Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DARC	2532	broad.mit.edu	37	1	159175495	159175495	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159175495G>A	uc001fto.2	+	2	506	c.266G>A	c.(265-267)CGC>CAC	p.R89H	DARC_uc001ftp.3_Missense_Mutation_p.R91H	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	89	Cytoplasmic (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					CCTCTCTTCCGCTGGCAGCTC	0.602																0.498208	432.116347	432.117136	139	140	KEEP	---	---	---	---	125	106	110	91	-1	capture	Missense_Mutation	SNP	159175495	159175495	DARC	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4199	211
OBSCN	84033	broad.mit.edu	37	1	228529316	228529316	+	Splice_Site	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228529316G>A	uc009xez.1	+	74	18078	c.18034_splice	c.e74+1	p.R6012_splice	OBSCN_uc001hsn.2_Splice_Site_p.R6012_splice|OBSCN_uc001hsr.1_Splice_Site_p.R641_splice	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCTGTGTGGCGTGAGTGTCCA	0.667					4006											0.333333	21.493558	22.083197	8	16	KEEP	---	---	---	---	7	5	6	20	-1	capture	Splice_Site	SNP	228529316	228529316	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	10717	211
AGAP6	414189	broad.mit.edu	37	10	51748567	51748567	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:51748567C>T	uc001jix.3	+	1	490	c.92C>T	c.(91-93)ACC>ATC	p.T31I		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	31					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						GAATCTGAGACCTATGAGGCA	0.597																0.115385	3.104641	6.894688	3	23	KEEP	---	---	---	---	1	3	35	36	-1	capture	Missense_Mutation	SNP	51748567	51748567	AGAP6	10	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	372	211
VENTX	27287	broad.mit.edu	37	10	135053299	135053299	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135053299C>T	uc010quy.1	+	2	372	c.361C>T	c.(361-363)CGG>TGG	p.R121W		NM_014468	NP_055283	O95231	VENTX_HUMAN	VENT homeobox	121	Homeobox.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		CCCTCTGGAGCGGAAGAGGCT	0.488																0.846154	74.059228	77.034445	22	4	KEEP	---	---	---	---	12	16	6	3	-1	capture	Missense_Mutation	SNP	135053299	135053299	VENTX	10	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17035	211
OR4C3	256144	broad.mit.edu	37	11	48346680	48346680	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48346680C>T	uc010rhv.1	+	1	188	c.188C>T	c.(187-189)ACG>ATG	p.T63M		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TATGTGGTCACGGTTTGTGGC	0.463																0.310881	166.643222	172.783714	60	133	KEEP	---	---	---	---	40	23	67	75	-1	capture	Missense_Mutation	SNP	48346680	48346680	OR4C3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10954	211
OR4A47	403253	broad.mit.edu	37	11	48510660	48510660	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48510660G>A	uc010rhx.1	+	1	316	c.316G>A	c.(316-318)GGT>AGT	p.G106S		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GCACATTTTCGGTGGGTCAGA	0.453																0.361257	219.562347	222.78166	69	122	KEEP	---	---	---	---	48	34	77	63	-1	capture	Missense_Mutation	SNP	48510660	48510660	OR4A47	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10946	211
OR5W2	390148	broad.mit.edu	37	11	55681751	55681751	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681751A>G	uc010rir.1	-	1	308	c.308T>C	c.(307-309)GTC>GCC	p.V103A		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GATACAGAAGACCAAGAATTG	0.468	Melanoma(48;171 1190 15239 43886 49348)															0.413223	165.819006	166.616271	50	71	KEEP	---	---	---	---	30	27	37	47	-1	capture	Missense_Mutation	SNP	55681751	55681751	OR5W2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	11089	211
GANAB	23193	broad.mit.edu	37	11	62400735	62400735	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62400735C>T	uc001nub.2	-	7	672	c.639G>A	c.(637-639)GAG>GAA	p.E213E	GANAB_uc001nua.2_Silent_p.E235E|GANAB_uc001nuc.2_Silent_p.E116E|GANAB_uc010rma.1_Silent_p.E121E|GANAB_uc010rmb.1_Silent_p.E99E	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	213					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						TCCCCTGAGTCTCCTCTGGCT	0.527	Melanoma(23;1005 1074 15747 18937)															0.464455	317.839952	318.070887	98	113	KEEP	---	---	---	---	61	46	69	67	-1	capture	Silent	SNP	62400735	62400735	GANAB	11	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	6173	211
USP28	57646	broad.mit.edu	37	11	113672259	113672259	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113672259C>T	uc001poh.2	-	24	3037	c.3004G>A	c.(3004-3006)GCC>ACC	p.A1002T	USP28_uc001pog.2_Missense_Mutation_p.A678T|USP28_uc010rwy.1_Missense_Mutation_p.A845T|USP28_uc001poi.2_Missense_Mutation_p.A325T	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	1002					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		ACCTCAATGGCATCCAGATCA	0.393	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)															0.305785	96.334625	100.402618	37	84	KEEP	---	---	---	---	18	23	36	53	-1	capture	Missense_Mutation	SNP	113672259	113672259	USP28	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	16940	211
DDX25	29118	broad.mit.edu	37	11	125788549	125788549	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125788549C>T	uc001qcz.3	+	10	1206	c.1065C>T	c.(1063-1065)ACC>ACT	p.T355T	DDX25_uc010sbk.1_Silent_p.T355T	NM_013264	NP_037396	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 25	355	Helicase C-terminal.				mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		AGTGGTTGACCGTGGAGATGA	0.512																0.375	63.963862	64.73097	21	35	KEEP	---	---	---	---	9	15	20	19	-1	capture	Silent	SNP	125788549	125788549	DDX25	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4310	211
PTPRB	5787	broad.mit.edu	37	12	70928634	70928634	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70928634G>A	uc001swb.3	-	28	5559	c.5529C>T	c.(5527-5529)ATC>ATT	p.I1843I	uc001svz.2_Intron|PTPRB_uc010sto.1_Silent_p.I1753I|PTPRB_uc010stp.1_Silent_p.I1753I|PTPRB_uc001swc.3_Silent_p.I2061I|PTPRB_uc001swa.3_Silent_p.I1973I	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1843	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TAAACTCCCGGATGGTCCACT	0.512																0.530864	137.828319	137.895294	43	38	KEEP	---	---	---	---	19	27	19	24	-1	capture	Silent	SNP	70928634	70928634	PTPRB	12	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	12691	211
SLC24A6	80024	broad.mit.edu	37	12	113737741	113737741	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113737741G>A	uc001tvc.2	-	16	1806	c.1596C>T	c.(1594-1596)GGC>GGT	p.G532G	SLC24A6_uc001tuz.2_Silent_p.G237G|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Silent_p.G270G	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	532	Helical; Name=12; (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						GCCCCAGGGCGCCTGCCAGGA	0.627																0.381818	51.192128	51.853313	21	34	KEEP	---	---	---	---	9	16	26	18	-1	capture	Silent	SNP	113737741	113737741	SLC24A6	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14362	211
KSR2	283455	broad.mit.edu	37	12	118105354	118105354	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118105354G>A	uc001two.2	-	5	1064	c.1009C>T	c.(1009-1011)CGC>TGC	p.R337C		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	366					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGAAGGAGCGGAGGGAGCGC	0.602					623											0.181818	12.730791	15.869197	6	27	KEEP	---	---	---	---	1	5	19	9	-1	capture	Missense_Mutation	SNP	118105354	118105354	KSR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8502	211
GCN1L1	10985	broad.mit.edu	37	12	120628101	120628101	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120628101C>T	uc001txo.2	-	2	134	c.121G>A	c.(121-123)GAT>AAT	p.D41N		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	41					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAATAAATACCTTTTCCAGCA	0.303																0.489051	231.328781	231.342819	67	70	KEEP	---	---	---	---	32	36	38	34	-1	capture	Missense_Mutation	SNP	120628101	120628101	GCN1L1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	6239	211
NEK3	4752	broad.mit.edu	37	13	52728302	52728302	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52728302A>G	uc001vgi.2	-	3	359	c.124T>C	c.(124-126)TCT>CCT	p.S42P	NEK3_uc001vgg.2_Intron|NEK3_uc001vgh.2_Missense_Mutation_p.S63P|NEK3_uc010tgx.1_RNA|NEK3_uc010tgy.1_Missense_Mutation_p.S42P	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a	42	Interaction with VAV2.|Protein kinase.				cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TGTGTATTAGAGAAAGACTAG	0.284					244											0.83871	97.044586	100.417566	26	5	KEEP	---	---	---	---	8	20	0	5	-1	capture	Missense_Mutation	SNP	52728302	52728302	NEK3	13	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10232	211
RIN3	79890	broad.mit.edu	37	14	93022210	93022210	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93022210G>A	uc001yap.2	+	2	311	c.159G>A	c.(157-159)CTG>CTA	p.L53L	RIN3_uc010auk.2_5'UTR	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	53					endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				TCAGCATCCTGGAGAAGCTCA	0.612																0.036145	-12.840965	6.529856	3	80	KEEP	---	---	---	---	1	2	44	55	-1	capture	Silent	SNP	93022210	93022210	RIN3	14	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	13265	211
TJP1	7082	broad.mit.edu	37	15	30053400	30053400	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30053400G>A	uc001zcr.2	-	8	1427	c.952C>T	c.(952-954)CAG>TAG	p.Q318*	TJP1_uc010azl.2_Nonsense_Mutation_p.Q306*|TJP1_uc001zcq.2_Nonsense_Mutation_p.Q322*|TJP1_uc001zcs.2_Nonsense_Mutation_p.Q318*	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	318					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCTGACCGCTGGTCAGGAGAT	0.488	Melanoma(77;681 1843 6309 6570)															0.538462	130.260414	130.364879	42	36	KEEP	---	---	---	---	22	32	19	29	-1	capture	Nonsense_Mutation	SNP	30053400	30053400	TJP1	15	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	15814	211
MAPKBP1	23005	broad.mit.edu	37	15	42067489	42067489	+	Missense_Mutation	SNP	T	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42067489T>G	uc001zok.3	+	2	302	c.16T>G	c.(16-18)TCA>GCA	p.S6A	MAPKBP1_uc001zoj.3_Missense_Mutation_p.S6A|MAPKBP1_uc010bcj.2_5'UTR|MAPKBP1_uc010bci.2_Missense_Mutation_p.S6A|MAPKBP1_uc010udb.1_5'UTR|MAPKBP1_uc010bck.2_5'UTR	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	6										central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TGTGGAAGGGTCAACCATTAC	0.557					360											0.27907	5.39819	7.679724	12	31	KEEP	---	---	---	---	15	19	14	25	-1	capture	Missense_Mutation	SNP	42067489	42067489	MAPKBP1	15	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	9205	211
SEMA7A	8482	broad.mit.edu	37	15	74708161	74708161	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74708161C>T	uc002axv.2	-	8	1007	c.967G>A	c.(967-969)GGT>AGT	p.G323S	SEMA7A_uc010ulk.1_Missense_Mutation_p.G158S|SEMA7A_uc010ull.1_Missense_Mutation_p.G309S	NM_003612	NP_003603	O75326	SEM7A_HUMAN	semaphorin 7A isoform 1 preproprotein	323	Sema.				axon guidance|immune response|inflammatory response|integrin-mediated signaling pathway|positive regulation of axon extension|positive regulation of ERK1 and ERK2 cascade|positive regulation of macrophage cytokine production|regulation of inflammatory response	anchored to membrane|external side of plasma membrane	receptor activity			breast(1)|central_nervous_system(1)	2						GAGAAAACACCATAGACCCTG	0.612																0.438596	82.702729	82.882563	25	32	KEEP	---	---	---	---	13	15	9	23	-1	capture	Missense_Mutation	SNP	74708161	74708161	SEMA7A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	13936	211
FBXO22	26263	broad.mit.edu	37	15	76196838	76196838	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76196838C>T	uc002bbk.2	+	2	252	c.147C>T	c.(145-147)TGC>TGT	p.C49C	FBXO22_uc002bbj.1_Silent_p.C49C|FBXO22_uc002bbl.2_Intron	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	49	F-box.				ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						TCAGCGTGTGCCGCTTATGGA	0.622																0.027972	-27.862689	7.194598	4	139	KEEP	---	---	---	---	2	2	98	77	-1	capture	Silent	SNP	76196838	76196838	FBXO22	15	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	5680	211
ZNF174	7727	broad.mit.edu	37	16	3458790	3458790	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3458790G>A	uc002cvc.2	+	3	1910	c.1095G>A	c.(1093-1095)CGG>CGA	p.R365R		NM_003450	NP_003441	Q15697	ZN174_HUMAN	zinc finger protein 174 isoform a	365	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|cytoplasm|nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0						GCTTTGGGCGGCAGTCAACCC	0.542																0.061224	-3.215005	6.632587	3	46	KEEP	---	---	---	---	2	1	19	30	-1	capture	Silent	SNP	3458790	3458790	ZNF174	16	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	17624	211
DNAH3	55567	broad.mit.edu	37	16	21080833	21080833	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21080833G>A	uc010vbe.1	-	23	3284	c.3284C>T	c.(3283-3285)CCA>CTA	p.P1095L		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1095	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ACTGAAGATTGGTTCCAGGTA	0.438																0.596708	492.120869	494.110619	145	98	KEEP	---	---	---	---	66	97	53	59	-1	capture	Missense_Mutation	SNP	21080833	21080833	DNAH3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4560	211
SRCAP	10847	broad.mit.edu	37	16	30734359	30734359	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30734359C>G	uc002dze.1	+	24	4353	c.3968C>G	c.(3967-3969)CCT>CGT	p.P1323R	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.P1118R|SRCAP_uc010bzz.1_Missense_Mutation_p.P893R	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1323	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			GGACTGACTCCTGTTCCTCCA	0.587																0.033149	-31.806056	11.246356	6	175	KEEP	---	---	---	---	2	4	92	104	-1	capture	Missense_Mutation	SNP	30734359	30734359	SRCAP	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	15027	211
RLTPR	146206	broad.mit.edu	37	16	67683468	67683468	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67683468G>A	uc002etn.2	+	20	1985	c.1865G>A	c.(1864-1866)GGG>GAG	p.G622E	RLTPR_uc010cel.1_Missense_Mutation_p.G615E|RLTPR_uc010vjr.1_Missense_Mutation_p.G586E	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	622	Tropomodulin-like.|LRR 14.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		AACGCCATGGGGGACGCGGGC	0.701																0.26	34.749845	37.359314	13	37	KEEP	---	---	---	---	9	6	18	24	-1	capture	Missense_Mutation	SNP	67683468	67683468	RLTPR	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13286	211
TP53	7157	broad.mit.edu	37	17	7577556	7577556	+	Missense_Mutation	SNP	C	T	T	rs121912655		TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577556C>T	uc002gim.2	-	7	919	c.725G>A	c.(724-726)TGC>TAC	p.C242Y	TP53_uc002gig.1_Missense_Mutation_p.C242Y|TP53_uc002gih.2_Missense_Mutation_p.C242Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C110Y|TP53_uc010cng.1_Missense_Mutation_p.C110Y|TP53_uc002gii.1_Missense_Mutation_p.C110Y|TP53_uc010cnh.1_Missense_Mutation_p.C242Y|TP53_uc010cni.1_Missense_Mutation_p.C242Y|TP53_uc002gij.2_Missense_Mutation_p.C242Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C149Y|TP53_uc002gio.2_Missense_Mutation_p.C110Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	242	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).	Zinc.	C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C242F(63)|p.C242Y(37)|p.C242S(25)|p.C242fs*5(16)|p.C242R(11)|p.C242W(7)|p.0?(7)|p.N239_C242delNSSC(3)|p.C242*(3)|p.C242C(2)|p.C242G(2)|p.C242fs*20(1)|p.C242fs*23(1)|p.Y236_M243delYMCNSSCM(1)|p.C242_M246>L(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*98(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.S241_G245delSCMGG(1)|p.N239_C242del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCCGCCCATGCAGGAACTGTT	0.577	Pancreas(47;798 1329 9957 10801)		111	p.C242F(DAOY-Tumor)|p.C242S(NCIH889-Tumor)|p.C238fs(SW1417-Tumor)|p.C242Y(HCC33-Tumor)|p.C242Y(TE10-Tumor)|p.C242S(NCIH841-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.791045	171.806651	177.057454	53	14	KEEP	---	---	---	---	29	39	10	6	-1	capture	Missense_Mutation	SNP	7577556	7577556	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	16264	211
MYH8	4626	broad.mit.edu	37	17	10304743	10304743	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10304743G>A	uc002gmm.2	-	24	3052	c.2957C>T	c.(2956-2958)GCA>GTA	p.A986V	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	986	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						ATCCAGGCCTGCCATCTCTTC	0.443												Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				0.018116	-64.689485	7.550998	5	271	KEEP	---	---	---	---	5	1	156	135	-1	capture	Missense_Mutation	SNP	10304743	10304743	MYH8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9951	211
CNDP1	84735	broad.mit.edu	37	18	72226676	72226676	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72226676G>A	uc002llq.2	+	3	483	c.272G>A	c.(271-273)CGT>CAT	p.R91H	uc002llr.2_RNA	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	91					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CTGGGGGCCCGTGTGGCCTCG	0.632	Melanoma(32;1029 1042 25286 38395 44237)															0.3	72.365527	75.970561	30	70	KEEP	---	---	---	---	13	21	46	40	-1	capture	Missense_Mutation	SNP	72226676	72226676	CNDP1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3558	211
TMEM146	257062	broad.mit.edu	37	19	5776309	5776309	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5776309C>T	uc002mda.2	+	21	2140	c.2079C>T	c.(2077-2079)ATC>ATT	p.I693I		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	693	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						ACATTTCGATCGTGGATCCGT	0.582																0.566667	111.359166	111.592111	34	26	KEEP	---	---	---	---	14	24	13	15	-1	capture	Silent	SNP	5776309	5776309	TMEM146	19	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	15944	211
MUC16	94025	broad.mit.edu	37	19	9090864	9090864	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9090864G>A	uc002mkp.2	-	1	1155	c.951C>T	c.(949-951)GCC>GCT	p.A317A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	317	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGCTGGCTCTGGCCTCGGGCA	0.498																0.511211	347.145486	347.169715	114	109	KEEP	---	---	---	---	60	67	51	69	-1	capture	Silent	SNP	9090864	9090864	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	9883	211
MAST1	22983	broad.mit.edu	37	19	12979571	12979571	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12979571G>A	uc002mvm.2	+	21	2809	c.2681G>A	c.(2680-2682)GGG>GAG	p.G894E		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	894					cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CAGATGTCAGGGGATGTGGCA	0.577					239											0.572139	395.045149	395.955695	115	86	KEEP	---	---	---	---	59	72	52	45	-1	capture	Missense_Mutation	SNP	12979571	12979571	MAST1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9237	211
ZNF626	199777	broad.mit.edu	37	19	20808078	20808078	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:20808078T>A	uc002npb.1	-	4	755	c.605A>T	c.(604-606)AAA>ATA	p.K202I	ZNF626_uc002npc.1_Missense_Mutation_p.K126I	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	202	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTCTTCACATTTGTAGGGTTT	0.368																0.456	165.855481	166.066817	57	68	KEEP	---	---	---	---	30	30	36	32	-1	capture	Missense_Mutation	SNP	20808078	20808078	ZNF626	19	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	17928	211
FKRP	79147	broad.mit.edu	37	19	47258817	47258817	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47258817G>A	uc002pfn.2	+	4	407	c.110G>A	c.(109-111)CGG>CAG	p.R37Q	FKRP_uc002pfp.2_Missense_Mutation_p.R37Q	NM_024301	NP_077277	Q9H9S5	FKRP_HUMAN	fukutin-related protein	37						extracellular space|Golgi apparatus|rough endoplasmic reticulum|sarcolemma	transferase activity			pancreas(1)	1		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		TCCCGGGCCCGGGGGCCCCGT	0.677																0.642857	30.479732	30.732122	9	5	KEEP	---	---	---	---	3	9	4	3	-1	capture	Missense_Mutation	SNP	47258817	47258817	FKRP	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5862	211
LILRB3	11025	broad.mit.edu	37	19	54724484	54724484	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54724484G>A	uc002qef.1	-	6	1283	c.1172C>T	c.(1171-1173)GCG>GTG	p.A391V	LILRB3_uc002qee.1_Missense_Mutation_p.A391V|LILRB3_uc002qeh.1_Missense_Mutation_p.A391V|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.A391V|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Missense_Mutation_p.A391V|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Missense_Mutation_p.A391V|LILRB3_uc002qep.1_Missense_Mutation_p.A391V|LILRB3_uc002qeq.1_Missense_Mutation_p.A391V|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.A391V|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	391	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTAGGTCCCCGCGTGGGCTGA	0.607																0.120482	12.402336	24.116751	10	73	KEEP	---	---	---	---	13	12	60	80	-1	capture	Missense_Mutation	SNP	54724484	54724484	LILRB3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8712	211
LILRA6	79168	broad.mit.edu	37	19	54744236	54744236	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54744236G>A	uc002qeu.1	-	6	1296	c.1172C>T	c.(1171-1173)GCG>GTG	p.A391V	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.A391V|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.A391V|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.A391V|LILRA6_uc010yeq.1_Missense_Mutation_p.A391V|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.A252V	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	391	Extracellular (Potential).|Ig-like C2-type 2.					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTAGGTCCCCGCGTGGGCTGA	0.592																0.182927	30.876805	38.616059	15	67	KEEP	---	---	---	---	21	15	69	70	-1	capture	Missense_Mutation	SNP	54744236	54744236	LILRA6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8709	211
GALNT3	2591	broad.mit.edu	37	2	166611230	166611230	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166611230G>A	uc010fph.1	-	9	1920	c.1533C>T	c.(1531-1533)AGC>AGT	p.S511S		NM_004482	NP_004473	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	511	Ricin B-type lectin.|Lumenal (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(2)|ovary(1)	3						GCTGACCAACGCTTTTAATCT	0.303																0.413043	53.212133	53.516881	19	27	KEEP	---	---	---	---	13	7	17	10	-1	capture	Silent	SNP	166611230	166611230	GALNT3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	6154	211
SESTD1	91404	broad.mit.edu	37	2	180014058	180014058	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:180014058C>A	uc002uni.3	-	7	697	c.547G>T	c.(547-549)GGA>TGA	p.G183*		NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	183					regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTATCACTTCCATTGTTAATC	0.308																0.05	-6.229463	6.66101	3	57	KEEP	---	---	---	---	2	1	38	31	0.333333333333	capture	Nonsense_Mutation	SNP	180014058	180014058	SESTD1	2	C	A	A	A	1	0	0	0	0	0	1	0	0	273	21	5	4	14020	211
ERG	2078	broad.mit.edu	37	21	39764312	39764312	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:39764312G>A	uc010gnw.2	-	9	1116	c.821C>T	c.(820-822)ACG>ATG	p.T274M	ERG_uc002yxa.2_Missense_Mutation_p.T267M|ERG_uc011aek.1_Missense_Mutation_p.T175M|ERG_uc010gnv.2_Missense_Mutation_p.T151M|ERG_uc010gnx.2_Missense_Mutation_p.T250M|ERG_uc011ael.1_Missense_Mutation_p.T274M|ERG_uc002yxb.2_Missense_Mutation_p.T250M|ERG_uc011aem.1_Missense_Mutation_p.T148M|ERG_uc010gny.1_RNA	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4	274					cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CGACTGGGGCGTGGGGTGGCC	0.448	Esophageal Squamous(130;336 1700 3010 3083 40589)				177											0.611111	35.028574	35.223399	11	7	KEEP	---	---	---	---	4	7	5	3	-1	capture	Missense_Mutation	SNP	39764312	39764312	ERG	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5177	211
TRAT1	50852	broad.mit.edu	37	3	108572602	108572602	+	Missense_Mutation	SNP	G	A	A	rs142175794	byFrequency	TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108572602G>A	uc003dxi.1	+	6	583	c.439G>A	c.(439-441)GTT>ATT	p.V147I	TRAT1_uc010hpx.1_Missense_Mutation_p.V110I	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	147	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						AGATGCCAGCGTTTCTAAGAC	0.458																0.338129	135.890802	139.107391	47	92	KEEP	---	---	---	---	21	27	38	57	-1	capture	Missense_Mutation	SNP	108572602	108572602	TRAT1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16349	211
PARP9	83666	broad.mit.edu	37	3	122274913	122274913	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122274913G>C	uc010hri.2	-	4	355	c.210C>G	c.(208-210)GAC>GAG	p.D70E	PARP9_uc003eff.3_Missense_Mutation_p.D35E|PARP9_uc011bjs.1_Missense_Mutation_p.D35E|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Missense_Mutation_p.D35E|PARP9_uc003efh.2_Missense_Mutation_p.D70E|PARP9_uc003efj.2_Missense_Mutation_p.D35E	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	70					cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		AAATTTTGAAGTCATTGTGGT	0.353					175											0.57037	292.1943	292.776683	77	58	KEEP	---	---	---	---	47	45	37	38	-1	capture	Missense_Mutation	SNP	122274913	122274913	PARP9	3	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	11369	211
KIT	3815	broad.mit.edu	37	4	55564507	55564507	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55564507C>T	uc010igr.2	+	3	482	c.395C>T	c.(394-396)ACG>ATG	p.T132M	KIT_uc010igs.2_Missense_Mutation_p.T132M	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	132	Extracellular (Potential).|Ig-like C2-type 2.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	GACAACGACACGCTGGTCCGC	0.498			1		431	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				0.115385	5.411557	12.99275	6	46	KEEP	---	---	---	---	4	2	31	22	-1	capture	Missense_Mutation	SNP	55564507	55564507	KIT	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8250	211
AASDH	132949	broad.mit.edu	37	4	57220268	57220268	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57220268C>A	uc003hbn.2	-	8	1473	c.1320G>T	c.(1318-1320)TTG>TTT	p.L440F	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Missense_Mutation_p.L287F|AASDH_uc003hbo.2_Missense_Mutation_p.L340F|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Missense_Mutation_p.L440F|AASDH_uc003hbp.2_Missense_Mutation_p.L440F	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	440					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CTTTTCGTCCCAAAAAAAAAA	0.363																0.037736	-17.198216	7.320397	4	102	KEEP	---	---	---	---	3	1	60	63	0.25	capture	Missense_Mutation	SNP	57220268	57220268	AASDH	4	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	22	211
SULT1B1	27284	broad.mit.edu	37	4	70592883	70592883	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70592883C>T	uc003hen.2	-	8	1112	c.814G>A	c.(814-816)GCC>ACC	p.A272T		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	272					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						TCATTTTGGGCCACGGTGAAG	0.343																0.207207	50.467769	59.282967	23	88	KEEP	---	---	---	---	12	15	60	47	-1	capture	Missense_Mutation	SNP	70592883	70592883	SULT1B1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15264	211
FRAS1	80144	broad.mit.edu	37	4	79447726	79447726	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79447726C>G	uc003hlb.2	+	70	11280	c.10840C>G	c.(10840-10842)CTG>GTG	p.L3614V		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3609	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CACCATCTACCTGATCCCTTG	0.512																0.730769	63.135264	64.383983	19	7	KEEP	---	---	---	---	10	10	1	7	-1	capture	Missense_Mutation	SNP	79447726	79447726	FRAS1	4	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	5986	211
FAT1	2195	broad.mit.edu	37	4	187522529	187522529	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187522529G>A	uc003izf.2	-	21	11722	c.11534C>T	c.(11533-11535)ACG>ATG	p.T3845M		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	3845	Extracellular (Potential).|Laminin G-like.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TTCATTTTCCGTCAGACGGTA	0.413	Colon(197;1040 2055 4143 4984 49344)												HNSCC(5;0.00058)			0.052632	-7.36196	8.706898	4	72	KEEP	---	---	---	---	1	3	36	44	-1	capture	Missense_Mutation	SNP	187522529	187522529	FAT1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5635	211
PCDHB7	56129	broad.mit.edu	37	5	140553530	140553530	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140553530G>C	uc003lit.2	+	1	1288	c.1114G>C	c.(1114-1116)GAC>CAC	p.D372H		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	372	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGGATTAGAGACAGAGATTC	0.468																0.481013	130.243885	130.26878	38	41	KEEP	---	---	---	---	18	24	18	27	-1	capture	Missense_Mutation	SNP	140553530	140553530	PCDHB7	5	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	11450	211
GM2A	2760	broad.mit.edu	37	5	150639411	150639411	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150639411C>T	uc003ltr.3	+	2	342	c.177C>T	c.(175-177)ATC>ATT	p.I59I	GM2A_uc011dcs.1_RNA|GM2A_uc011dcr.1_Silent_p.I59I|GM2A_uc003ltt.1_5'UTR	NM_000405	NP_000396	P17900	SAP3_HUMAN	GM2 ganglioside activator precursor	59						lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCCCATCATCGTTCCTGGAA	0.587																0.370968	65.607638	66.515035	23	39	KEEP	---	---	---	---	24	18	18	23	-1	capture	Silent	SNP	150639411	150639411	GM2A	5	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	6420	211
FAT2	2196	broad.mit.edu	37	5	150922530	150922530	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150922530C>G	uc003lue.3	-	9	8171	c.8158G>C	c.(8158-8160)GAT>CAT	p.D2720H	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2720	Cadherin 24.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGACTGGATCTTGAGCTGCC	0.478																0.322034	126.021203	129.333424	38	80	KEEP	---	---	---	---	24	23	57	40	-1	capture	Missense_Mutation	SNP	150922530	150922530	FAT2	5	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	5636	211
SLIT3	6586	broad.mit.edu	37	5	168233574	168233574	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168233574G>T	uc003mab.2	-	9	1232	c.812C>A	c.(811-813)CCA>CAA	p.P271Q	SLIT3_uc010jjg.2_Missense_Mutation_p.P271Q|SLIT3_uc010jji.2_Missense_Mutation_p.P271Q|SLIT3_uc003mac.1_Missense_Mutation_p.P68Q	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	271	LRRNT 2.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATTGCAGGATGGGGGCTCCGA	0.567	Ovarian(29;311 847 10864 17279 24903)															0.491228	168.403904	168.411141	56	58	KEEP	---	---	---	---	32	35	35	38	0.477611940299	capture	Missense_Mutation	SNP	168233574	168233574	SLIT3	5	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	14633	211
FOXI1	2299	broad.mit.edu	37	5	169535115	169535115	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169535115C>T	uc003mai.3	+	2	682	c.637C>T	c.(637-639)CGC>TGC	p.R213C	FOXI1_uc003maj.3_Intron	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	213	Fork-head.				epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGAAATTTCCGCAGGAAAAG	0.488												Pendred_syndrome				0.326923	152.474647	156.61786	51	105	KEEP	---	---	---	---	27	31	53	60	-1	capture	Missense_Mutation	SNP	169535115	169535115	FOXI1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5953	211
ARID1B	57492	broad.mit.edu	37	6	157495209	157495209	+	Silent	SNP	C	T	T	rs147853607		TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:157495209C>T	uc003qqn.2	+	10	3032	c.2880C>T	c.(2878-2880)GAC>GAT	p.D960D	ARID1B_uc003qqo.2_Silent_p.D973D|ARID1B_uc003qqp.2_Silent_p.D960D|ARID1B_uc010kjl.2_Silent_p.D158D	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TCAAAGCAGACGGCAAAGAAG	0.507																0.047619	-9.371638	8.927954	4	80	KEEP	---	---	---	---	1	5	42	71	-1	capture	Silent	SNP	157495209	157495209	ARID1B	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	907	211
GCC1	79571	broad.mit.edu	37	7	127222986	127222986	+	Silent	SNP	A	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127222986A>G	uc003vma.2	-	2	1828	c.1410T>C	c.(1408-1410)GCT>GCC	p.A470A		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	470	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						CCCCATCAGCAGCCTCCGAGC	0.542																0.317259	368.287538	380.013306	125	269	KEEP	---	---	---	---	69	65	138	164	-1	capture	Silent	SNP	127222986	127222986	GCC1	7	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	6225	211
OR2A25	392138	broad.mit.edu	37	7	143771552	143771552	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143771552G>A	uc011ktx.1	+	1	240	c.240G>A	c.(238-240)ATG>ATA	p.M80I		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					TGCCCCAGATGCTGGTGAACC	0.547																0.101911	7.273946	32.114275	16	141	KEEP	---	---	---	---	7	10	73	80	-1	capture	Missense_Mutation	SNP	143771552	143771552	OR2A25	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	10882	211
ABCB8	11194	broad.mit.edu	37	7	150737710	150737710	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150737710C>G	uc003wil.3	+	12	1521	c.1428C>G	c.(1426-1428)AAC>AAG	p.N476K	ABCB8_uc010lpw.1_Missense_Mutation_p.N348K|ABCB8_uc010lpx.2_Missense_Mutation_p.N459K|ABCB8_uc011kvd.1_Missense_Mutation_p.N371K|ABCB8_uc003wim.3_Missense_Mutation_p.N254K|ABCB8_uc003wik.3_Missense_Mutation_p.N459K	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	476	ABC transporter.					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATTTCAGAACGTCTGCTTCA	0.632																0.171617	123.325468	154.202417	52	251	KEEP	---	---	---	---	33	25	152	139	-1	capture	Missense_Mutation	SNP	150737710	150737710	ABCB8	7	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	47	211
SGK223	157285	broad.mit.edu	37	8	8235473	8235473	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:8235473G>T	uc003wsh.3	-	2	446	c.446C>A	c.(445-447)CCT>CAT	p.P149H		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	149							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						ATTGCCATCAGGGGAGGTAGA	0.642	GBM(34;731 755 10259 33573 33867)				135											0.191083	63.552926	77.559927	30	127	KEEP	---	---	---	---	15	19	84	69	0.441176470588	capture	Missense_Mutation	SNP	8235473	8235473	SGK223	8	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	14103	211
PRKDC	5591	broad.mit.edu	37	8	48869810	48869810	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48869810C>T	uc003xqi.2	-	3	302	c.245G>A	c.(244-246)AGA>AAA	p.R82K	PRKDC_uc003xqj.2_Missense_Mutation_p.R82K|PRKDC_uc011ldh.1_Missense_Mutation_p.R82K	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	82					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				GATTTCTTCTCTACATTCACG	0.318	Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566						NHEJ					0.130435	5.407816	8.464043	3	20	KEEP	---	---	---	---	3	1	9	12	-1	capture	Missense_Mutation	SNP	48869810	48869810	PRKDC	8	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	12417	211
TSNARE1	203062	broad.mit.edu	37	8	143425640	143425640	+	Silent	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143425640G>A	uc003ywk.2	-	4	550	c.432C>T	c.(430-432)CAC>CAT	p.H144H	TSNARE1_uc011lju.1_Silent_p.H144H|TSNARE1_uc003ywj.2_Silent_p.H144H|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	144					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACAGCAGCTGGTGGTGCTTGC	0.667																0.466667	61.768967	61.812648	21	24	KEEP	---	---	---	---	11	13	15	15	-1	capture	Silent	SNP	143425640	143425640	TSNARE1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	16513	211
ZNF658	26149	broad.mit.edu	37	9	40772759	40772759	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:40772759G>A	uc004abs.2	-	5	2668	c.2516C>T	c.(2515-2517)ACA>ATA	p.T839I	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.T839I	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	839	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ACAGAGGTGTGTTCTTTGGGA	0.428																0.429936	389.756176	391.104124	135	179	KEEP	---	---	---	---	63	100	114	152	-1	capture	Missense_Mutation	SNP	40772759	40772759	ZNF658	9	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17947	211
C9orf140	89958	broad.mit.edu	37	9	139959203	139959203	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139959203C>T	uc011men.1	-	6	1209	c.1093G>A	c.(1093-1095)GAG>AAG	p.E365K		NM_178448	NP_848543	Q86UD0	CI140_HUMAN	tumor specificity and mitosis phase-dependent	365	Potential.					cytoplasm|nucleus				skin(1)	1	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;3.02e-05)|Epithelial(140;0.000499)		TTCTCCTGCTCCAGCTGCGTG	0.647														OREG0019628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.333333	15.841774	16.285699	6	12	KEEP	---	---	---	---	2	5	8	7	-1	capture	Missense_Mutation	SNP	139959203	139959203	C9orf140	9	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2437	211
HCCS	3052	broad.mit.edu	37	X	11139917	11139917	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11139917G>A	uc004cuk.2	+	7	1060	c.794G>A	c.(793-795)CGT>CAT	p.R265H	HCCS_uc004cuj.2_Missense_Mutation_p.R265H|HCCS_uc004cul.1_Missense_Mutation_p.R265H	NM_005333	NP_005324	P53701	CCHL_HUMAN	holocytochrome c synthase	265					organ morphogenesis|oxidation-reduction process	mitochondrial inner membrane	holocytochrome-c synthase activity|metal ion binding				0						GCTTGGTGGCGTTGGACCTCG	0.428	Ovarian(86;1338 1347 1462 10340 37882)															0.336066	114.635465	117.537025	41	81	KEEP	---	---	---	---	17	25	33	54	-1	capture	Missense_Mutation	SNP	11139917	11139917	HCCS	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6916	211
MAGEB6	158809	broad.mit.edu	37	X	26212632	26212632	+	Silent	SNP	G	A	A	rs141448892		TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26212632G>A	uc004dbr.2	+	2	818	c.669G>A	c.(667-669)AAG>AAA	p.K223K	MAGEB6_uc010ngc.1_Silent_p.K3K	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	223	MAGE.									ovary(3)	3						ACATGCTGAAGTGTGTCCGCA	0.463																0.591195	314.380989	315.538028	94	65	KEEP	---	---	---	---	45	63	33	40	-1	capture	Silent	SNP	26212632	26212632	MAGEB6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	9093	211
CXorf22	170063	broad.mit.edu	37	X	35985763	35985763	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35985763C>T	uc004ddj.2	+	10	1687	c.1628C>T	c.(1627-1629)ACG>ATG	p.T543M	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	543										large_intestine(1)|lung(1)|ovary(1)	3						CGTAATCCCACGGGAAAGTTT	0.353																0.031746	-22.616905	7.613326	4	122	KEEP	---	---	---	---	4	0	81	64	-1	capture	Missense_Mutation	SNP	35985763	35985763	CXorf22	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4062	211
ZNF157	7712	broad.mit.edu	37	X	47272290	47272290	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47272290C>T	uc004dhr.1	+	4	887	c.818C>T	c.(817-819)CCC>CTC	p.P273L		NM_003446	NP_003437	P51786	ZN157_HUMAN	zinc finger protein 157	273					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GGGGAGAAACCCTATGAATGT	0.448																0.336842	95.566448	97.805521	32	63	KEEP	---	---	---	---	16	23	23	47	-1	capture	Missense_Mutation	SNP	47272290	47272290	ZNF157	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17617	211
MORF4L2	9643	broad.mit.edu	37	X	102931771	102931771	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102931771C>T	uc004ekw.2	-	4	1417	c.185G>A	c.(184-186)CGC>CAC	p.R62H	MORF4L2_uc004ela.2_Missense_Mutation_p.R62H|MORF4L2_uc004ekx.2_Missense_Mutation_p.R62H|MORF4L2_uc004elb.2_Missense_Mutation_p.R62H|MORF4L2_uc004eky.2_Missense_Mutation_p.R62H|MORF4L2_uc010nos.2_Missense_Mutation_p.R62H|MORF4L2_uc004ekz.2_Missense_Mutation_p.R62H|MORF4L2_uc011mry.1_Missense_Mutation_p.R62H|MORF4L2_uc011mrz.1_Missense_Mutation_p.R62H|MORF4L2_uc004elc.2_Missense_Mutation_p.R62H|MORF4L2_uc004elf.2_Missense_Mutation_p.R62H|MORF4L2_uc004ele.2_Missense_Mutation_p.R62H|MORF4L2_uc011msa.1_Missense_Mutation_p.R62H|MORF4L2_uc011msb.1_Missense_Mutation_p.R62H|MORF4L2_uc011msc.1_Missense_Mutation_p.R62H|MORF4L2_uc011msd.1_Missense_Mutation_p.R62H|MORF4L2_uc004eld.2_Missense_Mutation_p.R62H	NM_012286	NP_036418	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	62					chromatin modification|DNA repair|regulation of cell growth|transcription, DNA-dependent	nucleolus	protein binding				0						CTCTGCAGAGCGACCACCCCA	0.532																0.338384	185.166298	189.73837	67	131	KEEP	---	---	---	---	42	28	85	54	-1	capture	Missense_Mutation	SNP	102931771	102931771	MORF4L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9619	211
MID2	11043	broad.mit.edu	37	X	107084129	107084129	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107084129C>T	uc004enl.2	+	2	807	c.234C>T	c.(232-234)ACC>ACT	p.T78T	MID2_uc004enk.2_Silent_p.T78T	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	78	RING-type.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						AGTGTCCTACCTGCAGGTATG	0.512																0.596639	741.197446	744.102865	213	144	KEEP	---	---	---	---	123	109	79	85	-1	capture	Silent	SNP	107084129	107084129	MID2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	9490	211
IGSF1	3547	broad.mit.edu	37	X	130416634	130416634	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:130416634G>A	uc004ewd.2	-	7	1268	c.1030C>T	c.(1030-1032)CGA>TGA	p.R344*	IGSF1_uc004ewe.3_Nonsense_Mutation_p.R333*|IGSF1_uc004ewf.2_Nonsense_Mutation_p.R324*	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	344	Ig-like C2-type 4.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						ACTGGTCCTCGACACCGTAGG	0.488																0.299517	171.978596	179.407671	62	145	KEEP	---	---	---	---	35	38	68	108	-1	capture	Nonsense_Mutation	SNP	130416634	130416634	IGSF1	23	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	7520	211
DDX26B	203522	broad.mit.edu	37	X	134655171	134655171	+	Silent	SNP	C	T	T			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134655171C>T	uc004eyw.3	+	2	480	c.117C>T	c.(115-117)CGC>CGT	p.R39R		NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	39	VWFA.										0	Acute lymphoblastic leukemia(192;6.56e-05)					CGCAGCTGCGCGCCCGGGACC	0.632																0.304348	18.115861	18.90173	7	16	KEEP	---	---	---	---	4	3	10	9	-1	capture	Silent	SNP	134655171	134655171	DDX26B	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4311	211
LRRK2	120892	broad.mit.edu	37	12	40618993	40618996	+	Frame_Shift_Del	DEL	AGTC	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40618993_40618996delAGTC	uc001rmg.3	+	1	181_184	c.60_63delAGTC	c.(58-63)ATAGTCfs	p.I20fs		NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	20_21					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGAAGTTGATAGTCAGGCTGAACA	0.544					1771											0.41			25	36		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	40618993	40618996	LRRK2	12	AGTC	-	-	-	1	0	1	0	1	0	0	0	0	189	15	5	5	8948	211
UHRF1BP1L	23074	broad.mit.edu	37	12	100451481	100451482	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100451481_100451482delAG	uc001tgq.2	-	15	3520_3521	c.3291_3292delCT	c.(3289-3294)CTCTGTfs	p.L1097fs	UHRF1BP1L_uc001tgp.2_Frame_Shift_Del_p.L747fs	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1097_1098										ovary(2)	2						TAAGAAACACAGAGAGGAGCCA	0.332																0.12			10	72		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	100451481	100451482	UHRF1BP1L	12	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	16851	211
SRCAP	10847	broad.mit.edu	37	16	30749342	30749342	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30749342delG	uc002dze.1	+	34	8366	c.7981delG	c.(7981-7983)GATfs	p.D2661fs	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Frame_Shift_Del_p.D2456fs	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2661	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			AGCAGCATCTGATGAGCCACT	0.602																0.55			47	38		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	30749342	30749342	SRCAP	16	G	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	15027	211
SP100	6672	broad.mit.edu	37	2	231328786	231328786	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231328786delC	uc002vqt.2	+	11	1203	c.1062delC	c.(1060-1062)ATCfs	p.I354fs	SP100_uc002vqs.2_Frame_Shift_Del_p.I354fs|SP100_uc002vqu.1_Frame_Shift_Del_p.I354fs|SP100_uc002vqq.1_Frame_Shift_Del_p.I354fs|SP100_uc002vqr.1_Frame_Shift_Del_p.I329fs|SP100_uc010zmc.1_Frame_Shift_Del_p.I329fs|SP100_uc002vqv.1_Frame_Shift_Del_p.I318fs	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2	354					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GTGCAGTGATCAATAATGACA	0.408																0.47			27	31		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	231328786	231328786	SP100	2	C	-	-	-	1	0	1	0	1	0	0	0	0	369	29	5	5	14852	211
DBR1	51163	broad.mit.edu	37	3	137880744	137880746	+	In_Frame_Del	DEL	TCA	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137880744_137880746delTCA	uc003erv.2	-	8	1756_1758	c.1620_1622delTGA	c.(1618-1623)GATGAT>GAT	p.540_541DD>D	DBR1_uc003eru.2_In_Frame_Del_p.489_490DD>D|DBR1_uc003ert.2_In_Frame_Del_p.308_309DD>D	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	540_541						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						AGCTGCATCGTCATCATCATCAT	0.261																0.02			7	302		---	---	---	---						capture_indel	In_Frame_Del	DEL	137880744	137880746	DBR1	3	TCA	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	4216	211
IRS4	8471	broad.mit.edu	37	X	107977802	107977803	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107977802_107977803insC	uc004eoc.2	-	1	1805_1806	c.1772_1773insG	c.(1771-1773)GGCfs	p.G591fs		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	591						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						CTGAGCCTTTGCCCCCCCCAGA	0.545																0.01			8	776		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	107977802	107977803	IRS4	23	-	C	C	C	1	0	1	1	0	0	0	0	0	587	46	5	5	7765	211
ELF4	2000	broad.mit.edu	37	X	129201458	129201458	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-2509-01	TCGA-28-2509-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129201458delG	uc004evd.3	-	9	1615	c.1230delC	c.(1228-1230)CCCfs	p.P410fs	ELF4_uc004eve.3_Frame_Shift_Del_p.P410fs	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	410					natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCGACCCCACGGGGGCCACTC	0.592					86	T	ERG	AML								0.22			52	184		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	129201458	129201458	ELF4	23	G	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	5011	211
