Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AADACL4	343066	broad.mit.edu	37	1	12726232	12726232	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12726232A>G	uc001auf.2	+	4	710	c.710A>G	c.(709-711)CAG>CGG	p.Q237R		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	237	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		TCCTTTCAGCAGAACCAAAAT	0.517																0.340824	271.146465	277.124057	91	176	KEEP	---	---	---	---	48	58	100	108	-1	capture	Missense_Mutation	SNP	12726232	12726232	AADACL4	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13	273
C1orf173	127254	broad.mit.edu	37	1	75038917	75038917	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75038917G>C	uc001dgg.2	-	14	2696	c.2477C>G	c.(2476-2478)ACA>AGA	p.T826R		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	826	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CCTTTTTTCTGTAAACTCTTC	0.582																0.429907	323.070705	324.005167	92	122	KEEP	---	---	---	---	54	50	73	68	-1	capture	Missense_Mutation	SNP	75038917	75038917	C1orf173	1	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	1996	273
MAGI3	260425	broad.mit.edu	37	1	114215328	114215328	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114215328G>A	uc001edk.2	+	18	3191	c.3010G>A	c.(3010-3012)GCA>ACA	p.A1004T	MAGI3_uc001edh.3_Missense_Mutation_p.A1029T|MAGI3_uc001edi.3_Missense_Mutation_p.A1004T|MAGI3_uc010owm.1_Missense_Mutation_p.A1029T|MAGI3_uc001edj.2_Missense_Mutation_p.A725T	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	1029					apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCTGACACCGCAGTAATTTC	0.458																0.016563	-115.154422	12.558531	8	475	KEEP	---	---	---	---	7	2	262	292	-1	capture	Missense_Mutation	SNP	114215328	114215328	MAGI3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9106	273
MTMR11	10903	broad.mit.edu	37	1	149906114	149906114	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149906114G>A	uc001etl.3	-	7	904	c.653C>T	c.(652-654)ACG>ATG	p.T218M	MTMR11_uc001etm.1_Missense_Mutation_p.T146M|MTMR11_uc010pbm.1_Missense_Mutation_p.T190M|MTMR11_uc010pbn.1_Missense_Mutation_p.T60M	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	218	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CTCGTTGACCGTGCTGACCCT	0.572					238											0.441667	151.355447	151.711229	53	67	KEEP	---	---	---	---	28	29	44	36	-1	capture	Missense_Mutation	SNP	149906114	149906114	MTMR11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9850	273
PLXNA2	5362	broad.mit.edu	37	1	208391207	208391207	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:208391207G>T	uc001hgz.2	-	2	819	c.61C>A	c.(61-63)CTC>ATC	p.L21I	PLXNA2_uc001hha.3_Missense_Mutation_p.L75I	NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	21					axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ACCACTGAGAGCAGGACCACA	0.657																0.468354	112.570521	112.639092	37	42	KEEP	---	---	---	---	25	16	28	15	0.609756097561	capture	Missense_Mutation	SNP	208391207	208391207	PLXNA2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	12023	273
C10orf12	26148	broad.mit.edu	37	10	98743678	98743678	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98743678G>T	uc001kmv.2	+	1	2638	c.2531G>T	c.(2530-2532)AGG>ATG	p.R844M		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	844										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AGCAAGAAAAGGTCACGGAAA	0.393																0.105263	4.003795	12.837429	6	51	KEEP	---	---	---	---	3	3	29	29	0.5	capture	Missense_Mutation	SNP	98743678	98743678	C10orf12	10	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	1577	273
CTBP2	1488	broad.mit.edu	37	10	126727602	126727602	+	Nonsense_Mutation	SNP	T	A	A	rs76555439		TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:126727602T>A	uc009yak.2	-	3	309	c.22A>T	c.(22-24)AAA>TAA	p.K8*	CTBP2_uc009yal.2_Nonsense_Mutation_p.K8*|CTBP2_uc001lif.3_Nonsense_Mutation_p.K8*|CTBP2_uc001lih.3_Nonsense_Mutation_p.K8*	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1	8					negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CTCTTGACTTTGTGCTTATCC	0.453				p.K8*(CAL62-Tumor)|p.K8*(8MGBA-Tumor)|p.K8*(786O-Tumor)|p.K8*(BDCM-Tumor)	463											0.054054	-7.337149	8.158142	4	70	KEEP	---	---	---	---	2	6	35	45	-1	capture	Nonsense_Mutation	SNP	126727602	126727602	CTBP2	10	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	3962	273
CTBP2	1488	broad.mit.edu	37	10	126727604	126727604	+	Missense_Mutation	SNP	T	C	C	rs3208567		TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:126727604T>C	uc009yak.2	-	3	307	c.20A>G	c.(19-21)CAC>CGC	p.H7R	CTBP2_uc009yal.2_Missense_Mutation_p.H7R|CTBP2_uc001lif.3_Missense_Mutation_p.H7R|CTBP2_uc001lih.3_Missense_Mutation_p.H7R	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1	7					negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CTTGACTTTGTGCTTATCCAC	0.453					463											0.054795	-5.661049	9.578152	4	69	KEEP	---	---	---	---	2	6	33	45	-1	capture	Missense_Mutation	SNP	126727604	126727604	CTBP2	10	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3962	273
AMPD3	272	broad.mit.edu	37	11	10514962	10514962	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10514962A>T	uc001mio.1	+	7	1341	c.1006A>T	c.(1006-1008)ACA>TCA	p.T336S	AMPD3_uc010rbz.1_Missense_Mutation_p.T177S|AMPD3_uc001min.1_Missense_Mutation_p.T345S|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Missense_Mutation_p.T343S|AMPD3_uc009yfy.2_Missense_Mutation_p.T336S	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	336					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CATCAAGCACACATACCAGAC	0.612																0.044118	-26.866918	18.488007	9	195	KEEP	---	---	---	---	3	8	108	104	-1	capture	Missense_Mutation	SNP	10514962	10514962	AMPD3	11	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	587	273
VWA5A	4013	broad.mit.edu	37	11	124007318	124007318	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124007318C>G	uc001pzu.2	+	14	1771	c.1562C>G	c.(1561-1563)ACA>AGA	p.T521R	VWA5A_uc001pzt.2_Missense_Mutation_p.T521R	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	521										upper_aerodigestive_tract(1)|ovary(1)	2						CTCAAATATACACTCCAGGGC	0.378																0.013453	-53.892748	6.327455	3	220	KEEP	---	---	---	---	2	1	129	132	-1	capture	Missense_Mutation	SNP	124007318	124007318	VWA5A	11	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	17124	273
DYRK4	8798	broad.mit.edu	37	12	4721722	4721722	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4721722C>T	uc001qmx.2	+	12	1319	c.1159C>T	c.(1159-1161)CTT>TTT	p.L387F	DYRK4_uc009zeh.1_Missense_Mutation_p.L502F|DYRK4_uc001qmy.1_Missense_Mutation_p.L387F|DYRK4_uc001qmz.1_Missense_Mutation_p.L101F|DYRK4_uc001qna.1_Missense_Mutation_p.L24F|DYRK4_uc010ser.1_Missense_Mutation_p.L24F	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	387	Protein kinase.					Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			GGAACCTTCTCTTCGCATGAC	0.448					294											0.040462	-24.935015	14.42079	7	166	KEEP	---	---	---	---	3	4	102	81	-1	capture	Missense_Mutation	SNP	4721722	4721722	DYRK4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4813	273
ABCC9	10060	broad.mit.edu	37	12	21997717	21997717	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21997717T>C	uc001rfi.1	-	25	3249	c.3229A>G	c.(3229-3231)ATC>GTC	p.I1077V	ABCC9_uc001rfh.2_Missense_Mutation_p.I1077V|ABCC9_uc001rfj.1_Missense_Mutation_p.I1041V	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1077	ABC transmembrane type-1 2.|Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GGTCCAAGGATTATCTTATTG	0.368																0.065217	-5.352277	30.766435	12	172	KEEP	---	---	---	---	5	8	113	102	-1	capture	Missense_Mutation	SNP	21997717	21997717	ABCC9	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	59	273
HOXC11	3227	broad.mit.edu	37	12	54367099	54367099	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54367099G>A	uc001sem.2	+	1	190	c.74G>A	c.(73-75)CGA>CAA	p.R25Q		NM_014212	NP_055027	O43248	HXC11_HUMAN	homeobox C11	25					endoderm development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTCGGCGAGCGAGGGAGCTGC	0.617					53	T	NUP98	AML								0.051852	-17.084862	11.626272	7	128	KEEP	---	---	---	---	4	3	61	73	-1	capture	Missense_Mutation	SNP	54367099	54367099	HOXC11	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7235	273
TMTC2	160335	broad.mit.edu	37	12	83289748	83289748	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:83289748G>A	uc001szt.2	+	3	1238	c.806G>A	c.(805-807)CGC>CAC	p.R269H	TMTC2_uc001szr.1_Missense_Mutation_p.R269H|TMTC2_uc001szs.1_Missense_Mutation_p.R269H|TMTC2_uc010suk.1_Missense_Mutation_p.R24H	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	269						endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						CTCCTCACCCGCACTCTCACC	0.527																0.01992	-57.168262	7.658067	5	246	KEEP	---	---	---	---	4	1	147	117	-1	capture	Missense_Mutation	SNP	83289748	83289748	TMTC2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16144	273
HNF1A	6927	broad.mit.edu	37	12	121437175	121437175	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121437175C>T	uc001tzg.2	+	8	1629	c.1606C>T	c.(1606-1608)CTC>TTC	p.L536F	HNF1A_uc010szn.1_Missense_Mutation_p.L536F	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	536					glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCTGGCCAGCCTCACGCCCAC	0.672					239							Hepatic_Adenoma_Familial_Clustering_of				0.429379	242.868622	243.639123	76	101	KEEP	---	---	---	---	40	46	54	74	-1	capture	Missense_Mutation	SNP	121437175	121437175	HNF1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	7176	273
DZIP1	22873	broad.mit.edu	37	13	96234520	96234520	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:96234520C>T	uc001vmk.2	-	23	3424	c.2572G>A	c.(2572-2574)GTG>ATG	p.V858M	DZIP1_uc010afn.2_5'Flank|DZIP1_uc001vmi.2_Missense_Mutation_p.V106M|DZIP1_uc001vmj.2_Missense_Mutation_p.V334M|DZIP1_uc001vml.2_Missense_Mutation_p.V839M|DZIP1_uc001vmm.2_RNA	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	858					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CAATCAGTCACAGTTACTAAG	0.408																0.038835	-16.095542	7.5696	4	99	KEEP	---	---	---	---	4	1	55	60	-1	capture	Missense_Mutation	SNP	96234520	96234520	DZIP1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	4818	273
OR4K5	79317	broad.mit.edu	37	14	20388930	20388930	+	Silent	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20388930G>T	uc010tkw.1	+	1	165	c.165G>T	c.(163-165)CTG>CTT	p.L55L		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATACCAGCCTGCACTCCCCTA	0.408																0.021008	-159.860735	23.539605	15	699	KEEP	---	---	---	---	10	6	389	375	0.625	capture	Silent	SNP	20388930	20388930	OR4K5	14	G	T	T	T	1	0	0	0	0	0	0	0	1	587	46	4	4	10977	273
ZFYVE26	23503	broad.mit.edu	37	14	68274502	68274502	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:68274502G>A	uc001xka.2	-	5	638	c.499C>T	c.(499-501)CCA>TCA	p.P167S	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.P167S|ZFYVE26_uc010tta.1_Missense_Mutation_p.P167S	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	167					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCCTGTGCTGGCTGGGGAGAC	0.607																0.048611	-35.296836	27.08948	14	274	KEEP	---	---	---	---	7	8	133	190	-1	capture	Missense_Mutation	SNP	68274502	68274502	ZFYVE26	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17548	273
PSEN1	5663	broad.mit.edu	37	14	73678621	73678621	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73678621G>C	uc001xnr.2	+	10	1384	c.1100G>C	c.(1099-1101)AGT>ACT	p.S367T	PSEN1_uc001xnv.2_Missense_Mutation_p.S363T|PSEN1_uc010ark.2_Missense_Mutation_p.S363T|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	367	Required for interaction with CTNNB1.|Cytoplasmic (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		CTTTCCAGCAGTATCCTCGCT	0.493					189											0.033333	-14.258314	7.121077	3	87	KEEP	---	---	---	---	3	0	52	50	-1	capture	Missense_Mutation	SNP	73678621	73678621	PSEN1	14	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	12545	273
NOX5	79400	broad.mit.edu	37	15	69328195	69328195	+	Silent	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:69328195G>A	uc002ars.1	+	7	1127	c.1107G>A	c.(1105-1107)CCG>CCA	p.P369P	NOX5_uc002arp.1_Silent_p.P351P|NOX5_uc002arq.1_Silent_p.P323P|NOX5_uc010bid.1_Silent_p.P334P|NOX5_uc002arr.1_Silent_p.P341P|NOX5_uc010bie.1_Silent_p.P169P|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	369	Ferric oxidoreductase.|Helical; (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						CGGCCTCCCCGACAGGTGTCG	0.632																0.242236	87.11501	96.905892	39	122	KEEP	---	---	---	---	24	27	68	78	-1	capture	Silent	SNP	69328195	69328195	NOX5	15	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10466	273
OTOA	146183	broad.mit.edu	37	16	21726417	21726417	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21726417G>A	uc002djh.2	+	13	1433	c.1432G>A	c.(1432-1434)GTC>ATC	p.V478I	uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.V399I|OTOA_uc002dji.2_Missense_Mutation_p.V154I|OTOA_uc010vbk.1_Missense_Mutation_p.V126I	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	492					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		GAGAAGTGCCGTCTCCCAGTA	0.577																0.460705	500.970219	501.469269	170	199	KEEP	---	---	---	---	86	109	96	129	-1	capture	Missense_Mutation	SNP	21726417	21726417	OTOA	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11206	273
HERPUD1	9709	broad.mit.edu	37	16	56970643	56970643	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56970643G>C	uc002eke.1	+	4	754	c.345G>C	c.(343-345)CAG>CAC	p.Q115H	HERPUD1_uc010vhj.1_Missense_Mutation_p.Q176H|HERPUD1_uc002ekf.1_Missense_Mutation_p.Q114H|HERPUD1_uc002ekg.1_Missense_Mutation_p.Q90H|HERPUD1_uc010cco.1_Missense_Mutation_p.Q176H|HERPUD1_uc010ccp.1_Missense_Mutation_p.Q175H|HERPUD1_uc002ekh.1_5'UTR	NM_014685	NP_055500	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum	115	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	protein binding				0						ATCGGGGACAGTATCCTGAGG	0.448						T	ERG	prostate								0.429379	269.678689	270.447461	76	101	KEEP	---	---	---	---	34	46	54	56	-1	capture	Missense_Mutation	SNP	56970643	56970643	HERPUD1	16	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	6989	273
ANKFY1	51479	broad.mit.edu	37	17	4084568	4084568	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4084568C>T	uc002fxq.1	-	16	2259	c.2221G>A	c.(2221-2223)GCC>ACC	p.A741T	ANKFY1_uc002fxn.2_Missense_Mutation_p.A783T|ANKFY1_uc002fxo.2_Missense_Mutation_p.A742T|ANKFY1_uc002fxp.2_Missense_Mutation_p.A740T|ANKFY1_uc010ckp.2_Missense_Mutation_p.A683T	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	741	ANK 12.					endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						AGAAAGCAGGCGGTGGGCTCG	0.522																0.305556	86.333782	89.976449	33	75	KEEP	---	---	---	---	18	19	43	37	-1	capture	Missense_Mutation	SNP	4084568	4084568	ANKFY1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	623	273
USP6	9098	broad.mit.edu	37	17	5037255	5037255	+	Missense_Mutation	SNP	G	A	A	rs138849740	byFrequency	TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5037255G>A	uc002gau.1	+	15	2688	c.458G>A	c.(457-459)CGG>CAG	p.R153Q	USP6_uc002gav.1_Missense_Mutation_p.R153Q|USP6_uc010ckz.1_5'UTR|USP6_uc002gaw.2_Missense_Mutation_p.R214Q|uc002gay.1_5'Flank|uc002gba.2_5'Flank|uc002gbb.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	153	Rab-GAP TBC.				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						ACGACTCTCCGGAACCATGTC	0.562					464	T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								0.37931	173.989307	175.842607	55	90	KEEP	---	---	---	---	30	30	48	55	-1	capture	Missense_Mutation	SNP	5037255	5037255	USP6	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16968	273
MYH13	8735	broad.mit.edu	37	17	10250061	10250061	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10250061C>T	uc002gmk.1	-	13	1289	c.1199G>A	c.(1198-1200)GGC>GAC	p.G400D	MYH13_uc010vvf.1_Missense_Mutation_p.G75D	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	400	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						ACAGCACAGGCCCTTCAGCAT	0.458																0.397059	78.223714	78.849794	27	41	KEEP	---	---	---	---	19	13	18	30	-1	capture	Missense_Mutation	SNP	10250061	10250061	MYH13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9942	273
KRTAP4-9	100132386	broad.mit.edu	37	17	39261809	39261809	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39261809T>C	uc010wfp.1	+	1	169	c.169T>C	c.(169-171)TCT>CCT	p.S57P		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	57	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].|7.					keratin filament					0						GTGCTGCCAGTCTGTGTGCTG	0.652																0.075472	-3.053897	6.859883	4	49	KEEP	---	---	---	---	1	3	38	34	-1	capture	Missense_Mutation	SNP	39261809	39261809	KRTAP4-9	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	8477	273
KIF2B	84643	broad.mit.edu	37	17	51900577	51900577	+	Silent	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900577G>T	uc002iua.2	+	1	339	c.183G>T	c.(181-183)GTG>GTT	p.V61V		NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	61					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TAGAGTGGGTGGAGAAAGCAG	0.557																0.066298	-12.944194	22.425017	12	169	KEEP	---	---	---	---	10	5	91	94	0.666666666667	capture	Silent	SNP	51900577	51900577	KIF2B	17	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8220	273
KIF2B	84643	broad.mit.edu	37	17	51900579	51900579	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900579A>G	uc002iua.2	+	1	341	c.185A>G	c.(184-186)GAG>GGG	p.E62G		NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	62					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						GAGTGGGTGGAGAAAGCAGTC	0.552																0.066667	-4.252863	30.694193	12	168	KEEP	---	---	---	---	9	7	94	92	-1	capture	Missense_Mutation	SNP	51900579	51900579	KIF2B	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	8220	273
GRIN2C	2905	broad.mit.edu	37	17	72845978	72845978	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72845978G>A	uc002jlt.1	-	7	1742	c.1586C>T	c.(1585-1587)ACG>ATG	p.T529M	GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Missense_Mutation_p.T529M	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	529	Extracellular (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	ACTGATGCCCGTCTCCACAAA	0.627																0.045802	-16.755646	12.091729	6	125	KEEP	---	---	---	---	4	2	69	60	-1	capture	Missense_Mutation	SNP	72845978	72845978	GRIN2C	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6714	273
MC5R	4161	broad.mit.edu	37	18	13826125	13826125	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13826125A>G	uc010xaf.1	+	1	361	c.361A>G	c.(361-363)ATG>GTG	p.M121V		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	121	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						GTTTGACTCCATGATCTGCAT	0.517																0.025974	-31.735259	6.570958	4	150	KEEP	---	---	---	---	4	0	76	88	-1	capture	Missense_Mutation	SNP	13826125	13826125	MC5R	18	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9280	273
KIAA0427	9811	broad.mit.edu	37	18	46284644	46284644	+	Silent	SNP	A	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:46284644A>C	uc002ldc.2	+	8	1224	c.939A>C	c.(937-939)CCA>CCC	p.P313P	KIAA0427_uc002ldd.2_Silent_p.P313P|KIAA0427_uc002lde.3_5'Flank	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	313					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GGCTGCCCCCACAGCAGTCAG	0.632																0.097087	-10.946742	6.707763	10	93	KEEP	---	---	---	---	13	27	61	82	-1	capture	Silent	SNP	46284644	46284644	KIAA0427	18	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8098	273
MAN2B1	4125	broad.mit.edu	37	19	12769127	12769127	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12769127C>T	uc002mub.2	-	9	1217	c.1141G>A	c.(1141-1143)GCG>ACG	p.A381T	MAN2B1_uc010dyv.1_Missense_Mutation_p.A380T	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	381					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						GGGCCATCCGCGTAAGGGAAG	0.617																0.110236	9.384837	28.471032	14	113	KEEP	---	---	---	---	7	9	58	78	-1	capture	Missense_Mutation	SNP	12769127	12769127	MAN2B1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9130	273
NLRP5	126206	broad.mit.edu	37	19	56565093	56565093	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56565093C>T	uc002qmj.2	+	13	3218	c.3218C>T	c.(3217-3219)ACG>ATG	p.T1073M	NLRP5_uc002qmi.2_Missense_Mutation_p.T1054M	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	1073	LRR 12.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTGGATCTCACGGACAATGCC	0.587																0.358696	93.446958	95.065592	33	59	KEEP	---	---	---	---	14	20	38	30	-1	capture	Missense_Mutation	SNP	56565093	56565093	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10387	273
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393																0.238095	12.863664	14.179936	5	16	KEEP	---	---	---	---	1	4	7	9	0.2	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	273
C2orf39	92749	broad.mit.edu	37	2	26647184	26647184	+	Silent	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26647184C>T	uc002rhg.2	+	4	476	c.402C>T	c.(400-402)TTC>TTT	p.F134F	C2orf39_uc010eym.1_Intron	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	134	Potential.										0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGACAAATTCGATGAAATCA	0.498																0.114695	38.102096	78.919081	32	247	KEEP	---	---	---	---	17	17	108	160	-1	capture	Silent	SNP	26647184	26647184	C2orf39	2	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	2144	273
SRBD1	55133	broad.mit.edu	37	2	45801787	45801787	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:45801787G>A	uc002rus.2	-	8	1224	c.1148C>T	c.(1147-1149)ACG>ATG	p.T383M		NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	383					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			GAAGTCAAGCGTGTCTTTGTC	0.393																0.36747	178.732469	181.295221	61	105	KEEP	---	---	---	---	35	35	67	49	-1	capture	Missense_Mutation	SNP	45801787	45801787	SRBD1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15025	273
GALNT5	11227	broad.mit.edu	37	2	158165186	158165186	+	Silent	SNP	A	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158165186A>G	uc002tzg.2	+	9	2883	c.2628A>G	c.(2626-2628)AGA>AGG	p.R876R	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	876	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						GTGATAACAGAAACAAAGGGC	0.388																0.438679	329.253349	329.94666	93	119	KEEP	---	---	---	---	57	51	66	79	-1	capture	Silent	SNP	158165186	158165186	GALNT5	2	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	6156	273
LY75	4065	broad.mit.edu	37	2	160755282	160755282	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160755282C>A	uc002ubc.3	-	2	452	c.383G>T	c.(382-384)GGA>GTA	p.G128V	LY75_uc002ubb.3_Missense_Mutation_p.G128V|LY75_uc010fos.2_Missense_Mutation_p.G128V|LY75_uc010fot.1_Missense_Mutation_p.G128V	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	128	Extracellular (Potential).|Ricin B-type lectin.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TGTGCCATGTCCATCCTTCAG	0.522																0.045455	-12.173968	7.250958	4	84	KEEP	---	---	---	---	3	2	45	44	0.4	capture	Missense_Mutation	SNP	160755282	160755282	LY75	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	9014	273
VIL1	7429	broad.mit.edu	37	2	219294359	219294359	+	Silent	SNP	C	T	T	rs148795202		TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219294359C>T	uc002via.2	+	8	875	c.810C>T	c.(808-810)GTC>GTT	p.V270V	VIL1_uc010zke.1_5'UTR|VIL1_uc002vib.2_Silent_p.V270V|VIL1_uc002vic.1_Silent_p.V270V	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	270	Core.|Gelsolin-like 3.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAGGGAAGTCGCCACACGGC	0.622																0.096386	8.616998	35.694112	16	150	KEEP	---	---	---	---	5	14	94	92	-1	capture	Silent	SNP	219294359	219294359	VIL1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	17046	273
SPEG	10290	broad.mit.edu	37	2	220344732	220344732	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220344732C>T	uc010fwg.2	+	25	5212	c.5212C>T	c.(5212-5214)CGG>TGG	p.R1738W		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1738	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GCAGCAGGTGCGGATCTGTGA	0.572					482											0.1125	8.6326	20.482603	9	71	KEEP	---	---	---	---	9	3	54	50	-1	capture	Missense_Mutation	SNP	220344732	220344732	SPEG	2	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	14928	273
D2HGDH	728294	broad.mit.edu	37	2	242681957	242681957	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242681957T>C	uc002wce.1	+	4	631	c.458T>C	c.(457-459)ATG>ACG	p.M153T	D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Missense_Mutation_p.M19T|D2HGDH_uc002wcg.1_RNA	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	153	FAD-binding PCMH-type.				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		ACTGCCCGCATGAACCGGGTC	0.642																0.072727	0.020007	20.670084	8	102	KEEP	---	---	---	---	4	4	57	61	-1	capture	Missense_Mutation	SNP	242681957	242681957	D2HGDH	2	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	4173	273
TNNC2	7125	broad.mit.edu	37	20	44453472	44453472	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44453472G>A	uc002xpr.2	-	2	71	c.5C>T	c.(4-6)ACG>ATG	p.T2M		NM_003279	NP_003270	P02585	TNNC2_HUMAN	fast skeletal muscle troponin C	2				TD -> DT (in Ref. 6; AA sequence).	muscle filament sliding|regulation of muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(115;0.0122)				CTGCTGGTCCGTCTGCAGGAG	0.612																0.429078	358.810968	360.050627	121	161	KEEP	---	---	---	---	52	91	84	109	-1	capture	Missense_Mutation	SNP	44453472	44453472	TNNC2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16208	273
GOLGA4	2803	broad.mit.edu	37	3	37366849	37366849	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:37366849G>A	uc003cgv.2	+	14	3776	c.3472G>A	c.(3472-3474)GTT>ATT	p.V1158I	GOLGA4_uc010hgr.1_Missense_Mutation_p.V719I|GOLGA4_uc003cgw.2_Missense_Mutation_p.V1180I|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.V1039I	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	1158	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						AGAGCAGCTAGTTGAACTGAA	0.383																0.443182	125.913471	126.16111	39	49	KEEP	---	---	---	---	18	23	28	26	-1	capture	Missense_Mutation	SNP	37366849	37366849	GOLGA4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	6491	273
CEP63	80254	broad.mit.edu	37	3	134225989	134225989	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134225989T>C	uc003eqo.1	+	4	532	c.83T>C	c.(82-84)CTC>CCC	p.L28P	CEP63_uc003eql.1_Missense_Mutation_p.L28P|CEP63_uc003eqm.2_Missense_Mutation_p.L28P|CEP63_uc003eqn.1_Missense_Mutation_p.L28P	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a	28	Potential.				cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						CTACAGGAGCTCATGAAACAG	0.363																0.019737	-32.714048	6.630527	3	149	KEEP	---	---	---	---	1	3	87	86	-1	capture	Missense_Mutation	SNP	134225989	134225989	CEP63	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	3225	273
HTR3D	200909	broad.mit.edu	37	3	183756271	183756271	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183756271C>A	uc011bqv.1	+	7	994	c.994C>A	c.(994-996)CAC>AAC	p.H332N	HTR3D_uc003fmj.2_Missense_Mutation_p.H157N|HTR3D_uc011bqu.1_Missense_Mutation_p.H282N|HTR3D_uc010hxp.2_Missense_Mutation_p.H111N	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform	332	Cytoplasmic (Potential).					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCACCTGCTGCACGTGGCCAC	0.652																0.029197	-26.724462	6.671574	4	133	KEEP	---	---	---	---	2	2	76	76	0.5	capture	Missense_Mutation	SNP	183756271	183756271	HTR3D	3	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	7372	273
TRIML2	205860	broad.mit.edu	37	4	189018255	189018255	+	Silent	SNP	G	A	A	rs144128750		TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189018255G>A	uc003izl.2	-	6	591	c.555C>T	c.(553-555)TGC>TGT	p.C185C	TRIML2_uc003izj.1_5'UTR|TRIML2_uc003izk.1_5'UTR|TRIML2_uc011cle.1_Silent_p.C260C	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	185	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CTCTTATGTGGCATAAACTCA	0.493																0.021622	-40.3938	6.843888	4	181	KEEP	---	---	---	---	3	2	92	117	-1	capture	Silent	SNP	189018255	189018255	TRIML2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	16434	273
HCN1	348980	broad.mit.edu	37	5	45262592	45262592	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262592C>T	uc003jok.2	-	8	2129	c.2104G>A	c.(2104-2106)GCG>ACG	p.A702T		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	702	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CTGCAGACCGCGGTGGTGTAG	0.592																0.470588	94.993484	95.044709	32	36	KEEP	---	---	---	---	17	17	20	24	-1	capture	Missense_Mutation	SNP	45262592	45262592	HCN1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6922	273
RGNEF	64283	broad.mit.edu	37	5	73048878	73048878	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73048878G>A	uc011csq.1	+	3	337	c.326G>A	c.(325-327)CGC>CAC	p.R109H	RGNEF_uc003kcx.2_Missense_Mutation_p.R109H|RGNEF_uc003kcy.1_Missense_Mutation_p.R109H|RGNEF_uc010izf.2_Missense_Mutation_p.R109H	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	109					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CAGGCCAATCGCCTCACAGCC	0.617																0.4	13.237236	13.370856	6	9	KEEP	---	---	---	---	5	2	5	7	-1	capture	Missense_Mutation	SNP	73048878	73048878	RGNEF	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13178	273
FBXO38	81545	broad.mit.edu	37	5	147807459	147807459	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147807459C>A	uc003lpf.1	+	15	2722	c.2602C>A	c.(2602-2604)CTA>ATA	p.L868I	FBXO38_uc003lpg.1_Intron|FBXO38_uc003lph.2_Intron	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	868						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGGAGGCCCCTAACCAGGGC	0.562																0.041237	-13.485548	8.473284	4	93	KEEP	---	---	---	---	3	1	55	50	0.25	capture	Missense_Mutation	SNP	147807459	147807459	FBXO38	5	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	5692	273
FOXI1	2299	broad.mit.edu	37	5	169535162	169535162	+	Silent	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169535162C>A	uc003mai.3	+	2	729	c.684C>A	c.(682-684)TCC>TCA	p.S228S	FOXI1_uc003maj.3_Intron	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	228					epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCACAGCCTCCTTGGCCTTAG	0.532												Pendred_syndrome				0.065089	-11.519268	21.700829	11	158	KEEP	---	---	---	---	6	7	81	90	0.538461538462	capture	Silent	SNP	169535162	169535162	FOXI1	5	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	5953	273
DAXX	1616	broad.mit.edu	37	6	33286946	33286946	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33286946C>A	uc003oec.2	-	7	2195	c.1991G>T	c.(1990-1992)TGT>TTT	p.C664F	ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Missense_Mutation_p.C589F|DAXX_uc011dre.1_Missense_Mutation_p.C676F|DAXX_uc003oed.2_Missense_Mutation_p.C664F	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	664	Interaction with SPOP.				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						GGGCAGGGTACATATCTTTTT	0.542					125	Mis|F|N		Pancreatic neuroendocrine tumors								0.110619	25.707223	59.609323	25	201	KEEP	---	---	---	---	8	19	107	129	0.703703703704	capture	Missense_Mutation	SNP	33286946	33286946	DAXX	6	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	4202	273
IP6K3	117283	broad.mit.edu	37	6	33690701	33690701	+	Silent	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33690701C>T	uc010jvf.2	-	7	1565	c.1029G>A	c.(1027-1029)CCG>CCA	p.P343P	IP6K3_uc003ofb.2_Silent_p.P343P	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	343					inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0						CGTGAGGATGCGGGCTGCCTG	0.552																0.026144	-31.322909	6.677342	4	149	KEEP	---	---	---	---	3	1	86	74	-1	capture	Silent	SNP	33690701	33690701	IP6K3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7713	273
ABCB5	340273	broad.mit.edu	37	7	20782599	20782599	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20782599C>T	uc003suw.3	+	16	2335	c.1789C>T	c.(1789-1791)CGA>TGA	p.R597*	ABCB5_uc010kuh.2_Nonsense_Mutation_p.R1042*	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	597	Cytoplasmic (Potential).|ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						CAGTATTGAGCGAGGAAAGAC	0.483																0.1	8.143584	30.529013	14	126	KEEP	---	---	---	---	7	9	65	75	-1	capture	Nonsense_Mutation	SNP	20782599	20782599	ABCB5	7	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	44	273
C7orf60	154743	broad.mit.edu	37	7	112461814	112461814	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112461814T>C	uc003vgo.1	-	5	1330	c.1203A>G	c.(1201-1203)ATA>ATG	p.I401M	C7orf60_uc011kms.1_Missense_Mutation_p.I427M	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	401										ovary(2)|skin(1)	3						TTAAAAGTAATATGGGGTCTT	0.358																0.02071	-71.464017	15.453079	7	331	KEEP	---	---	---	---	4	4	189	188	-1	capture	Missense_Mutation	SNP	112461814	112461814	C7orf60	7	T	C	C	C	1	0	0	0	0	1	0	0	0	628	49	3	3	2384	273
PPP1R3A	5506	broad.mit.edu	37	7	113518832	113518832	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113518832G>A	uc010ljy.1	-	4	2346	c.2315C>T	c.(2314-2316)GCG>GTG	p.A772V		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	772					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						TGGATCAAACGCTGTTTCCTT	0.403					235											0.298658	235.852622	246.655163	89	209	KEEP	---	---	---	---	57	45	109	124	-1	capture	Missense_Mutation	SNP	113518832	113518832	PPP1R3A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12272	273
OR2A1	346528	broad.mit.edu	37	7	144015510	144015510	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144015510C>T	uc011kud.1	+	1	275	c.275C>T	c.(274-276)ACG>ATG	p.T92M	OR2A9P_uc003wec.1_Intron	NM_001001802	NP_001001802	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.14)					GGCTGCATGACGCAGACCTTT	0.577																0.109399	54.916665	153.009009	71	578	KEEP	---	---	---	---	45	35	365	317	-1	capture	Missense_Mutation	SNP	144015510	144015510	OR2A1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10878	273
GIMAP1	170575	broad.mit.edu	37	7	150417468	150417468	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150417468G>A	uc003whq.2	+	3	463	c.376G>A	c.(376-378)GCC>ACC	p.A126T	GIMAP1_uc003whp.2_Missense_Mutation_p.A134T	NM_130759	NP_570115	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	126	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCGGTTCACCGCCCAGGACCA	0.637																0.149123	26.442624	39.874277	17	97	KEEP	---	---	---	---	9	12	55	61	-1	capture	Missense_Mutation	SNP	150417468	150417468	GIMAP1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6318	273
FAM110B	90362	broad.mit.edu	37	8	59059573	59059573	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59059573G>C	uc003xtj.1	+	5	1664	c.784G>C	c.(784-786)GAC>CAC	p.D262H		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	262						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GTCTAAGTCAGACTTGAGTGA	0.562																0.122807	39.647777	63.465171	21	150	KEEP	---	---	---	---	7	15	77	86	-1	capture	Missense_Mutation	SNP	59059573	59059573	FAM110B	8	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	5351	273
ZFHX4	79776	broad.mit.edu	37	8	77768255	77768255	+	Nonsense_Mutation	SNP	C	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77768255C>G	uc003yav.2	+	10	9350	c.8963C>G	c.(8962-8964)TCA>TGA	p.S2988*	ZFHX4_uc003yau.1_Nonsense_Mutation_p.S3033*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.S2988*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2988						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCACATTTCAAAAGTGAGG	0.537													HNSCC(33;0.089)			0.422018	171.335442	171.913362	46	63	KEEP	---	---	---	---	28	20	28	37	-1	capture	Nonsense_Mutation	SNP	77768255	77768255	ZFHX4	8	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	17515	273
FAM83H	286077	broad.mit.edu	37	8	144808629	144808629	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808629C>T	uc003yzk.2	-	5	3071	c.3002G>A	c.(3001-3003)CGT>CAT	p.R1001H	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	1001					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGTGACAGACGCCGCGGGCT	0.697																0.722222	36.970091	37.766351	13	5	KEEP	---	---	---	---	8	5	2	5	-1	capture	Missense_Mutation	SNP	144808629	144808629	FAM83H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5586	273
PIP5K1B	8395	broad.mit.edu	37	9	71509330	71509330	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71509330A>G	uc004agu.2	+	8	852	c.547A>G	c.(547-549)ATC>GTC	p.I183V	PIP5K1B_uc011lrq.1_Missense_Mutation_p.I183V|PIP5K1B_uc004agv.2_RNA	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	183	PIPK.					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		AGGCATTAATATCAGGATTGT	0.373					223											0.457143	295.496013	295.774263	80	95	KEEP	---	---	---	---	36	49	52	51	-1	capture	Missense_Mutation	SNP	71509330	71509330	PIP5K1B	9	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11843	273
C9orf79	286234	broad.mit.edu	37	9	90501883	90501883	+	Silent	SNP	C	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90501883C>G	uc004app.3	+	4	2516	c.2481C>G	c.(2479-2481)CTC>CTG	p.L827L	C9orf79_uc004apo.1_Silent_p.L639L	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	827						integral to membrane				ovary(3)	3						TTTCCTTCCTCCATCCCTGCA	0.562																0.05618	-4.802216	13.62585	5	84	KEEP	---	---	---	---	5	0	36	51	-1	capture	Silent	SNP	90501883	90501883	C9orf79	9	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	2473	273
MXRA5	25878	broad.mit.edu	37	X	3240193	3240193	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3240193T>C	uc004crg.3	-	5	3690	c.3533A>G	c.(3532-3534)GAG>GGG	p.E1178G		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1178						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AGAAAAAGTCTCTGATGGGGC	0.488																0.411067	354.256476	356.003764	104	149	KEEP	---	---	---	---	69	44	94	72	-1	capture	Missense_Mutation	SNP	3240193	3240193	MXRA5	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	9913	273
RAI2	10742	broad.mit.edu	37	X	17818870	17818870	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17818870C>T	uc004cyf.2	-	3	1831	c.1261G>A	c.(1261-1263)GAA>AAA	p.E421K	RAI2_uc004cyg.2_Missense_Mutation_p.E421K|RAI2_uc010nfa.2_Missense_Mutation_p.E421K|RAI2_uc004cyh.3_Missense_Mutation_p.E421K|RAI2_uc011miy.1_Missense_Mutation_p.E371K	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	421					embryo development					ovary(1)|breast(1)	2	Hepatocellular(33;0.183)					GCCTTGACTTCGCCGCTGGGG	0.567																0.407143	337.797458	339.90622	114	166	KEEP	---	---	---	---	61	65	97	88	-1	capture	Missense_Mutation	SNP	17818870	17818870	RAI2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12904	273
KLHL34	257240	broad.mit.edu	37	X	21675213	21675213	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21675213C>G	uc004czz.1	-	1	1236	c.694G>C	c.(694-696)GTA>CTA	p.V232L		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	232	BACK.									ovary(1)	1						CGCCGCAGTACGTCGGCGGGA	0.667																0.36	30.470484	30.900875	9	16	KEEP	---	---	---	---	3	9	9	9	-1	capture	Missense_Mutation	SNP	21675213	21675213	KLHL34	23	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	8307	273
DUSP21	63904	broad.mit.edu	37	X	44703624	44703624	+	Silent	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:44703624C>T	uc004dgd.2	+	1	376	c.246C>T	c.(244-246)TAC>TAT	p.Y82Y		NM_022076	NP_071359	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	82	Tyrosine-protein phosphatase.|Sufficient for mitochondrial localization (By similarity).					cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			large_intestine(1)|lung(1)	2						CGCGTCTCTACGACTTTTTTG	0.542																0.378378	196.088407	198.494574	70	115	KEEP	---	---	---	---	37	37	48	77	-1	capture	Silent	SNP	44703624	44703624	DUSP21	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4775	273
EDA2R	60401	broad.mit.edu	37	X	65819404	65819404	+	Silent	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:65819404C>T	uc004dwq.2	-	5	827	c.816G>A	c.(814-816)GAG>GAA	p.E272E	EDA2R_uc004dwr.2_Intron|EDA2R_uc004dws.2_Silent_p.E272E|EDA2R_uc011mpb.1_RNA|EDA2R_uc011mpc.1_Silent_p.E148E|EDA2R_uc010nkt.1_Silent_p.E272E|EDA2R_uc004dwt.1_Silent_p.E293E	NM_021783	NP_068555	Q9HAV5	TNR27_HUMAN	X-linked ectodysplasin receptor	272	Cytoplasmic (Potential).				cell differentiation|embryo development|epidermis development|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity	integral to plasma membrane	tumor necrosis factor receptor activity			upper_aerodigestive_tract(1)	1						CCCCCAAGGTCTCAGCTCCAG	0.547																0.142857	5.109785	7.691832	3	18	KEEP	---	---	---	---	4	0	13	5	-1	capture	Silent	SNP	65819404	65819404	EDA2R	23	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	4859	273
PCDH11X	27328	broad.mit.edu	37	X	91873723	91873723	+	Silent	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91873723C>A	uc004efk.1	+	7	4673	c.3828C>A	c.(3826-3828)GTC>GTA	p.V1276V	PCDH11X_uc004efl.1_Silent_p.V1266V|PCDH11X_uc004efo.1_Silent_p.V1239V|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Silent_p.V1268V|PCDH11X_uc004efn.1_Silent_p.V1258V	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1276	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AATCATCAGTCAGTTTGCAGC	0.517	NSCLC(38;925 1092 2571 38200 45895)															0.431818	554.662603	556.449991	190	250	KEEP	---	---	---	---	104	104	132	146	0.5	capture	Silent	SNP	91873723	91873723	PCDH11X	23	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	11411	273
CSTF2	1478	broad.mit.edu	37	X	100075435	100075435	+	Silent	SNP	G	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100075435G>T	uc004egh.2	+	1	88	c.30G>T	c.(28-30)GCG>GCT	p.A10A	CSTF2_uc010nnd.2_Silent_p.A10A|CSTF2_uc004egi.2_Silent_p.A10A	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	10					mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding			skin(1)	1						GAGACCCAGCGGTGGATCGTT	0.562																0.327869	55.667181	57.276212	20	41	KEEP	---	---	---	---	10	10	22	21	0.5	capture	Silent	SNP	100075435	100075435	CSTF2	23	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	3949	273
TEX13B	56156	broad.mit.edu	37	X	107224498	107224498	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107224498C>G	uc004enn.1	-	3	844	c.751G>C	c.(751-753)GTC>CTC	p.V251L		NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B	251										ovary(1)	1						AGAAGACAGACATGGCTGTTT	0.552																0.064815	-7.701559	56.056584	21	303	KEEP	---	---	---	---	7	15	169	171	-1	capture	Missense_Mutation	SNP	107224498	107224498	TEX13B	23	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	15662	273
TRPC5	7224	broad.mit.edu	37	X	111020072	111020072	+	Silent	SNP	G	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:111020072G>A	uc004epl.1	-	11	3310	c.2391C>T	c.(2389-2391)GTC>GTT	p.V797V		NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	797	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						AATTAAAAGAGACACTCTTGG	0.483																0.128599	98.678294	168.679456	67	454	KEEP	---	---	---	---	31	38	227	259	-1	capture	Silent	SNP	111020072	111020072	TRPC5	23	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	16465	273
AFF2	2334	broad.mit.edu	37	X	148059892	148059892	+	Silent	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148059892C>T	uc004fcp.2	+	18	3956	c.3477C>T	c.(3475-3477)TGC>TGT	p.C1159C	AFF2_uc004fcq.2_Silent_p.C1149C|AFF2_uc004fcr.2_Silent_p.C1120C|AFF2_uc011mxb.1_Silent_p.C1124C|AFF2_uc004fcs.2_Silent_p.C1124C|AFF2_uc011mxc.1_Silent_p.C800C	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	1159					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					ATCACCACAGCTACCGATGTT	0.378																0.451327	315.923743	316.390018	102	124	KEEP	---	---	---	---	51	62	76	69	-1	capture	Silent	SNP	148059892	148059892	AFF2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	357	273
MTMR1	8776	broad.mit.edu	37	X	149931076	149931076	+	Silent	SNP	C	A	A			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149931076C>A	uc004fei.2	+	15	2007	c.1872C>A	c.(1870-1872)GTC>GTA	p.V624V	MTMR1_uc011mya.1_Silent_p.V530V|MTMR1_uc004feh.1_Silent_p.V632V|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_Intron	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	624						plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TGCTGGCCGTCAGGGCGGAGC	0.627																0.113333	16.161547	38.299247	17	133	KEEP	---	---	---	---	9	13	72	89	0.590909090909	capture	Silent	SNP	149931076	149931076	MTMR1	23	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	9848	273
ABCD1	215	broad.mit.edu	37	X	153008746	153008746	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153008746C>T	uc004fif.2	+	9	2336	c.1937C>T	c.(1936-1938)GCG>GTG	p.A646V	ABCD1_uc004fig.2_Missense_Mutation_p.A146V|ABCD1_uc004fih.2_RNA	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	646	ABC transporter.		A -> P (in X-ALD).		fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCTTCCAGGCGGCCAAGGAC	0.672																0.296296	22.191529	23.192315	8	19	KEEP	---	---	---	---	4	5	7	14	-1	capture	Missense_Mutation	SNP	153008746	153008746	ABCD1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	60	273
PTEN	5728	broad.mit.edu	37	10	89720805	89720808	+	Frame_Shift_Del	DEL	CTTT	-	-			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720805_89720808delCTTT	uc001kfb.2	+	9	1987_1990	c.956_959delCTTT	c.(955-960)ACTTTAfs	p.T319fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	319_320	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.T319fs*1(22)|p.L318fs*2(11)|p.T319fs*6(6)|p.R55fs*1(4)|p.T319fs*24(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319del(2)|p.L320*(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.T319fs*4(1)|p.T319fs*5(1)|p.W274_F341del(1)|p.V317_K322del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTAGTACTTACTTTAACAAAAAAT	0.328			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.81			104	25		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89720805	89720808	PTEN	10	CTTT	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	12633	273
CDC27	996	broad.mit.edu	37	17	45219355	45219355	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-4935-01	TCGA-76-4935-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219355delC	uc002ild.3	-	12	1542	c.1415delG	c.(1414-1416)GGTfs	p.G472fs	CDC27_uc002ile.3_Frame_Shift_Del_p.G478fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.G471fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.G411fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	472					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AGCTAAATAACCTTTCCCCAT	0.368																0.02			8	330		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	45219355	45219355	CDC27	17	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	3037	273
