Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TARS2	80222	broad.mit.edu	37	1	150471051	150471051	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150471051C>T	uc001euq.2	+	11	1319	c.1312C>T	c.(1312-1314)CGG>TGG	p.R438W	TARS2_uc010pcd.1_RNA|TARS2_uc001eur.2_Missense_Mutation_p.R356W|TARS2_uc009wlt.2_Missense_Mutation_p.R64W|TARS2_uc009wls.2_Missense_Mutation_p.R308W	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial	438					threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GGCTCTACACCGGGCCGAAGC	0.632																0.02963	-25.218382	7.593915	4	131	KEEP	---	---	---	---	1	3	78	67	-1	capture	Missense_Mutation	SNP	150471051	150471051	TARS2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	15448	241
TRIM11	81559	broad.mit.edu	37	1	228582635	228582635	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228582635G>A	uc001hss.2	-	6	1433	c.1178C>T	c.(1177-1179)GCC>GTC	p.A393V	TRIM11_uc010pvx.1_Missense_Mutation_p.A392V	NM_145214	NP_660215	Q96F44	TRI11_HUMAN	tripartite motif-containing 11	393	B30.2/SPRY.				response to virus	cytoplasm|nucleus	protein binding|zinc ion binding			lung(3)|ovary(1)	4		Prostate(94;0.0724)				TGGAGCCAAGGCCCGTTCCGA	0.597																0.446154	172.554761	172.878587	58	72	KEEP	---	---	---	---	32	34	40	40	-1	capture	Missense_Mutation	SNP	228582635	228582635	TRIM11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16370	241
COG2	22796	broad.mit.edu	37	1	230820980	230820980	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230820980G>C	uc001htw.2	+	12	1529	c.1378G>C	c.(1378-1380)GAG>CAG	p.E460Q	COG2_uc001htx.2_Missense_Mutation_p.E460Q|COG2_uc010pwc.1_Missense_Mutation_p.E333Q	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	460					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GTTTGTCAATGAGGTAAGGGC	0.423																0.022388	-27.102157	6.995559	3	131	KEEP	---	---	---	---	2	1	85	55	-1	capture	Missense_Mutation	SNP	230820980	230820980	COG2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	3623	241
PTEN	5728	broad.mit.edu	37	10	89692835	89692835	+	Missense_Mutation	SNP	G	T	T	rs57374291		TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692835G>T	uc001kfb.2	+	6	1350	c.319G>T	c.(319-321)GAT>TAT	p.D107Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	107	Phosphatase tensin-type.		D -> Y (in BZS and glioblastoma; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.D107Y(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.D107N(1)|p.D107A(1)|p.F56fs*2(1)|p.P103fs*3(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTTTTGTGAAGATCTTGACCA	0.368			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.677778	197.700051	200.223096	61	29	KEEP	---	---	---	---	42	30	29	19	0.583333333333	capture	Missense_Mutation	SNP	89692835	89692835	PTEN	10	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	12633	241
NFKB2	4791	broad.mit.edu	37	10	104158521	104158521	+	Silent	SNP	G	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104158521G>T	uc001kvb.2	+	12	1282	c.1017G>T	c.(1015-1017)CGG>CGT	p.R339R	NFKB2_uc001kva.2_Silent_p.R339R|NFKB2_uc010qqk.1_Silent_p.R339R|NFKB2_uc001kvd.2_Silent_p.R339R|NFKB2_uc009xxc.2_Silent_p.R339R	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	339	RHD.|Nuclear localization signal (Potential).				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		AGCGGAAGCGGAGGAAGGCCT	0.637					140	T	IGH@	B-NHL								0.653846	53.486781	54.034788	17	9	KEEP	---	---	---	---	14	6	7	2	0.7	capture	Silent	SNP	104158521	104158521	NFKB2	10	G	T	T	T	1	0	0	0	0	0	0	0	1	522	41	4	4	10283	241
MUC5B	727897	broad.mit.edu	37	11	1158988	1158988	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1158988T>C	uc009ycr.1	+	11	1292	c.1166T>C	c.(1165-1167)GTC>GCC	p.V389A		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCGGCTGTGTCCCTGTGTCA	0.662																0.217391	13.280972	14.961442	5	18	KEEP	---	---	---	---	3	4	15	14	-1	capture	Missense_Mutation	SNP	1158988	1158988	MUC5B	11	T	C	C	C	1	0	0	0	0	1	0	0	0	742	58	3	3	9889	241
OR51L1	119682	broad.mit.edu	37	11	5020755	5020755	+	Silent	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5020755T>C	uc010qyu.1	+	1	543	c.543T>C	c.(541-543)TGT>TGC	p.C181C		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACGCCTTCTGTTTGCACCAGG	0.473																0.35468	247.549606	251.324567	72	131	KEEP	---	---	---	---	46	32	85	55	-1	capture	Silent	SNP	5020755	5020755	OR51L1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	11006	241
OR4D6	219983	broad.mit.edu	37	11	59225156	59225156	+	Silent	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59225156G>A	uc010rku.1	+	1	723	c.723G>A	c.(721-723)ACG>ACA	p.T241T		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCACGTGCACGTCCCACATGC	0.557																0.4	207.120359	208.648794	70	105	KEEP	---	---	---	---	34	37	52	56	-1	capture	Silent	SNP	59225156	59225156	OR4D6	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10962	241
OR4D11	219986	broad.mit.edu	37	11	59271382	59271382	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59271382A>T	uc001noa.1	+	1	334	c.334A>T	c.(334-336)ATT>TTT	p.I112F		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGGGGCAGACATTTTTTCTCT	0.473																0.417266	379.184463	380.836021	116	162	KEEP	---	---	---	---	62	58	94	79	-1	capture	Missense_Mutation	SNP	59271382	59271382	OR4D11	11	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	10959	241
OR4D11	219986	broad.mit.edu	37	11	59271391	59271391	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59271391C>G	uc001noa.1	+	1	343	c.343C>G	c.(343-345)CTC>GTC	p.L115V		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CATTTTTTCTCTCTCTGTGAT	0.488																0.433824	413.113865	414.152038	118	154	KEEP	---	---	---	---	62	59	91	72	-1	capture	Missense_Mutation	SNP	59271391	59271391	OR4D11	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10959	241
CHRDL2	25884	broad.mit.edu	37	11	74414523	74414523	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74414523G>A	uc001ovi.2	-	8	1026	c.773C>T	c.(772-774)ACG>ATG	p.T258M	CHRDL2_uc001ovg.2_Missense_Mutation_p.T142M|CHRDL2_uc001ovh.2_Missense_Mutation_p.T258M|CHRDL2_uc001ovj.1_RNA|CHRDL2_uc001ovk.1_Intron			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;	258	VWFC 3.				cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					GTGGGAGTACGTCTTCCCGCC	0.657																0.566667	51.375676	51.491527	17	13	KEEP	---	---	---	---	10	9	8	7	-1	capture	Missense_Mutation	SNP	74414523	74414523	CHRDL2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3339	241
SIK2	23235	broad.mit.edu	37	11	111590592	111590592	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111590592G>A	uc001plt.2	+	10	1478	c.1360G>A	c.(1360-1362)GAA>AAA	p.E454K		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	454					intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						CTCCATTGACGAAGGGCTGGA	0.587					204											0.418605	111.587057	112.083898	36	50	KEEP	---	---	---	---	25	13	33	24	-1	capture	Missense_Mutation	SNP	111590592	111590592	SIK2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14211	241
ZBTB44	29068	broad.mit.edu	37	11	130130851	130130851	+	Silent	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130130851A>T	uc001qga.2	-	2	1312	c.918T>A	c.(916-918)CCT>CCA	p.P306P	ZBTB44_uc001qgb.3_Silent_p.P306P|ZBTB44_uc001qfx.2_RNA|ZBTB44_uc001qgc.1_Silent_p.P306P|ZBTB44_uc001qfz.2_Silent_p.P306P	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	306					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		ATGCACTGACAGGCTGGGACA	0.473																0.017007	-68.595081	8.901409	5	289	KEEP	---	---	---	---	4	2	167	157	-1	capture	Silent	SNP	130130851	130130851	ZBTB44	11	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	17425	241
ANO2	57101	broad.mit.edu	37	12	5672695	5672695	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5672695T>A	uc001qnm.2	-	26	2839	c.2767A>T	c.(2767-2769)ATT>TTT	p.I923F		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	928	Helical; (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						ATGTCTGGAATCATCCAGTCC	0.527																0.442105	135.239835	135.516753	42	53	KEEP	---	---	---	---	24	23	30	28	-1	capture	Missense_Mutation	SNP	5672695	5672695	ANO2	12	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	691	241
PLEKHG6	55200	broad.mit.edu	37	12	6436676	6436676	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6436676C>T	uc001qnr.2	+	15	2075	c.1927C>T	c.(1927-1929)CGC>TGC	p.R643C	PLEKHG6_uc010sew.1_Missense_Mutation_p.R643C|PLEKHG6_uc010sex.1_Missense_Mutation_p.R611C	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G	643					regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						AGCTCCTCAACGCCGAAGCGC	0.642																0.478261	69.748482	69.767315	22	24	KEEP	---	---	---	---	5	17	8	18	-1	capture	Missense_Mutation	SNP	6436676	6436676	PLEKHG6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11977	241
HCFC2	29915	broad.mit.edu	37	12	104461817	104461817	+	Silent	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104461817T>C	uc001tkj.3	+	3	508	c.405T>C	c.(403-405)TAT>TAC	p.Y135Y	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	135					regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						TCTCTTTATATGGTAACAAAT	0.418	Esophageal Squamous(184;1814 2036 4771 6974 15702)															0.44086	494.144363	495.278323	164	208	KEEP	---	---	---	---	100	70	115	109	-1	capture	Silent	SNP	104461817	104461817	HCFC2	12	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	6919	241
RB1	5925	broad.mit.edu	37	13	49039230	49039230	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49039230C>T	uc001vcb.2	+	22	2474	c.2308C>T	c.(2308-2310)CAG>TAG	p.Q770*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	770	Interaction with LIMD1.|Pocket; binds T and E1A.|Domain B.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(8)|p.L769fs*2(1)|p.Q770fs*24(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAATATTTTGCAGTATGCTTC	0.323			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.818182	146.3039	151.532714	45	10	KEEP	---	---	---	---	24	24	9	1	-1	capture	Nonsense_Mutation	SNP	49039230	49039230	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	12993	241
KCNRG	283518	broad.mit.edu	37	13	50589726	50589726	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50589726C>T	uc001vdu.2	+	1	337	c.97C>T	c.(97-99)CGC>TGC	p.R33C	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_Missense_Mutation_p.R33C|TRIM13_uc001vdp.1_3'UTR|TRIM13_uc001vdq.1_3'UTR|TRIM13_uc001vdr.1_3'UTR|TRIM13_uc001vds.1_3'UTR	NM_173605	NP_775876	Q8N5I3	KCNRG_HUMAN	potassium channel regulator isoform 1	33	BTB.					voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		TCGTTTGGCACGCATGTTAGA	0.408																0.791304	307.98984	317.035865	91	24	KEEP	---	---	---	---	50	49	15	9	-1	capture	Missense_Mutation	SNP	50589726	50589726	KCNRG	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8009	241
TM9SF1	10548	broad.mit.edu	37	14	24661549	24661549	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24661549C>T	uc001wnb.1	-	4	1329	c.981G>A	c.(979-981)ATG>ATA	p.M327I	IPO4_uc001wmx.1_5'Flank|IPO4_uc001wmy.1_5'Flank|IPO4_uc010tnz.1_5'Flank|IPO4_uc001wmw.1_5'Flank|IPO4_uc001wmz.1_5'Flank|TM9SF1_uc010toa.1_Missense_Mutation_p.M240I|TM9SF1_uc001wna.1_RNA|TM9SF1_uc010tob.1_Missense_Mutation_p.M562I|TM9SF1_uc001wnc.2_Missense_Mutation_p.M327I|TM9SF1_uc001wnd.2_Missense_Mutation_p.M183I	NM_006405	NP_006396	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1 isoform a	327	Helical; (Potential).				autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0183)		CCAGCAGTGCCATGACAATAA	0.537																0.266667	20.284851	21.761309	8	22	KEEP	---	---	---	---	6	2	14	12	-1	capture	Missense_Mutation	SNP	24661549	24661549	TM9SF1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	15862	241
SERPINA4	5267	broad.mit.edu	37	14	95033524	95033524	+	Silent	SNP	T	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95033524T>A	uc001ydk.2	+	3	933	c.867T>A	c.(865-867)ATT>ATA	p.I289I	SERPINA4_uc010avd.2_Silent_p.I326I|SERPINA4_uc001ydl.2_Silent_p.I289I	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	289					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		TGAGGGAGATTGAAGAGGTTC	0.468																0.354167	101.022459	102.821992	34	62	KEEP	---	---	---	---	11	24	32	41	-1	capture	Silent	SNP	95033524	95033524	SERPINA4	14	T	A	A	A	1	0	0	0	0	0	0	0	1	809	63	4	4	13984	241
PLA2G4F	255189	broad.mit.edu	37	15	42439928	42439928	+	Silent	SNP	A	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42439928A>C	uc001zoz.2	-	12	1155	c.1092T>G	c.(1090-1092)GGT>GGG	p.G364G	PLA2G4F_uc010bcq.2_5'Flank|PLA2G4F_uc001zoy.2_5'UTR|PLA2G4F_uc010bcr.2_Silent_p.G115G|PLA2G4F_uc001zpa.2_Silent_p.G115G|PLA2G4F_uc010bcs.2_Silent_p.G151G	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	364	PLA2c.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTCGGGTTCCACCCCCGGAAC	0.522																0.243243	8.32589	10.79263	9	28	KEEP	---	---	---	---	14	12	14	23	-1	capture	Silent	SNP	42439928	42439928	PLA2G4F	15	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	11909	241
MAP1A	4130	broad.mit.edu	37	15	43817784	43817784	+	Silent	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43817784C>T	uc001zrt.2	+	4	4580	c.4113C>T	c.(4111-4113)GAC>GAT	p.D1371D		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1371						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGCAGAAAGACAAAACTCTGG	0.453																0.418605	103.479892	103.978362	36	50	KEEP	---	---	---	---	9	28	25	31	-1	capture	Silent	SNP	43817784	43817784	MAP1A	15	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	9141	241
RNF111	54778	broad.mit.edu	37	15	59323149	59323149	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59323149T>C	uc002afv.2	+	2	407	c.128T>C	c.(127-129)ATT>ACT	p.I43T	RNF111_uc002afs.2_Missense_Mutation_p.I43T|RNF111_uc002aft.2_Missense_Mutation_p.I43T|RNF111_uc002afu.2_Missense_Mutation_p.I43T|RNF111_uc002afw.2_Missense_Mutation_p.I43T	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	43					multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		CCAGAGCCCATTGGGGCAGCC	0.438	NSCLC(72;983 1365 10746 34387 47081)															0.458824	137.036482	137.159183	39	46	KEEP	---	---	---	---	21	20	24	24	-1	capture	Missense_Mutation	SNP	59323149	59323149	RNF111	15	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	13317	241
TP53	7157	broad.mit.edu	37	17	7577520	7577520	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577520A>C	uc002gim.2	-	7	955	c.761T>G	c.(760-762)ATC>AGC	p.I254S	TP53_uc002gig.1_Missense_Mutation_p.I254S|TP53_uc002gih.2_Missense_Mutation_p.I254S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I122S|TP53_uc010cng.1_Missense_Mutation_p.I122S|TP53_uc002gii.1_Missense_Mutation_p.I122S|TP53_uc010cnh.1_Missense_Mutation_p.I254S|TP53_uc010cni.1_Missense_Mutation_p.I254S|TP53_uc002gij.2_Missense_Mutation_p.I254S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.I161S|TP53_uc002gio.2_Missense_Mutation_p.I122S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	254	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> L (in a sporadic cancer; somatic mutation).|I -> D (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|I -> F (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|I -> M (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.I254F(7)|p.I254S(5)|p.I254fs*10(5)|p.I254V(4)|p.I254T(3)|p.L252_I254delLTI(3)|p.I254N(3)|p.I254D(3)|p.T253_I255del(2)|p.I254del(2)|p.I254I(1)|p.?(1)|p.I254fs*7(1)|p.I254fs*91(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGTGTGATGATGGTGAGGAT	0.587	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.803571	167.707708	172.517987	45	11	KEEP	---	---	---	---	25	29	8	5	-1	capture	Missense_Mutation	SNP	7577520	7577520	TP53	17	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	16264	241
DHRS11	79154	broad.mit.edu	37	17	34951507	34951507	+	Missense_Mutation	SNP	G	A	A	rs148449399		TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34951507G>A	uc002hnd.2	+	2	468	c.254G>A	c.(253-255)CGT>CAT	p.R85H		NM_024308	NP_077284	Q6UWP2	DHR11_HUMAN	short-chain dehydrogenase/reductase precursor	85						extracellular region	binding|oxidoreductase activity				0						TCAGCTATCCGTTCTCAGCAC	0.537																0.875817	464.577222	485.81009	134	19	KEEP	---	---	---	---	68	85	14	7	-1	capture	Missense_Mutation	SNP	34951507	34951507	DHRS11	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4445	241
LAMA3	3909	broad.mit.edu	37	18	21511114	21511114	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21511114C>T	uc002kuq.2	+	65	8611	c.8525C>T	c.(8524-8526)ACG>ATG	p.T2842M	LAMA3_uc002kur.2_Missense_Mutation_p.T2786M|LAMA3_uc002kus.3_Missense_Mutation_p.T1233M|LAMA3_uc002kut.3_Missense_Mutation_p.T1177M	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2842	Laminin G-like 3.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCTCCACAGACGTATATGGAT	0.428																0.753623	177.635094	181.679724	52	17	KEEP	---	---	---	---	33	23	10	7	-1	capture	Missense_Mutation	SNP	21511114	21511114	LAMA3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8527	241
DSC3	1825	broad.mit.edu	37	18	28604418	28604418	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28604418A>T	uc002kwj.3	-	6	827	c.672T>A	c.(670-672)GAT>GAA	p.D224E	DSC3_uc002kwi.3_Missense_Mutation_p.D224E	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	224	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			GGAGGGGCAGATCTGCTGAAT	0.398																0.8	144.429612	148.616003	40	10	KEEP	---	---	---	---	19	23	9	2	-1	capture	Missense_Mutation	SNP	28604418	28604418	DSC3	18	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	4722	241
GNA15	2769	broad.mit.edu	37	19	3151776	3151776	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3151776G>A	uc002lxf.2	+	4	815	c.557G>A	c.(556-558)CGC>CAC	p.R186H		NM_002068	NP_002059	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein),	186	GTP (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			skin(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		CTCCGCAGCCGCATGCCCACC	0.532																0.424731	229.388953	230.309048	79	107	KEEP	---	---	---	---	54	63	62	84	-1	capture	Missense_Mutation	SNP	3151776	3151776	GNA15	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6439	241
ANKRD24	170961	broad.mit.edu	37	19	4207777	4207777	+	Splice_Site	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4207777G>A	uc010dtt.1	+	10	921	c.645_splice	c.e10-1	p.R215_splice	ANKRD24_uc002lzs.2_Splice_Site_p.R186_splice|ANKRD24_uc002lzt.2_Splice_Site_p.R187_splice	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TCCCCTGGTAGGACGGCCCTG	0.682														OREG0025162	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.785714	38.832546	39.887575	11	3	KEEP	---	---	---	---	7	5	3	0	-1	capture	Splice_Site	SNP	4207777	4207777	ANKRD24	19	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	649	241
CACNA1A	773	broad.mit.edu	37	19	13355996	13355996	+	Silent	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13355996C>T	uc010dze.2	-	31	5189	c.4953G>A	c.(4951-4953)GGG>GGA	p.G1651G	CACNA1A_uc010xnd.1_Silent_p.G356G|CACNA1A_uc002mwx.3_Silent_p.G356G|CACNA1A_uc010dzc.2_Silent_p.G1176G|CACNA1A_uc002mwy.3_Silent_p.G1650G|CACNA1A_uc010xne.1_Silent_p.G1179G|CACNA1A_uc002mwv.3_Silent_p.G167G	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1651	Extracellular (Potential).|IV.			G -> GNP (in Ref. 1; AAB61613/AAB61612).	cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GGAGACTTACCCCAAACTCAG	0.597																0.327273	55.229394	56.68561	18	37	KEEP	---	---	---	---	12	8	25	19	-1	capture	Silent	SNP	13355996	13355996	CACNA1A	19	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	2514	241
ATP4A	495	broad.mit.edu	37	19	36051416	36051416	+	Silent	SNP	G	A	A	rs149880813		TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36051416G>A	uc002oal.1	-	6	665	c.636C>T	c.(634-636)GCC>GCT	p.A212A	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	212	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	TGCGGATGTCGGCGGGCACTC	0.622																0.473684	147.611407	147.664366	45	50	KEEP	---	---	---	---	24	25	33	20	-1	capture	Silent	SNP	36051416	36051416	ATP4A	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1136	241
EPS8L1	54869	broad.mit.edu	37	19	55593671	55593671	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55593671C>T	uc002qis.3	+	11	1123	c.1019C>T	c.(1018-1020)CCC>CTC	p.P340L	EPS8L1_uc010ess.1_Missense_Mutation_p.P322L|EPS8L1_uc010est.1_Missense_Mutation_p.P340L|EPS8L1_uc010yfr.1_Missense_Mutation_p.P276L|EPS8L1_uc010esu.1_RNA|EPS8L1_uc002qiu.2_Missense_Mutation_p.P213L|EPS8L1_uc002qiv.2_5'UTR|EPS8L1_uc002qiw.2_Missense_Mutation_p.P87L	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway	340						cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		ATCGCCGACCCCTCCTCTCCG	0.662	Ovarian(149;255 1863 3636 27051 29647)															0.583333	69.575214	69.792473	21	15	KEEP	---	---	---	---	7	16	7	9	-1	capture	Missense_Mutation	SNP	55593671	55593671	EPS8L1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5150	241
ZFP28	140612	broad.mit.edu	37	19	57066095	57066095	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57066095T>G	uc002qnj.2	+	8	2012	c.1941T>G	c.(1939-1941)TGT>TGG	p.C647W	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	647	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		CCTATGAATGTAAGGTTTGTA	0.458	Ovarian(124;554 1662 19430 21141 52494)															0.4375	172.56519	172.945351	49	63	KEEP	---	---	---	---	28	21	31	33	-1	capture	Missense_Mutation	SNP	57066095	57066095	ZFP28	19	T	G	G	G	1	0	0	0	0	1	0	0	0	738	57	4	4	17522	241
THSD7B	80731	broad.mit.edu	37	2	137814764	137814764	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:137814764C>T	uc002tva.1	+	2	821	c.821C>T	c.(820-822)TCG>TTG	p.S274L	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.S164L	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CGGCAGGTTTCGTGTACAAGA	0.363																0.483333	93.273506	93.287939	29	31	KEEP	---	---	---	---	20	12	13	21	-1	capture	Missense_Mutation	SNP	137814764	137814764	THSD7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15765	241
OBFC2A	64859	broad.mit.edu	37	2	192546717	192546717	+	Silent	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192546717G>A	uc002usx.2	+	3	756	c.276G>A	c.(274-276)AGG>AGA	p.R92R	OBFC2A_uc002usw.2_Silent_p.R12R|OBFC2A_uc002usy.2_RNA|OBFC2A_uc002usz.2_RNA|OBFC2A_uc002uta.2_Silent_p.R12R	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold	92	OB.				double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			ATACTGGAAGGGGTGGTGAAC	0.289																0.421053	78.190355	78.50051	24	33	KEEP	---	---	---	---	22	8	20	27	-1	capture	Silent	SNP	192546717	192546717	OBFC2A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	555	43	2	2	10713	241
RPE	6120	broad.mit.edu	37	2	210881273	210881273	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:210881273G>A	uc002vdn.2	+	4	390	c.385G>A	c.(385-387)GCA>ACA	p.A129T	RPE_uc002vdm.2_Missense_Mutation_p.A129T|RPE_uc002vdo.2_Missense_Mutation_p.A79T|RPE_uc010zjf.1_Missense_Mutation_p.A129T|RPE_uc002vdp.2_Missense_Mutation_p.A76T|RPE_uc010fup.2_Missense_Mutation_p.A61T|RPE_uc002vdq.2_Missense_Mutation_p.A79T|RPE_uc002vdr.2_Intron	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1	129					pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		TGAGTATTTGGCACCATGGGC	0.398																0.141892	32.668085	50.979024	21	127	KEEP	---	---	---	---	15	7	78	62	-1	capture	Missense_Mutation	SNP	210881273	210881273	RPE	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13436	241
NSFL1C	55968	broad.mit.edu	37	20	1424444	1424444	+	Silent	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1424444G>A	uc002wfc.2	-	9	2011	c.1063C>T	c.(1063-1065)CTG>TTG	p.L355L	NSFL1C_uc002wfd.2_Silent_p.L244L|NSFL1C_uc002wfe.2_Silent_p.L324L|NSFL1C_uc002wff.2_RNA|NSFL1C_uc010gag.2_Silent_p.L121L	NM_016143	NP_057227	Q9UNZ2	NSF1C_HUMAN	p47 protein isoform a	355	UBX.					chromosome|Golgi stack|nucleus	lipid binding|protein binding				0						GCTTCCTTCAGGGTCTGGCTC	0.582																0.04878	-8.568495	9.170551	4	78	KEEP	---	---	---	---	2	2	39	40	-1	capture	Silent	SNP	1424444	1424444	NSFL1C	20	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	10579	241
MAN2B2	23324	broad.mit.edu	37	4	6598876	6598876	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6598876G>A	uc003gjf.1	+	8	1130	c.1094G>A	c.(1093-1095)CGC>CAC	p.R365H	MAN2B2_uc003gje.1_Missense_Mutation_p.R365H|MAN2B2_uc011bwf.1_Missense_Mutation_p.R314H	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	365					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						TACACGTCCCGCAGCTCACTG	0.632																0.453333	297.926776	298.351446	102	123	KEEP	---	---	---	---	67	59	92	72	-1	capture	Missense_Mutation	SNP	6598876	6598876	MAN2B2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9131	241
KIT	3815	broad.mit.edu	37	4	55561826	55561826	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55561826T>A	uc010igr.2	+	2	303	c.216T>A	c.(214-216)GAT>GAA	p.D72E	KIT_uc010igs.2_Missense_Mutation_p.D72E	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	72	Extracellular (Potential).|Ig-like C2-type 1.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	p.571_572>GE(1)		soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGATCCTGGATGAAACGAATG	0.463			1		431	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				0.4	116.186995	116.972425	36	54	KEEP	---	---	---	---	15	28	27	34	-1	capture	Missense_Mutation	SNP	55561826	55561826	KIT	4	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	8250	241
BANK1	55024	broad.mit.edu	37	4	102816534	102816534	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:102816534T>C	uc003hvy.3	+	6	1250	c.976T>C	c.(976-978)TCT>CCT	p.S326P	BANK1_uc003hvx.3_Missense_Mutation_p.S311P|BANK1_uc010ill.2_Missense_Mutation_p.S193P|BANK1_uc003hvz.3_Missense_Mutation_p.S296P	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	326	DBB.				B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGAGTTCCAGTCTCTTCAAAC	0.303																0.050505	-7.509358	13.688186	5	94	KEEP	---	---	---	---	6	1	54	51	-1	capture	Missense_Mutation	SNP	102816534	102816534	BANK1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	1298	241
OTUD4	54726	broad.mit.edu	37	4	146059760	146059760	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146059760G>A	uc003ika.3	-	21	2110	c.1972C>T	c.(1972-1974)CCT>TCT	p.P658S	OTUD4_uc003ijz.3_Missense_Mutation_p.P657S	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	722							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					TGGTGCAGAGGGTACAGGTAA	0.488																0.373016	145.293789	147.077991	47	79	KEEP	---	---	---	---	20	32	46	42	-1	capture	Missense_Mutation	SNP	146059760	146059760	OTUD4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11218	241
DNAH5	1767	broad.mit.edu	37	5	13841119	13841119	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13841119T>C	uc003jfd.2	-	34	5647	c.5605A>G	c.(5605-5607)ACA>GCA	p.T1869A		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1869	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCTATCAATGTATTGAGTAGC	0.413												Kartagener_syndrome				0.463415	281.802204	281.991387	76	88	KEEP	---	---	---	---	48	35	57	40	-1	capture	Missense_Mutation	SNP	13841119	13841119	DNAH5	5	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	4561	241
PRDM9	56979	broad.mit.edu	37	5	23522425	23522425	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23522425A>G	uc003jgo.2	+	7	703	c.521A>G	c.(520-522)AAG>AGG	p.K174R		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	174					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CTCAGGAAGAAGGAGACTGAA	0.428													HNSCC(3;0.000094)			0.418848	291.780307	292.87528	80	111	KEEP	---	---	---	---	40	49	63	66	-1	capture	Missense_Mutation	SNP	23522425	23522425	PRDM9	5	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	12359	241
PIK3R1	5295	broad.mit.edu	37	5	67591121	67591121	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591121C>T	uc003jva.2	+	13	2274	c.1714C>T	c.(1714-1716)CAG>TAG	p.Q572*	PIK3R1_uc003jvb.2_Nonsense_Mutation_p.Q572*|PIK3R1_uc003jvc.2_Nonsense_Mutation_p.Q272*|PIK3R1_uc003jvd.2_Nonsense_Mutation_p.Q302*|PIK3R1_uc003jve.2_Nonsense_Mutation_p.Q251*|PIK3R1_uc011crb.1_Nonsense_Mutation_p.Q242*	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	572					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.L570_D578del(1)|p.L570_Q572del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AGACCTTATCCAGCTGAGAAA	0.373					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.393939	157.866567	159.16809	52	80	KEEP	---	---	---	---	28	29	46	45	-1	capture	Nonsense_Mutation	SNP	67591121	67591121	PIK3R1	5	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	11821	241
FTMT	94033	broad.mit.edu	37	5	121187841	121187841	+	Silent	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:121187841C>T	uc003kss.2	+	1	192	c.183C>T	c.(181-183)CCC>CCT	p.P61P		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	61					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CTACCGGGCCCGCCGCCGGCC	0.736																0.414634	54.067897	54.328773	17	24	KEEP	---	---	---	---	6	11	14	13	-1	capture	Silent	SNP	121187841	121187841	FTMT	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6027	241
C5orf25	375484	broad.mit.edu	37	5	175717776	175717776	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175717776C>T	uc003mds.3	+	4	1599	c.1192C>T	c.(1192-1194)CCA>TCA	p.P398S	C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Missense_Mutation_p.P417S			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	398											0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		CATGGAAACCCCAGCCAGAAA	0.517																0.362963	143.335244	145.567186	49	86	KEEP	---	---	---	---	28	35	66	75	-1	capture	Missense_Mutation	SNP	175717776	175717776	C5orf25	5	C	T	T	T	1	0	0	0	0	1	0	0	0	274	22	2	2	2266	241
RNF130	55819	broad.mit.edu	37	5	179467635	179467635	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179467635A>T	uc003mll.1	-	2	667	c.260T>A	c.(259-261)CTG>CAG	p.L87Q	RNF130_uc003mlm.1_Missense_Mutation_p.L87Q	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor	87	Extracellular (Potential).				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCACAGCCCAGATGATCAGC	0.388	GBM(24;432 554 38471 39699 51728)				168											0.275862	44.674684	47.298081	16	42	KEEP	---	---	---	---	6	11	19	26	-1	capture	Missense_Mutation	SNP	179467635	179467635	RNF130	5	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	13330	241
PACRG	135138	broad.mit.edu	37	6	163235309	163235309	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163235309G>A	uc003qua.2	+	3	511	c.287G>A	c.(286-288)TGG>TAG	p.W96*	PACRG_uc003qub.2_Nonsense_Mutation_p.W96*|PACRG_uc003quc.2_Nonsense_Mutation_p.W96*	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	96											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		AAAATCGCCTGGAAGGTAAGT	0.488																0.464481	267.657773	267.85875	85	98	KEEP	---	---	---	---	45	47	47	63	-1	capture	Nonsense_Mutation	SNP	163235309	163235309	PACRG	6	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	11274	241
IL6	3569	broad.mit.edu	37	7	22769182	22769182	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:22769182A>T	uc011jyn.1	+	5	833	c.374A>T	c.(373-375)TAC>TTC	p.Y125F	uc010kun.1_5'Flank|IL6_uc011jyo.1_Missense_Mutation_p.Y125F|IL6_uc011jyp.1_Missense_Mutation_p.Y49F|IL6_uc003svj.3_Missense_Mutation_p.Y125F|IL6_uc011jyq.1_Missense_Mutation_p.Y179F	NM_000600	NP_000591	P05231	IL6_HUMAN	interleukin 6 precursor	125					acute-phase response|cellular response to hydrogen peroxide|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|defense response to virus|endocrine pancreas development|glucagon secretion|hepatic immune response|interleukin-6-mediated signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of chemokine biosynthetic process|negative regulation of collagen biosynthetic process|negative regulation of fat cell differentiation|negative regulation of lipid storage|neuron projection development|neutrophil apoptosis|platelet activation|positive regulation of acute inflammatory response|positive regulation of anti-apoptosis|positive regulation of B cell activation|positive regulation of chemokine production|positive regulation of immunoglobulin secretion|positive regulation of interleukin-6 production|positive regulation of osteoblast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of smooth muscle cell proliferation|positive regulation of T cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of translation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of vascular endothelial growth factor production|response to glucocorticoid stimulus|response to peptidoglycan	extracellular space|interleukin-6 receptor complex	cytokine activity|growth factor activity|interleukin-6 receptor binding				0					Arsenic trioxide(DB01169)|Bicalutamide(DB01128)|Ginseng(DB01404)|Simvastatin(DB00641)	TTTGAGGTATACCTAGAGTAC	0.443	Esophageal Squamous(47;342 1214 13936 33513)															0.456376	212.794824	213.040119	68	81	KEEP	---	---	---	---	32	40	40	45	-1	capture	Missense_Mutation	SNP	22769182	22769182	IL6	7	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	7624	241
NOD1	10392	broad.mit.edu	37	7	30496383	30496383	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30496383G>A	uc003tav.2	-	4	678	c.155C>T	c.(154-156)GCC>GTC	p.A52V	NOD1_uc010kvs.2_Missense_Mutation_p.A52V|NOD1_uc003tax.2_RNA|NOD1_uc003tay.2_RNA|NOD1_uc010kvt.2_RNA|NOD1_uc010kvu.2_RNA	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	52	CARD.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						CGCATCTTCGGCCGAGAAGTA	0.552																0.430108	121.989311	122.384477	40	53	KEEP	---	---	---	---	29	18	38	27	-1	capture	Missense_Mutation	SNP	30496383	30496383	NOD1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10423	241
ABCA13	154664	broad.mit.edu	37	7	48318026	48318026	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48318026C>G	uc003toq.2	+	18	7260	c.7235C>G	c.(7234-7236)GCT>GGT	p.A2412G	ABCA13_uc010kys.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2412					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTTGGGTCAGCTCTTCACCTT	0.383																0.505495	173.453007	173.455397	46	45	KEEP	---	---	---	---	31	20	29	22	-1	capture	Missense_Mutation	SNP	48318026	48318026	ABCA13	7	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	31	241
RABGEF1	27342	broad.mit.edu	37	7	66240358	66240358	+	Silent	SNP	T	C	C			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66240358T>C	uc011kee.1	+	3	530	c.366T>C	c.(364-366)TCT>TCC	p.S122S	RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_5'UTR|RABGEF1_uc010lag.2_Silent_p.S108S|RABGEF1_uc003tvh.2_Silent_p.S108S|RABGEF1_uc003tvi.2_5'UTR	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	286					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						TCAGTGCATCTTCCAGGGTCG	0.463																0.404762	123.132832	123.798518	34	50	KEEP	---	---	---	---	22	15	20	40	-1	capture	Silent	SNP	66240358	66240358	RABGEF1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	12861	241
SEMA3C	10512	broad.mit.edu	37	7	80430136	80430136	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80430136A>T	uc003uhj.2	-	10	1485	c.923T>A	c.(922-924)GTG>GAG	p.V308E	SEMA3C_uc011kgw.1_Missense_Mutation_p.V326E|SEMA3C_uc011kgx.1_Missense_Mutation_p.V160E	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	308	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						CAGCAGAAACACATCCTCTAT	0.279																0.138686	28.92976	46.225095	19	118	KEEP	---	---	---	---	9	11	73	56	-1	capture	Missense_Mutation	SNP	80430136	80430136	SEMA3C	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	13919	241
CACNA2D1	781	broad.mit.edu	37	7	81591256	81591256	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81591256C>T	uc003uhr.1	-	36	3176	c.2920G>A	c.(2920-2922)GAC>AAC	p.D974N	CACNA2D1_uc011kgy.1_Missense_Mutation_p.D186N	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	986	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	GATTTACTGTCGTTATCGAAG	0.418																0.370787	99.554129	100.858968	33	56	KEEP	---	---	---	---	25	11	37	25	-1	capture	Missense_Mutation	SNP	81591256	81591256	CACNA2D1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2524	241
TES	26136	broad.mit.edu	37	7	115889244	115889244	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115889244C>T	uc003vho.2	+	3	465	c.284C>T	c.(283-285)ACG>ATG	p.T95M	TES_uc011kmx.1_Missense_Mutation_p.T95M|TES_uc011kmy.1_Intron|TES_uc010lka.1_Missense_Mutation_p.T86M|TES_uc003vhp.2_Missense_Mutation_p.T86M	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	95	PET.				negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			ATGATATTGACGAATCCAGTT	0.393																0.027174	-37.028767	8.332895	5	179	KEEP	---	---	---	---	2	3	104	87	-1	capture	Missense_Mutation	SNP	115889244	115889244	TES	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15650	241
SLC6A14	11254	broad.mit.edu	37	X	115573956	115573956	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115573956G>T	uc004eqi.2	+	4	552	c.448G>T	c.(448-450)GAA>TAA	p.E150*	SLC6A14_uc011mtm.1_RNA	NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	150	Extracellular (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	TTTTCAAAGTGAACTACCATG	0.323																0.852941	284.883905	297.085753	87	15	KEEP	---	---	---	---	64	31	11	5	0.673684210526	capture	Nonsense_Mutation	SNP	115573956	115573956	SLC6A14	23	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	14569	241
KDM1A	23028	broad.mit.edu	37	1	23381588	23381589	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23381588_23381589delCA	uc001bgi.2	+	5	906_907	c.757_758delCA	c.(757-759)CACfs	p.H253fs	KDM1A_uc001bgj.2_Frame_Shift_Del_p.H273fs	NM_015013	NP_055828	O60341	KDM1A_HUMAN	lysine-specific histone demethylase 1 isoform b	253	SWIRM.				blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2						CCACCGAGTTCACAGTTATTTA	0.371																0.70			169	73		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	23381588	23381589	KDM1A	1	CA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	8044	241
EXPH5	23086	broad.mit.edu	37	11	108383232	108383232	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108383232delC	uc001pkk.2	-	6	3113	c.3002delG	c.(3001-3003)AGCfs	p.S1001fs	EXPH5_uc010rvy.1_Frame_Shift_Del_p.S813fs|EXPH5_uc010rvz.1_Frame_Shift_Del_p.S845fs|EXPH5_uc010rwa.1_Frame_Shift_Del_p.S925fs	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1001					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCAATGAGGCTCCTGTGATC	0.363																0.44			90	116		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	108383232	108383232	EXPH5	11	C	-	-	-	1	0	1	0	1	0	0	0	0	364	28	5	5	5277	241
NISCH	11188	broad.mit.edu	37	3	52521429	52521440	+	In_Frame_Del	DEL	GAGGAGGAGGAA	-	-			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52521429_52521440delGAGGAGGAGGAA	uc011beg.1	+	17	1993_2004	c.1921_1932delGAGGAGGAGGAA	c.(1921-1932)GAGGAGGAGGAAdel	p.EEEE641del	NISCH_uc003ded.3_In_Frame_Del_p.EEEE641del|NISCH_uc003dee.3_In_Frame_Del_p.EEEE130del|NISCH_uc003deg.1_RNA	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	641_644	Necessary for homooligomerization and targeting to endosomes.|Potential.|Glu-rich.|Interaction with PAK1 (By similarity).				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		ggaggaggatgaggaggaggaagaagaggagg	0.406																0.34			25	48		---	---	---	---						capture_indel	In_Frame_Del	DEL	52521429	52521440	NISCH	3	GAGGAGGAGGAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	10339	241
WDYHV1	55093	broad.mit.edu	37	8	124440173	124440173	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-2634-01	TCGA-32-2634-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124440173delT	uc003yqn.1	+	2	218	c.93delT	c.(91-93)AATfs	p.N31fs	WDYHV1_uc011lij.1_5'UTR|WDYHV1_uc003yqo.1_5'Flank	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	31					protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						GTGAAGAAAATATTTGGAAGC	0.289																0.37			97	167		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	124440173	124440173	WDYHV1	8	T	-	-	-	1	0	1	0	1	0	0	0	0	634	49	5	5	17224	241
