Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PLCH2	9651	broad.mit.edu	37	1	2411398	2411398	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2411398G>A	uc001aji.1	+	3	771	c.497G>A	c.(496-498)CGC>CAC	p.R166H	PLCH2_uc010nyz.1_5'Flank|PLCH2_uc009vle.1_5'Flank|PLCH2_uc001ajj.1_5'Flank|PLCH2_uc001ajk.1_5'Flank	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	166					intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CTGGCTCGCCGCCAGCGCACC	0.687																0.389831	59.372081	60.010102	23	36	KEEP	---	---	---	---	17	17	22	34	-1	capture	Missense_Mutation	SNP	2411398	2411398	PLCH2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11941	214
PTPN22	26191	broad.mit.edu	37	1	114399229	114399229	+	Missense_Mutation	SNP	G	A	A	rs115552198	byFrequency;by1000genomes	TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114399229G>A	uc001eds.2	-	6	551	c.421C>T	c.(421-423)CGC>TGC	p.R141C	uc001edv.1_5'Flank|PTPN22_uc009wgq.2_Missense_Mutation_p.R141C|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Missense_Mutation_p.R141C|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Missense_Mutation_p.R141C	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	141	Tyrosine-protein phosphatase.				negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCCAGTAGCGCTCACACTTT	0.438					661											0.436975	149.777721	150.190511	52	67	KEEP	---	---	---	---	31	30	33	42	-1	capture	Missense_Mutation	SNP	114399229	114399229	PTPN22	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12682	214
SUV39H2	79723	broad.mit.edu	37	10	14938880	14938880	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:14938880G>T	uc001inh.2	+	2	89	c.33G>T	c.(31-33)TGG>TGT	p.W11C	SUV39H2_uc001ing.2_Missense_Mutation_p.W71C|SUV39H2_uc001ini.2_Missense_Mutation_p.W11C|SUV39H2_uc001inj.2_Missense_Mutation_p.W11C	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2	71	Chromo.				cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding			breast(2)|ovary(1)	3						GGAAAGGATGGCCAGATTCTA	0.323																0.097222	9.053455	32.443829	14	130	KEEP	---	---	---	---	12	6	60	86	0.666666666667	capture	Missense_Mutation	SNP	14938880	14938880	SUV39H2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	15301	214
SYTL2	54843	broad.mit.edu	37	11	85445443	85445443	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:85445443C>T	uc010rth.1	-	6	1202	c.926G>A	c.(925-927)AGA>AAA	p.R309K	SYTL2_uc010rtg.1_Missense_Mutation_p.R310K|SYTL2_uc010rti.1_Missense_Mutation_p.R309K|SYTL2_uc010rtj.1_Missense_Mutation_p.R261K|SYTL2_uc001pbf.3_Missense_Mutation_p.R309K|SYTL2_uc010rtf.1_Missense_Mutation_p.R167K	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	309					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTCAGAAATTCTCTCATGGAT	0.438																0.437778	615.905396	617.425173	197	253	KEEP	---	---	---	---	107	117	132	147	-1	capture	Missense_Mutation	SNP	85445443	85445443	SYTL2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15371	214
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.269																0.065217	-8.454592	9.807336	6	86	KEEP	---	---	---	---	3	4	50	52	0.428571428571	capture	Silent	SNP	115080343	115080343	CADM1	11	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	2542	214
PDZD3	79849	broad.mit.edu	37	11	119058000	119058000	+	Missense_Mutation	SNP	A	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119058000A>T	uc001pwb.2	+	3	1074	c.550A>T	c.(550-552)AGC>TGC	p.S184C	PDZD3_uc001pvy.2_Missense_Mutation_p.S118C|PDZD3_uc001pvz.2_Missense_Mutation_p.S118C|PDZD3_uc010rzd.1_Missense_Mutation_p.S105C|PDZD3_uc001pwa.2_5'UTR			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	184	PDZ 1.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CATCCGGGCCAGCAGCCCTCG	0.632																0.333333	23.993356	24.583093	8	16	KEEP	---	---	---	---	4	5	8	13	-1	capture	Missense_Mutation	SNP	119058000	119058000	PDZD3	11	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11605	214
PRIM1	5557	broad.mit.edu	37	12	57140741	57140741	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57140741T>C	uc001smd.2	-	3	401	c.337A>G	c.(337-339)ACA>GCA	p.T113A	PRIM1_uc001sme.1_RNA|PRIM1_uc009zoz.1_Intron|PRIM1_uc001smf.2_Missense_Mutation_p.T113A	NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1	113					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0						TCATAGTCTGTCATGTCAATG	0.428																0.382353	90.336397	91.160941	26	42	KEEP	---	---	---	---	13	18	14	34	-1	capture	Missense_Mutation	SNP	57140741	57140741	PRIM1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	12386	214
IL26	55801	broad.mit.edu	37	12	68619487	68619487	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68619487G>C	uc001stx.1	-	1	85	c.50C>G	c.(49-51)TCT>TGT	p.S17C		NM_018402	NP_060872	Q9NPH9	IL26_HUMAN	interleukin 26 precursor	17					cell-cell signaling|negative regulation of epithelial cell proliferation|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of JAK-STAT cascade|positive regulation of protein kinase B signaling cascade|positive regulation of stress-activated MAPK cascade|positive regulation of transcription from RNA polymerase II promoter	cytosol|extracellular space|soluble fraction	cytokine activity				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		AATGGCAAGAGACAGAGTGAC	0.478																0.377698	362.707667	366.35724	105	173	KEEP	---	---	---	---	46	66	99	88	-1	capture	Missense_Mutation	SNP	68619487	68619487	IL26	12	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	7602	214
MIPEP	4285	broad.mit.edu	37	13	24448985	24448985	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:24448985C>T	uc001uox.3	-	5	703	c.603G>A	c.(601-603)AAG>AAA	p.K201K		NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor	201					protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		AAAGATGTACCTTTTCTTTGT	0.333																0.327731	235.969014	242.232288	78	160	KEEP	---	---	---	---	39	47	112	69	-1	capture	Silent	SNP	24448985	24448985	MIPEP	13	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	9504	214
ERCC5	2073	broad.mit.edu	37	13	103520596	103520596	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103520596C>T	uc001vpw.2	+	12	3110	c.2667C>T	c.(2665-2667)CTC>CTT	p.L889L	ERCC5_uc001vpu.1_Silent_p.L1343L|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Silent_p.L721L	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	889					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TGGAACCTCTCCTAAAATTCT	0.373					463	Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				0.360294	142.734157	145.072358	49	87	KEEP	---	---	---	---	26	27	40	61	-1	capture	Silent	SNP	103520596	103520596	ERCC5	13	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	5171	214
DLK1	8788	broad.mit.edu	37	14	101200827	101200827	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:101200827C>T	uc001yhs.3	+	5	899	c.746C>T	c.(745-747)GCG>GTG	p.A249V	DLK1_uc001yhu.3_Intron	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog precursor	249	Extracellular (Potential).				multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)				AAGAAGCGCGCGCTGAGCCCC	0.682																0.5	108.134037	108.134037	38	38	KEEP	---	---	---	---	20	27	17	28	-1	capture	Missense_Mutation	SNP	101200827	101200827	DLK1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4522	214
SIN3A	25942	broad.mit.edu	37	15	75693090	75693090	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75693090C>T	uc002bai.2	-	11	1977	c.1718G>A	c.(1717-1719)CGG>CAG	p.R573Q	SIN3A_uc002baj.2_Missense_Mutation_p.R573Q|SIN3A_uc010uml.1_Missense_Mutation_p.R573Q	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	573	Interactions with SUDS3 and SAP130.|Interaction with NCOR1 (By similarity).				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						GAGAGGAGTCCGTCCTGTACA	0.493																0.355932	63.759444	64.837888	21	38	KEEP	---	---	---	---	12	11	16	27	-1	capture	Missense_Mutation	SNP	75693090	75693090	SIN3A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14218	214
PKD1	5310	broad.mit.edu	37	16	2156265	2156265	+	Silent	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2156265G>A	uc002cos.1	-	19	7739	c.7530C>T	c.(7528-7530)TAC>TAT	p.Y2510Y	PKD1_uc002cot.1_Silent_p.Y2510Y|PKD1_uc010bse.1_5'Flank	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2510	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GCAGCAGGGCGTACACCAGCG	0.687																0.489362	66.551194	66.554596	23	24	KEEP	---	---	---	---	12	15	12	17	-1	capture	Silent	SNP	2156265	2156265	PKD1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11866	214
CREBBP	1387	broad.mit.edu	37	16	3779062	3779062	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3779062C>T	uc002cvv.2	-	31	6190	c.5986G>A	c.(5986-5988)GCC>ACC	p.A1996T	CREBBP_uc002cvw.2_Missense_Mutation_p.A1958T	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1996					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTCACGGGGGCCATCTGGCTC	0.697					748	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				0.75	19.253145	19.707352	6	2	KEEP	---	---	---	---	2	6	3	0	-1	capture	Missense_Mutation	SNP	3779062	3779062	CREBBP	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3826	214
ANKS3	124401	broad.mit.edu	37	16	4755095	4755095	+	Splice_Site	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4755095C>T	uc002cxj.1	-	8	1163	c.868_splice	c.e8+1	p.E290_splice	ANKS3_uc002cxi.1_Splice_Site_p.E217_splice|ANKS3_uc002cxk.2_Splice_Site_p.E161_splice|ANKS3_uc002cxl.2_Splice_Site_p.E117_splice|ANKS3_uc010uxs.1_Splice_Site_p.E217_splice|ANKS3_uc002cxm.2_Splice_Site_p.E84_splice	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain												0						GGGCCACTCACCATAGCGAGG	0.597																0.058296	-21.21423	24.409282	13	210	KEEP	---	---	---	---	7	6	117	129	-1	capture	Splice_Site	SNP	4755095	4755095	ANKS3	16	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	684	214
CNGB1	1258	broad.mit.edu	37	16	57918280	57918280	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57918280C>T	uc002emt.2	-	33	3609	c.3544G>A	c.(3544-3546)GAC>AAC	p.D1182N	CNGB1_uc010cdh.2_Missense_Mutation_p.D1176N	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	1182	Cytoplasmic (Potential).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						GCGGGTGGGTCGGTGGCGGCC	0.721	Colon(156;1293 1853 16336 28962 38659)															0.457143	45.296227	45.352012	16	19	KEEP	---	---	---	---	4	13	12	13	-1	capture	Missense_Mutation	SNP	57918280	57918280	CNGB1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3565	214
KRT39	390792	broad.mit.edu	37	17	39116542	39116542	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39116542G>A	uc002hvo.1	-	6	1244	c.1208C>T	c.(1207-1209)TCG>TTG	p.S403L	KRT39_uc010wfm.1_Missense_Mutation_p.S136L	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35	403	Coil 2.|Rod.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				CTTGCCATCCGAGCTCTCCAG	0.468																0.100437	13.871526	50.372109	23	206	KEEP	---	---	---	---	12	13	124	98	-1	capture	Missense_Mutation	SNP	39116542	39116542	KRT39	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8396	214
ONECUT2	9480	broad.mit.edu	37	18	55103358	55103358	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55103358C>T	uc002lgo.2	+	1	442	c.410C>T	c.(409-411)TCG>TTG	p.S137L		NM_004852	NP_004843	O95948	ONEC2_HUMAN	one cut domain, family member 2	137					organ morphogenesis	nucleus	sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		TCCTGCGACTCGTCTCCGCCT	0.617																0.666667	31.053836	31.422995	10	5	KEEP	---	---	---	---	4	7	3	4	-1	capture	Missense_Mutation	SNP	55103358	55103358	ONECUT2	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10773	214
CELF5	60680	broad.mit.edu	37	19	3293345	3293345	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3293345C>T	uc002lxm.2	+	12	1396	c.1359C>T	c.(1357-1359)AGC>AGT	p.S453S	CELF5_uc002lxl.1_3'UTR|CELF5_uc010dtj.1_3'UTR|CELF5_uc010xhg.1_3'UTR|CELF5_uc002lxn.2_RNA	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	453	RRM 3.				mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2						ACCCGGCCAGCGCCCAGGCAG	0.622																0.3125	111.710594	116.226305	45	99	KEEP	---	---	---	---	24	25	46	66	-1	capture	Silent	SNP	3293345	3293345	CELF5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	3187	214
TNFSF14	8740	broad.mit.edu	37	19	6664993	6664993	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6664993G>A	uc002mfk.1	-	5	1049	c.667C>T	c.(667-669)CGC>TGC	p.R223C	TNFSF14_uc002mfj.1_Missense_Mutation_p.R187C	NM_003807	NP_003798	O43557	TNF14_HUMAN	tumor necrosis factor ligand superfamily, member	223	Extracellular (Potential).				cellular response to mechanical stimulus|immune response|induction of apoptosis|release of cytoplasmic sequestered NF-kappaB|T cell homeostasis|T cell proliferation	cytoplasm|extracellular space|integral to membrane|plasma membrane	caspase inhibitor activity|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1						CGAACCAGGCGTTCATCCAGC	0.612																0.300676	220.283827	230.778029	89	207	KEEP	---	---	---	---	45	52	86	132	-1	capture	Missense_Mutation	SNP	6664993	6664993	TNFSF14	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16190	214
TNFSF14	8740	broad.mit.edu	37	19	6665273	6665273	+	Silent	SNP	G	A	A	rs147375196		TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6665273G>A	uc002mfk.1	-	5	769	c.387C>T	c.(385-387)CAC>CAT	p.H129H	TNFSF14_uc002mfj.1_Silent_p.H93H	NM_003807	NP_003798	O43557	TNF14_HUMAN	tumor necrosis factor ligand superfamily, member	129	Extracellular (Potential).				cellular response to mechanical stimulus|immune response|induction of apoptosis|release of cytoplasmic sequestered NF-kappaB|T cell homeostasis|T cell proliferation	cytoplasm|extracellular space|integral to membrane|plasma membrane	caspase inhibitor activity|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1						GGGCCCCATCGTGGTAGCTGA	0.647																0.269841	41.944734	44.957468	17	46	KEEP	---	---	---	---	10	9	23	26	-1	capture	Silent	SNP	6665273	6665273	TNFSF14	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16190	214
LRRC8E	80131	broad.mit.edu	37	19	7964176	7964176	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7964176C>T	uc002mir.2	+	3	870	c.769C>T	c.(769-771)CGA>TGA	p.R257*		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	257						integral to membrane				lung(1)|pancreas(1)	2						CATGTACATCCGACAGACGGT	0.532																0.336066	121.067767	123.953588	41	81	KEEP	---	---	---	---	21	23	51	35	-1	capture	Nonsense_Mutation	SNP	7964176	7964176	LRRC8E	19	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8940	214
LDLR	3949	broad.mit.edu	37	19	11221368	11221368	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11221368C>T	uc002mqk.3	+	7	1149	c.981C>T	c.(979-981)CAC>CAT	p.H327H	LDLR_uc010xlk.1_Silent_p.H327H|LDLR_uc010xll.1_Silent_p.H286H|LDLR_uc010xlm.1_Silent_p.H180H|LDLR_uc010xln.1_Silent_p.H200H|LDLR_uc010xlo.1_Silent_p.H159H	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	327	Extracellular (Potential).|EGF-like 1.		H -> Y (in FH).		cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	GCTGTTCCCACGTCTGCAATG	0.627	GBM(18;201 575 7820 21545)				1109											0.311111	74.769015	77.627692	28	62	KEEP	---	---	---	---	17	18	38	48	-1	capture	Silent	SNP	11221368	11221368	LDLR	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8624	214
FFAR2	2867	broad.mit.edu	37	19	35941517	35941517	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35941517C>T	uc002nzg.2	+	2	981	c.901C>T	c.(901-903)CGC>TGC	p.R301C	FFAR2_uc010eea.2_Missense_Mutation_p.R301C	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	301	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCTGTTGGGACGCAGAGGCAA	0.567	GBM(40;139 809 9833 23358 48736)				34											0.305344	216.317597	225.163996	80	182	KEEP	---	---	---	---	43	41	93	104	-1	capture	Missense_Mutation	SNP	35941517	35941517	FFAR2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5774	214
PSG8	440533	broad.mit.edu	37	19	43359720	43359720	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43359720C>G	uc002oul.3	-	1	151	c.52G>C	c.(52-54)GTC>CTC	p.V18L	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG8_uc002oum.3_Missense_Mutation_p.V18L|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.V18L|PSG10_uc010eip.2_RNA|PSG1_uc002our.1_Intron|PSG1_uc010eio.1_Intron|PSG1_uc002oux.1_Intron|PSG1_uc002ouy.1_Intron	NM_001130168	NP_001123640	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	18						extracellular region					0		Prostate(69;0.00899)				GTGAGCAGGACCCCCTTCCAT	0.567																0.048387	-14.762527	12.19041	6	118	KEEP	---	---	---	---	4	4	70	66	-1	capture	Missense_Mutation	SNP	43359720	43359720	PSG8	19	C	G	G	G	1	0	0	0	0	1	0	0	0	222	18	4	4	12556	214
KIR2DS4	3809	broad.mit.edu	37	19	55351111	55351111	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55351111C>T	uc002qhm.1	+	5	667	c.621C>T	c.(619-621)TAC>TAT	p.Y207Y	KIR2DS4_uc010yfj.1_Missense_Mutation_p.T193M|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Missense_Mutation_p.T200M|KIR2DS4_uc002qhn.1_Intron	NM_012314	NP_036446	P43632	KI2S4_HUMAN	killer cell immunoglobulin-like receptor, two	207	Extracellular (Potential).					integral to plasma membrane	receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		ACGCTCCCTACGAGTGGTCAA	0.562																0.287415	436.831353	460.668079	169	419	KEEP	---	---	---	---	96	105	207	269	-1	capture	Silent	SNP	55351111	55351111	KIR2DS4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	247	19	1	1	8241	214
NLRP2	55655	broad.mit.edu	37	19	55495082	55495082	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55495082C>T	uc002qij.2	+	6	2102	c.2016C>T	c.(2014-2016)GAC>GAT	p.D672D	NLRP2_uc010yfp.1_Silent_p.D649D|NLRP2_uc010esn.2_Silent_p.D648D|NLRP2_uc010eso.2_Silent_p.D669D|NLRP2_uc010esp.2_Silent_p.D650D	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	672					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CTGAATCAGACGCCGAGGTTG	0.507																0.301435	165.143327	172.503458	63	146	KEEP	---	---	---	---	44	30	88	82	-1	capture	Silent	SNP	55495082	55495082	NLRP2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10384	214
PTPRH	5794	broad.mit.edu	37	19	55693402	55693402	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55693402C>T	uc002qjq.2	-	19	3253	c.3180G>A	c.(3178-3180)CCG>CCA	p.P1060P	PTPRH_uc010esv.2_Silent_p.P882P|SYT5_uc002qjm.1_5'Flank|SYT5_uc002qjp.2_5'Flank|SYT5_uc002qjn.1_5'Flank|SYT5_uc002qjo.1_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1060	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GCACCATCAACGGCCGACTCT	0.637																0.278912	206.526154	219.451755	82	212	KEEP	---	---	---	---	52	48	115	137	-1	capture	Silent	SNP	55693402	55693402	PTPRH	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12698	214
DYSF	8291	broad.mit.edu	37	2	71801344	71801344	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71801344C>T	uc002sie.2	+	30	3567	c.3191C>T	c.(3190-3192)GCG>GTG	p.A1064V	DYSF_uc010feg.2_Missense_Mutation_p.A1095V|DYSF_uc010feh.2_Missense_Mutation_p.A1050V|DYSF_uc002sig.3_Missense_Mutation_p.A1050V|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.A1064V|DYSF_uc010fef.2_Missense_Mutation_p.A1081V|DYSF_uc010fei.2_Missense_Mutation_p.A1081V|DYSF_uc010fek.2_Missense_Mutation_p.A1082V|DYSF_uc010fej.2_Missense_Mutation_p.A1051V|DYSF_uc010fel.2_Missense_Mutation_p.A1051V|DYSF_uc010feo.2_Missense_Mutation_p.A1096V|DYSF_uc010fem.2_Missense_Mutation_p.A1065V|DYSF_uc010fen.2_Missense_Mutation_p.A1082V|DYSF_uc002sif.2_Missense_Mutation_p.A1065V|DYSF_uc010yqy.1_5'Flank	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1064	Cytoplasmic (Potential).|Arg-rich.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CAGGCGGAGGCGGAGGGCGAG	0.662																0.39823	129.857072	130.878915	45	68	KEEP	---	---	---	---	19	32	32	46	-1	capture	Missense_Mutation	SNP	71801344	71801344	DYSF	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4814	214
SLC9A4	389015	broad.mit.edu	37	2	103095611	103095611	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103095611C>T	uc002tbz.3	+	2	1027	c.570C>T	c.(568-570)GAC>GAT	p.D190D		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	190	Extracellular (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GCCTGGGCGACGTCAACCTGC	0.632																0.447368	48.187158	48.27546	17	21	KEEP	---	---	---	---	7	11	11	11	-1	capture	Silent	SNP	103095611	103095611	SLC9A4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14608	214
DPP10	57628	broad.mit.edu	37	2	116447456	116447456	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116447456G>A	uc002tla.1	+	7	992	c.535G>A	c.(535-537)GTC>ATC	p.V179I	DPP10_uc002tlb.1_Missense_Mutation_p.V129I|DPP10_uc002tlc.1_Missense_Mutation_p.V175I|DPP10_uc002tle.2_Missense_Mutation_p.V183I|DPP10_uc002tlf.1_Missense_Mutation_p.V172I	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	179	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						AGAGGACTCCGTCTTGCAGTA	0.438																0.385965	125.172851	126.472181	44	70	KEEP	---	---	---	---	36	16	41	45	-1	capture	Missense_Mutation	SNP	116447456	116447456	DPP10	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4682	214
ABCB11	8647	broad.mit.edu	37	2	169850255	169850255	+	Missense_Mutation	SNP	G	C	C			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169850255G>C	uc002ueo.1	-	8	875	c.749C>G	c.(748-750)CCT>CGT	p.P250R		NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	250	Helical; (Potential).|ABC transmembrane type-1 1.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	CCCAATGAGAGGGCTGACAGA	0.453																0.384615	29.74436	30.047652	10	16	KEEP	---	---	---	---	6	9	7	10	-1	capture	Missense_Mutation	SNP	169850255	169850255	ABCB11	2	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	42	214
ZNF337	26152	broad.mit.edu	37	20	25666266	25666266	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25666266G>A	uc002wva.2	-	3	709	c.187C>T	c.(187-189)CGG>TGG	p.R63W	ZNF337_uc010ztg.1_Intron|ZNF337_uc002wvb.2_Missense_Mutation_p.R63W|ZNF337_uc002wvc.2_Missense_Mutation_p.R63W	NM_015655	NP_056470	Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	63	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGCTCTAGCCGCCTGATGAGT	0.577																0.089514	2.006694	68.581879	35	356	KEEP	---	---	---	---	19	18	171	229	-1	capture	Missense_Mutation	SNP	25666266	25666266	ZNF337	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	17733	214
STAU1	6780	broad.mit.edu	37	20	47741010	47741010	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47741010C>T	uc002xud.2	-	7	1135	c.724G>A	c.(724-726)GCC>ACC	p.A242T	STAU1_uc002xua.2_Missense_Mutation_p.A161T|STAU1_uc002xub.2_Missense_Mutation_p.A167T|STAU1_uc002xuc.2_Missense_Mutation_p.A161T|STAU1_uc002xue.2_Missense_Mutation_p.A161T|STAU1_uc002xuf.2_Missense_Mutation_p.A167T|STAU1_uc002xug.2_Missense_Mutation_p.A242T	NM_017453	NP_059347	O95793	STAU1_HUMAN	staufen isoform b	242	DRBM 2.					microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding	p.A242T(1)		ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			ACAGCTATGGCGGCATTTTTC	0.468																0.44519	590.789795	591.954466	199	248	KEEP	---	---	---	---	102	105	122	150	-1	capture	Missense_Mutation	SNP	47741010	47741010	STAU1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15162	214
FBLN2	2199	broad.mit.edu	37	3	13670777	13670777	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13670777G>A	uc011avb.1	+	12	2811	c.2686G>A	c.(2686-2688)GGC>AGC	p.G896S	FBLN2_uc011auz.1_Missense_Mutation_p.G922S|FBLN2_uc011ava.1_Missense_Mutation_p.G943S|FBLN2_uc011avc.1_Missense_Mutation_p.G943S	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	896	EGF-like 6; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GGATGCCTTTGGCCGGGGCTG	0.662																0.25	13.965337	15.101485	5	15	KEEP	---	---	---	---	5	5	13	8	-1	capture	Missense_Mutation	SNP	13670777	13670777	FBLN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5645	214
TRAT1	50852	broad.mit.edu	37	3	108549621	108549621	+	Nonsense_Mutation	SNP	C	T	T	rs148894492		TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108549621C>T	uc003dxi.1	+	2	256	c.112C>T	c.(112-114)CGA>TGA	p.R38*	TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	38	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						GGAAAAGCAACGACAAGGTAA	0.418																0.336245	217.313209	222.741372	77	152	KEEP	---	---	---	---	47	38	76	84	-1	capture	Nonsense_Mutation	SNP	108549621	108549621	TRAT1	3	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	16349	214
IFT80	57560	broad.mit.edu	37	3	160083930	160083930	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160083930C>T	uc011boy.1	-	6	883	c.450G>A	c.(448-450)GTG>GTA	p.V150V	IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Silent_p.V13V|IFT80_uc003fdd.1_Intron|IFT80_uc003fde.1_Silent_p.V13V	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56	150	WD 3.					cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTACTGAATACACTGGTGTTC	0.353																0.376384	273.454304	277.09796	102	169	KEEP	---	---	---	---	41	75	84	103	-1	capture	Silent	SNP	160083930	160083930	IFT80	3	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	7489	214
RBM47	54502	broad.mit.edu	37	4	40440481	40440481	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440481C>T	uc003gvc.2	-	4	1140	c.430G>A	c.(430-432)GTG>ATG	p.V144M	RBM47_uc003gvd.2_Missense_Mutation_p.V144M|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.V106M|RBM47_uc003gvg.1_Missense_Mutation_p.V144M	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	144	RRM 1.					nucleus	nucleotide binding|RNA binding			breast(3)	3						CTGCAGCACACGCCGAGCAGG	0.637																0.25	34.690923	38.106457	15	45	KEEP	---	---	---	---	9	10	27	35	-1	capture	Missense_Mutation	SNP	40440481	40440481	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13036	214
LRRC66	339977	broad.mit.edu	37	4	52869513	52869513	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:52869513T>C	uc003gzi.2	-	2	555	c.542A>G	c.(541-543)AAT>AGT	p.N181S		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	181	LRR 4.					integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						CAATATCCCATTGAATGACAG	0.313																0.458621	487.163219	487.593853	133	157	KEEP	---	---	---	---	64	88	92	88	-1	capture	Missense_Mutation	SNP	52869513	52869513	LRRC66	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	8933	214
SULT1B1	27284	broad.mit.edu	37	4	70596318	70596318	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70596318G>A	uc003hen.2	-	7	977	c.679C>T	c.(679-681)CAC>TAC	p.H227Y		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	227	PAPS (By similarity).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						AATGAGGTGTGATGGATGATC	0.378																0.518868	167.919951	167.952382	55	51	KEEP	---	---	---	---	32	27	22	31	-1	capture	Missense_Mutation	SNP	70596318	70596318	SULT1B1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	15264	214
C4orf40	401137	broad.mit.edu	37	4	71021774	71021774	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71021774C>T	uc003hfa.3	+	3	128	c.55C>T	c.(55-57)CGG>TGG	p.R19W	C4orf40_uc003hfb.3_Missense_Mutation_p.R19W	NM_214711	NP_999876	Q6MZM9	CD040_HUMAN	hypothetical protein LOC401137 precursor	19						extracellular region					0						ATTTTAGAGACGGTTCCCCTT	0.259																0.471698	78.271529	78.308449	25	28	KEEP	---	---	---	---	20	9	14	20	-1	capture	Missense_Mutation	SNP	71021774	71021774	C4orf40	4	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	2247	214
AFM	173	broad.mit.edu	37	4	74365901	74365901	+	Missense_Mutation	SNP	A	C	C	rs149561663		TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74365901A>C	uc003hhb.2	+	12	1634	c.1603A>C	c.(1603-1605)ATG>CTG	p.M535L		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	535	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCACGCAGACATGTGTCAATC	0.393																0.348485	80.6093	81.944609	23	43	KEEP	---	---	---	---	8	17	21	26	-1	capture	Missense_Mutation	SNP	74365901	74365901	AFM	4	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	361	214
AGXT2L1	64850	broad.mit.edu	37	4	109667553	109667553	+	Splice_Site	SNP	A	G	G			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:109667553A>G	uc003hzc.2	-	11	1484	c.1303_splice	c.e11+1	p.V435_splice	AGXT2L1_uc010imc.2_Splice_Site_p.V429_splice|AGXT2L1_uc011cfm.1_Splice_Site_p.V395_splice|AGXT2L1_uc011cfn.1_Splice_Site_p.V362_splice|AGXT2L1_uc011cfo.1_Splice_Site_p.V377_splice	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1						cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)		CCATGGACCCACCTGTTAGAA	0.413																0.297872	77.16389	80.596796	28	66	KEEP	---	---	---	---	19	13	32	39	-1	capture	Splice_Site	SNP	109667553	109667553	AGXT2L1	4	A	G	G	G	1	0	0	0	0	0	0	1	0	78	6	5	3	406	214
SYNPO2	171024	broad.mit.edu	37	4	119948017	119948017	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:119948017C>T	uc003icm.3	+	3	689	c.493C>T	c.(493-495)CAA>TAA	p.Q165*	SYNPO2_uc010ina.2_Nonsense_Mutation_p.Q165*|SYNPO2_uc010inb.2_Nonsense_Mutation_p.Q165*|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Nonsense_Mutation_p.Q93*	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	165						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						CCCGAGCTACCAAAGGGCTCC	0.557																0.293103	46.347686	48.573084	17	41	KEEP	---	---	---	---	9	8	19	25	-1	capture	Nonsense_Mutation	SNP	119948017	119948017	SYNPO2	4	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	15345	214
CAMK4	814	broad.mit.edu	37	5	110818505	110818505	+	Missense_Mutation	SNP	A	C	C			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:110818505A>C	uc011cvj.1	+	11	950	c.851A>C	c.(850-852)GAT>GCT	p.D284A	CAMK4_uc003kpf.2_Missense_Mutation_p.D284A|CAMK4_uc010jbv.2_Missense_Mutation_p.D87A|CAMK4_uc003kpg.2_5'UTR	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	284	Protein kinase.				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		ATTGTTTTGGATCCAAAGAAA	0.423					687											0.401042	266.323512	267.970878	77	115	KEEP	---	---	---	---	40	56	66	65	-1	capture	Missense_Mutation	SNP	110818505	110818505	CAMK4	5	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	2581	214
PCDHB7	56129	broad.mit.edu	37	5	140553289	140553289	+	Silent	SNP	G	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140553289G>T	uc003lit.2	+	1	1047	c.873G>T	c.(871-873)ACG>ACT	p.T291T		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	291	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCTCAAAACGTTTCAAATCA	0.418																0.365385	238.84745	242.161081	76	132	KEEP	---	---	---	---	36	50	77	68	0.418604651163	capture	Silent	SNP	140553289	140553289	PCDHB7	5	G	T	T	T	1	0	0	0	0	0	0	0	1	509	40	4	4	11450	214
KIAA1244	57221	broad.mit.edu	37	6	138559683	138559683	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138559683G>A	uc003qhu.2	+	6	458	c.458G>A	c.(457-459)CGT>CAT	p.R153H		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	153					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGTCACCAGCGTAGCATAAAC	0.453																0.331683	183.546713	188.622257	67	135	KEEP	---	---	---	---	38	32	75	71	-1	capture	Missense_Mutation	SNP	138559683	138559683	KIAA1244	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8139	214
RNASET2	8635	broad.mit.edu	37	6	167360227	167360227	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167360227C>T	uc003qve.2	-	4	611	c.204G>A	c.(202-204)TGG>TGA	p.W68*	RNASET2_uc003qvh.2_Intron|RNASET2_uc003qvf.2_5'UTR|RNASET2_uc003qvg.2_Silent_p.K5K|RNASET2_uc003qvi.1_Intron	NM_003730	NP_003721	O00584	RNT2_HUMAN	ribonuclease T2 precursor	68					RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		TTTTATCGGGCCTGGAAATTC	0.348																0.277778	26.542163	28.13704	10	26	KEEP	---	---	---	---	6	5	13	17	-1	capture	Nonsense_Mutation	SNP	167360227	167360227	RNASET2	6	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	13310	214
ABCA13	154664	broad.mit.edu	37	7	48443394	48443394	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48443394C>T	uc003toq.2	+	39	12013	c.11988C>T	c.(11986-11988)ACC>ACT	p.T3996T	ABCA13_uc010kys.1_Silent_p.T1070T|ABCA13_uc003tos.1_Silent_p.T822T|ABCA13_uc010kyt.1_RNA	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3996	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TGTCGAGGACCGTGGTTCTGG	0.572																0.119403	11.057431	20.579014	8	59	KEEP	---	---	---	---	4	5	29	35	-1	capture	Silent	SNP	48443394	48443394	ABCA13	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	31	214
EIF4H	7458	broad.mit.edu	37	7	73601967	73601967	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73601967G>T	uc003uad.1	+	2	94	c.86G>T	c.(85-87)GGT>GTT	p.G29V	RFC2_uc011kfa.1_Intron|EIF4H_uc011kfg.1_Missense_Mutation_p.G29V|EIF4H_uc010lbm.2_Missense_Mutation_p.G29V|EIF4H_uc003uae.1_Missense_Mutation_p.G29V|EIF4H_uc003uaf.1_Intron	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	29					interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0						GGTGGCCATGGTTCCCGTAGC	0.527																0.266332	129.263228	139.102234	53	146	KEEP	---	---	---	---	32	32	81	94	0.5	capture	Missense_Mutation	SNP	73601967	73601967	EIF4H	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	4994	214
PILRA	29992	broad.mit.edu	37	7	99996939	99996939	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99996939C>T	uc003uuo.1	+	5	945	c.733C>T	c.(733-735)CCA>TCA	p.P245S	PILRA_uc011kjo.1_Missense_Mutation_p.P172S|PILRA_uc003uup.1_Missense_Mutation_p.P172S|PILRA_uc003uuq.1_Silent_p.S160S	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha	245	Cytoplasmic (Potential).				interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACAGAGGAGCCATATGAGAA	0.483																0.171429	22.761344	29.902232	12	58	KEEP	---	---	---	---	5	11	31	35	-1	capture	Missense_Mutation	SNP	99996939	99996939	PILRA	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11828	214
GRM8	2918	broad.mit.edu	37	7	126249517	126249517	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126249517C>T	uc003vlr.2	-	7	1704	c.1393G>A	c.(1393-1395)GGA>AGA	p.G465R	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.G465R|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	465	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GGAGCATCTCCGTTTTCATTA	0.378													HNSCC(24;0.065)			0.497238	279.747331	279.748506	90	91	KEEP	---	---	---	---	45	52	47	50	-1	capture	Missense_Mutation	SNP	126249517	126249517	GRM8	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6736	214
IDO1	3620	broad.mit.edu	37	8	39782809	39782809	+	Missense_Mutation	SNP	T	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39782809T>A	uc003xnm.2	+	9	889	c.775T>A	c.(775-777)TTT>ATT	p.F259I	IDO1_uc003xnn.2_RNA	NM_002164	NP_002155	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	259					female pregnancy|tryptophan catabolic process	cytosol	electron carrier activity|heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			central_nervous_system(2)	2					L-Tryptophan(DB00150)	CCCAAAGGAGTTTGCAGGGGG	0.507																0.090909	1.566878	8.990107	4	40	KEEP	---	---	---	---	1	3	13	31	-1	capture	Missense_Mutation	SNP	39782809	39782809	IDO1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	7426	214
RAD21	5885	broad.mit.edu	37	8	117875483	117875483	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:117875483G>A	uc003yod.2	-	3	448	c.160C>T	c.(160-162)CGG>TGG	p.R54W		NM_006265	NP_006256	O60216	RAD21_HUMAN	RAD21 homolog	54					apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding			lung(1)|skin(1)	2	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					CCTGATGTCCGTAATGCCATT	0.348					357											0.421739	287.434406	288.663941	97	133	KEEP	---	---	---	---	55	52	69	82	-1	capture	Missense_Mutation	SNP	117875483	117875483	RAD21	8	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	12876	214
PALM2-AKAP2	445815	broad.mit.edu	37	9	112686091	112686091	+	Silent	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112686091C>T	uc004bei.2	+	4	526	c.334C>T	c.(334-336)CTG>TTG	p.L112L	PALM2_uc004bef.2_Silent_p.L114L|PALM2_uc004beg.2_Silent_p.L114L|PALM2_uc004beh.3_Silent_p.L112L|PALM2-AKAP2_uc004bek.3_Silent_p.L112L|PALM2-AKAP2_uc004bej.3_Silent_p.L112L|PALM2-AKAP2_uc004bel.1_5'UTR	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	Error:Variant_position_missing_in_Q9Y2D5_after_alignment							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						CCTAGAGAAACTGAAGGAAAC	0.403																0.456522	67.071987	67.147445	21	25	KEEP	---	---	---	---	15	9	8	20	-1	capture	Silent	SNP	112686091	112686091	PALM2-AKAP2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	11314	214
SERPINA7	6906	broad.mit.edu	37	X	105280734	105280734	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105280734C>T	uc004eme.1	-	1	332	c.316G>A	c.(316-318)GTA>ATA	p.V106I	SERPINA7_uc010npd.2_Missense_Mutation_p.V106I|SERPINA7_uc010npe.1_Missense_Mutation_p.V106I	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	106					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	TGGATCTCTACCATTGGAGTG	0.478																0.846154	369.812862	384.696089	110	20	KEEP	---	---	---	---	51	68	13	9	-1	capture	Missense_Mutation	SNP	105280734	105280734	SERPINA7	23	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	13987	214
FLG2	388698	broad.mit.edu	37	1	152324558	152324559	+	Frame_Shift_Del	DEL	TG	-	-	rs140875805	byFrequency	TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152324558_152324559delTG	uc001ezw.3	-	3	5776_5777	c.5703_5704delCA	c.(5701-5706)CACAGCfs	p.H1901fs	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1901_1902							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGCTTGGCTGTGTGTGTGTC	0.515																0.02			10	508		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	152324558	152324559	FLG2	1	TG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	5868	214
PTPN14	5784	broad.mit.edu	37	1	214557049	214557051	+	In_Frame_Del	DEL	CCT	-	-			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214557049_214557051delCCT	uc001hkk.1	-	13	2418_2420	c.2147_2149delAGG	c.(2146-2151)GAGGCT>GCT	p.E716del	PTPN14_uc010pty.1_In_Frame_Del_p.E617del	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	716	Poly-Glu.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTCTGGAGCCTCCTCCTCCTC	0.626	Colon(92;557 1424 24372 34121 40073)															0.05			7	136		---	---	---	---						capture_indel	In_Frame_Del	DEL	214557049	214557051	PTPN14	1	CCT	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	12678	214
MKI67	4288	broad.mit.edu	37	10	129901939	129901947	+	In_Frame_Del	DEL	CTCTTTGTG	-	-	rs1050767	byFrequency;by1000genomes	TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129901939_129901947delCTCTTTGTG	uc001lke.2	-	13	8352_8360	c.8157_8165delCACAAAGAG	c.(8155-8166)AGCACAAAGAGG>AGG	p.STK2719del	MKI67_uc001lkf.2_In_Frame_Del_p.STK2359del|MKI67_uc009yav.1_In_Frame_Del_p.STK2294del|MKI67_uc009yaw.1_In_Frame_Del_p.STK1869del	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2719_2721	16 X 122 AA approximate repeats.|15.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCTGAGATGCCTCTTTGTGCTTGCTGTGG	0.483																0.67			102	50		---	---	---	---						capture_indel	In_Frame_Del	DEL	129901939	129901947	MKI67	10	CTCTTTGTG	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	9510	214
ARHGEF7	8874	broad.mit.edu	37	13	111896312	111896315	+	Splice_Site	DEL	AAGT	-	-			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111896312_111896315delAAGT	uc001vrs.2	+	8	1167	c.917_splice	c.e8+1	p.K306_splice	ARHGEF7_uc001vrr.2_Splice_Site_p.K285_splice|ARHGEF7_uc001vrt.2_Splice_Site_p.K256_splice|ARHGEF7_uc010tjn.1_Intron|ARHGEF7_uc001vru.1_Splice_Site_p.K128_splice|ARHGEF7_uc001vrv.3_Splice_Site_p.K128_splice|ARHGEF7_uc001vrw.3_Splice_Site_p.K128_splice|ARHGEF7_uc001vrx.3_Splice_Site_p.K128_splice|ARHGEF7_uc010tjo.1_Splice_Site_p.K203_splice|ARHGEF7_uc010tjp.1_Splice_Site_p.K50_splice|ARHGEF7_uc010agn.1_Splice_Site_p.K50_splice	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GACCAGTGAGAAGTAAGTTAGATG	0.324					707											0.29			30	75		---	---	---	---						capture_indel	Splice_Site	DEL	111896312	111896315	ARHGEF7	13	AAGT	-	-	-	1	0	1	0	1	0	0	1	0	117	9	5	5	904	214
APC2	10297	broad.mit.edu	37	19	1466495	1466496	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1466495_1466496insT	uc002lsr.1	+	15	3403_3404	c.3195_3196insT	c.(3193-3198)CTCTCGfs	p.L1065fs	APC2_uc002lss.1_Frame_Shift_Ins_p.L647fs|APC2_uc002lst.1_Frame_Shift_Ins_p.L1065fs|APC2_uc002lsu.1_Frame_Shift_Ins_p.L1064fs|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	1065_1066	Interaction with CTNNB1.|1.|5 X 20 AA approximate repeat of F-X-V-E- X-T-P-X-C-F-S-R-X-S-S-L-S-S-L-S.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGGCCACTCTCGCTGTCCCG	0.683																0.20			8	32		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	1466495	1466496	APC2	19	-	T	T	T	1	0	1	1	0	0	0	0	0	405	32	5	5	757	214
CD3EAP	10849	broad.mit.edu	37	19	45911859	45911861	+	In_Frame_Del	DEL	GAA	-	-			TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45911859_45911861delGAA	uc002pbq.1	+	3	1121_1123	c.633_635delGAA	c.(631-636)CGGAAG>CGG	p.K217del	PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_In_Frame_Del_p.K219del	NM_012099	NP_036231	O15446	RPA34_HUMAN	CD3E antigen, epsilon polypeptide associated	217	Poly-Lys.				rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity			large_intestine(2)|ovary(2)	4		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGGATGTGCGGAAGAAGAAGAAG	0.581																0.02			7	341		---	---	---	---						capture_indel	In_Frame_Del	DEL	45911859	45911861	CD3EAP	19	GAA	-	-	-	1	0	1	0	1	0	0	0	0	522	41	5	5	2983	214
SEC24D	9871	broad.mit.edu	37	4	119745869	119745870	+	Frame_Shift_Ins	INS	-	G	G	rs141446866		TCGA-28-2514-01	TCGA-28-2514-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:119745869_119745870insG	uc003ici.3	-	3	425_426	c.153_154insC	c.(151-156)ACCGCCfs	p.T51fs	SEC24D_uc003icj.3_Frame_Shift_Ins_p.T51fs|SEC24D_uc003icl.2_RNA|SEC24D_uc010imz.1_RNA|SEC24D_uc011cgg.1_RNA	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	51_52	Pro-rich.				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						CCCCTAGTGGCGGTGGCCCCCA	0.540																0.03			8	284		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	119745869	119745870	SEC24D	4	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	13890	214
