uc003fsk.2_Missense_Mutation_p.R277H|IL1RAP_uc003fsl.2_Missense_Mutation_p.R277H|IL1RAP_uc010hzf.2_Missense_Mutation_p.R136H|IL1RAP_uc010hzg.1_Missense_Mutation_p.R277H|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.R277H|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Missense_Mutation_p.R277H	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	277	Extracellular (Potential).|Ig-like C2-type 3.				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		ATGGATTCTCGCAATGAGGTT	0.348				p.R277H(SNUC2A-Tumor)	227											0.153409	48.409439	68.631534	27	149	KEEP	---	---	---	---	14	16	90	88	-1	capture	Missense_Mutation	SNP	190345166	190345166	IL1RAP	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7583	204
MUC4	4585	broad.mit.edu	37	3	195505813	195505813	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505813T>C	uc011bto.1	-	3	12714	c.12254A>G	c.(12253-12255)GAC>GGC	p.D4085G	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.592																0.2	5.747003	6.581845	2	8	KEEP	---	---	---	---	1	1	6	4	-1	capture	Missense_Mutation	SNP	195505813	195505813	MUC4	3	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	9888	204
UGT2B11	10720	broad.mit.edu	37	4	70079956	70079956	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70079956G>A	uc003heh.2	-	1	494	c.485C>T	c.(484-486)GCG>GTG	p.A162V	uc003hei.1_Intron	NM_001073	NP_001064	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family,	162					estrogen metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	p.A162A(1)		ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3						GTTAAGTAGCGCAGCCAGCAG	0.423																0.229299	82.421945	92.97157	36	121	KEEP	---	---	---	---	17	25	77	75	-1	capture	Missense_Mutation	SNP	70079956	70079956	UGT2B11	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16839	204
ADAM29	11086	broad.mit.edu	37	4	175897289	175897289	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897289G>A	uc003iuc.2	+	5	1283	c.613G>A	c.(613-615)GTC>ATC	p.V205I	ADAM29_uc003iud.2_Missense_Mutation_p.V205I|ADAM29_uc010irr.2_Missense_Mutation_p.V205I|ADAM29_uc011cki.1_Missense_Mutation_p.V205I	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	205	Peptidase M12B.|Extracellular (Potential).		V -> I (in a colorectal cancer sample; somatic mutation).		proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	p.V205I(1)		skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AATTGTAGTCGTCATTGATAA	0.348	Ovarian(140;1727 1835 21805 25838 41440)			p.V205I(SNUC5-Tumor)|p.V205I(HCC2279-Tumor)	106											0.149068	39.987953	59.025351	24	137	KEEP	---	---	---	---	20	6	70	77	-1	capture	Missense_Mutation	SNP	175897289	175897289	ADAM29	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	247	204
TMEM174	134288	broad.mit.edu	37	5	72469396	72469396	+	Missense_Mutation	SNP	C	T	T	rs34059261	byFrequency	TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72469396C>T	uc010izc.2	+	1	374	c.326C>T	c.(325-327)CCG>CTG	p.P109L		NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	109						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GAAAGGGTCCCGGACTCGGAA	0.527																0.147959	53.086326	76.375475	29	167	KEEP	---	---	---	---	17	14	95	94	-1	capture	Missense_Mutation	SNP	72469396	72469396	TMEM174	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15973	204
EGR1	1958	broad.mit.edu	37	5	137803019	137803019	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137803019C>A	uc003ldb.1	+	2	1151	c.881C>A	c.(880-882)GCC>GAC	p.A294D	EGR1_uc011cyu.1_Intron	NM_001964	NP_001955	P18146	EGR1_HUMAN	early growth response 1	294					cellular response to heparin|cellular response to mycophenolic acid|glomerular mesangial cell proliferation|interleukin-1-mediated signaling pathway|positive regulation of glomerular metanephric mesangial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of protein sumoylation|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytoplasm|nucleus	histone acetyltransferase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACTATTAAGGCCTTTGCCACT	0.627																0.174089	78.25297	103.095818	43	204	KEEP	---	---	---	---	21	29	122	130	0.58	capture	Missense_Mutation	SNP	137803019	137803019	EGR1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	4926	204
DSP	1832	broad.mit.edu	37	6	7583937	7583937	+	Missense_Mutation	SNP	G	A	A	rs144539278		TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7583937G>A	uc003mxp.1	+	24	6721	c.6442G>A	c.(6442-6444)GCC>ACC	p.A2148T	DSP_uc003mxq.1_Missense_Mutation_p.A1549T	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2148	Plectin 4.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAAGATGTCGCCTTGGCCCG	0.478																0.22973	79.401864	89.294404	34	114	KEEP	---	---	---	---	23	13	49	67	-1	capture	Missense_Mutation	SNP	7583937	7583937	DSP	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4736	204
HIST1H2AM	8336	broad.mit.edu	37	6	27860752	27860752	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27860752A>T	uc003nkb.1	-	1	212	c.176T>A	c.(175-177)CTA>CAA	p.L59Q	HIST1H3J_uc003nka.2_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003514	NP_003505	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	59					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			ovary(2)	2						CTCGGCAGTTAGGTACTCCAG	0.662																0.086667	2.083567	28.016099	13	137	KEEP	---	---	---	---	14	2	74	91	-1	capture	Missense_Mutation	SNP	27860752	27860752	HIST1H2AM	6	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	7064	204
NEU1	4758	broad.mit.edu	37	6	31830506	31830506	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31830506C>T	uc003nxq.3	-	1	204	c.48G>A	c.(46-48)GGG>GGA	p.G16G	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_RNA|NEU1_uc010jth.2_5'UTR|NEU1_uc003nxs.3_Silent_p.G16G	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	16						cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	GAATCCGCGGCCCCCAGCGTC	0.662																0.189189	26.998305	33.621145	14	60	KEEP	---	---	---	---	5	9	29	47	-1	capture	Silent	SNP	31830506	31830506	NEU1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	10248	204
PKHD1	5314	broad.mit.edu	37	6	51751972	51751972	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51751972C>T	uc003pah.1	-	44	7344	c.7068G>A	c.(7066-7068)CCG>CCA	p.P2356P	PKHD1_uc010jzn.1_Silent_p.P339P|PKHD1_uc003pai.2_Silent_p.P2356P	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2356	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	p.P2356P(1)		lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AGGAAAGAAGCGGAGCTTGTG	0.388				p.P2356P(JHUEM1-Tumor)	1537											0.189024	63.048265	77.873438	31	133	KEEP	---	---	---	---	11	21	73	69	-1	capture	Silent	SNP	51751972	51751972	PKHD1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11874	204
C6orf165	154313	broad.mit.edu	37	6	88170826	88170826	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:88170826G>A	uc003plv.2	+	12	1673	c.1581G>A	c.(1579-1581)ACG>ACA	p.T527T	SLC35A1_uc003plx.2_RNA|C6orf165_uc003plw.2_Silent_p.T339T|C6orf165_uc010kbv.1_RNA	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1	527										central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TGCCACCAACGATTGTGAGAT	0.328																0.204545	42.500002	49.627916	18	70	KEEP	---	---	---	---	5	16	44	37	-1	capture	Silent	SNP	88170826	88170826	C6orf165	6	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	2318	204
SDK1	221935	broad.mit.edu	37	7	4215452	4215452	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4215452T>C	uc003smx.2	+	34	5121	c.4982T>C	c.(4981-4983)ATG>ACG	p.M1661T	SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Missense_Mutation_p.M148T	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1661	Fibronectin type-III 10.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACATCGACGATGTGTGAACTA	0.582																0.1	10.878694	36.457119	16	144	KEEP	---	---	---	---	10	8	72	86	-1	capture	Missense_Mutation	SNP	4215452	4215452	SDK1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	13861	204
GPR141	353345	broad.mit.edu	37	7	37780665	37780665	+	Missense_Mutation	SNP	C	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37780665C>G	uc003tfm.1	+	1	670	c.670C>G	c.(670-672)CAG>GAG	p.Q224E	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	224	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						GTTCTGGGCTCAGCTGAAAAA	0.438					74											0.051873	-24.039949	49.652242	18	329	KEEP	---	---	---	---	10	8	168	198	-1	capture	Missense_Mutation	SNP	37780665	37780665	GPR141	7	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	6583	204
GLI3	2737	broad.mit.edu	37	7	42004153	42004153	+	Silent	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42004153G>A	uc011kbh.1	-	15	4609	c.4518C>T	c.(4516-4518)TTC>TTT	p.F1506F	GLI3_uc011kbg.1_Silent_p.F1447F	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1506	Asp/Glu-rich (acidic).				negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						TGATGGCATCGAAGTCAATCT	0.552				p.F1506F(HT115-Tumor)|p.F1506F(SNU81-Tumor)	806							Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				0.178947	33.519728	42.735182	17	78	KEEP	---	---	---	---	8	13	46	57	-1	capture	Silent	SNP	42004153	42004153	GLI3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	6375	204
SEMA3E	9723	broad.mit.edu	37	7	83095907	83095907	+	Missense_Mutation	SNP	G	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:83095907G>T	uc003uhy.1	-	4	813	c.347C>A	c.(346-348)GCA>GAA	p.A116E		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	116	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				AACATAATTTGCACATTCACC	0.388																0.07767	-0.687871	18.108562	8	95	KEEP	---	---	---	---	5	6	54	51	0.454545454545	capture	Missense_Mutation	SNP	83095907	83095907	SEMA3E	7	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	13921	204
SAMD9L	219285	broad.mit.edu	37	7	92763418	92763418	+	Missense_Mutation	SNP	T	G	G			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92763418T>G	uc003umh.1	-	5	3083	c.1867A>C	c.(1867-1869)AAA>CAA	p.K623Q	SAMD9L_uc003umj.1_Missense_Mutation_p.K623Q|SAMD9L_uc003umi.1_Missense_Mutation_p.K623Q|SAMD9L_uc010lfb.1_Missense_Mutation_p.K623Q|SAMD9L_uc003umk.1_Missense_Mutation_p.K623Q|SAMD9L_uc010lfc.1_Missense_Mutation_p.K623Q|SAMD9L_uc010lfd.1_Missense_Mutation_p.K623Q|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	623										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GATTTTAGTTTAAGGATAGTG	0.383																0.04918	-24.022856	41.78731	15	290	KEEP	---	---	---	---	4	15	171	155	-1	capture	Missense_Mutation	SNP	92763418	92763418	SAMD9L	7	T	G	G	G	1	0	0	0	0	1	0	0	0	793	61	4	4	13719	204
TRRAP	8295	broad.mit.edu	37	7	98581850	98581850	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98581850G>A	uc003upp.2	+	60	9378	c.9169G>A	c.(9169-9171)GCT>ACT	p.A3057T	TRRAP_uc011kis.1_Missense_Mutation_p.A3028T|TRRAP_uc003upr.2_Missense_Mutation_p.A2745T	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3057	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGTCAATGTAGCTCTGGATAT	0.448					1847											0.141538	76.620398	116.911289	46	279	KEEP	---	---	---	---	34	21	143	176	-1	capture	Missense_Mutation	SNP	98581850	98581850	TRRAP	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	16484	204
ZCWPW1	55063	broad.mit.edu	37	7	99998699	99998699	+	Missense_Mutation	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99998699C>T	uc003uut.2	-	18	2133	c.1885G>A	c.(1885-1887)GGG>AGG	p.G629R	ZCWPW1_uc011kjq.1_Missense_Mutation_p.G509R|ZCWPW1_uc003uur.2_3'UTR|ZCWPW1_uc003uus.2_Missense_Mutation_p.G458R|ZCWPW1_uc011kjr.1_3'UTR|ZCWPW1_uc011kjp.1_RNA	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	629							zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGCAGCTCCCCGCTCTGCCCC	0.602																0.066667	-3.718604	13.794122	6	84	KEEP	---	---	---	---	4	4	49	47	-1	capture	Missense_Mutation	SNP	99998699	99998699	ZCWPW1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17477	204
NEFM	4741	broad.mit.edu	37	8	24772136	24772136	+	Missense_Mutation	SNP	T	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24772136T>C	uc003xed.3	+	1	863	c.830T>C	c.(829-831)CTC>CCC	p.L277P	NEFM_uc011lac.1_Missense_Mutation_p.L277P|NEFM_uc010lue.2_5'Flank|uc010luc.1_5'UTR	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	277	Rod.|Coil 2A.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		CGCTCCCAGCTCGAAAGCCAC	0.587																0.035714	-12.345328	7.312735	3	81	KEEP	---	---	---	---	0	5	47	54	-1	capture	Missense_Mutation	SNP	24772136	24772136	NEFM	8	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10223	204
ANK1	286	broad.mit.edu	37	8	41753935	41753935	+	Missense_Mutation	SNP	G	C	C			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41753935G>C	uc003xom.2	-	1	346	c.64C>G	c.(64-66)CAG>GAG	p.Q22E		NM_001142446	NP_001135918	P16157	ANK1_HUMAN	ankyrin 1 isoform 9	Error:Variant_position_missing_in_P16157_after_alignment					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TTCTCCTTCTGCTCCTGGAGG	0.637																0.172414	6.752916	9.710882	5	24	KEEP	---	---	---	---	2	4	17	12	-1	capture	Missense_Mutation	SNP	41753935	41753935	ANK1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	617	204
RALYL	138046	broad.mit.edu	37	8	85774569	85774569	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:85774569G>A	uc003ycq.3	+	7	868	c.452G>A	c.(451-453)CGT>CAT	p.R151H	RALYL_uc003ycr.3_Missense_Mutation_p.R151H|RALYL_uc003ycs.3_Missense_Mutation_p.R151H|RALYL_uc010lzy.2_Missense_Mutation_p.R140H|RALYL_uc003yct.3_Missense_Mutation_p.R164H|RALYL_uc003ycu.3_Missense_Mutation_p.R78H|RALYL_uc003ycv.3_Missense_Mutation_p.R63H	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	151							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						CCACCTCCCCGTGCAGTAATT	0.498																0.15	7.607693	12.354407	6	34	KEEP	---	---	---	---	2	5	27	13	-1	capture	Missense_Mutation	SNP	85774569	85774569	RALYL	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12915	204
KCNS2	3788	broad.mit.edu	37	8	99440635	99440635	+	Missense_Mutation	SNP	G	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99440635G>A	uc003yin.2	+	2	778	c.428G>A	c.(427-429)AGC>AAC	p.S143N		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	143	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			GACCAGGAGAGCACCACGTCT	0.582	Pancreas(138;844 2489 9202 24627)															0.114286	10.716007	26.140032	12	93	KEEP	---	---	---	---	7	5	44	56	-1	capture	Missense_Mutation	SNP	99440635	99440635	KCNS2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	8011	204
SNX30	401548	broad.mit.edu	37	9	115598647	115598647	+	Missense_Mutation	SNP	A	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115598647A>T	uc004bgj.3	+	5	920	c.772A>T	c.(772-774)ACC>TCC	p.T258S	SNX30_uc004bgi.3_5'Flank	NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	258					cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						CAAACTGGGAACCATTGATCG	0.498																0.076923	-5.044404	30.779641	15	180	KEEP	---	---	---	---	9	6	95	107	-1	capture	Missense_Mutation	SNP	115598647	115598647	SNX30	9	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	14792	204
FRMD7	90167	broad.mit.edu	37	X	131212279	131212279	+	Missense_Mutation	SNP	C	A	A			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131212279C>A	uc004ewn.2	-	12	1944	c.1766G>T	c.(1765-1767)AGG>ATG	p.R589M	FRMD7_uc011muy.1_Missense_Mutation_p.R574M	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	589					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GCTCTGGGACCTTTTAGGGGT	0.433																0.306569	112.992238	117.566718	42	95	KEEP	---	---	---	---	25	18	49	52	0.418604651163	capture	Missense_Mutation	SNP	131212279	131212279	FRMD7	23	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	5998	204
GPR50	9248	broad.mit.edu	37	X	150349759	150349759	+	Silent	SNP	C	T	T			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150349759C>T	uc010ntg.1	+	2	1839	c.1704C>T	c.(1702-1704)GCC>GCT	p.A568A		NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	568	Cytoplasmic (Potential).|Pro-rich.				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CTAGCCCTGCCGCTGGGCCCA	0.602																0.363636	109.978475	111.595842	36	63	KEEP	---	---	---	---	15	24	31	44	-1	capture	Silent	SNP	150349759	150349759	GPR50	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6630	204
THBS3	7059	broad.mit.edu	37	1	155170717	155170719	+	In_Frame_Del	DEL	CAT	-	-			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155170717_155170719delCAT	uc001fix.2	-	13	1540_1542	c.1517_1519delATG	c.(1516-1521)GATGCT>GCT	p.D506del	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_In_Frame_Del_p.D497del|THBS3_uc001fiz.2_In_Frame_Del_p.D469del|THBS3_uc001fiy.2_In_Frame_Del_p.D35del|THBS3_uc010pfu.1_In_Frame_Del_p.D386del|THBS3_uc010pfv.1_RNA|THBS3_uc001fja.2_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	506	TSP type-3 2.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCCCCATCAGCATCATCATCACA	0.542					217											0.15			82	463		---	---	---	---						capture_indel	In_Frame_Del	DEL	155170717	155170719	THBS3	1	CAT	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	15740	204
SLC5A12	159963	broad.mit.edu	37	11	26708091	26708091	+	Frame_Shift_Del	DEL	C	-	-			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:26708091delC	uc001mra.2	-	10	1467	c.1154delG	c.(1153-1155)TGTfs	p.C385fs	SLC5A12_uc001mrb.2_RNA	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	385	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						AAATAAGAGACCTGAAAGAAA	0.453																0.20			19	75		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	26708091	26708091	SLC5A12	11	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	14556	204
ATXN7	6314	broad.mit.edu	37	3	63981678	63981678	+	Frame_Shift_Del	DEL	C	-	-			TCGA-27-2527-01	TCGA-27-2527-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:63981678delC	uc003dlw.3	+	12	2733	c.2180delC	c.(2179-2181)TCTfs	p.S727fs	ATXN7_uc003dlv.2_Frame_Shift_Del_p.S727fs|ATXN7_uc010hnv.2_Frame_Shift_Del_p.S727fs|ATXN7_uc011bfn.1_Frame_Shift_Del_p.S582fs	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	727	Poly-Ser.|Ser-rich.				cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		tcctcctcttcttcTCATTCC	0.413																0.25			25	75		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	63981678	63981678	ATXN7	3	C	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	1206	204
