Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DNAJC11	55735	broad.mit.edu	37	1	6727822	6727822	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6727822G>A	uc001aof.2	-	4	431	c.325C>T	c.(325-327)CGG>TGG	p.R109W	DNAJC11_uc010nzt.1_Missense_Mutation_p.R71W|DNAJC11_uc001aog.2_Missense_Mutation_p.R109W|DNAJC11_uc010nzu.1_Missense_Mutation_p.R19W	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	109					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTGCAGCCGCTCAAACTCC	0.522																0.030769	-24.797233	6.566374	4	126	KEEP	---	---	---	---	4	1	57	99	-1	capture	Missense_Mutation	SNP	6727822	6727822	DNAJC11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	4586	244
NBPF10	100132406	broad.mit.edu	37	1	145324371	145324371	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145324371T>C	uc001end.3	+	30	3826	c.3791T>C	c.(3790-3792)GTA>GCA	p.V1264A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_RNA	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1189											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTGCTGGAGGTAGTAGCGCCT	0.498																0.25	6.250387	6.70198	2	6	KEEP	---	---	---	---	5	3	10	17	-1	capture	Missense_Mutation	SNP	145324371	145324371	NBPF10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10100	244
TDRKH	11022	broad.mit.edu	37	1	151755433	151755433	+	Silent	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151755433C>T	uc009wnb.1	-	2	248	c.66G>A	c.(64-66)GGG>GGA	p.G22G	TDRKH_uc001eyy.2_5'UTR|TDRKH_uc001ezb.3_Silent_p.G22G|TDRKH_uc001ezc.3_Silent_p.G22G|TDRKH_uc001eza.3_Silent_p.G22G|TDRKH_uc001ezd.3_Silent_p.G22G|TDRKH_uc010pdn.1_5'UTR	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	22							RNA binding	p.G22V(1)		ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGGCTGGGATCCCAAGGCCCA	0.463																0.043831	-84.388645	52.807241	27	589	KEEP	---	---	---	---	16	17	353	403	-1	capture	Silent	SNP	151755433	151755433	TDRKH	1	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	15622	244
CRTC2	200186	broad.mit.edu	37	1	153921628	153921628	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153921628G>A	uc010ped.1	-	12	1707	c.1637C>T	c.(1636-1638)TCT>TTT	p.S546F	DENND4B_uc001fdd.1_5'Flank|CRTC2_uc001fde.3_RNA|CRTC2_uc001fdf.3_Missense_Mutation_p.S82F	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	546					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCGGTGGTAAGACTGTTGCCC	0.597																0.054299	-20.893979	25.389732	12	209	KEEP	---	---	---	---	6	6	104	133	-1	capture	Missense_Mutation	SNP	153921628	153921628	CRTC2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	3865	244
OR10J3	441911	broad.mit.edu	37	1	159283999	159283999	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159283999C>T	uc010piu.1	-	1	451	c.451G>A	c.(451-453)GGG>AGG	p.G151R		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					AGGCCAATCCCCAGTGATCCA	0.507																0.026549	-19.475589	8.520013	3	110	KEEP	---	---	---	---	3	0	53	63	-1	capture	Missense_Mutation	SNP	159283999	159283999	OR10J3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10815	244
POU2F1	5451	broad.mit.edu	37	1	167358969	167358969	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167358969C>G	uc001gec.2	+	10	1051	c.889C>G	c.(889-891)CAA>GAA	p.Q297E	POU2F1_uc010plg.1_RNA|POU2F1_uc001ged.2_Missense_Mutation_p.Q295E|POU2F1_uc001gee.2_Missense_Mutation_p.Q297E|POU2F1_uc010plh.1_Missense_Mutation_p.Q234E|POU2F1_uc001gef.2_Missense_Mutation_p.Q309E|POU2F1_uc001geg.2_Missense_Mutation_p.Q195E	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	297	POU-specific.				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						GACCTTCAAACAAAGACGAAT	0.438																0.128571	17.324198	26.731979	9	61	KEEP	---	---	---	---	3	6	36	37	-1	capture	Missense_Mutation	SNP	167358969	167358969	POU2F1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	12172	244
C1orf26	54823	broad.mit.edu	37	1	185143825	185143825	+	Missense_Mutation	SNP	G	C	C	rs146489629	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185143825G>C	uc001grg.3	+	5	660	c.546G>C	c.(544-546)AAG>AAC	p.K182N	C1orf26_uc001grh.3_Missense_Mutation_p.K182N	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	182											0						AGAGAGAGAAGATGAAAGAAC	0.353																0.071429	-0.384198	34.078078	13	169	KEEP	---	---	---	---	6	7	89	86	-1	capture	Missense_Mutation	SNP	185143825	185143825	C1orf26	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	2017	244
CFH	3075	broad.mit.edu	37	1	196694295	196694295	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196694295G>A	uc001gtj.3	+	12	1981	c.1741G>A	c.(1741-1743)GAT>AAT	p.D581N		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	581	Sushi 10.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						CTTAGTTCCTGATCGCAAGAA	0.343																0.364662	264.888045	269.179762	97	169	KEEP	---	---	---	---	56	47	89	100	-1	capture	Missense_Mutation	SNP	196694295	196694295	CFH	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3249	244
TLL2	7093	broad.mit.edu	37	10	98155658	98155658	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98155658C>T	uc001kml.1	-	12	1730	c.1504G>A	c.(1504-1506)GTG>ATG	p.V502M	TLL2_uc009xvf.1_Missense_Mutation_p.V480M	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	502	CUB 2.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTAAGTCCCACGTGAAACCCC	0.498														OREG0020398	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.378151	127.741781	129.293678	45	74	KEEP	---	---	---	---	24	25	35	49	-1	capture	Missense_Mutation	SNP	98155658	98155658	TLL2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15831	244
CHUK	1147	broad.mit.edu	37	10	101960490	101960490	+	Silent	SNP	A	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101960490A>G	uc001kqp.2	-	15	1672	c.1617T>C	c.(1615-1617)GCT>GCC	p.A539A		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	539					I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		CCATGATTTCAGCATGCAAAG	0.413	Ovarian(159;52 1904 10536 35305 37148)				415											0.018634	-34.223556	7.753718	3	158	KEEP	---	---	---	---	0	3	82	100	-1	capture	Silent	SNP	101960490	101960490	CHUK	10	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	3381	244
MYO7A	4647	broad.mit.edu	37	11	76901767	76901767	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76901767T>C	uc001oyb.2	+	30	4048	c.3776T>C	c.(3775-3777)ATG>ACG	p.M1259T	MYO7A_uc010rsm.1_Missense_Mutation_p.M1248T|MYO7A_uc001oyc.2_Missense_Mutation_p.M1259T|MYO7A_uc009yus.1_RNA|MYO7A_uc009yut.1_Missense_Mutation_p.M470T	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	1259	FERM 1.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						AAGCCAATCATGTTGCCCGTG	0.597																0.066667	0.842112	6.664669	2	28	KEEP	---	---	---	---	0	2	17	16	-1	capture	Missense_Mutation	SNP	76901767	76901767	MYO7A	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	9992	244
C12orf35	55196	broad.mit.edu	37	12	32135884	32135884	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32135884C>G	uc001rks.2	+	4	2409	c.1995C>G	c.(1993-1995)GAC>GAG	p.D665E		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	665										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			CTAAAAGTGACAGTAGCTGTT	0.423																0.01875	-34.021392	7.661733	3	157	KEEP	---	---	---	---	0	4	88	82	-1	capture	Missense_Mutation	SNP	32135884	32135884	C12orf35	12	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	1668	244
ABCD2	225	broad.mit.edu	37	12	40013182	40013182	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40013182C>G	uc001rmb.2	-	1	662	c.236G>C	c.(235-237)GGA>GCA	p.G79A		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	79	Interaction with PEX19.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						TGCATTCACTCCAGGCGAAGG	0.463																0.28481	304.118972	317.25223	90	226	KEEP	---	---	---	---	42	52	118	122	-1	capture	Missense_Mutation	SNP	40013182	40013182	ABCD2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	61	244
OR6C2	341416	broad.mit.edu	37	12	55846834	55846834	+	Silent	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55846834C>T	uc001sgz.1	+	1	837	c.837C>T	c.(835-837)GTC>GTT	p.V279V		NM_054105	NP_473446	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C,	279	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						CTACTTCTGTCGCACCCTTGT	0.408																0.311005	179.901707	186.548414	65	144	KEEP	---	---	---	---	37	35	70	92	-1	capture	Silent	SNP	55846834	55846834	OR6C2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11095	244
LEMD3	23592	broad.mit.edu	37	12	65637180	65637180	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:65637180A>G	uc001ssl.1	+	10	2324	c.2318A>G	c.(2317-2319)GAT>GGT	p.D773G	LEMD3_uc009zqo.1_Missense_Mutation_p.D772G	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	773	Interaction with SMAD1, SMAD2, SMAD3 and SMAD5.				negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		TTTCATTTAGATAGAAGAAAT	0.279																0.239316	174.790496	189.304214	56	178	KEEP	---	---	---	---	40	27	90	115	-1	capture	Missense_Mutation	SNP	65637180	65637180	LEMD3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8641	244
IKBIP	121457	broad.mit.edu	37	12	99007867	99007867	+	Silent	SNP	T	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:99007867T>C	uc001tfv.2	-	3	659	c.549A>G	c.(547-549)TCA>TCG	p.S183S	IKBIP_uc001tfw.2_3'UTR	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2	183					induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						TTACTAAACCTGAAATCCGTC	0.308																0.026144	-29.640152	8.369178	4	149	KEEP	---	---	---	---	1	3	70	89	-1	capture	Silent	SNP	99007867	99007867	IKBIP	12	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	7533	244
ACADS	35	broad.mit.edu	37	12	121176677	121176677	+	Missense_Mutation	SNP	C	T	T	rs140853839	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121176677C>T	uc001tza.3	+	8	1106	c.988C>T	c.(988-990)CGC>TGC	p.R330C	ACADS_uc010szl.1_Missense_Mutation_p.R326C|ACADS_uc001tzb.3_Missense_Mutation_p.R211C	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	330						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	GCTGACCTGGCGCGCTGCCAT	0.637																0.268199	172.663495	185.306581	70	191	KEEP	---	---	---	---	38	41	91	132	-1	capture	Missense_Mutation	SNP	121176677	121176677	ACADS	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	114	244
MMP14	4323	broad.mit.edu	37	14	23312494	23312494	+	Silent	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23312494C>T	uc001whc.2	+	5	951	c.717C>T	c.(715-717)CAC>CAT	p.H239H		NM_004995	NP_004986	P50281	MMP14_HUMAN	matrix metalloproteinase 14 preproprotein	239	Extracellular (Potential).	Zinc; catalytic.				extracellular matrix|integral to plasma membrane|melanosome	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		TGGCTGTGCACGAGCTGGGCC	0.602																0.478261	128.295578	128.333089	44	48	KEEP	---	---	---	---	24	26	16	43	-1	capture	Silent	SNP	23312494	23312494	MMP14	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9565	244
TMC7	79905	broad.mit.edu	37	16	19073157	19073157	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19073157A>T	uc002dfq.2	+	16	2294	c.2164A>T	c.(2164-2166)AGG>TGG	p.R722W	TMC7_uc010vap.1_Missense_Mutation_p.R612W	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	722	Cytoplasmic (Potential).					integral to membrane				skin(2)|ovary(1)	3						AAGGGACATGAGGAACTAACT	0.418																0.28169	105.538942	111.621012	40	102	KEEP	---	---	---	---	26	21	65	57	-1	capture	Missense_Mutation	SNP	19073157	19073157	TMC7	16	A	T	T	T	1	0	0	0	0	1	0	0	0	140	11	4	4	15875	244
ULK2	9706	broad.mit.edu	37	17	19699577	19699577	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19699577T>G	uc002gwm.3	-	19	2337	c.1828A>C	c.(1828-1830)ATC>CTC	p.I610L	ULK2_uc002gwn.2_Missense_Mutation_p.I610L	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	610					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GTTTTAGGGATTTTGAAAGGA	0.413					475											0.287356	161.984498	169.036814	50	124	KEEP	---	---	---	---	20	35	68	72	-1	capture	Missense_Mutation	SNP	19699577	19699577	ULK2	17	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	16858	244
CNTNAP1	8506	broad.mit.edu	37	17	40847561	40847561	+	Silent	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40847561G>A	uc002iay.2	+	19	3231	c.3015G>A	c.(3013-3015)CCG>CCA	p.P1005P	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	1005	Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TCTTTGAGCCGGGCACCTGGA	0.567																0.2125	161.534734	185.974529	68	252	KEEP	---	---	---	---	45	38	140	172	-1	capture	Silent	SNP	40847561	40847561	CNTNAP1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3611	244
TBCD	6904	broad.mit.edu	37	17	80842049	80842049	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80842049C>T	uc002kfz.2	+	15	1634	c.1504C>T	c.(1504-1506)CGA>TGA	p.R502*	TBCD_uc002kfx.1_Nonsense_Mutation_p.R485*|TBCD_uc002kfy.1_Nonsense_Mutation_p.R502*	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	502					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GGTGTTTGACCGAGACATAAA	0.443																0.243902	19.919447	22.390356	10	31	KEEP	---	---	---	---	8	4	22	15	-1	capture	Nonsense_Mutation	SNP	80842049	80842049	TBCD	17	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	15520	244
ZNF492	57615	broad.mit.edu	37	19	22846757	22846757	+	Nonsense_Mutation	SNP	G	T	T	rs112130958		TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22846757G>T	uc002nqw.3	+	4	530	c.286G>T	c.(286-288)GAA>TAA	p.E96*		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	96					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				GGTGCACAAAGAATGTTACAA	0.299																0.304348	35.228849	36.802245	14	32	KEEP	---	---	---	---	14	3	19	20	0.823529411765	capture	Nonsense_Mutation	SNP	22846757	22846757	ZNF492	19	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	17822	244
CEACAM5	1048	broad.mit.edu	37	19	42224052	42224052	+	Missense_Mutation	SNP	G	A	A	rs138799075	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42224052G>A	uc002ork.2	+	7	1817	c.1696G>A	c.(1696-1698)GCA>ACA	p.A566T	CEACAM5_uc002orj.1_Missense_Mutation_p.A565T|CEACAM5_uc002orl.2_Missense_Mutation_p.A566T	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	566	Ig-like 6.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AAGAAATGACGCAAGAGCCTA	0.522																0.30411	289.07433	301.580726	111	254	KEEP	---	---	---	---	54	66	122	154	-1	capture	Missense_Mutation	SNP	42224052	42224052	CEACAM5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3164	244
KLK11	11012	broad.mit.edu	37	19	51528895	51528895	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51528895A>G	uc002pvd.1	-	2	201	c.89T>C	c.(88-90)CTC>CCC	p.L30P	KLK11_uc002pvb.1_5'UTR|KLK11_uc002pve.1_5'UTR|KLK11_uc002pvf.1_5'UTR|KLK11_uc002pvc.3_5'UTR|KLK11_uc010eom.2_5'UTR	NM_144947	NP_659196	Q9UBX7	KLK11_HUMAN	kallikrein 11 isoform 2 precursor	30					proteolysis	extracellular region	serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CATGGCCTGGAGGGGGGAGGA	0.627																0.064516	0.625478	6.734005	2	29	KEEP	---	---	---	---	2	2	26	14	-1	capture	Missense_Mutation	SNP	51528895	51528895	KLK11	19	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	8319	244
LILRB2	10288	broad.mit.edu	37	19	54783717	54783717	+	Missense_Mutation	SNP	C	T	T	rs145209585	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54783717C>T	uc002qfb.2	-	4	550	c.284G>A	c.(283-285)CGA>CAA	p.R95Q	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.R95Q|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.R95Q|LILRB2_uc010yet.1_5'UTR|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	95	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACAGCCATATCGCCCTGTGTG	0.557																0.297101	319.238185	334.494419	123	291	KEEP	---	---	---	---	75	72	164	183	-1	capture	Missense_Mutation	SNP	54783717	54783717	LILRB2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8711	244
HEATR5B	54497	broad.mit.edu	37	2	37295836	37295836	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37295836T>C	uc002rpp.1	-	8	1261	c.1165A>G	c.(1165-1167)ATG>GTG	p.M389V		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	389							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				ACGGCTTTCATTTGTTTTCCA	0.353																0.230392	141.125323	154.709691	47	157	KEEP	---	---	---	---	18	34	104	92	-1	capture	Missense_Mutation	SNP	37295836	37295836	HEATR5B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	6959	244
KIF5C	3800	broad.mit.edu	37	2	149793797	149793797	+	Splice_Site	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149793797G>A	uc010zbu.1	+	4	660	c.292_splice	c.e4-1	p.G98_splice		NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TCGCCCACTAGGGGAAGCTGC	0.512																0.086957	2.531166	6.503589	2	21	KEEP	---	---	---	---	2	0	9	14	-1	capture	Splice_Site	SNP	149793797	149793797	KIF5C	2	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	8229	244
SIRPG	55423	broad.mit.edu	37	20	1629729	1629729	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1629729C>A	uc002wfm.1	-	2	464	c.399G>T	c.(397-399)AAG>AAT	p.K133N	SIRPG_uc002wfn.1_Missense_Mutation_p.K133N|SIRPG_uc002wfo.1_Missense_Mutation_p.K133N	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1	133	Extracellular (Potential).|Ig-like V-type.				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						CTGGTCCAGACTTAAACTCCA	0.493																0.241722	185.813562	204.196359	73	229	KEEP	---	---	---	---	37	45	99	160	0.548780487805	capture	Missense_Mutation	SNP	1629729	1629729	SIRPG	20	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	14229	244
SIGLEC1	6614	broad.mit.edu	37	20	3673751	3673751	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3673751T>C	uc002wja.2	-	14	3536	c.3536A>G	c.(3535-3537)TAC>TGC	p.Y1179C	SIGLEC1_uc002wjb.1_5'UTR|SIGLEC1_uc002wiz.3_Missense_Mutation_p.Y1179C	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1179	Ig-like C2-type 12.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CTCCAGGAGGTAGGTCAGGCG	0.682																0.032609	-15.537527	6.394691	3	89	KEEP	---	---	---	---	0	3	63	52	-1	capture	Missense_Mutation	SNP	3673751	3673751	SIGLEC1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	14198	244
NTSR1	4923	broad.mit.edu	37	20	61340984	61340984	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61340984G>A	uc002ydf.2	+	1	796	c.425G>A	c.(424-426)CGC>CAC	p.R142H		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	142	Extracellular (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			GCCGGCTGCCGCGGCTACTAC	0.677	GBM(37;400 780 6403 19663 35669)				297											0.164384	19.75286	27.564264	12	61	KEEP	---	---	---	---	20	26	54	71	-1	capture	Missense_Mutation	SNP	61340984	61340984	NTSR1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10617	244
TBX1	6899	broad.mit.edu	37	22	19748718	19748718	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19748718G>T	uc002zqb.2	+	3	454	c.325G>T	c.(325-327)GGT>TGT	p.G109C	TBX1_uc002zqa.1_Missense_Mutation_p.G109C|TBX1_uc002zqc.2_Missense_Mutation_p.G109C	NM_080646	NP_542377	O43435	TBX1_HUMAN	T-box 1 isoform A	109					embryonic viscerocranium morphogenesis|heart development|parathyroid gland development|pharyngeal system development|regulation of transcription from RNA polymerase II promoter|soft palate development|thymus development	nucleus	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)	2	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				GAAGGTGGCCGGTGTGAGCGT	0.592																0.06	-2.812111	7.306804	3	47	KEEP	---	---	---	---	1	2	19	31	0.333333333333	capture	Missense_Mutation	SNP	19748718	19748718	TBX1	22	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	15537	244
LZTR1	8216	broad.mit.edu	37	22	21341825	21341825	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21341825G>A	uc002zto.2	+	4	456	c.353G>A	c.(352-354)CGT>CAT	p.R118H	LZTR1_uc002ztn.2_Missense_Mutation_p.R77H|LZTR1_uc011ahy.1_Missense_Mutation_p.R99H|LZTR1_uc010gsr.1_5'UTR	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	118	Kelch 1.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCGGCCCCCCGTTACCACCAC	0.662				p.R118H(HEC1B-Tumor)|p.R118H(HEC1A-Tumor)	1299											0.4	139.704136	140.802085	50	75	KEEP	---	---	---	---	29	30	38	52	-1	capture	Missense_Mutation	SNP	21341825	21341825	LZTR1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9052	244
TFIP11	24144	broad.mit.edu	37	22	26890269	26890269	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26890269A>C	uc003acr.2	-	13	2368	c.1994T>G	c.(1993-1995)GTG>GGG	p.V665G	TFIP11_uc003acq.2_Missense_Mutation_p.V24G|TFIP11_uc003acs.2_Missense_Mutation_p.V665G|TFIP11_uc003act.2_Missense_Mutation_p.V665G|uc003acu.1_RNA	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	665					biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						AGAGCACAGCACCTGCCAAAA	0.463																0.1	-9.831918	7.239851	10	90	KEEP	---	---	---	---	13	19	52	61	-1	capture	Missense_Mutation	SNP	26890269	26890269	TFIP11	22	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	15692	244
NEFH	4744	broad.mit.edu	37	22	29886360	29886360	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29886360C>A	uc003afo.2	+	4	2802	c.2731C>A	c.(2731-2733)CCT>ACT	p.P911T	NEFH_uc003afp.2_5'UTR	NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa	917	Tail.				cell death|nervous system development	neurofilament					0						GAAGGAGGCTCCTGCCAAGGT	0.502																0.097561	4.168372	10.817753	4	37	KEEP	---	---	---	---	2	2	26	16	0.5	capture	Missense_Mutation	SNP	29886360	29886360	NEFH	22	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	10221	244
DEPDC5	9681	broad.mit.edu	37	22	32275577	32275577	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32275577G>A	uc003als.2	+	37	3921	c.3779G>A	c.(3778-3780)CGC>CAC	p.R1260H	DEPDC5_uc011als.1_Missense_Mutation_p.R1191H|DEPDC5_uc011alu.1_Missense_Mutation_p.R1291H|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.R1282H|DEPDC5_uc003alu.2_Missense_Mutation_p.R709H|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_Missense_Mutation_p.R558H|DEPDC5_uc011alx.1_Missense_Mutation_p.R108H|DEPDC5_uc010gwk.2_Missense_Mutation_p.R286H|DEPDC5_uc011aly.1_Missense_Mutation_p.R108H	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1260					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						AGCTTCCAGCGCAAGTGGTTT	0.607																0.027027	-37.091101	8.617502	5	180	KEEP	---	---	---	---	5	2	129	125	-1	capture	Missense_Mutation	SNP	32275577	32275577	DEPDC5	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4400	244
STXBP5L	9515	broad.mit.edu	37	3	120871386	120871386	+	Silent	SNP	A	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120871386A>G	uc003eec.3	+	8	872	c.732A>G	c.(730-732)GAA>GAG	p.E244E	STXBP5L_uc011bji.1_Silent_p.E244E	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	244	WD 4.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AAAGAGCAGAACTGAGAGTTT	0.333																0.296029	279.152191	289.452689	82	195	KEEP	---	---	---	---	46	50	105	123	-1	capture	Silent	SNP	120871386	120871386	STXBP5L	3	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	15247	244
C3orf59	151963	broad.mit.edu	37	3	192517421	192517421	+	Missense_Mutation	SNP	T	C	C	rs117555490	by1000genomes	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:192517421T>C	uc011bsp.1	-	2	551	c.230A>G	c.(229-231)GAC>GGC	p.D77G		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	77											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		AAGCTTTTGGTCCAGCTTTTG	0.443																0.026786	-20.662994	7.03277	3	109	KEEP	---	---	---	---	4	1	56	76	-1	capture	Missense_Mutation	SNP	192517421	192517421	C3orf59	3	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	2217	244
NKX3-2	579	broad.mit.edu	37	4	13546023	13546023	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13546023C>T	uc003gmx.2	-	1	92	c.16G>A	c.(16-18)GCC>ACC	p.A6T		NM_001189	NP_001180	P78367	NKX32_HUMAN	NK3 homeobox 2	6					negative regulation of chondrocyte differentiation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AAGGTGTTGGCGCCGCGCACA	0.557																0.15	5.111898	7.46073	3	17	KEEP	---	---	---	---	0	4	12	11	-1	capture	Missense_Mutation	SNP	13546023	13546023	NKX3-2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10363	244
GEMIN5	25929	broad.mit.edu	37	5	154275813	154275813	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154275813G>C	uc003lvx.3	-	24	3519	c.3436C>G	c.(3436-3438)CAC>GAC	p.H1146D	GEMIN5_uc011ddk.1_Missense_Mutation_p.H1145D	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	1146					ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTCCAAGTGTGGTAAGAGGAG	0.547																0.25625	107.093816	115.718296	41	119	KEEP	---	---	---	---	18	24	40	90	-1	capture	Missense_Mutation	SNP	154275813	154275813	GEMIN5	5	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	6271	244
AGXT2L2	85007	broad.mit.edu	37	5	177649920	177649920	+	Missense_Mutation	SNP	C	T	T	rs142142484	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177649920C>T	uc003miz.2	-	7	886	c.634G>A	c.(634-636)GCT>ACT	p.A212T	AGXT2L2_uc003miy.2_5'UTR|AGXT2L2_uc003mjc.2_Missense_Mutation_p.A171T|AGXT2L2_uc003mja.2_RNA|AGXT2L2_uc003mjb.2_5'UTR|AGXT2L2_uc003mjd.1_Missense_Mutation_p.A70T	NM_153373	NP_699204	Q8IUZ5	AT2L2_HUMAN	alanine-glyoxylate aminotransferase 2-like 2	212						mitochondrion	pyridoxal phosphate binding|transaminase activity			pancreas(1)	1	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.181)|all cancers(165;0.235)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	AGAGACTCAGCGAAGAAGGCT	0.587																0.278351	71.302443	75.578267	27	70	KEEP	---	---	---	---	9	22	43	38	-1	capture	Missense_Mutation	SNP	177649920	177649920	AGXT2L2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	407	244
BMP6	654	broad.mit.edu	37	6	7727630	7727630	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7727630G>A	uc003mxu.3	+	1	620	c.442G>A	c.(442-444)GAC>AAC	p.D148N		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	148					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					CGCCGACAACGACGAGGACGG	0.682																0.107143	2.903815	7.192192	3	25	KEEP	---	---	---	---	0	3	16	14	-1	capture	Missense_Mutation	SNP	7727630	7727630	BMP6	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1452	244
NFKBIE	4794	broad.mit.edu	37	6	44229437	44229437	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44229437C>A	uc003oxe.1	-	3	1059	c.1034G>T	c.(1033-1035)TGC>TTC	p.C345F		NM_004556	NP_004547	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene	345	ANK 3.				cytoplasmic sequestering of transcription factor		protein binding			breast(2)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCCAGCAGGCAGCGGGCACA	0.632																0.05	-5.82397	7.061753	3	57	KEEP	---	---	---	---	2	1	32	36	0.333333333333	capture	Missense_Mutation	SNP	44229437	44229437	NFKBIE	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	10287	244
COL19A1	1310	broad.mit.edu	37	6	70589454	70589454	+	Translation_Start_Site	SNP	G	T	T			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70589454G>T	uc003pfc.1	+	2	112	c.-5G>T	c.(-7--3)AAGGC>AATGC			NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ATGGTTTCAAGGCACAATGAG	0.418																0.036585	-12.651924	6.45074	3	79	KEEP	---	---	---	---	1	4	45	42	0.2	capture	Translation_Start_Site	SNP	70589454	70589454	COL19A1	6	G	T	T	T	1	0	0	0	0	0	0	0	0	443	35	4	4	3641	244
RFPL4B	442247	broad.mit.edu	37	6	112671523	112671523	+	Missense_Mutation	SNP	C	T	T	rs143103700	byFrequency	TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:112671523C>T	uc003pvx.1	+	3	925	c.613C>T	c.(613-615)CGC>TGC	p.R205C		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	205	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		CCCTCGCCTTCGCCGTGTGGG	0.448																0.408046	213.793959	215.07884	71	103	KEEP	---	---	---	---	29	48	53	59	-1	capture	Missense_Mutation	SNP	112671523	112671523	RFPL4B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13151	244
DSE	29940	broad.mit.edu	37	6	116757341	116757341	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116757341C>A	uc003pws.2	+	6	1904	c.1710C>A	c.(1708-1710)GAC>GAA	p.D570E	DSE_uc011ebg.1_Missense_Mutation_p.D589E|DSE_uc003pwt.2_Missense_Mutation_p.D570E|DSE_uc003pwu.2_Missense_Mutation_p.D237E	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	570					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TCCTTGTAGACCAAATACACC	0.502																0.026549	-21.375865	6.624511	3	110	KEEP	---	---	---	---	2	1	59	62	0.333333333333	capture	Missense_Mutation	SNP	116757341	116757341	DSE	6	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	4729	244
CLIP2	7461	broad.mit.edu	37	7	73771699	73771699	+	Silent	SNP	G	A	A			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73771699G>A	uc003uam.2	+	6	1434	c.1107G>A	c.(1105-1107)GAG>GAA	p.E369E	CLIP2_uc003uan.2_Silent_p.E369E	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	369	Potential.					microtubule associated complex				skin(3)	3						AGCACATTGAGCAGCTGCTGG	0.617																0.040541	-10.143724	6.689378	3	71	KEEP	---	---	---	---	1	2	34	43	-1	capture	Silent	SNP	73771699	73771699	CLIP2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	3498	244
PRUNE2	158471	broad.mit.edu	37	9	79321219	79321219	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79321219C>G	uc010mpk.2	-	8	6095	c.5971G>C	c.(5971-5973)GAA>CAA	p.E1991Q	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	1991					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TCTTGACCTTCATTAGTTGAA	0.423																0.021127	-28.910013	7.518338	3	139	KEEP	---	---	---	---	0	3	60	81	-1	capture	Missense_Mutation	SNP	79321219	79321219	PRUNE2	9	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	12536	244
DAPK1	1612	broad.mit.edu	37	9	90266587	90266587	+	Missense_Mutation	SNP	C	T	T	rs36214022		TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90266587C>T	uc004apc.2	+	17	1910	c.1772C>T	c.(1771-1773)CCT>CTT	p.P591L	DAPK1_uc004apd.2_Missense_Mutation_p.P591L|DAPK1_uc011ltg.1_Missense_Mutation_p.P591L|DAPK1_uc011lth.1_Missense_Mutation_p.P328L|DAPK1_uc004apf.1_Missense_Mutation_p.P145L	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	591	ANK 7.		P -> L.		apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						GGCAACATGCCTATCGTGGTG	0.498					862							Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				0.034091	-13.956625	6.85157	3	85	KEEP	---	---	---	---	4	0	47	50	-1	capture	Missense_Mutation	SNP	90266587	90266587	DAPK1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4194	244
LPAR3	23566	broad.mit.edu	37	1	85331664	85331665	+	Frame_Shift_Ins	INS	-	A	A	rs76299065		TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85331664_85331665insA	uc001dkl.2	-	1	178_179	c.139_140insT	c.(139-141)TCTfs	p.S47fs	LPAR3_uc009wcj.1_Frame_Shift_Ins_p.S47fs	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	47	Helical; Name=1; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						CAGAGAATTAGAAAAAAAAATA	0.401																0.02			7	335		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	85331664	85331665	LPAR3	1	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	8822	244
EIF5B	9669	broad.mit.edu	37	2	99977775	99977777	+	In_Frame_Del	DEL	TGA	-	-			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99977775_99977777delTGA	uc002tab.2	+	4	595_597	c.411_413delTGA	c.(409-414)AGTGAT>AGT	p.D142del		NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	142	Poly-Asp.				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3						ACTCTGGGAGTGATGATGATGAT	0.345	Colon(162;2388 2567 2705 3444)															0.02			8	373		---	---	---	---						capture_indel	In_Frame_Del	DEL	99977775	99977777	EIF5B	2	TGA	-	-	-	1	0	1	0	1	0	0	0	0	764	59	5	5	4999	244
PEX5L	51555	broad.mit.edu	37	3	179616029	179616029	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-4209-01	TCGA-32-4209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:179616029delT	uc003fki.1	-	3	229	c.99delA	c.(97-99)AAAfs	p.K33fs	PEX5L_uc011bqd.1_5'UTR|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_5'UTR|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Frame_Shift_Del_p.K31fs|PEX5L_uc011bqg.1_Frame_Shift_Del_p.K9fs|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	33					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CCCTAGAGCCTTTTCCCTATA	0.413					648											0.02			7	349		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	179616029	179616029	PEX5L	3	T	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	11652	244
