Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MFN2	9927	broad.mit.edu	37	1	12052619	12052619	+	Nonsense_Mutation	SNP	C	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12052619C>G	uc001atn.3	+	4	636	c.183C>G	c.(181-183)TAC>TAG	p.Y61*	MFN2_uc009vni.2_Nonsense_Mutation_p.Y61*	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2	61	Cytoplasmic (Potential).				blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CAGACACGTACAGGAATGCAG	0.562																0.019157	-57.572362	10.261264	5	256	KEEP	---	---	---	---	5	2	111	161	-1	capture	Nonsense_Mutation	SNP	12052619	12052619	MFN2	1	C	G	G	G	1	0	0	0	0	0	1	0	0	220	17	5	4	9436	243
JAK1	3716	broad.mit.edu	37	1	65313353	65313353	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:65313353C>A	uc001dbu.1	-	13	2010	c.1761G>T	c.(1759-1761)GAG>GAT	p.E587D	JAK1_uc009wam.1_Missense_Mutation_p.E575D|JAK1_uc009wal.1_5'Flank	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	587	Protein kinase 1.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		TCCCAAGGTGCTCGCCCTGAG	0.507					1025	Mis		ALL								0.023669	-36.361521	6.306874	4	165	KEEP	---	---	---	---	3	1	87	110	0.25	capture	Missense_Mutation	SNP	65313353	65313353	JAK1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	7860	243
EPHX4	253152	broad.mit.edu	37	1	92515977	92515977	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92515977G>C	uc001don.2	+	5	812	c.708G>C	c.(706-708)AAG>AAC	p.K236N		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	236						integral to membrane	hydrolase activity			central_nervous_system(1)	1						ATGATTTCAAGGTAAGCCAAA	0.259	GBM(140;473 1857 5172 22066 49719)															0.496894	245.197675	245.198977	80	81	KEEP	---	---	---	---	32	51	29	52	-1	capture	Missense_Mutation	SNP	92515977	92515977	EPHX4	1	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	5137	243
EXTL2	2135	broad.mit.edu	37	1	101339636	101339636	+	Silent	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:101339636A>G	uc001dtk.1	-	5	1192	c.855T>C	c.(853-855)CAT>CAC	p.H285H	EXTL2_uc001dtl.1_Silent_p.H285H|EXTL2_uc010ouk.1_Silent_p.H272H|EXTL2_uc001dtm.1_Silent_p.H284H	NM_001439	NP_001430	Q9UBQ6	EXTL2_HUMAN	exostoses-like 2	285	Lumenal (Potential).				N-acetylglucosamine metabolic process|UDP-N-acetylgalactosamine metabolic process	extracellular region|integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,4-N-acetylgalactosaminyltransferase activity|glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.48e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0425)|all cancers(265;0.0628)|COAD - Colon adenocarcinoma(174;0.148)|Colorectal(144;0.167)|Lung(183;0.195)		GCTCAGCTCGATGCCACATTC	0.398																0.315789	149.762501	154.341026	48	104	KEEP	---	---	---	---	24	27	47	70	-1	capture	Silent	SNP	101339636	101339636	EXTL2	1	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	5281	243
NUP210L	91181	broad.mit.edu	37	1	154125256	154125256	+	Missense_Mutation	SNP	G	C	C	rs150389273	by1000genomes	TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154125256G>C	uc001fdw.2	-	2	368	c.296C>G	c.(295-297)ACG>AGG	p.T99R	NUP210L_uc010peh.1_Missense_Mutation_p.T99R	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	99						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TATCGGTTGCGTAGATTCAGC	0.423																0.016949	-39.539129	7.129163	3	174	KEEP	---	---	---	---	3	0	81	109	-1	capture	Missense_Mutation	SNP	154125256	154125256	NUP210L	1	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	10668	243
HMCN1	83872	broad.mit.edu	37	1	185878606	185878606	+	Silent	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185878606G>A	uc001grq.1	+	5	988	c.759G>A	c.(757-759)GGG>GGA	p.G253G		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	253					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CTTTGAGTGGGCCTTCTCCAA	0.363																0.02439	-34.422959	6.755297	4	160	KEEP	---	---	---	---	3	1	84	102	-1	capture	Silent	SNP	185878606	185878606	HMCN1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	7145	243
CACNA1S	779	broad.mit.edu	37	1	201029914	201029914	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201029914G>T	uc001gvv.2	-	26	3513	c.3286C>A	c.(3286-3288)CGC>AGC	p.R1096S		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1096	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CTCAGTGGGCGGGCCTTCAGG	0.532																0.419421	621.854191	624.593322	203	281	KEEP	---	---	---	---	119	124	167	174	0.489711934156	capture	Missense_Mutation	SNP	201029914	201029914	CACNA1S	1	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	2523	243
EPRS	2058	broad.mit.edu	37	1	220146600	220146600	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:220146600G>C	uc001hly.1	-	29	4494	c.4224C>G	c.(4222-4224)ATC>ATG	p.I1408M		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1408	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	GGGTGACCTGGATGTCTTCCA	0.423																0.01845	-58.672548	12.067707	5	266	KEEP	---	---	---	---	2	5	124	187	-1	capture	Missense_Mutation	SNP	220146600	220146600	EPRS	1	G	C	C	C	1	0	0	0	0	1	0	0	0	525	41	4	4	5146	243
ANKRD16	54522	broad.mit.edu	37	10	5929963	5929963	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5929963C>T	uc010qat.1	-	2	925	c.382G>A	c.(382-384)GCC>ACC	p.A128T	ANKRD16_uc009xie.2_Missense_Mutation_p.A128T|ANKRD16_uc009xif.2_Missense_Mutation_p.A128T|ANKRD16_uc001iiq.2_Missense_Mutation_p.A128T|FBXO18_uc001iir.2_5'Flank|FBXO18_uc001iis.2_5'Flank|FBXO18_uc009xig.2_5'Flank	NM_019046	NP_061919	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16 isoform a	128	ANK 3.										0						AGTGGATTGGCGCCATGTTCC	0.552																0.388626	226.489693	228.786332	82	129	KEEP	---	---	---	---	52	52	81	81	-1	capture	Missense_Mutation	SNP	5929963	5929963	ANKRD16	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	642	243
ERCC6	2074	broad.mit.edu	37	10	50690763	50690763	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50690763C>T	uc001jhs.3	-	10	2293	c.2139G>A	c.(2137-2139)ATG>ATA	p.M713I	ERCC6_uc010qgr.1_Missense_Mutation_p.M83I|ERCC6_uc001jhr.3_Missense_Mutation_p.M113I	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	713					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						AATATCCCCCCATGGTGATGG	0.408					738						Direct_reversal_of_damage|NER					0.025862	-21.879587	6.987564	3	113	KEEP	---	---	---	---	2	1	64	61	-1	capture	Missense_Mutation	SNP	50690763	50690763	ERCC6	10	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5172	243
HECTD2	143279	broad.mit.edu	37	10	93244394	93244394	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93244394A>G	uc001khl.2	+	9	1052	c.952A>G	c.(952-954)AAA>GAA	p.K318E	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.K322E|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'UTR|HECTD2_uc001khn.1_5'UTR	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	318					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						ATCAGCCGCTAAAGTGTTGGC	0.333	NSCLC(12;376 469 1699 39910 41417)															0.043478	-8.233875	7.174077	3	66	KEEP	---	---	---	---	2	1	47	60	-1	capture	Missense_Mutation	SNP	93244394	93244394	HECTD2	10	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	6966	243
NUP98	4928	broad.mit.edu	37	11	3744479	3744479	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3744479T>C	uc001lyh.2	-	16	2345	c.2054A>G	c.(2053-2055)GAA>GGA	p.E685G	NUP98_uc001lyi.2_Missense_Mutation_p.E685G|NUP98_uc001lyj.1_Missense_Mutation_p.E685G|NUP98_uc001lyk.1_Missense_Mutation_p.E702G	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	702					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ACTGCTTCCTTCCAGCCCATT	0.433					613	T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								0.021277	-27.901854	8.227403	3	138	KEEP	---	---	---	---	1	2	59	100	-1	capture	Missense_Mutation	SNP	3744479	3744479	NUP98	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10680	243
GALNTL4	374378	broad.mit.edu	37	11	11470460	11470460	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:11470460C>T	uc001mjo.2	-	2	680	c.259G>A	c.(259-261)GCA>ACA	p.A87T		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	87	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		TCGGCCTCTGCCTCCTCAGGC	0.602																0.25	5.947449	6.401029	2	6	KEEP	---	---	---	---	4	0	1	9	-1	capture	Missense_Mutation	SNP	11470460	11470460	GALNTL4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6163	243
CDC42BPG	55561	broad.mit.edu	37	11	64602005	64602005	+	Silent	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64602005C>T	uc001obs.3	-	19	2220	c.2220G>A	c.(2218-2220)TCG>TCA	p.S740S		NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)	740	Potential.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						CCAGCCTGGCCGAGGCCTCCA	0.672					665											0.105263	3.440661	6.378602	2	17	KEEP	---	---	---	---	2	0	9	14	-1	capture	Silent	SNP	64602005	64602005	CDC42BPG	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3045	243
CREBZF	58487	broad.mit.edu	37	11	85375510	85375510	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:85375510G>C	uc001pas.2	-	1	673	c.410C>G	c.(409-411)TCG>TGG	p.S137W	CREBZF_uc010rtc.1_RNA|CREBZF_uc010rtd.1_RNA	NM_001039618	NP_001034707	Q9NS37	ZHANG_HUMAN	HCF-binding transcription factor Zhangfei	137					negative regulation of gene expression, epigenetic|negative regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|response to virus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				GCCGCTATCCGAGCCTCCGCC	0.637	NSCLC(172;674 2044 9050 18334 41735)															0.075	2.038173	16.813548	6	74	KEEP	---	---	---	---	8	3	40	56	-1	capture	Missense_Mutation	SNP	85375510	85375510	CREBZF	11	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	3828	243
C12orf60	144608	broad.mit.edu	37	12	14975979	14975979	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14975979T>G	uc001rcj.3	+	2	314	c.110T>G	c.(109-111)TTT>TGT	p.F37C		NM_175874	NP_787070	Q5U649	CL060_HUMAN	hypothetical protein LOC144608	37										ovary(1)|central_nervous_system(1)	2						ACTGAATTGTTTAGCCGCAGT	0.343																0.112195	61.500279	122.55096	46	364	KEEP	---	---	---	---	19	33	175	224	-1	capture	Missense_Mutation	SNP	14975979	14975979	C12orf60	12	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	1689	243
LEMD3	23592	broad.mit.edu	37	12	65632357	65632357	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:65632357A>G	uc001ssl.1	+	5	1777	c.1771A>G	c.(1771-1773)ATA>GTA	p.I591V	LEMD3_uc009zqo.1_Missense_Mutation_p.I590V	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	591					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AGATGTTGGAATAAGGTAAAG	0.313																0.127148	73.28376	112.724337	37	254	KEEP	---	---	---	---	15	24	122	143	-1	capture	Missense_Mutation	SNP	65632357	65632357	LEMD3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8641	243
ANO4	121601	broad.mit.edu	37	12	101480543	101480543	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101480543G>C	uc010svm.1	+	17	2214	c.1642G>C	c.(1642-1644)GTT>CTT	p.V548L	ANO4_uc001thw.2_Missense_Mutation_p.V513L|ANO4_uc001thx.2_Missense_Mutation_p.V548L|ANO4_uc001thy.2_Missense_Mutation_p.V68L	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	548	Helical; (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						TAACTCTCAGGTTGCAACCAC	0.493													HNSCC(74;0.22)			0.0625	-7.67687	40.194611	15	225	KEEP	---	---	---	---	7	11	110	126	-1	capture	Missense_Mutation	SNP	101480543	101480543	ANO4	12	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	693	243
MPHOSPH8	54737	broad.mit.edu	37	13	20233374	20233374	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20233374A>G	uc001umh.2	+	7	1745	c.1736A>G	c.(1735-1737)TAT>TGT	p.Y579C	MPHOSPH8_uc001umg.2_Missense_Mutation_p.Y579C	NM_017520	NP_059990	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	579					cell cycle	cytoplasm|nucleus					0		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		AATGGGGATTATATTACTGTA	0.284																0.410714	262.658189	263.824578	69	99	KEEP	---	---	---	---	29	55	56	59	-1	capture	Missense_Mutation	SNP	20233374	20233374	MPHOSPH8	13	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9639	243
PAN3	255967	broad.mit.edu	37	13	28794497	28794497	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28794497A>G	uc001urz.2	+	5	552	c.544A>G	c.(544-546)ACT>GCT	p.T182A	PAN3_uc010tdo.1_Missense_Mutation_p.T328A|PAN3_uc001ury.2_5'UTR|PAN3_uc001urx.2_Missense_Mutation_p.T128A	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	328	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		AAGCCCTGCTACTGCTGGATT	0.438																0.408582	794.055101	797.960511	219	317	KEEP	---	---	---	---	119	149	160	223	-1	capture	Missense_Mutation	SNP	28794497	28794497	PAN3	13	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11319	243
FRY	10129	broad.mit.edu	37	13	32808846	32808846	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32808846A>G	uc001utx.2	+	42	6159	c.5663A>G	c.(5662-5664)GAC>GGC	p.D1888G	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	1888					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCCTTATCTGACCTTCTCTCA	0.517																0.403226	173.330735	174.344584	50	74	KEEP	---	---	---	---	15	41	30	50	-1	capture	Missense_Mutation	SNP	32808846	32808846	FRY	13	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	6006	243
RAP2A	5911	broad.mit.edu	37	13	98086962	98086962	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:98086962C>G	uc001vnd.2	+	1	488	c.238C>G	c.(238-240)CTC>GTC	p.L80V		NM_021033	NP_066361	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family precursor	80					actin cytoskeleton reorganization|cellular protein localization|establishment of protein localization|positive regulation of protein autophosphorylation|Rap protein signal transduction|regulation of dendrite morphogenesis|regulation of JNK cascade	recycling endosome membrane	GTP binding|GTPase activity|protein binding			central_nervous_system(1)	1	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			GGGCTTCATCCTCGTCTACAG	0.632																0.456897	165.653727	165.842318	53	63	KEEP	---	---	---	---	28	33	28	40	-1	capture	Missense_Mutation	SNP	98086962	98086962	RAP2A	13	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	12935	243
OSGEP	55644	broad.mit.edu	37	14	20922812	20922812	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20922812C>T	uc001vxf.2	-	1	387	c.31G>A	c.(31-33)GCC>ACC	p.A11T	APEX1_uc001vxg.2_5'Flank|APEX1_uc001vxh.2_5'Flank|APEX1_uc001vxi.2_5'Flank|APEX1_uc001vxj.2_5'Flank	NM_017807	NP_060277	Q9NPF4	OSGEP_HUMAN	O-sialoglycoprotein endopeptidase	11					proteolysis|tRNA processing		metal ion binding|metalloendopeptidase activity|protein binding				0	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		ATCTTATTGGCGCTGCCTTCA	0.632																0.3375	70.702598	72.569817	27	53	KEEP	---	---	---	---	17	15	34	24	-1	capture	Missense_Mutation	SNP	20922812	20922812	OSGEP	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11191	243
C14orf166B	145497	broad.mit.edu	37	14	77292858	77292858	+	Nonsense_Mutation	SNP	C	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77292858C>G	uc001xsx.2	+	1	134	c.20C>G	c.(19-21)TCA>TGA	p.S7*	C14orf166B_uc010asn.1_Translation_Start_Site|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010aso.1_RNA|C14orf166B_uc010tvg.1_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	7											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CAATTCCCATCAAAGCCTACT	0.547	Ovarian(165;1056 1958 32571 36789 48728)															0.133333	4.639352	6.596373	2	13	KEEP	---	---	---	---	0	2	4	9	-1	capture	Nonsense_Mutation	SNP	77292858	77292858	C14orf166B	14	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	1743	243
HERC2	8924	broad.mit.edu	37	15	28474893	28474893	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28474893C>A	uc001zbj.2	-	32	5016	c.4910G>T	c.(4909-4911)AGT>ATT	p.S1637I		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1637					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGCAATTGTACTGAGGAGTGG	0.428					1580											0.023881	-71.101312	13.342348	8	327	KEEP	---	---	---	---	9	5	298	402	0.357142857143	capture	Missense_Mutation	SNP	28474893	28474893	HERC2	15	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	6984	243
MYO1E	4643	broad.mit.edu	37	15	59502739	59502739	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59502739C>G	uc002aga.2	-	13	1708	c.1336G>C	c.(1336-1338)GTA>CTA	p.V446L		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	446	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		AGGTCACATACGATTTTATTA	0.348																0.015789	-43.651759	6.836525	3	187	KEEP	---	---	---	---	2	2	99	131	-1	capture	Missense_Mutation	SNP	59502739	59502739	MYO1E	15	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	9982	243
C16orf59	80178	broad.mit.edu	37	16	2512205	2512205	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2512205G>A	uc002cqh.2	+	6	746	c.715G>A	c.(715-717)GCC>ACC	p.A239T	C16orf59_uc002cqf.1_Missense_Mutation_p.A239T|C16orf59_uc002cqg.1_Missense_Mutation_p.A72T|C16orf59_uc002cqi.2_Missense_Mutation_p.A72T|C16orf59_uc010uwb.1_Missense_Mutation_p.A72T	NM_025108	NP_079384	Q7L2K0	CP059_HUMAN	hypothetical protein LOC80178	239											0		Ovarian(90;0.17)				TGCCGCCGCTGCCAAAACCCA	0.612																0.0625	-2.708923	6.862011	3	45	KEEP	---	---	---	---	3	0	27	57	-1	capture	Missense_Mutation	SNP	2512205	2512205	C16orf59	16	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	1809	243
TMC5	79838	broad.mit.edu	37	16	19477522	19477522	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19477522G>A	uc002dgc.3	+	9	2353	c.1604G>A	c.(1603-1605)TGC>TAC	p.C535Y	TMC5_uc010vaq.1_Missense_Mutation_p.C535Y|TMC5_uc002dgb.3_Missense_Mutation_p.C535Y|TMC5_uc010var.1_Missense_Mutation_p.C535Y|TMC5_uc002dgd.1_Missense_Mutation_p.C289Y|TMC5_uc002dge.3_Missense_Mutation_p.C289Y|TMC5_uc002dgf.3_Missense_Mutation_p.C218Y|TMC5_uc002dgg.3_Missense_Mutation_p.C176Y	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	535	Helical; (Potential).					integral to membrane				skin(1)	1						ATCGGAGCATGCTTGACCACC	0.458																0.246753	42.379647	46.881434	19	58	KEEP	---	---	---	---	12	8	40	24	-1	capture	Missense_Mutation	SNP	19477522	19477522	TMC5	16	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	15873	243
SCNN1B	6338	broad.mit.edu	37	16	23360058	23360058	+	Silent	SNP	C	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23360058C>A	uc002dln.2	+	2	314	c.138C>A	c.(136-138)CCC>CCA	p.P46P		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	46	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GTGAGGGGCCCAAGAAGAAAG	0.612																0.05	-6.527056	6.364819	3	57	KEEP	---	---	---	---	3	0	35	31	-1	capture	Silent	SNP	23360058	23360058	SCNN1B	16	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	13821	243
OR1A2	26189	broad.mit.edu	37	17	3101531	3101531	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3101531G>C	uc002fvd.1	+	1	719	c.719G>C	c.(718-720)TGT>TCT	p.C240S		NM_012352	NP_036484	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TTCTGCACCTGTGGCTCCCAC	0.438																0.015873	-101.095484	16.034496	7	434	KEEP	---	---	---	---	3	4	195	273	-1	capture	Missense_Mutation	SNP	3101531	3101531	OR1A2	17	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	10854	243
DLG4	1742	broad.mit.edu	37	17	7099833	7099833	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7099833G>A	uc002get.3	-	12	2475	c.1274C>T	c.(1273-1275)GCG>GTG	p.A425V	DLG4_uc010vtm.1_RNA|DLG4_uc010vtn.1_Missense_Mutation_p.A322V|DLG4_uc010cly.2_Missense_Mutation_p.A379V|DLG4_uc010vto.1_Missense_Mutation_p.A422V	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	382	PDZ 3.				axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						CGTCTGACCCGCATTCTTCAG	0.542																0.035398	-19.337125	7.113351	4	109	KEEP	---	---	---	---	2	3	63	89	-1	capture	Missense_Mutation	SNP	7099833	7099833	DLG4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4515	243
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	Pancreas(47;798 1329 9957 10801)	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	p.R175L(LS123-Tumor)|p.R175L(VMRCLCD-Tumor)|p.R175L(DETROIT562-Tumor)|p.R175L(KMS26-Tumor)|p.R175L(KLE-Tumor)|p.R175L(SNU245-Tumor)|p.R175L(SKBR3-Tumor)|p.R175L(RKN-Tumor)|p.R174fs(THP1-Tumor)|p.R175L(HCC1395-Tumor)|p.R175L(VMCUB1-Tumor)|p.R175L(RT11284-Tumor)|p.R175L(AU565-Tumor)|p.R175L(SKUT1-Tumor)|p.R175L(HS571.T-Tumor)|p.R175L(HUCCT1-Tumor)|p.R175L(TYKNU-Tumor)|p.R175L(LMSU-Tumor)|p.R175L(CAL33-Tumor)|p.R175L(SNU1197-Tumor)|p.R175L(NCIH196-Tumor)|p.R175H(HCC44-Tumor)|p.R175L(OPM2-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.9	168.782115	178.374664	54	6	KEEP	---	---	---	---	29	32	2	4	-1	capture	Missense_Mutation	SNP	7578406	7578406	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	243
SFRS1	6426	broad.mit.edu	37	17	56083327	56083327	+	Silent	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56083327A>G	uc002ivi.2	-	3	596	c.387T>C	c.(385-387)CCT>CCC	p.P129P	SFRS1_uc002ivj.2_Silent_p.P129P	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	129	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		TTCCACTTGGAGGCAGTCCTG	0.388																0.025424	-22.584098	6.863405	3	115	KEEP	---	---	---	---	0	3	49	81	-1	capture	Silent	SNP	56083327	56083327	SFRS1	17	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	14058	243
KCNH6	81033	broad.mit.edu	37	17	61613357	61613357	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61613357G>A	uc002jay.2	+	6	1509	c.1429G>A	c.(1429-1431)GTG>ATG	p.V477M	KCNH6_uc002jax.1_Missense_Mutation_p.V477M|KCNH6_uc010wpl.1_Missense_Mutation_p.V354M|KCNH6_uc010wpm.1_Missense_Mutation_p.V477M|KCNH6_uc002jaz.1_Missense_Mutation_p.V424M	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	477	Selectivity filter (By similarity).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	CCTCACCAGCGTGGGCTTCGG	0.602																0.409091	75.802916	76.281469	27	39	KEEP	---	---	---	---	13	20	21	30	-1	capture	Missense_Mutation	SNP	61613357	61613357	KCNH6	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7958	243
FAM20A	54757	broad.mit.edu	37	17	66551780	66551780	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66551780C>T	uc002jho.2	-	2	797	c.509G>A	c.(508-510)CGC>CAC	p.R170H	FAM20A_uc010wqp.1_Missense_Mutation_p.R32H|FAM20A_uc002jhn.2_5'UTR	NM_017565	NP_060035	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	170						extracellular region					0	Breast(10;1.64e-13)					GAGCCCATGGCGGTTAATACC	0.562																0.401274	170.98944	172.327739	63	94	KEEP	---	---	---	---	32	33	56	54	-1	capture	Missense_Mutation	SNP	66551780	66551780	FAM20A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5488	243
DSC2	1824	broad.mit.edu	37	18	28654745	28654745	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28654745C>G	uc002kwl.3	-	12	2246	c.1792G>C	c.(1792-1794)GAT>CAT	p.D598H	DSC2_uc002kwk.3_Missense_Mutation_p.D598H	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	598	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TCATCAGGATCAACCGCAACA	0.428																0.040816	-13.087914	9.155728	4	94	KEEP	---	---	---	---	2	2	44	58	-1	capture	Missense_Mutation	SNP	28654745	28654745	DSC2	18	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	4721	243
GALNT1	2589	broad.mit.edu	37	18	33234759	33234759	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33234759G>A	uc010dmu.2	+	2	186	c.133G>A	c.(133-135)GGA>AGA	p.G45R	GALNT1_uc002kyz.3_5'UTR|GALNT1_uc002kza.2_Missense_Mutation_p.G45R|GALNT1_uc002kzb.2_Missense_Mutation_p.G45R	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	45	Lumenal (Potential).				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						ACTTCCTGCTGGAGATGGTGA	0.338																0.015957	-43.258606	6.652309	3	185	KEEP	---	---	---	---	0	3	81	151	-1	capture	Missense_Mutation	SNP	33234759	33234759	GALNT1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	6147	243
APC2	10297	broad.mit.edu	37	19	1468647	1468647	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1468647G>A	uc002lsr.1	+	15	5555	c.5347G>A	c.(5347-5349)GGG>AGG	p.G1783R	APC2_uc002lss.1_Missense_Mutation_p.G1365R|APC2_uc002lst.1_Missense_Mutation_p.G1783R|APC2_uc002lsu.1_Missense_Mutation_p.G1782R|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	1783	Pro-rich.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCACGCCCGGGGTGCCAGC	0.721																0.15	5.11215	7.461362	3	17	KEEP	---	---	---	---	3	0	9	8	-1	capture	Missense_Mutation	SNP	1468647	1468647	APC2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	757	243
CDC37	11140	broad.mit.edu	37	19	10505756	10505756	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10505756C>T	uc002mof.1	-	5	783	c.667G>A	c.(667-669)GCC>ACC	p.A223T	CDC37_uc002moe.1_Missense_Mutation_p.A178T|CDC37_uc010dxf.1_Missense_Mutation_p.A60T|CDC37_uc002mog.1_Intron|CDC37_uc002moh.2_Missense_Mutation_p.A223T	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	223					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		AGGCTCTTGGCCAGCTCCAGG	0.592																0.022727	-37.856951	6.829838	4	172	KEEP	---	---	---	---	0	4	95	101	-1	capture	Missense_Mutation	SNP	10505756	10505756	CDC37	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3039	243
FAM129C	199786	broad.mit.edu	37	19	17649991	17649991	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17649991G>A	uc010xpr.1	+	7	859	c.721G>A	c.(721-723)GCC>ACC	p.A241T	FAM129C_uc010xpq.1_Missense_Mutation_p.A241T|FAM129C_uc002ngy.3_5'UTR|FAM129C_uc010xpu.1_5'UTR|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_5'UTR|FAM129C_uc002nhb.2_5'Flank	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	241											0						TGCTGCCCGGGCCTTCCTGGA	0.697																0.214286	7.118636	8.172985	3	11	KEEP	---	---	---	---	2	1	7	8	-1	capture	Missense_Mutation	SNP	17649991	17649991	FAM129C	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5392	243
CD177	57126	broad.mit.edu	37	19	43865711	43865711	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43865711G>T	uc002owi.2	+	9	1103	c.1061G>T	c.(1060-1062)GGG>GTG	p.G354V	CD177_uc010eis.2_RNA|CD177_uc002owj.2_RNA	NM_020406	NP_065139	Q8N6Q3	CD177_HUMAN	CD177 molecule precursor	354	UPAR/Ly6 2.				blood coagulation|leukocyte migration	anchored to membrane|plasma membrane				central_nervous_system(1)	1		Prostate(69;0.00682)				TGTTATGATGGGTACATTCAT	0.398																0.636364	21.827023	22.006735	7	4	KEEP	---	---	---	---	4	5	2	5	0.444444444444	capture	Missense_Mutation	SNP	43865711	43865711	CD177	19	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	2942	243
IFT172	26160	broad.mit.edu	37	2	27688614	27688614	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27688614G>A	uc002rku.2	-	17	1879	c.1828C>T	c.(1828-1830)CGG>TGG	p.R610W		NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	610	TPR 1.				cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					GCCTCTCACCGGATGTAGTTG	0.537																0.036735	-121.936497	48.94261	27	708	KEEP	---	---	---	---	13	25	418	540	-1	capture	Missense_Mutation	SNP	27688614	27688614	IFT172	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	7482	243
GCC2	9648	broad.mit.edu	37	2	109103075	109103075	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109103075G>A	uc002tec.2	+	16	4055	c.3901G>A	c.(3901-3903)GCA>ACA	p.A1301T	GCC2_uc002ted.2_Missense_Mutation_p.A1200T	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1301	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						GAGAGTGACAGCACTACAGGA	0.512																0.034884	-13.85531	6.384949	3	83	KEEP	---	---	---	---	0	3	47	41	-1	capture	Missense_Mutation	SNP	109103075	109103075	GCC2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	6226	243
LRP2	4036	broad.mit.edu	37	2	170026272	170026272	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170026272T>C	uc002ues.2	-	60	11650	c.11437A>G	c.(11437-11439)AGT>GGT	p.S3813G		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3813	Extracellular (Potential).|LDL-receptor class A 33.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTCAGTTCACTGTGTACACAA	0.438					2055											0.02521	-23.166468	6.553905	3	116	KEEP	---	---	---	---	2	2	56	69	-1	capture	Missense_Mutation	SNP	170026272	170026272	LRP2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	8872	243
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.328125	113.305797	116.658963	42	86	KEEP	---	---	---	---	24	26	49	44	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	243
RHBDD1	84236	broad.mit.edu	37	2	227729644	227729644	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227729644T>C	uc002voi.2	+	2	356	c.235T>C	c.(235-237)TGG>CGG	p.W79R	RHBDD1_uc010fxc.2_Missense_Mutation_p.W79R	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1	79						integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		TGCTGATGATTGGCATTTGTA	0.438																0.20462	162.487426	187.008726	62	241	KEEP	---	---	---	---	33	36	118	143	-1	capture	Missense_Mutation	SNP	227729644	227729644	RHBDD1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	13208	243
CRYBA4	1413	broad.mit.edu	37	22	27018564	27018564	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:27018564A>G	uc003acz.3	+	2	39	c.4A>G	c.(4-6)ACC>GCC	p.T2A		NM_001886	NP_001877	P53673	CRBA4_HUMAN	crystallin, beta A4	2	N-terminal arm.				camera-type eye development|visual perception	soluble fraction	structural constituent of eye lens				0						GGCCACAATGACCCTGCAATG	0.552																0.020408	-30.798763	7.075125	3	144	KEEP	---	---	---	---	2	1	99	74	-1	capture	Missense_Mutation	SNP	27018564	27018564	CRYBA4	22	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3874	243
APOBEC3F	200316	broad.mit.edu	37	22	39436982	39436982	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39436982G>A	uc003aww.2	+	1	310	c.17G>A	c.(16-18)AGA>AAA	p.R6K	APOBEC3F_uc003awv.2_Missense_Mutation_p.R6K|APOBEC3F_uc011aog.1_Missense_Mutation_p.R6K	NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	6					base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					CCTCACTTCAGGTACCGCTGC	0.647																0.142857	5.040567	6.76094	2	12	KEEP	---	---	---	---	0	3	6	9	-1	capture	Missense_Mutation	SNP	39436982	39436982	APOBEC3F	22	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	786	243
DOCK3	1795	broad.mit.edu	37	3	51387773	51387773	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51387773G>C	uc011bds.1	+	40	4080	c.4057G>C	c.(4057-4059)GAG>CAG	p.E1353Q		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1353	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CCTGGAGCCTGAGTTCTTTCG	0.448					1034											0.033445	-45.229695	25.749326	10	289	KEEP	---	---	---	---	6	6	175	215	-1	capture	Missense_Mutation	SNP	51387773	51387773	DOCK3	3	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	4644	243
TNFSF10	8743	broad.mit.edu	37	3	172232698	172232698	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172232698T>C	uc003fid.2	-	2	318	c.223A>G	c.(223-225)AGC>GGC	p.S75G	TNFSF10_uc003fie.2_Missense_Mutation_p.S75G	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	75	Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CAGCAGGGGCTGTTCATACTC	0.498					52											0.413333	301.461948	302.929726	93	132	KEEP	---	---	---	---	49	50	68	73	-1	capture	Missense_Mutation	SNP	172232698	172232698	TNFSF10	3	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	16184	243
SPATA16	83893	broad.mit.edu	37	3	172835032	172835032	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172835032G>C	uc003fin.3	-	2	648	c.490C>G	c.(490-492)CAT>GAT	p.H164D		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	164					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CTGAAATTATGTACACTCAAA	0.448																0.059925	-11.635462	42.453033	16	251	KEEP	---	---	---	---	7	10	129	142	-1	capture	Missense_Mutation	SNP	172835032	172835032	SPATA16	3	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	14893	243
MUC4	4585	broad.mit.edu	37	3	195511959	195511959	+	Silent	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195511959G>A	uc011bto.1	-	2	6952	c.6492C>T	c.(6490-6492)ACC>ACT	p.T2164T	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	45					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.577																0.666667	7.051246	7.124733	2	1	KEEP	---	---	---	---	0	2	1	2	-1	capture	Silent	SNP	195511959	195511959	MUC4	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9888	243
GABRA2	2555	broad.mit.edu	37	4	46252347	46252347	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46252347G>A	uc003gxc.3	-	9	2007	c.1334C>T	c.(1333-1335)CCT>CTT	p.P445L	GABRA2_uc010igc.2_Missense_Mutation_p.P445L|GABRA2_uc011bzc.1_Missense_Mutation_p.P450L	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	445					gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CCCTAATACAGGTTCTCTGTT	0.338																0.478528	258.439471	258.505041	78	85	KEEP	---	---	---	---	35	49	39	63	-1	capture	Missense_Mutation	SNP	46252347	46252347	GABRA2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6103	243
SEC24B	10427	broad.mit.edu	37	4	110442579	110442579	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110442579A>G	uc003hzk.2	+	14	2360	c.2305A>G	c.(2305-2307)ATA>GTA	p.I769V	SEC24B_uc003hzl.2_Missense_Mutation_p.I734V|SEC24B_uc011cfp.1_Missense_Mutation_p.I799V|SEC24B_uc011cfq.1_Missense_Mutation_p.I768V|SEC24B_uc011cfr.1_Missense_Mutation_p.I733V	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	769					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCTCAGCTTATAAAAGACTT	0.343																0.047619	-7.567153	10.72862	4	80	KEEP	---	---	---	---	0	4	44	43	-1	capture	Missense_Mutation	SNP	110442579	110442579	SEC24B	4	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	13888	243
MYOZ2	51778	broad.mit.edu	37	4	120085521	120085521	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:120085521G>C	uc003icp.3	+	5	745	c.532G>C	c.(532-534)GAA>CAA	p.E178Q		NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN	myozenin 2	178							protein phosphatase 2B binding				0						AGGAAAGGCAGAACTGCCTGA	0.418																0.018987	-34.126858	6.978559	3	155	KEEP	---	---	---	---	1	4	88	101	-1	capture	Missense_Mutation	SNP	120085521	120085521	MYOZ2	4	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	10006	243
PCDHA4	56144	broad.mit.edu	37	5	140189035	140189035	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140189035A>G	uc003lhi.2	+	1	2364	c.2263A>G	c.(2263-2265)AGG>GGG	p.R755G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.R755G|PCDHA4_uc011daa.1_Missense_Mutation_p.R755G	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	755	Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCAGAGGAGGCCGAGGGT	0.662																0.018072	-36.508959	6.914271	3	163	KEEP	---	---	---	---	4	1	76	102	-1	capture	Missense_Mutation	SNP	140189035	140189035	PCDHA4	5	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	11429	243
CLK4	57396	broad.mit.edu	37	5	178040532	178040532	+	Silent	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178040532C>T	uc003mjf.1	-	7	876	c.768G>A	c.(766-768)CTG>CTA	p.L256L	CLK4_uc003mjg.1_Silent_p.L220L|CLK4_uc010jku.1_Silent_p.L76L|CLK4_uc003mjh.1_Silent_p.L76L|CLK4_uc010jkv.1_RNA|CLK4_uc011dgg.1_Silent_p.L256L|CLK4_uc011dgh.1_Silent_p.L76L	NM_020666	NP_065717	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	256	Protein kinase.					nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(1)	1	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTGAAATGGCAGAAAGCTGT	0.328					146											0.207792	30.94993	37.048062	16	61	KEEP	---	---	---	---	10	9	37	31	-1	capture	Silent	SNP	178040532	178040532	CLK4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	3504	243
KIF13A	63971	broad.mit.edu	37	6	17831467	17831467	+	Splice_Site	SNP	C	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17831467C>A	uc003ncg.3	-	13	1372	c.1267_splice	c.e13-1	p.E423_splice	KIF13A_uc003ncf.2_Splice_Site_p.E423_splice|KIF13A_uc003nch.3_Splice_Site_p.E423_splice|KIF13A_uc003nci.3_Splice_Site_p.E423_splice|KIF13A_uc003ncj.2_Splice_Site_p.E99_splice	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GTTGTCTTTCCTGTGCACAAA	0.438																0.021127	-29.110625	7.321316	3	139	KEEP	---	---	---	---	2	2	82	84	0.5	capture	Splice_Site	SNP	17831467	17831467	KIF13A	6	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	8196	243
BTNL2	56244	broad.mit.edu	37	6	32370963	32370963	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32370963T>C	uc003obg.1	-	3	458	c.458A>G	c.(457-459)GAG>GGG	p.E153G	BTNL2_uc010jty.1_Intron|BTNL2_uc010jtz.1_Intron|BTNL2_uc010jua.1_Intron	NM_019602	NP_062548	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2	153	Ig-like V-type 2.|Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						CCCAGGTCCCTCCATGTGGAT	0.607																0.054054	-1.280031	6.475615	2	35	KEEP	---	---	---	---	0	2	20	20	-1	capture	Missense_Mutation	SNP	32370963	32370963	BTNL2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	1553	243
DEF6	50619	broad.mit.edu	37	6	35280172	35280172	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35280172G>A	uc003okk.2	+	4	556	c.517G>A	c.(517-519)GCC>ACC	p.A173T	DEF6_uc010jvs.2_Missense_Mutation_p.A173T|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	173						cytoplasm|nucleus|plasma membrane					0						GGCCCAGGTGGCCCAGACCAC	0.647																0.026178	-39.564277	7.85577	5	186	KEEP	---	---	---	---	3	2	108	121	-1	capture	Missense_Mutation	SNP	35280172	35280172	DEF6	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4344	243
PKHD1	5314	broad.mit.edu	37	6	51799070	51799070	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51799070C>T	uc003pah.1	-	37	6235	c.5959G>A	c.(5959-5961)GCC>ACC	p.A1987T	PKHD1_uc010jzn.1_Missense_Mutation_p.A12T|PKHD1_uc003pai.2_Missense_Mutation_p.A1987T	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1987	Extracellular (Potential).|G8 1.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ACAAGGATGGCGTGTGCCCTG	0.542					1537									OREG0017491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.367347	154.209894	156.484529	54	93	KEEP	---	---	---	---	28	33	45	58	-1	capture	Missense_Mutation	SNP	51799070	51799070	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11874	243
MTHFD1L	25902	broad.mit.edu	37	6	151336802	151336802	+	Silent	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151336802C>T	uc003qob.2	+	24	2827	c.2559C>T	c.(2557-2559)AGC>AGT	p.S853S	MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Silent_p.S854S|MTHFD1L_uc003qoc.2_Silent_p.S801S	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	853	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		GTAAAAGAAGCCGATTCCAGT	0.463																0.075	0.491434	7.905701	3	37	KEEP	---	---	---	---	1	2	21	23	-1	capture	Silent	SNP	151336802	151336802	MTHFD1L	6	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	9838	243
ADAP1	11033	broad.mit.edu	37	7	943765	943765	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:943765T>C	uc003sjo.3	-	6	822	c.646A>G	c.(646-648)AAG>GAG	p.K216E	ADAP1_uc003sjm.3_Missense_Mutation_p.K42E|ADAP1_uc011jvs.1_Missense_Mutation_p.K121E|ADAP1_uc003sjn.3_Missense_Mutation_p.K144E|ADAP1_uc010ksc.2_Missense_Mutation_p.K144E	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1	216	PH 1.				cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						GCACCCACCTTCCCGTCCTCA	0.672																0.030928	-16.237238	7.122748	3	94	KEEP	---	---	---	---	3	0	41	80	-1	capture	Missense_Mutation	SNP	943765	943765	ADAP1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	279	243
ZMIZ2	83637	broad.mit.edu	37	7	44798997	44798997	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44798997C>T	uc003tlr.2	+	7	1054	c.931C>T	c.(931-933)CCC>TCC	p.P311S	ZMIZ2_uc003tlq.2_Missense_Mutation_p.P279S|ZMIZ2_uc003tls.2_Missense_Mutation_p.P311S|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1	311	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						GCACAGGCTGCCCCTGCAGCA	0.687	NSCLC(20;604 852 1948 16908 50522)															0.042553	-13.982682	7.134371	4	90	KEEP	---	---	---	---	2	2	53	54	-1	capture	Missense_Mutation	SNP	44798997	44798997	ZMIZ2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17577	243
CLIP2	7461	broad.mit.edu	37	7	73790959	73790959	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73790959G>C	uc003uam.2	+	10	2555	c.2228G>C	c.(2227-2229)CGG>CCG	p.R743P	CLIP2_uc003uan.2_Missense_Mutation_p.R708P|CLIP2_uc003uao.2_Missense_Mutation_p.R137P	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	743	Potential.					microtubule associated complex				skin(3)	3						GTGGAGTACCGGGGCCAGGCG	0.657																0.054545	-4.831023	6.768936	3	52	KEEP	---	---	---	---	0	3	37	32	-1	capture	Missense_Mutation	SNP	73790959	73790959	CLIP2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	3498	243
OPN1SW	611	broad.mit.edu	37	7	128415066	128415066	+	Silent	SNP	G	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128415066G>T	uc003vnt.3	-	2	495	c.495C>A	c.(493-495)TCC>TCA	p.S165S		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	165	Helical; Name=4; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						AGGGTGGGATGGAGACGCCAA	0.552																0.045977	-11.079041	8.069537	4	83	KEEP	---	---	---	---	0	4	39	55	-1	capture	Silent	SNP	128415066	128415066	OPN1SW	7	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	10784	243
ABCF2	10061	broad.mit.edu	37	7	150915908	150915908	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150915908G>A	uc003wjp.2	-	9	1180	c.1069C>T	c.(1069-1071)CAG>TAG	p.Q357*	ABCF2_uc003wjo.1_Nonsense_Mutation_p.Q357*	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	357						ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCTTGCTCTGGGCCTGCCGG	0.428																0.043062	-33.458979	13.361773	9	200	KEEP	---	---	---	---	5	7	101	148	-1	capture	Nonsense_Mutation	SNP	150915908	150915908	ABCF2	7	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	66	243
RAB11FIP1	80223	broad.mit.edu	37	8	37730590	37730590	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37730590G>T	uc003xkm.1	-	4	1774	c.1730C>A	c.(1729-1731)CCC>CAC	p.P577H	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_5'UTR|RAB11FIP1_uc003xko.1_5'UTR|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	577	Ser-rich.				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CAATTCAGAGGGGACAGATGC	0.557																0.015873	-43.657531	6.550164	3	186	KEEP	---	---	---	---	1	2	104	101	0.333333333333	capture	Missense_Mutation	SNP	37730590	37730590	RAB11FIP1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12788	243
RALYL	138046	broad.mit.edu	37	8	85774532	85774532	+	Silent	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:85774532T>C	uc003ycq.3	+	7	831	c.415T>C	c.(415-417)TTA>CTA	p.L139L	RALYL_uc003ycr.3_Silent_p.L139L|RALYL_uc003ycs.3_Silent_p.L139L|RALYL_uc010lzy.2_Silent_p.L128L|RALYL_uc003yct.3_Silent_p.L152L|RALYL_uc003ycu.3_Silent_p.L66L|RALYL_uc003ycv.3_Silent_p.L51L	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	139							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						TTTGTAAAGGTTATTTGATTA	0.473																0.459459	64.874898	64.927449	17	20	KEEP	---	---	---	---	8	10	14	11	-1	capture	Silent	SNP	85774532	85774532	RALYL	8	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	12915	243
PLEC	5339	broad.mit.edu	37	8	144991998	144991998	+	Silent	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144991998G>C	uc003zaf.1	-	32	12572	c.12402C>G	c.(12400-12402)GGC>GGG	p.G4134G	PLEC_uc003zab.1_Silent_p.G3997G|PLEC_uc003zac.1_Silent_p.G4001G|PLEC_uc003zad.2_Silent_p.G3997G|PLEC_uc003zae.1_Silent_p.G3965G|PLEC_uc003zag.1_Silent_p.G3975G|PLEC_uc003zah.2_Silent_p.G3983G|PLEC_uc003zaj.2_Silent_p.G4024G	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4134	Plectin 23.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						TGAACTCGGGGCCCACAATGC	0.622																0.380952	71.042316	71.838904	24	39	KEEP	---	---	---	---	13	15	23	21	-1	capture	Silent	SNP	144991998	144991998	PLEC	8	G	C	C	C	1	0	0	0	0	0	0	0	1	535	42	4	4	11955	243
UNC13B	10497	broad.mit.edu	37	9	35386179	35386179	+	Silent	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35386179C>T	uc003zwq.2	+	23	3028	c.2736C>T	c.(2734-2736)AGC>AGT	p.S912S	UNC13B_uc003zwr.2_Silent_p.S912S	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	912					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			AACTGCAAAGCCCTCCAAGAG	0.483																0.017241	-38.472417	7.256143	3	171	KEEP	---	---	---	---	0	3	91	101	-1	capture	Silent	SNP	35386179	35386179	UNC13B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	16867	243
ZNF658	26149	broad.mit.edu	37	9	40772547	40772547	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:40772547A>C	uc004abs.2	-	5	2880	c.2728T>G	c.(2728-2730)TAT>GAT	p.Y910D	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.Y910D	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	910	C2H2-type 20.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGCATTCATAGGGTTTCTCC	0.448																0.019753	-91.04798	13.768625	8	397	KEEP	---	---	---	---	3	6	198	242	-1	capture	Missense_Mutation	SNP	40772547	40772547	ZNF658	9	A	C	C	C	1	0	0	0	0	1	0	0	0	195	15	4	4	17947	243
PTPDC1	138639	broad.mit.edu	37	9	96859671	96859671	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96859671C>T	uc004auf.1	+	7	1001	c.661C>T	c.(661-663)CGG>TGG	p.R221W	PTPDC1_uc004aug.1_Missense_Mutation_p.R221W|PTPDC1_uc004auh.1_Missense_Mutation_p.R273W|PTPDC1_uc010mrj.1_Missense_Mutation_p.R275W|PTPDC1_uc010mri.1_Missense_Mutation_p.R273W	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	221	Tyrosine-protein phosphatase.						protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						TATATTTGTGCGGGCAAAGCG	0.418																0.024096	-35.243291	6.538899	4	162	KEEP	---	---	---	---	1	3	62	115	-1	capture	Missense_Mutation	SNP	96859671	96859671	PTPDC1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12668	243
CLCN4	1183	broad.mit.edu	37	X	10181901	10181901	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10181901T>C	uc004csy.3	+	11	2187	c.1757T>C	c.(1756-1758)GTG>GCG	p.V586A	CLCN4_uc011mid.1_Missense_Mutation_p.V492A	NM_001830	NP_001821	P51793	CLCN4_HUMAN	chloride channel 4	586	Cytoplasmic (By similarity).					early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						TTCCTTGACGTGAAGGACGAG	0.597	Melanoma(74;1050 1296 1576 30544 38374)															0.180328	24.589174	30.450519	11	50	KEEP	---	---	---	---	4	9	32	25	-1	capture	Missense_Mutation	SNP	10181901	10181901	CLCN4	23	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3430	243
NHS	4810	broad.mit.edu	37	X	17743937	17743937	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17743937A>T	uc004cxx.2	+	6	1986	c.1648A>T	c.(1648-1650)AGC>TGC	p.S550C	NHS_uc011mix.1_Missense_Mutation_p.S571C|NHS_uc004cxy.2_Missense_Mutation_p.S394C|NHS_uc004cxz.2_Missense_Mutation_p.S373C|NHS_uc004cya.2_Missense_Mutation_p.S273C	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	550						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					ACATCTTCACAGCCCCCAGCA	0.557																0.037037	-12.24606	6.561783	3	78	KEEP	---	---	---	---	3	1	33	51	-1	capture	Missense_Mutation	SNP	17743937	17743937	NHS	23	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	10318	243
SMC1A	8243	broad.mit.edu	37	X	53409449	53409449	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53409449A>G	uc004dsg.2	-	21	3332	c.3263T>C	c.(3262-3264)CTG>CCG	p.L1088P	SMC1A_uc011moe.1_Missense_Mutation_p.L1066P	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1088					cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						ATTGCGGGACAGGGCCTTATA	0.527																0.066667	0.92689	6.763521	2	28	KEEP	---	---	---	---	0	2	17	15	-1	capture	Missense_Mutation	SNP	53409449	53409449	SMC1A	23	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	14673	243
ATRX	546	broad.mit.edu	37	X	76938029	76938029	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76938029G>A	uc004ecp.3	-	9	2951	c.2719C>T	c.(2719-2721)CGA>TGA	p.R907*	ATRX_uc004ecq.3_Nonsense_Mutation_p.R869*|ATRX_uc004eco.3_Nonsense_Mutation_p.R692*|ATRX_uc004ecr.2_Nonsense_Mutation_p.R839*|ATRX_uc010nlx.1_Nonsense_Mutation_p.R878*|ATRX_uc010nly.1_Nonsense_Mutation_p.R852*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	907					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	p.R907*(1)		haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TTAGGAAGTCGATCTCTTAAT	0.418					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.902878	812.978298	858.162203	251	27	KEEP	---	---	---	---	120	148	12	18	-1	capture	Nonsense_Mutation	SNP	76938029	76938029	ATRX	23	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	1199	243
PGK1	5230	broad.mit.edu	37	X	77372859	77372860	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77372859_77372860GC>CT	uc004ecz.3	+	5	640_641	c.468_469GC>CT	c.(466-471)AAGCTA>AACTTA	p.K156N	PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_Missense_Mutation_p.K128N	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	156					gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						CACTTTCCAAGCTAGGGGATGT	0.426																0.067797	0.048495	11.457239	4	55	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	77372859	77372860	PGK1	23	GC	CT	CT	CT	1	0	0	0	0	1	0	0	0	438	34	4	4	11693	243
CXorf57	55086	broad.mit.edu	37	X	105882786	105882786	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105882786G>C	uc004emi.3	+	9	1754	c.1603G>C	c.(1603-1605)GTC>CTC	p.V535L	CXorf57_uc004emj.3_Intron	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	535										ovary(1)|lung(1)|breast(1)	3						TATAAGTGAAGTCAGGAAGGA	0.363																0.04698	-13.81026	18.777892	7	142	KEEP	---	---	---	---	4	3	89	83	-1	capture	Missense_Mutation	SNP	105882786	105882786	CXorf57	23	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	4073	243
CXorf57	55086	broad.mit.edu	37	X	105882797	105882797	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105882797G>C	uc004emi.3	+	9	1765	c.1614G>C	c.(1612-1614)GAG>GAC	p.E538D	CXorf57_uc004emj.3_Intron	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	538										ovary(1)|lung(1)|breast(1)	3						TCAGGAAGGAGATTGAAGACT	0.373																0.037975	-21.391046	15.088024	6	152	KEEP	---	---	---	---	5	2	88	98	-1	capture	Missense_Mutation	SNP	105882797	105882797	CXorf57	23	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	4073	243
SLITRK2	84631	broad.mit.edu	37	X	144906297	144906297	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:144906297C>T	uc004fcd.2	+	5	3344	c.2354C>T	c.(2353-2355)GCC>GTC	p.A785V	SLITRK2_uc010nsp.2_Missense_Mutation_p.A785V|SLITRK2_uc010nso.2_Missense_Mutation_p.A785V|SLITRK2_uc011mwq.1_Missense_Mutation_p.A785V|SLITRK2_uc011mwr.1_Missense_Mutation_p.A785V|SLITRK2_uc011mws.1_Missense_Mutation_p.A785V|SLITRK2_uc004fcg.2_Missense_Mutation_p.A785V|SLITRK2_uc011mwt.1_Missense_Mutation_p.A785V|CXorf1_uc004fch.2_5'Flank	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	785	Cytoplasmic (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCAGTTTGCCCCTTCCTAT	0.453																0.020202	-44.566784	6.530588	4	194	KEEP	---	---	---	---	4	0	97	119	-1	capture	Missense_Mutation	SNP	144906297	144906297	SLITRK2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14635	243
BOK	666	broad.mit.edu	37	2	242509549	242509549	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242509549delG	uc002wbq.2	+	4	605	c.359delG	c.(358-360)TGGfs	p.W120fs	BOK_uc002wbr.2_5'Flank	NM_032515	NP_115904	Q9UMX3	BOK_HUMAN	BCL2-related ovarian killer	120	BH1.				activation of caspase activity|cell proliferation|signal transduction by p53 class mediator resulting in induction of apoptosis	mitochondrial membrane|nucleus				ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.04e-33)|all cancers(36;7.87e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.52e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.64e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0835)		GGCATCACGTGGGGCAAGGTG	0.657					246											0.22			13	45		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	242509549	242509549	BOK	2	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	1472	243
TATDN2	9797	broad.mit.edu	37	3	10312062	10312064	+	In_Frame_Del	DEL	GCA	-	-			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10312062_10312064delGCA	uc003bvg.2	+	4	1777_1779	c.1196_1198delGCA	c.(1195-1200)GGCAGC>GGC	p.S402del	TATDN2_uc003bvf.2_In_Frame_Del_p.S402del|TATDN2_uc011atr.1_In_Frame_Del_p.S402del|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	402						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2						CCCTCCACAGGCAGCAGCAGCAA	0.552																0.02			7	294		---	---	---	---						capture_indel	In_Frame_Del	DEL	10312062	10312064	TATDN2	3	GCA	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	15480	243
FAM175A	84142	broad.mit.edu	37	4	84388619	84388641	+	Frame_Shift_Del	DEL	TTGTAATGAAGCATACATTTCAT	-	-			TCGA-32-4208-01	TCGA-32-4208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:84388619_84388641delTTGTAATGAAGCATACATTTCAT	uc003hou.2	-	7	712_734	c.647_669delATGAAATGTATGCTTCATTACAA	c.(646-669)AATGAAATGTATGCTTCATTACAAfs	p.N216fs	MRPS18C_uc011ccu.1_Intron|FAM175A_uc003hot.2_Frame_Shift_Del_p.N44fs|FAM175A_uc003hov.2_Frame_Shift_Del_p.N107fs	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98	216_223	Potential.				chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						TTAATTCCTCTTGTAATGAAGCATACATTTCATTTATCTTATG	0.309																0.13			7	48		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	84388619	84388641	FAM175A	4	TTGTAATGAAGCATACATTTCAT	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	5450	243
