Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0562	9731	broad.mit.edu	37	1	3746424	3746424	+	Silent	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3746424G>A	uc001aky.2	-	14	2333	c.1974C>T	c.(1972-1974)AAC>AAT	p.N658N	KIAA0562_uc010nzm.1_RNA	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,	658						centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		TGTAGAGAATGTTCCTGCGTG	0.463																0.244068	173.577698	191.170464	72	223	KEEP	---	---	---	---	37	38	118	128	-1	capture	Silent	SNP	3746424	3746424	KIAA0562	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	8106	233
RPA2	6118	broad.mit.edu	37	1	28223599	28223599	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28223599G>A	uc001bpe.1	-	6	724	c.442C>T	c.(442-444)CCC>TCC	p.P148S	RPA2_uc001bpd.1_Missense_Mutation_p.P156S|RPA2_uc010ofp.1_Missense_Mutation_p.P52S	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa	148					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTCCAGGGGCATGATCTTA	0.383											Direct_reversal_of_damage|NER					0.026846	-29.938937	6.922028	4	145	KEEP	---	---	---	---	2	2	75	87	-1	capture	Missense_Mutation	SNP	28223599	28223599	RPA2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13429	233
C8B	732	broad.mit.edu	37	1	57417728	57417728	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57417728G>A	uc001cyp.2	-	5	726	c.659C>T	c.(658-660)ACG>ATG	p.T220M	C8B_uc010oon.1_Missense_Mutation_p.T158M|C8B_uc010ooo.1_Missense_Mutation_p.T168M	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	220	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						TACCTGTGGCGTGTAGCTTTC	0.284																0.305419	169.38517	176.301301	62	141	KEEP	---	---	---	---	28	38	63	93	-1	capture	Missense_Mutation	SNP	57417728	57417728	C8B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2394	233
SGIP1	84251	broad.mit.edu	37	1	67206953	67206953	+	Splice_Site	SNP	A	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67206953A>T	uc001dcr.2	+	24	2517	c.2300_splice	c.e24-2	p.G767_splice	SGIP1_uc010opd.1_Splice_Site_p.G367_splice|SGIP1_uc001dcs.2_Splice_Site_p.G367_splice|SGIP1_uc001dct.2_Splice_Site_p.G369_splice|SGIP1_uc009wat.2_Splice_Site_p.G561_splice|SGIP1_uc001dcu.2_Splice_Site_p.G272_splice	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						GTTTTTTTTTAGGGGTGGGTT	0.373																0.023669	-35.301222	7.299595	4	165	KEEP	---	---	---	---	0	5	80	107	-1	capture	Splice_Site	SNP	67206953	67206953	SGIP1	1	A	T	T	T	1	0	0	0	0	0	0	1	0	195	15	5	4	14099	233
TDRD10	126668	broad.mit.edu	37	1	154479756	154479756	+	Silent	SNP	G	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154479756G>C	uc009wow.2	+	3	880	c.42G>C	c.(40-42)CTG>CTC	p.L14L	TDRD10_uc001ffd.2_Silent_p.L14L	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a	14							nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTGATAAACTGTTTGGGAAGA	0.502																0.279412	61.896805	64.871365	19	49	KEEP	---	---	---	---	15	9	27	27	-1	capture	Silent	SNP	154479756	154479756	TDRD10	1	G	C	C	C	1	0	0	0	0	0	0	0	1	613	48	4	4	15616	233
SLAMF7	57823	broad.mit.edu	37	1	160718192	160718192	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160718192C>A	uc001fwq.2	+	2	279	c.264C>A	c.(262-264)TAC>TAA	p.Y88*	SLAMF7_uc010pjn.1_Intron|SLAMF7_uc001fws.2_Intron|SLAMF7_uc001fwr.2_Nonsense_Mutation_p.Y88*|SLAMF7_uc010pjo.1_Nonsense_Mutation_p.Y88*|SLAMF7_uc010pjp.1_Intron|SLAMF7_uc010pjq.1_Nonsense_Mutation_p.Y88*|SLAMF7_uc010pjr.1_Intron	NM_021181	NP_067004	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	88	Extracellular (Potential).				cell adhesion|natural killer cell activation|natural killer cell mediated cytotoxicity	integral to membrane	receptor activity			skin(2)|ovary(1)	3	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ATGGAGGCTACTCCCTGAAGC	0.507																0.065217	-11.109226	7.119298	6	86	KEEP	---	---	---	---	3	3	34	61	0.5	capture	Nonsense_Mutation	SNP	160718192	160718192	SLAMF7	1	C	A	A	A	1	0	0	0	0	0	1	0	0	259	20	5	4	14262	233
USH2A	7399	broad.mit.edu	37	1	216052106	216052106	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216052106C>A	uc001hku.1	-	42	8945	c.8558G>T	c.(8557-8559)AGA>ATA	p.R2853I		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2853	Extracellular (Potential).|Fibronectin type-III 15.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTCTCTTACCTCAAATTAGG	0.393													HNSCC(13;0.011)			0.051724	-5.907111	6.408031	3	55	KEEP	---	---	---	---	2	1	25	37	0.333333333333	capture	Missense_Mutation	SNP	216052106	216052106	USH2A	1	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16918	233
OBSCN	84033	broad.mit.edu	37	1	228444458	228444458	+	Silent	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228444458G>A	uc009xez.1	+	15	4460	c.4416G>A	c.(4414-4416)GAG>GAA	p.E1472E	OBSCN_uc001hsn.2_Silent_p.E1472E	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1472	Ig-like 15.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCCAGACGGAGGTGATGTGGT	0.657					4006											0.288889	35.550879	37.352955	13	32	KEEP	---	---	---	---	6	8	17	16	-1	capture	Silent	SNP	228444458	228444458	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	10717	233
CUBN	8029	broad.mit.edu	37	10	16870839	16870839	+	Missense_Mutation	SNP	C	T	T	rs139051724		TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:16870839C>T	uc001ioo.2	-	66	10781	c.10729G>A	c.(10729-10731)GCC>ACC	p.A3577T		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3577	CUB 27.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGAGAGCTGGCGTTGGGCCCA	0.443				p.A3577T(HEC59-Tumor)	2704									OREG0020047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.484211	133.246133	133.266112	46	49	KEEP	---	---	---	---	26	31	25	30	-1	capture	Missense_Mutation	SNP	16870839	16870839	CUBN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4011	233
OR52M1	119772	broad.mit.edu	37	11	4566817	4566817	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4566817C>T	uc010qyf.1	+	1	397	c.397C>T	c.(397-399)CGT>TGT	p.R133C		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAACCCACTACGTCATAGCAT	0.522																0.314516	110.879993	114.675849	39	85	KEEP	---	---	---	---	18	24	53	46	-1	capture	Missense_Mutation	SNP	4566817	4566817	OR52M1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11030	233
OR4S2	219431	broad.mit.edu	37	11	55419151	55419151	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55419151C>T	uc001nhs.1	+	1	772	c.772C>T	c.(772-774)CGC>TGC	p.R258C		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TATGTACATGCGCCCTGATAC	0.463																0.327586	260.434398	268.075178	95	195	KEEP	---	---	---	---	50	50	88	124	-1	capture	Missense_Mutation	SNP	55419151	55419151	OR4S2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10987	233
SLC25A45	283130	broad.mit.edu	37	11	65143941	65143941	+	Silent	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65143941G>A	uc001odp.1	-	6	1226	c.804C>T	c.(802-804)CGC>CGT	p.R268R	SLC25A45_uc009yqi.1_Silent_p.R206R|SLC25A45_uc001odq.1_Silent_p.R244R|SLC25A45_uc001odr.1_Silent_p.R268R|SLC25A45_uc001ods.1_Silent_p.R226R|SLC25A45_uc001odt.1_Silent_p.R226R	NM_001077241	NP_001070709	Q8N413	S2545_HUMAN	solute carrier family 25, member 45 isoform b	268	Helical; Name=6; (Potential).|Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CGGGAAAGGCGCGGGCACTGT	0.617																0.24	45.387872	49.96496	18	57	KEEP	---	---	---	---	9	10	36	25	-1	capture	Silent	SNP	65143941	65143941	SLC25A45	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14402	233
CD3G	917	broad.mit.edu	37	11	118223167	118223167	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118223167C>A	uc001psu.2	+	6	612	c.532C>A	c.(532-534)CAG>AAG	p.Q178K	CD3G_uc009zaa.1_Missense_Mutation_p.Q118K	NM_000073	NP_000064	P09693	CD3G_HUMAN	CD3G antigen, gamma polypeptide precursor	178	Cytoplasmic (Potential).				establishment or maintenance of cell polarity|protein complex assembly|protein transport|regulation of apoptosis|T cell activation|T cell costimulation|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	protein heterodimerization activity|receptor signaling complex scaffold activity|T cell receptor binding|transmembrane receptor activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		TCAAGGAAACCAGTTGAGGAG	0.443																0.283784	173.426035	182.748768	63	159	KEEP	---	---	---	---	43	29	80	108	0.402777777778	capture	Missense_Mutation	SNP	118223167	118223167	CD3G	11	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	2984	233
KCNA6	3742	broad.mit.edu	37	12	4919731	4919731	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4919731G>C	uc001qng.2	+	1	1390	c.524G>C	c.(523-525)GGC>GCC	p.G175A		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	175	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						CCGGCCAGGGGCATCGCCATC	0.597													HNSCC(72;0.22)			0.186441	24.945745	30.338321	11	48	KEEP	---	---	---	---	9	5	26	36	-1	capture	Missense_Mutation	SNP	4919731	4919731	KCNA6	12	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	7929	233
NANOG	79923	broad.mit.edu	37	12	7945667	7945667	+	Silent	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7945667C>T	uc009zfy.1	+	2	489	c.273C>T	c.(271-273)GTC>GTT	p.V91V		NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox	91					cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		AAGACAAGGTCCCGGTCAAGA	0.478																0.434783	153.03102	153.457838	50	65	KEEP	---	---	---	---	31	22	37	33	-1	capture	Silent	SNP	7945667	7945667	NANOG	12	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	10059	233
FAM60A	58516	broad.mit.edu	37	12	31451078	31451078	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31451078C>T	uc010sjz.1	-	2	300	c.61G>A	c.(61-63)GCT>ACT	p.A21T	FAM60A_uc001rkd.2_Missense_Mutation_p.A21T|FAM60A_uc010ska.1_Missense_Mutation_p.A21T|FAM60A_uc001rke.2_Missense_Mutation_p.A21T|FAM60A_uc010skb.1_Intron|FAM60A_uc001rkc.2_Missense_Mutation_p.A46T	NM_021238	NP_067061	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	21											0	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					GAGGACTTAGCTCTGCAAATA	0.418																0.168033	84.722704	110.195994	41	203	KEEP	---	---	---	---	16	28	100	115	-1	capture	Missense_Mutation	SNP	31451078	31451078	FAM60A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	5543	233
TAOK3	51347	broad.mit.edu	37	12	118599775	118599775	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118599775C>T	uc001twx.2	-	18	2252	c.1957G>A	c.(1957-1959)GAC>AAC	p.D653N	TAOK3_uc001twv.2_Missense_Mutation_p.D193N|TAOK3_uc001tww.2_Missense_Mutation_p.D483N|TAOK3_uc001twy.3_Missense_Mutation_p.D653N	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	653					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGGACTCGTCGTGCCGGATT	0.507					500											0.259669	126.04287	135.508967	47	134	KEEP	---	---	---	---	26	28	75	80	-1	capture	Missense_Mutation	SNP	118599775	118599775	TAOK3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15437	233
ABCB9	23457	broad.mit.edu	37	12	123430663	123430663	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123430663T>G	uc001udm.3	-	6	1470	c.1160A>C	c.(1159-1161)GAG>GCG	p.E387A	ABCB9_uc010tai.1_5'Flank|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Missense_Mutation_p.E387A|ABCB9_uc010taj.1_Missense_Mutation_p.E387A|ABCB9_uc001udp.2_Missense_Mutation_p.E387A|ABCB9_uc001udq.2_Missense_Mutation_p.E169A|ABCB9_uc001udr.2_Missense_Mutation_p.E387A	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	387	Poly-Glu.|ABC transmembrane type-1.				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CACCTCTGCCTCCTCCTCCTC	0.602	Ovarian(49;786 1333 9175 38236)															0.0375	-12.029479	6.479171	3	77	KEEP	---	---	---	---	0	3	42	48	-1	capture	Missense_Mutation	SNP	123430663	123430663	ABCB9	12	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	48	233
FRMD6	122786	broad.mit.edu	37	14	52179253	52179253	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52179253G>T	uc001wzd.2	+	9	1118	c.833G>T	c.(832-834)GGA>GTA	p.G278V	FRMD6_uc001wzb.2_Missense_Mutation_p.G270V|FRMD6_uc001wzc.2_Missense_Mutation_p.G270V|FRMD6_uc001wze.2_Missense_Mutation_p.G201V|FRMD6_uc001wzf.2_5'Flank	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6	278	FERM.					cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					ACAAATGTTGGAAAATTGGTG	0.284																0.241071	65.975003	72.821804	27	85	KEEP	---	---	---	---	14	15	46	48	0.48275862069	capture	Missense_Mutation	SNP	52179253	52179253	FRMD6	14	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	5997	233
PLEKHH1	57475	broad.mit.edu	37	14	68026397	68026397	+	Missense_Mutation	SNP	A	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:68026397A>C	uc001xjl.1	+	5	554	c.412A>C	c.(412-414)AAG>CAG	p.K138Q		NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	138	Potential.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGTGACACTCAAGTTGGCAAA	0.537																0.266667	12.293716	13.030979	4	11	KEEP	---	---	---	---	1	4	1	12	-1	capture	Missense_Mutation	SNP	68026397	68026397	PLEKHH1	14	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	11979	233
FBLN5	10516	broad.mit.edu	37	14	92403398	92403398	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:92403398G>A	uc001xzx.3	-	4	745	c.272C>T	c.(271-273)CCG>CTG	p.P91L	FBLN5_uc010aud.2_Missense_Mutation_p.P96L|FBLN5_uc010aue.2_Missense_Mutation_p.P132L	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor	91					cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				TGCTGGGTACGGACCTgagta	0.433				p.P132L(IPC298-Tumor)	478											0.313043	106.858096	110.435898	36	79	KEEP	---	---	---	---	15	22	50	35	-1	capture	Missense_Mutation	SNP	92403398	92403398	FBLN5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5646	233
TMCO5A	145942	broad.mit.edu	37	15	38233922	38233922	+	Silent	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:38233922C>T	uc001zjw.2	+	7	598	c.495C>T	c.(493-495)CTC>CTT	p.L165L	TMCO5A_uc001zjv.1_Silent_p.L165L|TMCO5A_uc010bbc.1_Silent_p.L165L	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	165	Potential.					integral to membrane				central_nervous_system(1)	1						ATCAAGCCCTCTACATAAAGG	0.363																0.348485	142.808962	145.483959	46	86	KEEP	---	---	---	---	26	27	45	50	-1	capture	Silent	SNP	38233922	38233922	TMCO5A	15	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	15884	233
MAP1A	4130	broad.mit.edu	37	15	43816806	43816806	+	Silent	SNP	T	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43816806T>C	uc001zrt.2	+	4	3602	c.3135T>C	c.(3133-3135)GCT>GCC	p.A1045A		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1045						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AAGATGCTGCTGAGGAGACAG	0.572																0.288288	81.137004	85.611916	32	79	KEEP	---	---	---	---	16	25	42	44	-1	capture	Silent	SNP	43816806	43816806	MAP1A	15	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9141	233
SENP8	123228	broad.mit.edu	37	15	72432114	72432114	+	Silent	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72432114C>T	uc002atp.2	+	2	249	c.150C>T	c.(148-150)CAC>CAT	p.H50H		NM_145204	NP_660205	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	50	Protease.				proteolysis		cysteine-type peptidase activity|protein binding			ovary(1)|skin(1)	2						GCTCTGATCACGTCAGTTTCA	0.478																0.245552	178.247882	194.80801	69	212	KEEP	---	---	---	---	35	45	104	129	-1	capture	Silent	SNP	72432114	72432114	SENP8	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13945	233
LRRK1	79705	broad.mit.edu	37	15	101528988	101528988	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101528988C>T	uc002bwr.2	+	5	902	c.583C>T	c.(583-585)CGC>TGC	p.R195C	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bwq.1_Missense_Mutation_p.R195C	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	195	ANK 4.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGTCATCGTGCGCTTGCCCCT	0.607					1100											0.301587	52.414016	54.621535	19	44	KEEP	---	---	---	---	11	9	22	25	-1	capture	Missense_Mutation	SNP	101528988	101528988	LRRK1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8947	233
ZNF646	9726	broad.mit.edu	37	16	31091658	31091658	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31091658G>A	uc002eap.2	+	2	4302	c.4013G>A	c.(4012-4014)CGC>CAC	p.R1338H		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1338	C2H2-type 24.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						TACTCCAACCGCATGGCCCTG	0.697																0.044776	-8.522308	6.315294	3	64	KEEP	---	---	---	---	2	1	40	44	-1	capture	Missense_Mutation	SNP	31091658	31091658	ZNF646	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17940	233
CDH13	1012	broad.mit.edu	37	16	83704446	83704446	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:83704446G>A	uc002fgx.2	+	9	1273	c.1153G>A	c.(1153-1155)GTT>ATT	p.V385I	CDH13_uc010vns.1_Missense_Mutation_p.V432I|CDH13_uc010vnt.1_Missense_Mutation_p.V131I|CDH13_uc010vnu.1_Missense_Mutation_p.V346I	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	385	Cadherin 3.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CAATTTGACAGTTGAAGATAA	0.478																0.30303	117.850272	122.420943	40	92	KEEP	---	---	---	---	18	23	53	47	-1	capture	Missense_Mutation	SNP	83704446	83704446	CDH13	16	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	3070	233
MYO15A	51168	broad.mit.edu	37	17	18025430	18025430	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18025430C>T	uc010vxh.1	+	2	3654	c.3316C>T	c.(3316-3318)CGG>TGG	p.R1106W		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1106	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GGGGGGTGAACGGCGCCAGGC	0.672																0.327586	97.729389	100.779302	38	78	KEEP	---	---	---	---	18	21	39	44	-1	capture	Missense_Mutation	SNP	18025430	18025430	MYO15A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	9973	233
TP53I13	90313	broad.mit.edu	37	17	27899640	27899640	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27899640C>G	uc002hee.2	+	6	1032	c.994C>G	c.(994-996)CGG>GGG	p.R332G		NM_138349	NP_612358	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	332	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane					0				READ - Rectum adenocarcinoma(3;0.236)		GCTCTGCACACGGCTGCACAG	0.682																0.181818	5.343909	6.38948	2	9	KEEP	---	---	---	---	2	0	5	6	-1	capture	Missense_Mutation	SNP	27899640	27899640	TP53I13	17	C	G	G	G	1	0	0	0	0	1	0	0	0	243	19	4	4	16269	233
NF1	4763	broad.mit.edu	37	17	29556164	29556164	+	Missense_Mutation	SNP	T	C	C	rs137854566		TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29556164T>C	uc002hgg.2	+	21	2864	c.2531T>C	c.(2530-2532)CTT>CCT	p.L844P	NF1_uc002hgh.2_Missense_Mutation_p.L844P|NF1_uc010csn.1_Missense_Mutation_p.L704P|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	844			L -> F (in NF1).|L -> P (in NF1).|L -> R (in NF1; sporadic).		actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACTGGCTTCCTTTGTGCCCTT	0.517					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.338983	67.184361	68.535651	20	39	KEEP	---	---	---	---	5	18	18	23	-1	capture	Missense_Mutation	SNP	29556164	29556164	NF1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10263	233
SLFN11	91607	broad.mit.edu	37	17	33680901	33680901	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33680901C>G	uc010ctp.2	-	6	1818	c.1376G>C	c.(1375-1377)TGT>TCT	p.C459S	SLFN11_uc010ctq.2_Missense_Mutation_p.C459S|SLFN11_uc002hjh.3_Missense_Mutation_p.C459S|SLFN11_uc002hjg.3_Missense_Mutation_p.C459S|SLFN11_uc010ctr.2_Missense_Mutation_p.C459S	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	459						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGAGCATCACAGATGACTCC	0.488																0.26506	71.329744	75.458588	22	61	KEEP	---	---	---	---	10	17	32	40	-1	capture	Missense_Mutation	SNP	33680901	33680901	SLFN11	17	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	14625	233
SLFN13	146857	broad.mit.edu	37	17	33769128	33769128	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33769128C>G	uc002hjk.1	-	3	1706	c.1376G>C	c.(1375-1377)TGT>TCT	p.C459S	SLFN13_uc010wch.1_Missense_Mutation_p.C459S|SLFN13_uc002hjl.2_Missense_Mutation_p.C459S|SLFN13_uc010ctt.2_Missense_Mutation_p.C141S|SLFN13_uc002hjm.2_Missense_Mutation_p.C128S	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	459						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CAGAGCATCACAGATGACTCC	0.527																0.069767	-0.923224	15.514157	6	80	KEEP	---	---	---	---	2	8	56	41	-1	capture	Missense_Mutation	SNP	33769128	33769128	SLFN13	17	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	14628	233
KRT34	3885	broad.mit.edu	37	17	39535641	39535641	+	Silent	SNP	G	A	A	rs145615462		TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39535641G>A	uc002hwm.2	-	5	978	c.966C>T	c.(964-966)AAC>AAT	p.N322N		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	322	Rod.|Coil 2.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				TCTCCAGGGCGTTGACTGTGC	0.597																0.209581	81.637641	94.670318	35	132	KEEP	---	---	---	---	16	26	87	85	-1	capture	Silent	SNP	39535641	39535641	KRT34	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8391	233
C1QTNF1	114897	broad.mit.edu	37	17	77043872	77043872	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77043872G>A	uc002jwp.2	+	4	888	c.548G>A	c.(547-549)GGC>GAC	p.G183D	C1QTNF1_uc002jwq.2_Missense_Mutation_p.G101D|C1QTNF1_uc002jwr.3_Missense_Mutation_p.G193D|C1QTNF1_uc002jws.2_Missense_Mutation_p.G183D|C1QTNF1_uc002jwt.2_Missense_Mutation_p.G281D	NM_030968	NP_112230	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	183	C1q.					collagen				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			ATGTTCACCGGCAAGTTCTAC	0.547																0.025641	-31.405024	7.439044	4	152	KEEP	---	---	---	---	1	5	75	92	-1	capture	Missense_Mutation	SNP	77043872	77043872	C1QTNF1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1944	233
KIAA0802	23255	broad.mit.edu	37	18	8807023	8807023	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:8807023G>A	uc002knr.2	+	11	2711	c.2569G>A	c.(2569-2571)GTG>ATG	p.V857M	KIAA0802_uc002knq.2_Missense_Mutation_p.V816M|KIAA0802_uc002kns.2_Missense_Mutation_p.V187M	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	1167	Potential.										0						GGCCTGGGACGTGGAGTGGGC	0.637					468											0.138889	7.950919	12.487522	5	31	KEEP	---	---	---	---	1	5	11	20	-1	capture	Missense_Mutation	SNP	8807023	8807023	KIAA0802	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8116	233
NKG7	4818	broad.mit.edu	37	19	51875671	51875671	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51875671G>A	uc002pwj.2	-	1	290	c.119C>T	c.(118-120)TCG>TTG	p.S40L	NKG7_uc002pwk.2_Missense_Mutation_p.S40L	NM_005601	NP_005592	Q16617	NKG7_HUMAN	natural killer cell group 7 sequence	40						integral to plasma membrane				central_nervous_system(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCAGAGGCCCGAGTGAGCTGA	0.607																0.281106	160.609362	169.942928	61	156	KEEP	---	---	---	---	26	45	83	87	-1	capture	Missense_Mutation	SNP	51875671	51875671	NKG7	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10350	233
MARCO	8685	broad.mit.edu	37	2	119732140	119732140	+	Silent	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:119732140G>A	uc002tln.1	+	6	744	c.612G>A	c.(610-612)GCG>GCA	p.A204A	MARCO_uc010yyf.1_Silent_p.A126A	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	204	Collagen-like.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						AGGGAGAGGCGGGTGAGTAGG	0.572	GBM(8;18 374 7467 11269 32796)															0.3	43.705378	45.492262	15	35	KEEP	---	---	---	---	9	8	16	28	-1	capture	Silent	SNP	119732140	119732140	MARCO	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9224	233
C2orf80	389073	broad.mit.edu	37	2	209036767	209036767	+	Silent	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209036767C>T	uc002vcr.2	-	7	571	c.399G>A	c.(397-399)TTG>TTA	p.L133L		NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073	133										skin(1)	1						CAAAGGGGTGCAAGGAGAGGC	0.478																0.216958	187.012355	216.642713	87	314	KEEP	---	---	---	---	58	41	166	182	-1	capture	Silent	SNP	209036767	209036767	C2orf80	2	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	2177	233
ITCH	83737	broad.mit.edu	37	20	32981637	32981637	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:32981637A>G	uc010geu.1	+	3	212	c.20A>G	c.(19-21)CAA>CGA	p.Q7R	ITCH_uc002xak.2_Missense_Mutation_p.Q7R|ITCH_uc010zuj.1_5'UTR	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase	7	C2.				apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						AGTGGATCACAACTTGGTTCA	0.378																0.258865	182.444922	197.301751	73	209	KEEP	---	---	---	---	38	45	130	129	-1	capture	Missense_Mutation	SNP	32981637	32981637	ITCH	20	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	7791	233
RPRD1B	58490	broad.mit.edu	37	20	36668949	36668949	+	Silent	SNP	T	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36668949T>C	uc002xho.3	+	2	666	c.264T>C	c.(262-264)GCT>GCC	p.A88A		NM_021215	NP_067038	Q9NQG5	RPR1B_HUMAN	Regulation of nuclear pre-mRNA domain containing	88	CID.									pancreas(1)	1						TTGTGGATGCTTTTTCTCATG	0.353																0.015924	-74.786702	8.585007	5	309	KEEP	---	---	---	---	3	5	181	177	-1	capture	Silent	SNP	36668949	36668949	RPRD1B	20	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	13508	233
HNF4A	3172	broad.mit.edu	37	20	43057004	43057004	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43057004C>T	uc002xma.2	+	9	1248	c.1159C>T	c.(1159-1161)CAC>TAC	p.H387Y	HNF4A_uc002xlu.2_Missense_Mutation_p.H365Y|HNF4A_uc002xlv.2_Missense_Mutation_p.H365Y|HNF4A_uc002xlz.2_Missense_Mutation_p.H387Y|HNF4A_uc010ggq.2_Missense_Mutation_p.H380Y	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	387					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCATGCCCACCACCCCCTGCA	0.587	Colon(79;2 1269 8820 14841 52347)															0.221239	58.435812	66.504943	25	88	KEEP	---	---	---	---	14	13	41	62	-1	capture	Missense_Mutation	SNP	43057004	43057004	HNF4A	20	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	7178	233
KCNB1	3745	broad.mit.edu	37	20	48098546	48098546	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48098546G>A	uc002xur.1	-	1	636	c.472C>T	c.(472-474)CGG>TGG	p.R158W	KCNB1_uc002xus.1_Missense_Mutation_p.R158W	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	158	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCGCCTTCCCGCTCCCGTAGG	0.582																0.276243	128.013063	136.146745	50	131	KEEP	---	---	---	---	23	32	73	75	-1	capture	Missense_Mutation	SNP	48098546	48098546	KCNB1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	7934	233
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	CA	CA	rs142470496;rs146546850	byFrequency;byFrequency	TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29091840_29091841TG>CA	uc003adu.1	-	11	1188_1189	c.1116_1117CA>TG	c.(1114-1119)TCCAAG>TCTGAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)|p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCAA	0.416					268	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				0.075	2.184618	17.009009	6	74	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	29091840	29091841	CHEK2	22	TG	CA	CA	CA	1	0	0	0	0	1	0	0	0	819	63	3	3	3301	233
C22orf23	84645	broad.mit.edu	37	22	38341090	38341090	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38341090C>T	uc003auj.1	-	5	531	c.440G>A	c.(439-441)CGA>CAA	p.R147Q	C22orf23_uc003auk.1_Missense_Mutation_p.R147Q	NM_032561	NP_115950	Q9BZE7	EVG1_HUMAN	hypothetical protein LOC84645	147											0	Melanoma(58;0.045)					AGCCTTCTGTCGTGCAGGAGG	0.562																0.443662	191.504759	191.897107	63	79	KEEP	---	---	---	---	36	40	45	42	-1	capture	Missense_Mutation	SNP	38341090	38341090	C22orf23	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2118	233
RNF168	165918	broad.mit.edu	37	3	196214417	196214417	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196214417T>G	uc003fwq.2	-	3	949	c.411A>C	c.(409-411)GAA>GAC	p.E137D	RNF168_uc010iah.2_5'UTR	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168	137	Glu-rich.				double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CTTTGTTTTCTTCTTCCTCGC	0.433																0.269076	177.835105	189.88575	67	182	KEEP	---	---	---	---	28	40	84	109	-1	capture	Missense_Mutation	SNP	196214417	196214417	RNF168	3	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	13351	233
PPEF2	5470	broad.mit.edu	37	4	76811138	76811138	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76811138G>A	uc003hix.2	-	5	746	c.389C>T	c.(388-390)GCC>GTC	p.A130V	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.A130V	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	130	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTCTACCAGGGCAGTTGCATG	0.522	NSCLC(105;1359 1603 15961 44567 47947)															0.235294	107.296464	119.286246	44	143	KEEP	---	---	---	---	19	31	87	88	-1	capture	Missense_Mutation	SNP	76811138	76811138	PPEF2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12209	233
FHDC1	85462	broad.mit.edu	37	4	153897134	153897134	+	Silent	SNP	A	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153897134A>G	uc003inf.2	+	11	2766	c.2691A>G	c.(2689-2691)TCA>TCG	p.S897S		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	897					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					TGACCGCCTCAGAGAACGAGA	0.692																0.307692	56.165964	58.314876	20	45	KEEP	---	---	---	---	5	18	30	31	-1	capture	Silent	SNP	153897134	153897134	FHDC1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5822	233
ADCY2	108	broad.mit.edu	37	5	7706894	7706894	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:7706894C>T	uc003jdz.1	+	8	1214	c.1147C>T	c.(1147-1149)CGC>TGC	p.R383C	ADCY2_uc011cmo.1_Missense_Mutation_p.R203C	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	383	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TATCAACATGCGCGTGGGCGT	0.473																0.019305	-59.524826	7.702895	5	254	KEEP	---	---	---	---	1	5	140	146	-1	capture	Missense_Mutation	SNP	7706894	7706894	ADCY2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	294	233
C6	729	broad.mit.edu	37	5	41149449	41149449	+	Silent	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41149449G>A	uc003jmk.2	-	17	2727	c.2517C>T	c.(2515-2517)GAC>GAT	p.D839D	C6_uc003jml.1_Silent_p.D839D	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	839	C5b-binding domain.|Complement control factor I module 1.|Kazal-like 1.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ACTGGCGGCCGTCTTGGCAGG	0.418																0.016287	-73.794672	7.516709	5	302	KEEP	---	---	---	---	2	3	165	198	-1	capture	Silent	SNP	41149449	41149449	C6	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2292	233
PCDHB7	56129	broad.mit.edu	37	5	140553608	140553608	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140553608G>A	uc003lit.2	+	1	1366	c.1192G>A	c.(1192-1194)GAA>AAA	p.E398K		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	398	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCATCTGTCGAAAACTTCTA	0.493																0.252874	56.209737	61.033973	22	65	KEEP	---	---	---	---	8	15	34	37	-1	capture	Missense_Mutation	SNP	140553608	140553608	PCDHB7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11450	233
GEMIN5	25929	broad.mit.edu	37	5	154311130	154311130	+	Silent	SNP	A	G	G			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154311130A>G	uc003lvx.3	-	5	752	c.669T>C	c.(667-669)GCT>GCC	p.A223A	GEMIN5_uc011ddk.1_Silent_p.A222A	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	223	WD 4.				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGGTAATTTCAGCTTCTTCTA	0.358																0.019231	-34.120713	6.397011	3	153	KEEP	---	---	---	---	3	1	75	92	-1	capture	Silent	SNP	154311130	154311130	GEMIN5	5	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	6271	233
GABRG2	2566	broad.mit.edu	37	5	161524703	161524703	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161524703C>A	uc003lyz.3	+	4	745	c.387C>A	c.(385-387)AAC>AAA	p.N129K	GABRG2_uc010jjc.2_Missense_Mutation_p.N129K|GABRG2_uc003lyy.3_Missense_Mutation_p.N129K|GABRG2_uc011dej.1_Missense_Mutation_p.N34K	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	129	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		TGAAATTTAACAGCACCATTA	0.353																0.240385	131.341493	144.138061	50	158	KEEP	---	---	---	---	23	31	89	88	0.574074074074	capture	Missense_Mutation	SNP	161524703	161524703	GABRG2	5	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	6114	233
ODZ2	57451	broad.mit.edu	37	5	167626105	167626105	+	Missense_Mutation	SNP	G	A	A	rs140215976	by1000genomes	TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167626105G>A	uc010jjd.2	+	16	3121	c.3121G>A	c.(3121-3123)GTG>ATG	p.V1041M	ODZ2_uc003lzr.3_Missense_Mutation_p.V818M|ODZ2_uc003lzt.3_Missense_Mutation_p.V414M|ODZ2_uc010jje.2_Missense_Mutation_p.V312M	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		GAATCCCATCGTGCCTGAGAC	0.587																0.2	12.531635	15.044152	6	24	KEEP	---	---	---	---	2	4	15	12	-1	capture	Missense_Mutation	SNP	167626105	167626105	ODZ2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10740	233
ADAMTS2	9509	broad.mit.edu	37	5	178556986	178556986	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178556986C>T	uc003mjw.2	-	16	2404	c.2404G>A	c.(2404-2406)GGC>AGC	p.G802S		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	802	Spacer.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTCTCCCGGCCGTCCTCGTCT	0.602					1974											0.057471	-7.289783	10.581751	5	82	KEEP	---	---	---	---	3	2	50	52	-1	capture	Missense_Mutation	SNP	178556986	178556986	ADAMTS2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	265	233
PCLO	27445	broad.mit.edu	37	7	82764629	82764629	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82764629T>C	uc003uhx.2	-	3	2526	c.2237A>G	c.(2236-2238)AAG>AGG	p.K746R	PCLO_uc003uhv.2_Missense_Mutation_p.K746R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	692	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AACAGGGGCCTTGTCCTGCTC	0.512																0.152466	78.604358	104.376722	34	189	KEEP	---	---	---	---	16	19	93	105	-1	capture	Missense_Mutation	SNP	82764629	82764629	PCLO	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11486	233
GRM3	2913	broad.mit.edu	37	7	86415655	86415655	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86415655C>T	uc003uid.2	+	3	1646	c.547C>T	c.(547-549)CGC>TGC	p.R183C	GRM3_uc010lef.2_Missense_Mutation_p.R181C|GRM3_uc010leg.2_Missense_Mutation_p.R55C|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	183	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGATAAGTCGCGCTATGATTA	0.562	GBM(52;969 1098 3139 52280)															0.185542	169.075155	207.513756	77	338	KEEP	---	---	---	---	42	42	158	203	-1	capture	Missense_Mutation	SNP	86415655	86415655	GRM3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6731	233
CALD1	800	broad.mit.edu	37	7	134552500	134552500	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134552500C>T	uc003vrz.2	+	3	475	c.16C>T	c.(16-18)CGT>TGT	p.R6C	CALD1_uc003vry.2_Missense_Mutation_p.R6C|CALD1_uc003vsa.2_Missense_Mutation_p.R6C|CALD1_uc003vsb.2_Missense_Mutation_p.R6C|CALD1_uc010lmm.2_Missense_Mutation_p.R6C|CALD1_uc011kpt.1_5'UTR	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	6					cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						TGATTTTGAGCGTCGCAGAGA	0.433																0.147541	14.634658	21.912923	9	52	KEEP	---	---	---	---	3	6	33	27	-1	capture	Missense_Mutation	SNP	134552500	134552500	CALD1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2557	233
MGAM	8972	broad.mit.edu	37	7	141747587	141747587	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141747587G>A	uc003vwy.2	+	22	2555	c.2501G>A	c.(2500-2502)CGA>CAA	p.R834Q		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	834	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCCCACAGTCGAAAGAACCCT	0.413																0.139785	21.13376	32.770934	13	80	KEEP	---	---	---	---	8	6	36	59	-1	capture	Missense_Mutation	SNP	141747587	141747587	MGAM	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9453	233
AGAP3	116988	broad.mit.edu	37	7	150840450	150840450	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150840450C>T	uc003wjg.1	+	17	2299	c.2296C>T	c.(2296-2298)CGG>TGG	p.R766W	AGAP3_uc003wje.1_Missense_Mutation_p.R435W|AGAP3_uc003wjj.1_Missense_Mutation_p.R265W|AGAP3_uc003wjk.1_Missense_Mutation_p.R184W	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	730	Arf-GAP.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						ACGCTGGATACGGGCCAAGTA	0.622																0.08547	1.160154	21.548958	10	107	KEEP	---	---	---	---	4	9	54	70	-1	capture	Missense_Mutation	SNP	150840450	150840450	AGAP3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	369	233
CDCA2	157313	broad.mit.edu	37	8	25319665	25319665	+	Missense_Mutation	SNP	C	T	T	rs142497699	byFrequency	TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25319665C>T	uc003xep.1	+	4	807	c.328C>T	c.(328-330)CGG>TGG	p.R110W	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.R110W|CDCA2_uc003xeq.1_Missense_Mutation_p.R95W	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	110					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TTTCATTGCTCGGCAGCAAAA	0.423																0.255814	115.139958	124.427909	44	128	KEEP	---	---	---	---	18	29	64	77	-1	capture	Missense_Mutation	SNP	25319665	25319665	CDCA2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	3057	233
ACRC	93953	broad.mit.edu	37	X	70830624	70830624	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70830624C>T	uc004eae.2	+	11	2206	c.1705C>T	c.(1705-1707)CGC>TGC	p.R569C	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	569						nucleus				ovary(3)	3	Renal(35;0.156)					AAAGTGGCGGCGCTTTGCCAA	0.517																0.52381	36.027533	36.038065	11	10	KEEP	---	---	---	---	7	11	9	9	-1	capture	Missense_Mutation	SNP	70830624	70830624	ACRC	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	171	233
DDX5	1655	broad.mit.edu	37	17	62496298	62496298	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62496298delT	uc002jek.2	-	13	1835	c.1588delA	c.(1588-1590)ACTfs	p.T530fs	DDX5_uc010deh.2_Frame_Shift_Del_p.T530fs|DDX5_uc002jej.2_Frame_Shift_Del_p.T425fs|DDX5_uc010wqa.1_Frame_Shift_Del_p.T451fs	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	530					cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CCATTCTGAGTTTTTGCCCCA	0.413	NSCLC(22;406 813 4871 19580 40307)					T	ETV4	prostate								0.01			7	503		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	62496298	62496298	DDX5	17	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	4325	233
FSTL5	56884	broad.mit.edu	37	4	162680612	162680614	+	In_Frame_Del	DEL	ATC	-	-			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:162680612_162680614delATC	uc003iqh.2	-	6	1112_1114	c.676_678delGAT	c.(676-678)GATdel	p.D226del	FSTL5_uc003iqi.2_In_Frame_Del_p.D225del|FSTL5_uc010iqv.2_In_Frame_Del_p.D225del	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	226	2 (Potential).|EF-hand 2.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CAGCATTAAAATCATCATATTTC	0.340																0.20			37	152		---	---	---	---						capture_indel	In_Frame_Del	DEL	162680612	162680614	FSTL5	4	ATC	-	-	-	1	0	1	0	1	0	0	0	0	50	4	5	5	6022	233
CSF2	1437	broad.mit.edu	37	5	131409540	131409540	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-1986-01	TCGA-32-1986-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131409540delC	uc003kwf.2	+	1	56	c.24delC	c.(22-24)CTCfs	p.L8fs		NM_000758	NP_000749	P04141	CSF2_HUMAN	colony stimulating factor 2 precursor	8					immune response|negative regulation of cytolysis|positive regulation of DNA replication|positive regulation of interleukin-23 production|positive regulation of macrophage derived foam cell differentiation|positive regulation of podosome assembly|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|granulocyte macrophage colony-stimulating factor receptor binding|growth factor activity				0		all_cancers(142;4.28e-07)|all_lung(232;2.81e-05)|Lung NSC(810;0.000693)|Lung SC(612;0.122)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Sargramostim(DB00020)	GCCTGCTGCTCTTGGGCACTG	0.597					33											0.21			15	57		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	131409540	131409540	CSF2	5	C	-	-	-	1	0	1	0	1	0	0	0	0	405	32	5	5	3898	233
